theubiquitinligaseitchregulatesapoptosisbytargeting … ·...

The Ubiquitin Ligase Itch Regulates Apoptosis by TargetingThioredoxin-interacting Protein for Ubiquitin-dependentDegradation*

Received for publication, September 9, 2009, and in revised form, January 12, 2010 Published, JBC Papers in Press, January 12, 2010, DOI 10.1074/jbc.M109.063321

Pingzhao Zhang‡§1, Chenji Wang‡1, Kun Gao¶, Dejie Wang‡, Jun Mao‡, Jian An‡, Chen Xu‡, Di Wu‡, Hongxiu Yu§,Jun O. Liu�, and Long Yu‡§2

From the ‡State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Sciences, Fudan University,Shanghai 200433, China, the §Institutes of Biomedical Sciences, Fudan University, Shanghai 200032, China, the ¶Key Laboratory ofTransplant Engineering and Immunology, Ministry of Health, West China Hospital, Sichuan University, Chengdu 610041, China,and the �Departments of Pharmacology and Molecular Sciences and Oncology, The Johns Hopkins School of Medicine,Baltimore, Maryland 21205

Thioredoxin interacting protein (TXNIP)was originally char-acterized as an endogenous inhibitor of thioredoxin, a key reg-ulator in cellular redox homeostasis. TXNIP is also known toplay important roles in tumor growth and metastasis, glucoseand lipid metabolism. TXNIP expression is induced by variousstress stimuli. However, it has been unclear how TXNIP isdown-regulated.Here, we report that TXNIPundergoes protea-somal degradation in cells. We identify Itch as the E3 ubiquitinligase for TXNIP.We demonstrate that Itchmediates polyubiq-uitination of TXNIP both in vitro and in vivo. Overexpression ofItch leads to TXNIP proteasomal degradation. Knockdown ofItch by small interfering RNA causes an accumulation of thesteady-state level of TXNIP.We also show that the PPXYmotifsof TXNIP and the WW domains of Itch mediate their interac-tion. Furthermore, the Itch-TXNIP interaction regulates intra-cellular reactive oxygen species levels and apoptosis. These find-ings establish a new mechanism for the negative regulation ofTXNIP by Itch and shed new light on the regulation of cellularredox homeostasis.

The intracellular redox homeostasis is maintained in part bythe reactive oxygen species (ROS)3-scavenging system, animportant component of which is thioredoxin. Thioredoxinreduces ROS through its free thiols at two cysteine residues(Cys-32 and Cys-35). Oxidized thioredoxin is recycled to itsreduced state by thioredoxin reductase and NAPDH (1).

Thioredoxin-interacting protein (TXNIP), an endogenousinhibitor of thioredoxin also known as vitamin D3 up-regu-lated protein-1 or thioredoxin-binding protein-2, inhibitsantioxidative function of thioredoxin by binding to its redox-active cysteine residues (1–3). By negatively regulating thiore-doxin, TXNIP is involved in a wide variety of cellular processessuch as cell proliferation or apoptosis (4).TXNIP has also been shown to be an important tumor sup-

pressor, and its expression is dramatically reduced in varioustypes of human tumors (5, 6). Overexpression of TXNIP inhib-its cell proliferation and promotes apoptosis. Pointmutation orknock-out of the TXNIP gene in a mouse model is associatedwith a higher incidence of hepatocellular carcinoma (7). Fur-thermore, increased TXNIP expression inhibited melanomametastasis and up-regulated KISS1, suggesting TXNIP is also ametastasis suppressor (5).It has been shown that the Krebs cycle-mediated fatty acid

utilization was impaired in TXNIP knock-out mice, indicatingits involvement in lipidmetabolism (8). Furthermore, TXNIP isa critical mediator of glucose-induced beta cell apoptosis (9).TXNIP null mice have fasting hypoglycemia with a strikingenhancement of glucose uptake by peripheral tissues (10–12).In humans, TXNIP expression is suppressed by insulin andstrongly up-regulated in diabetes, suggesting that TXNIP is acritical regulator of glucose metabolism in vivo (13).Protein ubiquitination has emerged as a fundamental mech-

anism for regulating the half-lives and activity of many cellularproteins. The specificity of ubiquitination reaction is achievedby the E3 ubiquitin ligases (E3), which mediate the transfer ofubiquitin from E2 ubiquitin-conjugating enzymes (E2) to sub-strates. Ubiquitination controls turnover and abundance ofproteins by targeting them for proteasomal degradation (14).The Nedd4-like family of E3 ubiquitin ligases is characterizedby a distinct modular domain architecture, with each memberconsisting of a Ca2�/lipid-binding (C2) domain involved inmembrane targeting, 2–4 WW domains conferring substratespecificity, and a HECT-type ligase domain coordinating withthe E2 and providing the catalytic E3 activity (15–17). TheNedd4 family contains nine members in humans includingNedd4, Nedd4-2, Itch, Smurf1, Smurf1, WWP1, WWP2,NEDL1, andNEDL2 (17). The E3 ubiquitin ligase Itch was orig-

* This work was supported by National 973 Program of China Grant2004CB518605, National 863 Project of China Grant 2006AA020501,National Key Sci-Tech Special Project of China Grant 2008ZX10002-020,Project of the Shanghai Municipal Science and Technology CommissionGrant 03dz14086, and the Changjiang Visiting Scholars Program.

1 Both authors contributed equally to this work.2 To whom correspondence should be addressed: State Key Laboratory of

Genetic Engineering, Institute of Genetics, School of Life Sciences, FudanUniversity, 220 Handan Rd., Shanghai 200433, China. Tel.: 86-21-65643954;Fax: 86-21-65643250; E-mail: [email protected].

3 The abbreviations used are: ROS, reactive oxygen species; TXNIP, thiore-doxin interacting protein; GFP, green fluorescent protein; PBS, phosphate-buffered saline; GST, glutathione S-transferase; E1, ubiquitin-activatingenzyme; E2, ubiquitin carrier protein; E3, ubiquitin-protein isopeptideligase; qRT, quantitative reverse transcription; HA, hemagglutinin; siRNA,small interfering RNA; RNAi, RNA interfering; WT, wild-type; Ub, ubiquitin;DCF, dichlorofluorescin.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 285, NO. 12, pp. 8869 –8879, March 19, 2010© 2010 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.

MARCH 19, 2010 • VOLUME 285 • NUMBER 12 JOURNAL OF BIOLOGICAL CHEMISTRY 8869

by guest on June 1, 2018http://w

ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

inally identified as a gene disrupted in the non-agouti-lethal18H mice, or Itchy mice that suffer from severe immune andinflammatory defects. A number of Itch proteolysis targets arecentral players in or regulators of multiple signaling pathways,including c-Jun, JunB, p73, p63, C-FLIP, and others (18).Herein, we report that the TXNIP is negatively regulated by

Itch in cancer cells.We demonstrate that Itch directly interactswith and acts as a robust E3 ubiquitin ligase for TXNIP. Over-expression of Itch promotes ubiquitination and proteasomaldegradation of TXNIP. Conversely, knockdown of Itch bysiRNAs increases the TXNIP steady-state level. Furthermore,Itch may modulate ROS-induced apoptosis by controlling theTXNIP protein level.

EXPERIMENTAL PROCEDURES

Cell Culture and Transfection—293T, H1299, and U2OScells were obtained from the American Type Culture Collec-tion. 293T cells weremaintained inDulbecco’smodified Eagle’smedium with 10% fetal bovine serum. H1299 cells were main-tained in RPMI 1640 with 10% fetal bovine serum. U2OS cellswere maintained inMcCoy’s 5Amediumwith 10% fetal bovineserum. Cells were transiently transfected using Lipofectamine(Invitrogen) according to the manufacturer’s instructions.Expression Constructs—Human FLAG-TXNIP plasmid was

kindly provided by Dr. Junji Yodoi (Kyoto University, Japan)and subcloned into pCMV-HA (Clontech) and pGEX-4T-2vectors to add HA and GST tags, respectively. Wild type andcatalytically inactive mutant (C830A) Myc-Itch were kindlyprovided by Dr. GerryMelino (Leicester University, UK). GFP-Itch and GST-Itch were kindly provided by Dr. Annie Angers(Universite de Montreal, Canada). Myc-Smurf1/2 and Myc-WWP1 were kindly provided by Dr. Kohei Miyazono (Univer-sity of Tokyo, Japan). HA-Nedd4 was kindly provided by Dr.Xuejun Jiang (Memorial Sloan-Kettering Cancer Center) andsubcloned into pCMV-Myc vector. All other TXNIP or Itchmutants were generated using the QuikChange Site-directedMutagenesis kit (Stratagene).RNA Interference—The RNAi oligos for Itch and TXNIP

were purchased from Genepharma (Shanghai, China). TheRNAi oligos sequences for Itch were: RNAi-1, 5�-CCAGUUG-GACUCAAGGAUUUAdTdT-3� andRNAi-2, 5�-GGUGACA-AAGAGCCAACAGAGdTdT-3�. The RNAi oligos sequencesfor TXNIP were: RNAi-1, 5�-ACAGACUUCGGAGUACCU-GdTdT-3� and RNAi-2, 5�-GCCGUUAGGAUCCUGGCU-UdTdT-3�. The sequence of negative control was ControlRNAi, 5�-ACAGACUUCGGAGUACCUGdTdT-3�.Quantitative RT-PCR—Total RNA was isolated from U2OS

cells using the TRIzol reagent (Tiangen, China), and cDNAwasreversed-transcribed using the Superscript RT kit (TOYOBO,Japan), according to the manufacturer’s instructions. PCRprimer sequences for human TXNIP were selected as follows:AGTTACTCGTGTCAAAGCCGTTAG (forward) and TCA-CCATCTCATTCTCACCTGTTG (reverse), human Itchprimer sequences are as follows: CAAGACCTTCACGACCA-CCAC (forward) and TCCAGATGTTGCTCCTTCAGATG(reverse). PCR amplification was performed using the SYBRGreen PCRmastermix kit (TOYOBO, Japan). All quantitations

were normalized to the level of endogenous control glyceralde-hyde-3-phosphate dehydrogenase.Antibodies—ForWestern blot, the following antibodies were

used: mouse monoclonal antibodies against TXNIP (JY2;MBL), Itch (sc-28367; Santa Cruz), Myc (9E10; Sigma), FLAG(M2; Sigma), HA (MM5–101R; Convance), GFP (sc-8334;Santa Cruz, USA), Actin (AC-74; Sigma), GST (710974; Nova-gen), and ubiquitin (U5379; Bethyl, A300-317A).Immunoprecipitation—Cells were lysed with cell lysis buffer

(20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% Triton, 1 mM

EGTA, 1 mM Na2EDTA, 2.5 mM sodium pyrophosphate, 1 mM

�-glycerophosphate, 1 mM Na3VO4, and 1 �g/ml leupeptin)and the lysate was centrifuged. The supernatant was preclearedwith protein A/G beads (Sigma), followed by incubation with 2�l of antibody for 2 h and thereafter with protein A/G beads for2 h, all at 4 °C. Pellets were washed 4 times with lysis buffer andresuspended in sample buffer and analyzed by SDS-PAGE.Western Blot—Cell lysates and immunoprecipitates were

subjected to SDS-PAGE and proteins were transferred to nitro-cellulose membranes (GE Healthcare). The membrane wasblocked in PBS containing 5% nonfat milk and 0.1% Tween 20,washed twice in PBS, and incubated with primary antibody atroom temperature for 2 h, followed by incubation with second-ary antibody at room temperature for 45 min. Afterward, theproteins of interest were visualized using the ECL chemilumi-nescence system (Santa Cruz Biotechnology).GST Pulldown Assay—HEK 293 T cells were lysed 36 h after

transfection with cell lysis buffer for 30 min at 4 °C. GST fusionproteins were immobilized on glutathione-Sepharose beads(Amersham Biosciences). After washing with pulldown buffer(20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.1% Nonidet P-40, 1mM dithiothreitol, 10% glycerol, 1 mM EDTA, 2.5 mM MgCl2,and 1 �g/ml leupeptin), the beads were incubated with lysatesof transfected H1299 cells for 4 h. The beads were then washedfour times with binding buffer and resuspended in samplebuffer. The bound proteins were subjected to SDS-PAGE.In Vivo and in Vitro Ubiquitination Assays—The in vivo

ubiquitination assay was conducted as previously described(19). In vitro ubiquitination assay was carried out in a buffercontaining 50 mM HEPES (pH 7.9), 5 mM MgCl2, 15 �M ZnCl2,and 4mMATP, with 100 nM E1 (Sigma), 200 nM human recom-binant UbcH7, 250 �M ubiquitin (Sigma). In vitro reactionswere carried out at 37 °C for 60–90 min.Immunofluorescence—COS7 cells cultured on coverslips

were fixed in 4% paraformaldehyde for 10 min and permeabi-lized in 0.2% Triton X-100 for 5 min at room temperature. Thecoverslips were blocked with 5% normal goat serum plus 2%bovine serum albumin for 1 h and then incubated with mouseanti-HA antibody (1:300 dilution) for 1 h at room temperature,which was followed by sequential incubation with a Texas Red-conjugated goat anti-mouse secondary antibody at 1:300 dilu-tion, and with 4�,6-diamidino-2-phenylindole (1:500 dilution)for 10 min. Epifluorescence images were captured using Olym-pus Inverted System Microscope.ROS Assay—U2OS cells were seeded overnight in 6-well

plates. Forty-eight hours after transfection, cellswere trypsinizedand centrifuged, followed by incubation in 5�MH2DCF-DA for30 min at 37 °C. Cells were washed twice, suspended in PBS,

Itch Ubiquitinates and Degrades TXNIP

8870 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 285 • NUMBER 12 • MARCH 19, 2010


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

and analyzed immediately by FACScan (BD Biosciences) thatwas equipped with a 488 Argon laser for measurements ofintracellular fluorescence. Logarithmic detectors were used forthe FL-1 fluorescence channel necessary for DCF detection.Mean log fluorescence intensity values were obtained by theCELLQUEST software program.Apoptosis Assay—U2OS cells were seeded overnight in

6-well plates. Forty eight hours after transfection, cells weretreated with 20 �M etoposide for 12 h. The cells were collectedand fixed with 2 ml of 70% ethanol at 4 °C for 2 h. Cells werewashedwith PBS and incubated in PBS containing 100�g/ml ofRNase A and 50 �g/ml of propidium iodide for 15 min at roomtemperature. DNA content and cell cycle were assessed byFACScan. Based on propidium iodide staining, cells in sub-G1were considered apoptotic.Statistical Analysis—The ROS and apoptosis data in this

study were expressed as the mean � S.D. from at least threeindependent experiments. Statistical analysis was performedusing one-way analysis of variance with a Newman-Keulspost hoc test. A value of p � 0.05 was considered statisticallysignificant.

RESULTS

TXNIP Stability Is Controlled by the Ubiquitin-ProteasomePathway—Although it is known TXNIP mRNA is rapidlyinduced by various stresses stimuli (4), little is known about thepost-translational regulation of TXNIP. Given its relativelyrapid turnover, we decided to investigate whether TXNIP wassubjected to ubiquitination-dependent degradation. Becausemost cellular protein degradation is mediated by the proteaso-mal pathway, we treated U2OS and 293T cells with the protea-some inhibitorMG132 for 0, 0.5, 1, and 2 h and determined theprotein levels of endogenous TXNIP by Western blot. Asshown in Fig. 1A (upper andmiddle panels), MG132 treatmentled to a rapid increase in TXNIP protein levels in both cell lines.Because MG132 also inhibits non-proteasomal enzymes, werepeated the experiment using a second mechanistically differ-ent proteasome inhibitor, lactacystin, whose only known targetis the proteasome (20). As shown in Fig. 1A (lower panel), lac-tacystin treatment led to a greater increase in the TXNIP pro-tein level than that caused byMG132 inU2OS cells. To excludethe possibility that higher protein levels might have resultedfromup-regulation of transcription,we performedqRT-PCR tomeasure the mRNA level of TXNIP in U2OS cells upon lacta-cystin treatment. As shown in Fig. 1B, lactacystin has littleeffect on the mRNA level of TXNIP. Together, these resultssuggested that TXNIP stability might be regulated by the pro-teasomal pathway.As proteins destined to proteasomal degradation are often

ubiquitinated, we next determined whether TXNIP underwentubiquitination in vivo. First, We co-expressed HA-TXNIP andHis6-ubiquitin inH1299 cells. TXNIP conjugated toHis6-ubiq-uitin was pulled down using nickel-nitrilotriacetic acid beadsunder denaturing conditions and detected by Western blotwith the TXNIP-specific monoclonal antibody JY2. As shownin Fig. 1C (left panel), TXNIP did undergo ubiquitination invivo. Second, we transiently expressed FLAG-TXNIP in H1299cells. Upon MG132 treatment for 4 h, cells were lysed and the

FLAG-TXNIPproteinwas immunoprecipitated. The polyubiq-uitinated forms of TXNIP were detected by Western blot withanti-Ub antibody. As shown in Fig. 1C (right panel), inhibitionof the proteasome by MG132 caused accumulation of thepolyubiquitinated forms of TXNIP.The type of ubiquitin linkage determines the fate of ubiquiti-

nated proteins. Lys-48-linked ubiquitination generally directsproteins to the proteasome for degradation, whereas Lys-63-linked ubiquitination usually affects protein function or pro-tein-protein interactions (21). To determine which type ofubiquitin linkage is involved in the ubiquitination of TXNIP,weexamined the ability of HA-tagged wild-type (WT) ubiquitin orubiquitin mutants to ubiquitinate TXNIP. The K48R and K63Rubiquitin mutants containing a single lysine to arginine muta-tion at positions 48 and 63 were expected to disrupt the Lys-48and Lys-63 ubiquitin linkage. On the other hand, Lys-48 onlyand Lys-63 only ubiquitin mutants contain arginine substitu-tions on all lysine residues except at positions 48 and 63, respec-tively, and are thus expected to promote the proteasome-linkedLys-48 and the proteasome-independent Lys-63 ubiquitin link-ages, respectively. The K0 ubiquitin mutant is a lysine-lessubiquitin mutant capable of mediating monoubiquitinationonly. FLAG-TXNIP and various ubiquitin mutants were co-expressed in H1299 cells. TXNIP were immunoprecipitatedand its patterns of ubiquitination were determined byWesternblot with anti-Ub antibody. As shown in Fig. 1D, TXNIP ubiq-uitination was largely abolished when it was co-expressed withthe Ub-K0 mutant, suggesting that TXNIP cannot be mono-ubiquitinated at multiple sites. Interestingly, TXNIP ubiquitina-tion was also greatly abolished when it was co-expressed withUb-Lys-48 only or Ub-Lys-63 only, but was similar when it wasco-expressed with Ub-K48R and Ub-K63R, respectively. It ispossible that TXNIP polyubiquitination was mediated by otherunusual ubiquitin linkage, such as Lys-6, Lys-11, Lys-27, andLys-29. It has been reported that all these non-Lys-63 link-ages are abundant in vivo and may also target proteins fordegradation (22). Another possibility is that the ubiquitinlinkage of TXNIP is heterogeneous and dynamic in vivo. Theprecise mode of polyubiquitination of TXNIP remains to beelucidated.E3 Ligase Itch Promotes TXNIP Degradation—Next, we

searched for the relevant E3 ligase responsible for TXNIP deg-radation. Sequence alignment of multiple TXNIP orthologsacross different species revealed that two PPXY motifs at theC-terminal region of TXNIP are highly conserved (Fig. 2A).PPXYmotif is known to interact withWWdomain-containingproteins, which includes Nedd4-like family of E3 ubiquitinligases. This family of proteins are typically comprised of a cat-alytic C-terminal HECT domain and N-terminal C2 domainandWWdomains. TheWWdomains mediate ligase-substraterecognition through interactions with the PPXY consensussequence (16). Thus, we determined if one ormoremembers ofthe Nedd4-like family of E3 ubiquitin ligases might interactwith the conserved PPXYmotifs present inTXNIP andmediateits ubiquitination. HA-TXNIPwas co-expressedwith a panel ofNedd4 family of E3 ubiquitin ligases, including Itch, Smurf1,Smurf2, WWP1, and Nedd4, in H1299 cells. As shown in Fig.2B, of all E3 ubiquitin ligases tested, only Itch efficiently pro-




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

motedTXNIP degradation in a dose-dependentmanner. Theseresults raised the possibility that polyubiquitination of TXNIPmay be mediated by Itch.

Itch Is a Key Regulator of TXNIP Stability—To verify the roleof Itch in TXNIP degradation, we tested an Itch mutant inwhich the highly conserved Cys residue (Cys-830) in its HECT

FIGURE 1. TXNIP stability is controlled by the ubiquitin-proteasome pathway. A, U2OS cells and 293T cells were treated with 20 �M MG132 (upper andmiddle panels) or 10 �M lactacystin (lower panel, U2OS cells only) for the indicated lengths of times. Equal amounts of total cell lysates were subjected to Westernblot using antibodies against TXNIP and actin, respectively. The mean values (�S.D.) of three independent experiments are shown. B, qRT-PCR measurementsof the mRNA levels of TXNIP in U2OS cells after treatment with lactacystin at the indicated time points. C, left panel, HA-TXNIP and His6-Ub constructs weretransfected into H1299 cells. His6-ubiquitinated proteins were purified and subjected to Western blot using anti-TXNIP antibody. The lower panel containscontrol cell lysates. Right panel, HA-TXNIP was transfected into H1299 cells. Left panel, FLAG-TXNIP expression plasmid was transfected into H1299 cells. TNXIPproteins were immunoprecipitated by FLAG-M2 antibody after treatment with 40 �M MG132 for 4 h. The immunoprecipitates (IP) were eluted using 3� FLAGpeptide and separated by SDS-PAGE. The polyubiquitinated forms of TXNIP were detected by Western blot (WB) with anti-Ub antibody. D, FLAG-TXNIP wasco-transfected into H1299 cells with wild-type Ub or ubiquitin mutant (K48R, Lys-48 only, K63R, Lys-63 only, and knock-out (KO)). TNXIP proteins wereimmunoprecipitated using FLAG-M2 antibody. The immunoprecipitates were eluted using 3� FLAG peptide and separated on SDS-PAGE. The polyubiquiti-nated forms of TXNIP were detected by Western blot with anti-Ub antibody. The pGFP-N3 expression construct was included as a control.




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

domain was mutated to Ala (Itch/C830A). The C830A muta-tion has been shown to abrogate the ubiquitin ligase activity ofItch (23). As shown in Fig. 3A, wild-type Itch, but not the cata-lytically inactive Itch mutant, promoted TXNIP degradation ina dose-dependentmanner, indicating that theHECTdomain ofItch and its ubiquitin ligase activity are required for promotingTXNIP degradation. Consistent with this observation, TXNIPdegradation induced by Itch co-expression could be completelyrescued by the proteasome inhibitor MG132 (Fig. 3B). In theabsence of co-transfected Itch, TXNIP was relatively stable anddid not accumulate in the presence of MG132.We also determined the effects of Itch and the Itch/C830A

mutant on TXNIP protein turnover. H1299 cells were co-transfected with the HA-TXNIP expression plasmid and

empty vector, Itch, or Itch/C830Amutant. After 24 h, the cells weretreated with cycloheximide to blockprotein synthesis. As shown in Fig.3, C and D, co-expression of wild-type Itch and TXNIP resulted in astriking decrease in the TXNIP pro-tein level, indicating that Itch pro-moted TXNIP degradation. In con-trast, TXNIP was stabilized by theItch/C830A mutant, likely due to adominant negative effect of the cat-alytically inactive mutant on thewild-type enzyme.Next, we overexpressedwild-type

Itch and the Itch/C830Amutant in293T cells and determined theireffects on the protein level ofendogenous TXNIP. As shown inFig. 3E, overexpression of wild-typeItch led to a significant reduction inendogenous TXNIP. In compari-son, the Itch/C830A mutant had noeffect on the endogenous TXNIPlevel. Similar results were obtainedin U2OS cells (data not shown). In acomplementary experiment, weknocked down the endogenous Itchby two specific siRNAs and deter-mined the changes in the TXNIPprotein level in 293T and U2OScells, respectively. Knockdown ofItch resulted in an increase in thelevel of endogenous TXNIP (Fig.3F). To exclude the possibility thatTXNIP protein elevation resultedfrom transcriptional up-regulation,we performed qRT-PCR tomeasurethe mRNA level of TXNIP and Itchin siRNAknockdownU2OS cells. Incontrast to over a 4-fold decrease inItch mRNA transcripts, the mRNAlevel of TXNIP in Itch-depletedU2OS cells stayed at a level similar

to that of control cells (Fig. 3G). Taken together, these resultsfurther support the notion that Itch is a key regulator of TXNIPstability.TXNIP Forms a Complex with Itch—Given that Itch contains

WW domains that are known to mediate its binding to sub-strates through the PPXY motif, which were also present inTXNIP, we examined the interaction between these two pro-teins. We co-expressed HA-TXNIP and wild-type Itch or theItch/C830A mutant (which was used to avoid degradation ofthe protein bound to Itch) in H1299 cells and immunoprecipi-tated TXNIP. As shown in Fig. 4A, Itch coimmunoprecipitatedwith TXNIP. This interaction was independent of ubiquitinligase activity of Itch, as the Itch/C830A mutant also coimmu-noprecipitated with TXNIP. Similar results were obtained in a

FIGURE 2. Itch promotes TXNIP degradation. A, sequence alignment of TXNIP orthologs from different spe-cies, including Homo sapiens, Mus musculus, Canis familiaris, Xenopus tropicalis, and Tetraodon nigroviridis. Thetwo conserved PPXY motifs are boxed. B, expression construct for HA-TXNIP was co-transfected with increasingamounts of Myc-Itch, Myc-Smurf1, Myc-Smurf2, Myc-WWP1, and Myc-Nedd4 expression constructs into H1299cells. The protein levels of TXNIP and E3 ubiquitin ligases were determined by Western blot with anti-TXNIP andanti-Myc antibodies, respectively. The pGFP-N3 expression construct was included as a transfection efficiencycontrol and levels of GFP were determined by Western blot with anti-GFP antibodies. The quantification ofimmunoblot is shown in the lower panel. The mean values (�S.D.) of three independent experiments areshown.




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

reciprocal coimmunoprecipitation experiment using anti-Mycantibody (Fig. 4B). Furthermore, when endogenous TXNIPwasimmunoprecipitated by the anti-TXNIP antibody, endogenousItch was detectable in the immunoprecipitate by Western blot(Fig. 4C).To verify the interaction between

TXNIP and Itch in vivo, we investi-gated whether these two proteinsare localized to the same subcellularcompartments. The subcellular lo-calization of TXNIP and Itch inCOS-7 cells has been reported pre-viously. Itch was found in the trans-Golgi network and endosomal com-partments (24), whereasTXNIPwasmainly localized to the nucleus (25).HA-TXNIP and GFP-Itch expres-sion constructs were transfectedinto COS7 cells, respectively. Theirsubcellular localizations were simi-lar to those previously reported(Fig. 4D). But when HA-TXNIP andGFP-Itch were co-expressed in COS-7 cells, a significant proportion ofHA-TXNIP was co-localized withGFP-Itch at small speckle structuresin the cytoplasm, which were remi-niscent of endosomes (Fig. 4D).Because TXNIP was known to in-teract with Importin �1 and to beimported into the nucleus to exertits physiological effects includinggrowth-suppressive activity, thisresult suggested that TXNIP couldbe sequestered in the cytoplasmwhere it is degraded through Itch.Binding of Itch to TXNIP Is Medi-

ated through the WW Domain ofItch and the PPXY Motif of TXNIP—TXNIP contains two arrestin do-mains and a C-terminal domainwith two PPXY motifs (331–334amino acids, PPCY; and 375–378amino acids, PPPY). Itch containsmultipleWWdomains at its centralregion. To determine whether theItch-TXNIP interaction is mediatedthrough these domains, we gener-ated truncation mutants of TXNIPin which one (�PY1 and �PY2) orboth (�PY1/2) PPXY motifs aredeleted or a C-terminal (which har-bor the second PPXY motif) deletionmutant (�C). We also constructed asingle amino acid mutant (PYF) bysubstituting the terminal Tyr (Y) ofthe second PPXY for Phe (F). Thesemutations have been shown to abro-

gate binding of the PPXY motif to WW domains. All fivemutants, as well as TXNIP WT, were fused to GST andexpressed in and purified from bacteria. We used a pulldownassay with GST fusion proteins of TXNIP and Itch overex-




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

pressed in H1299 cells. As shown inFig. 5A, wild-type and �PY1 TXNIPinteracted with Itch. But the inter-actions were nearly abolished be-tween Itch and other TXNIP mu-tants, including �PY2, �PY1/2, �C,and PYF. Thus, the second PPXYmotif appeared to be indispensa-ble for the interaction of TXNIPwith Itch.Next, we generated three dele-

tion mutants of Itch and deter-mined the minimal domain of Itchthat is sufficient to mediate itsinteraction with TXNIP. Thus,WT and three Itch deletion mu-tants containing the C2 domain(C2), WW domain (WW), HECTdomain (HECT), respectively,were fused to GST and expressedin and purified from bacteria. AGST pulldown assay for Itch andHA-TXNIP expressed in H1299cells was carried out. As shown inFig. 5B, TXNIP interacted with theWW mutant harboring four WWdomains. Thus, Itch is capable ofinteracting with TXNIP throughmultiple WW domains.We also determined if the PPXY

motifs were essential for Itch-medi-ated degradation as well. As shownin Fig. 5C, Itch targeted wild-typeTXNIP for degradation efficiently,but not the �PY2, �PY1/2, �C, orthe PYF mutant. Surprisingly, Itchwas also unable to target the TXNIP�PY1 mutant for degradation, eventhough this mutant retained theability to interact with Itch (Fig. 5A).These results suggested that Itchinteracts with both PPXY motifsof TXNIP through its multipleWWdomains. Although the second

FIGURE 3. Itch regulates TXNIP stability. A, the same amount of HA-TXNIP expression construct was co-transfected with increasing amounts of Myc-Itch,Myc-Itch/C830A mutant into H1299 cells. The protein levels of TXNIP and Itch were determined by Western blot with anti-TXNIP and anti-Itch antibodies,respectively. The pGFP-N3 expression construct was included as a transfection efficiency control and levels of GFP were assessed with GFP antibodies.B, HA-TXNIP was transfected either alone or in combination with Myc-Itch or Itch C830A expression plasmids into H1299 cells. After a 24-h incubation, cells weretreated with 40 �M MG132 (a proteasome inhibitor) or dimethyl sulfoxide (DMSO) for 6 h. The protein levels of TXNIP and Itch were determined by Western blotwith anti-TXNIP and anti-Itch antibodies, respectively. The pGFP-N3 expression construct was included as a control similar to A. C, H1299 cells were co-transfected with HA-TXNIP, along with empty vector, Itch, or Itch/C830A mutant. Twenty-four hours after transfection, cells were treated with 30 �M cyclo-heximide (CHX) for the indicated lengths of time. Equal amounts of cell lysates were subjected to Western blot with anti-TXNIP and anti-actin antibodies,respectively. D, for each experimental condition, the blots correspond to one representative experiment and the graph shows the quantification of TXNIP levelsusing actin for standardization. The error bars represent mean � S.D. from three independent experiments. E, 293T cells were transfected with Myc-Itch orItch/C830A expression constructs. Thirty-six hours after transfection, cells were harvested and lysed. The cell lysates were subjected to Western blot withanti-TXNIP and anti-Itch antibodies, respectively. F, 293T cells and U2OS cells were transiently transfected with two Itch-specific siRNA or control siRNA.Forty-eight hours after transfection, the protein levels of endogenous TXNIP and Itch were determined by Western blot with anti-TXNIP and anti-Itch antibod-ies, respectively. The quantification of immunoblots are shown in the lower panel. The mean values (�S.D.) of three independent experiments are shown.G, qRT-PCR measurements of the mRNA levels of Itch and TXNIP in Itch RNAi U2OS cells. Two Itch-specific siRNA or control siRNA were transfected into U2OScells. The left three columns are relative mRNA levels of TXNIP, and the right three columns correspond to those of Itch. The mRNA level of glyceraldehyde-3-phosphate dehydrogenase was used for normalization. All data shown are mean � S.D. (error bar) from three independent experiments.

FIGURE 4. TXNIP forms a complex with Itch. A and B, H1299 cells were transiently co-transfected with HA-TXNIP and Myc-Itch or Itch/C830A constructs. Cell lysates were prepared and subjected to immunoprecipita-tion with TXNIP (A) or Myc (B) antibodies, respectively. The immunoprecipitates (IP) were analyzed by Westernblot with anti-TXNIP and anti-Myc antibodies, respectively. C, endogenous TXNIP interacts with endogenousItch in 293T Cells. 293T cell lysates were incubated with Protein A/G-Sepharose conjugated with either controlIgG or TXNIP antibody. The immunoprecipitates were washed and bound proteins were resolved on SDS-PAGEfollowed by Western blot with TXNIP and Itch antibodies, respectively. D, colocalization of TXNIP and Itch inCOS-7 cells. COS-7 cells were transiently transfected with HA-TXNIP and GFP-Itch constructs either alone or incombination. TXNIP was stained in paraformaldehyde-fixed cells with mouse anti-HA antibodies followed byincubation with Texas Red-conjugated goat anti-mouse second antibodies. Nuclei were stained with 4�,6-diamidino-2-phenylindole. WB, Western blot.




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

PPXY motif is dispensable for the Itch-TXNIP interaction inthe GST pulldown assay, it is still required for the degradationof TXNIP by Itch in vivo.Itch Ubiquitinates TXNIP Both in Vitro and in Vivo—Given

that Itch is capable of binding to TXNIP and inducing itsdegradation upon coexpression, it is highly likely that

TXNIP is a ubiquitination sub-strate of Itch. To assess this possi-bility, we co-expressed FLAG-TXNIP, HA-ubiquitin, and Itch orthe Itch/C830A mutant in H1299cells. The polyubiquitinated formsof TXNIP were immunoprecipi-tated and then detected by West-ern blot with anti-Ub antibody. Asshown in Fig. 6A (see short expo-sure), TXNIP was seen as a strongsmear of bands when it was co-ex-pressed with wild-type Itch. Wealso employed an in vitro ubiquiti-nation assay using purified recom-binant proteins to determinewhether TXNIP is a direct ubiquiti-nation substrate for Itch. As shownin Fig. 6B, Itch caused polyubiquiti-nation of TXNIP in the presence ofE1, E2 UbcH7, and His6-Ub. In con-trast, the Itch/C830A mutant failedto cause TXNIP polyubiquitination.These results indicated that TXNIPis a direct substrate of Itch in vitroand likely in vivo.Itch Modulates the Basal Level of

Intracellular ROS by Controlling theTXNIP Protein Level—It has beenshown that TXNIP is an inhibitorof thioredoxin, which possessesanti-apoptotic activity by scaveng-ing ROS (1). TXNIP is induced byvarious apoptosis-inducing stimuliand associated with increasing lev-els of ROS through reduction of thi-oredoxin activity (2). Because Itchcontrols the steady-state level ofendogenous TXNIP, we assessedwhether Itch had any effect on theintracellular ROS level. As expected,knockdown of TXNIP decreased theintracellular ROS level, whereasknockdown of Itch increased theintracellular ROS level (Fig. 7A).Notably, concomitant knockdownof TXNIP largely reversed the posi-tive effect of Itch knockdown on theintracellular ROS level (Fig. 7B).These results suggested that Itchmay play a role in regulating intra-cellular ROS levels at least in part,

by regulation of TXNIP protein stability.Knockdown of Itch Promotes Etoposide-induced ROS Accu-

mulation and Apoptosis—TXNIP has been implicated in theregulation of apoptosis induced by various stress stimuli byincreasing the levels of ROS. As the chemotherapeutic drugetoposide has been reported to cause significant ROS accumu-

FIGURE 5. Itch and TXNIP interact through WW domains and PPXY motifs. A and B, upper panels, deletionconstructs of TXNIP (A) and Itch (B) are shown schematically. A, lower panel, the second PPXY motif in TXNIP isrequired for its binding to Itch. Bacterially expressed GST fusion proteins of wild-type (WT), single (�PY1 or�PY2), double (�PY1/2), and single point (PYF) mutants of TXNIP were bound to glutathione-Sepharose beadsas indicated and incubated with lysates of H1299 cells transfected with a Myc-Itch expression plasmid. BoundMyc-Itch, GST-TXNIP (bottom) were subjected to Western blot with anti-Itch and anti-GST antibodies, respec-tively. B, lower panel, bacterially expressed GST fusion proteins of WT, C2 domain (C2), WW domain (WW), HECTdomain (HECT) mutants of TXNIP were bound to glutathione-Sepharose beads and incubated with lysates of293T cells transfected with the HA-TXNIP expression construct. Bound TXNIP, GST-Itch were detected by West-ern blot with anti-TXNIP and anti-GST antibodies, respectively. C, the same amount of WT or various mutantexpression constructs of TXNIP were co-transfected with increasing amounts of Itch plasmid into H1299 cells.The protein levels of TXNIP and Itch were determined by Western blot with TXNIP and Itch antibodies, respec-tively. The pGFP-N3 expression construct was included as a transfection efficiency control, and levels of GFPwere determined by Western blot with anti-GFP antibodies. The quantification of immunoblot is shown in thelower panel. The mean value (�S.D.) of three independent experiments is shown.




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

lation and induce apoptosis (26), wedetermined if Itch had an effect onROS accumulation and apoptosisinduced by etoposide. As shown inFig. 8A, knockdown of Itch in U2OScells increased the intracellular ROSlevel upon treatment with etopo-side. The increase in the ROS levelwas accompanied by an increase inapoptosis (Fig. 8B). These observa-tions suggest that Itch may modu-late chemotherapy drug-inducedROS accumulation and apoptosis inU2OS cells.

DISCUSSION

TXNIP is a multifunctional pro-tein involved in diverse cellularprocesses, including cell prolifera-tion, apoptosis, and differentia-tion (2, 4). TXNIP expression isunder tight control in normal cellsand deregulation of TXNIP hasbeen implicated in cancer, cardiac,and metabolic diseases (1, 4). TXNIPis induced by various stress stimuli,including H2O2, irradiation, UV,heat shock, serum deprivation, andgrowth-inhibitory factors such astransforming growth factor-�1 (4).Anticancer agents such as 5-fluo-rouracil, anisomycin, dexametha-sone, and ceramide also dramati-cally induce TXNIP expression (27).Much is known about the transcrip-tional regulation of TXNIP expres-sion. A number of transcriptionalfactors, including heat shock factor,glucocorticoid receptor, MondoA,and FOXO1, have been identifiedthat regulate TXNIP expression un-der different conditions (28–30). Incontrast, the post-transcriptionaland post-translational regulationof TXNIP has remained largelyunknown. Recently, some hints onthe potential post-translational reg-ulation of TXNIP have emergedfrom system proteomic studies. Forexample, Thr-349(-PTpTPL-) orSer-361(-QDpSPIF-) were identi-fied as potential phosphorylationsites in a high-through proteome-wide mapping of protein mitoticphosphorylation sites by massspectrometry (31), suggesting thatTXNIP could be phosphorylated atthose two conserved sites by an

FIGURE 6. Itch ubiquitnates TXNIP both in vivo and in vitro. A, Itch ubiquitnates TXNIP in vivo. FLAG-TXNIP, HA-Ubiquitin, Myc-Itch, or Itch/C830A mutant constructs were co-transfected into H1299 cells.TNXIP proteins were immunoprecipitated by FLAG-M2 antibody. The immunoprecipitates (IP) were elutedusing 3� FLAG peptide and resolved by SDS-PAGE. The polyubiquitinated forms of TXNIP were detectedby Western blot (WB) with anti-Ub antibody. The pGFP-N3 expression construct was included as a control.B, Itch directly ubiquitinates TXNIP in vitro. Bacterially expressed and purified GST-TXNIP were incubatedwith GST-Itch or GST-Itch/C830A mutant in the presence of E1, E2 (UbcH7), and ubiquitin (His-Ub). Fol-lowing the ubiquitination reaction, the TXNIP-ubiquitin conjugates were detected by Western blot withanti-TXNIP antibody.

FIGURE 7. Itch modulates intracellular ROS by controlling TXNIP protein levels. A, U2OS cells were tran-siently transfected with two Itch-specific siRNA and one TXNIP-specific siRNA either alone or in combination.Forty-eight hours after transfection, cells were trypsinized and H2DCF-DA was then added for an additional 30min. Labeled cells were analyzed by flow cytometry. The mean value (�S.D.) of three independent experimentsis shown. * indicates statistical significance (*, p � 0.05). B, the protein levels of endogenous TXNIP and Itchwere determined by Western blot with anti-TXNIP and anti-Itch antibodies, respectively.




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

unknown proline-directed kinase(s). Importantly, TXNIP hasalso been found to undergo ubiquitination in vivo in a globalubiquitination analysis in HeLa cells by mass spectrometry.Lys-122was detected as one potential ubiquitin attachment site(32). However, the ubiquitin E3 ligase responsible for TXNIPubiquitination has remained unknown.We searched for the ubiquitin E3 ligase that targets TXNIP

for ubiquitination anddegradation. TXNIPhave two character-istic arrestin domains and a C-terminal domain of unknownfunction. Structurally, TXNIP belongs to the recently identified�-arrestin protein family. In the human genome, this proteinfamily has six members: TXNIP and five other proteins, whichhave been named ARRDC1–5 (arrestin domain containing1–5). Recently, the function of�-arrestins in yeast was reportedand these proteins were identified as a family of arrestin-relatedproteins that target specific plasma membrane proteins forendocytic down-regulation by serving as adaptors for Rsp5, theNedd4-like ubiquitin ligase in yeast (33). �-Arrestin 1 containstwo PPXY motifs in the C-terminal region, similar to TXNIP.These motifs were essential for recruitment of Rsp5 that ubiq-uitinates �-arrestins as well as plasmamembrane proteins (33).The presence of two conserved PPXY motifs in the C-terminalregion of TXNIP prompted us to investigate whether Rsp5 likeE3 ubiquitin ligase(s) in human cells might target TXNIPfor ubiquitination and proteasome degradation. Yeast Rsp5belongs to theNedd4-like ubiquitin ligase family. Yeast has onlya single member Rsp5. In humans, this family contains a num-ber of proteins (16). Thus, we tested a panel of human Nedd4-like ubiquitin ligases for their effects on TXNIP stability.Although theNedd4-like ubiquitin ligases show similar domainarchitecture and significant sequence similarity among oneanother, only Itch was found to promote TXNIP degradationefficiently, underscoring high specificity of Itch for TXNIP. Insupport of the notion that Itch controls the steady level ofTXNIP through the ubiquitin-proteasome pathway, we alsofound that: 1) treatment of 293T or U2OS cells with protea-

some inhibitors MG132 and lactacystein caused TXNIP pro-tein accumulation, suggesting that 2) TXNIP is normallydegraded by the proteasome, and 3) TXNIP was shown to forma stable complex with Itch. TXNIP undergoes Itch-dependentubiquitination by in vivo and in vitro.

Thioredoxin exhibits an anti-apoptotic activity by scavengingROS, or promoting ubiquitination and degradation of signal regu-lating kinase-1 (ASK-1). As an inhibitor of thioredoxin, TXNIPpromotes apoptosis (1). Indeed, up-regulation of TXNIP expres-sion was associated with the induction of apoptosis triggered byvariousapoptosis-inducingagents.Moreover,TXNIPoverexpres-sionwas sufficient to induce apoptosis inWEHI7.2 T cell and pri-mary rat cardiomyocyte (29, 34). Interestingly, ubiquitin E3 ligaseItch has been implicated in apoptosis. Itch null mouse embryonickidney cells are more sensitive to DNA damaging reagents-in-duced apoptosis compared with wild-type mouse embryonickidney (35). The anti-apoptotic function of Itch has been attrib-uted in large part to the ubiquitination and degradation of twokey transcription factors, p63 and p73, which are pro-apoptotic(23, 36). Our findings raised the possibility that TXNIP mayserve as an alternative mediator of the anti-apoptotic functionof Itch in addition to p63 and p73.The identification of Itch as the E3 ligase for ubiquitination

and degradation of TXNIP also shed new light on the roles ofthese proteins in cancer. TXNIP is a novel tumor suppressorand its expression is dramatically reduced in various tumor tis-sues, including breast, lung, colon, gastrointestinal, and pros-tate cancers. The TXNIP null mouse shows a higher incidenceof hepatocelluar carcinoma (7). In contrast, Itch is an amplifi-cation target detected in anaplastic thyroid carcinoma cells(37). Queries in the Oncomine data base also revealed that Itchis up-regulated in lymphoma, bladder, and breast cancers.Although it is reported that promoter methylation and histonedeacetylation may be one possible mechanism in the down-regulation of TXNIP in human cancers, it is also possible thatan increase in Itch expression can also play a part in TXNIPdown-regulation.Itch knock-out mice have been generated and the Itch null

mousedisplaysepidermisabnormality (18).Theepidermispheno-type has been explained by the disregulation of a number of Itchubiquitination targets thatarekey transcription factorscontrollingepidermal stemcellmaintenance and keratinocyte differentiation,such as c-Jun, p63, Notch, andGli. Intriguingly, in addition to thi-oredoxin,TXNIPwasalso found to interactwithSciellin, aprecur-sor of the cornified envelope, andmay play a role in regulating thetransitionof postmitotic keratinocytes to differentiating ones (38).TXNIP is present in all layers of the epidermis with higher abun-dance in the upper layers. It will be interesting to investigate if Itchcontrols the in vivo expressiongradient of theTXNIP in epidermislayers and if this control would have a role in epidermal keratino-cyte differentiation.

Acknowledgments—We thank Dr. Junji Yodoi for the FLAG-TXNIPconstruct, Dr. Gerry Melino for Myc-Itch and Myc-Itch/C830A con-structs, Annie Angers for GFP-Itch and GST-Itch constructs, KoheiMiyazono Myc-Smurf1/2 and Myc-WWP1 constructs, and XuejunJiang for the HA-nedd4 construct.

FIGURE 8. Knockdown of Itch promotes etoposide-induced ROS elevationand apoptosis. A, U2OS cells were transiently transfected with two Itch-spe-cific siRNA or one TXNIP-specific siRNA. Forty-eight hours after transfection,cells were treated with dimethyl sulfoxide (DMSO) or 20 �M etoposide for12 h. Cells were trypsinized and H2DCF-DA was then added for an additional30 min. Labeled cells were analyzed by flow cytometry. B, similar to A, U2OScells were treated with DMSO or 20 �M etoposide for 36 h. Cells were stainedwith propidium iodide, followed by fluorescence-activated cell sorter analy-sis. The mean value (�S.D.) of three independent experiments is shown.* indicates statistical significance (*, p � 0.05).




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

REFERENCES1. Kaimul, A. M., Nakamura, H., Masutani, H., and Yodoi, J. (2007) Free

Radic. Biol. Med. 43, 861–8682. Chung, J. W., Jeon, J. H., Yoon, S. R., and Choi, I. (2006) J. Dermatol. 33,

662–6693. Yoshioka, J., Schreiter, E. R., and Lee, R. T. (2006) Antioxid. Redox Signal.

8, 2143–21514. Kim, S. Y., Suh, H. W., Chung, J. W., Yoon, S. R., and Choi, I. (2007) Cell

Mol. Immunol. 4, 345–3515. Goldberg, S. F., Miele, M. E., Hatta, N., Takata, M., Paquette-Straub, C.,

Freedman, L. P., and Welch, D. R. (2003) Cancer Res. 63, 432–4406. Nakamura, H., Masutani, H., and Yodoi, J. (2006) Semin. Cancer Biol. 16,

444–4517. Sheth, S. S., Bodnar, J. S., Ghazalpour, A., Thipphavong, C. K., Tsutsumi,

S., Tward, A. D., Demant, P., Kodama, T., Aburatani, H., and Lusis, A. J.(2006) Oncogene 25, 3528–3536

8. Oka, S., Liu, W. R., Masutani, H., Hirata, H., Shinkai, Y., Yamada, S.,Yoshida, T., Nakamura, H., and Yodoi, J. (2006) FASEB J. 20, 121–123

9. Chen, J., Saxena, G., Mungrue, I. N., Lusis, A. J., and Shalev, A. (2008)Diabetes 57, 938–944

10. Chutkow, W. A., Patwari, P., Yoshioka, J., and Lee, R. T. (2008) J. Biol.Chem. 283, 2397–2406

11. Hui, S. T., Andres, A. M., Miller, A. K., Spann, N. J., Potter, D. W., Post,N. M., Chen, A. Z., Sachithanantham, S., Jung, D. Y., Kim, J. K., and Davis,R. A. (2008) Proc. Natl. Acad. Sci. U.S.A. 105, 3921–3926

12. Hui, T. Y., Sheth, S. S., Diffley, J. M., Potter, D.W., Lusis, A. J., Attie, A. D.,and Davis, R. A. (2004) J. Biol. Chem. 279, 24387–24393

13. Parikh, H., Carlsson, E., Chutkow, W. A., Johansson, L. E., Storgaard, H.,Poulsen, P., Saxena, R., Ladd, C., Schulze, P. C., Mazzini, M. J., Jensen,C. B., Krook, A., Bjornholm, M., Tornqvist, H., Zierath, J. R., Ridderstrale,M., Altshuler, D., Lee, R. T., Vaag, A., Groop, L. C., and Mootha, V. K.(2007) Plos Med. 4, 868–879

14. Hershko, A., and Ciechanover, A. (1998) Annu. Rev. Biochem. 67,425–479

15. Bernassola, F., Karin, M., Ciechanover, A., and Melino, G. (2008) CancerCell 14, 10–21

16. Ingham, R. J., Gish, G., and Pawson, T. (2004) Oncogene 23, 1972–198417. Yang, B., and Kumar, S. (2010) Cell Death Differ. 17, 68–7718. Melino, G., Gallagher, E., Aqeilan, R. I., Knight, R., Peschiaroli, A., Rossi,

M., Scialpi, F., Malatesta, M., Zocchi, L., Browne, G., Ciechanover, A., andBernassola, F. (2008) Cell Death Differ. 15, 1103–1112

19. Pan, Y., and Chen, J. D. (2003)Mol. Cell. Biol. 23, 5113–512120. Kisselev, A. F., and Goldberg, A. L. (2001) Chem. Biol. 8, 739–75821. Weissman, A. M. (2001) Nat. Rev. Mol. Cell Biol. 2, 169–17822. Xu, P., Duong, D.M., Seyfried, N. T., Cheng, D., Xie, Y., Robert, J., Rush, J.,

Hochstrasser, M., Finley, D., and Peng, J. (2009) Cell 137, 133–14523. Rossi, M., De Laurenzi, V., Munarriz, E., Green, D. R., Liu, Y. C., Vousden,

K. H., Cesareni, G., and Melino, G. (2005) EMBO J. 24, 836–84824. Mouchantaf, R., Azakir, B. A., McPherson, P. S., Millard, S. M., Wood,

S. A., and Angers, A. (2006) J. Biol. Chem. 281, 38738–3874725. Nishinaka, Y.,Masutani,H.,Oka, S.,Matsuo, Y., Yamaguchi, Y., Nishio, K.,

Ishii, Y., and Yodoi, J. (2004) J. Biol. Chem. 279, 37559–3756526. Trachootham, D., Alexandre, J., and Huang, P. (2009)Nat. Rev. Drug Dis-

cov. 8, 579–59127. Chen, C. L., Lin, C. F., Chang, W. T., Huang, W. C., Teng, C. F., and Lin,

Y. S. (2008) Blood 111, 4365–437428. Kim, K. Y., Shin, S. M., Kim, J. K., Paik, S. G., Yang, Y., and Choi, I. (2004)

Biochem. Biophys. Res. Commun. 315, 369–37529. Wang, Z., Rong, Y. P., Malone, M. H., Davis, M. C., Zhong, F., and Distel-

horst, C. W. (2006) Oncogene 25, 1903–191330. Stoltzman, C. A., Peterson, C.W., Breen, K. T., Muoio, D.M., Billin, A. N.,

and Ayer, D. E. (2008) Proc. Natl. Acad. Sci. U.S.A. 105, 6912–691731. Dephoure, N., Zhou, C., Villen, J., Beausoleil, S. A., Bakalarski, C. E.,

Elledge, S. J., and Gygi, S. P. (2008) Proc. Natl. Acad. Sci. U.S.A. 105,10762–10767

32. Meierhofer, D.,Wang, X., Huang, L., and Kaiser, P. (2008) J. Proteome Res.7, 4566–4576

33. Lin, C. H., MacGurn, J. A., Chu, T., Stefan, C. J., and Emr, S. D. (2008)Cell135, 714–725

34. Schulze, P. C., De Keulenaer, G. W., Yoshioka, J., Kassik, K. A., and Lee,R. T. (2002) Circ. Res. 91, 689–695

35. Hansen, T.M., Rossi,M., Roperch, J. P., Ansell, K., Simpson, K., Taylor, D.,Mathon, N., Knight, R. A., and Melino, G. (2007) Biochem. Biophys. Res.Commun. 361, 33–36

36. Rossi, M., Aqeilan, R. I., Neale, M., Candi, E., Salomoni, P., Knight, R. A.,Croce, C. M., and Melino, G. (2006) Proc. Natl. Acad. Sci. U.S.A. 103,12753–12758

37. Ishihara, T., Tsuda, H., Hotta, A., Kozaki, K., Yoshida, A., Noh, J. Y., Ito, K.,Imoto, I., and Inazawa, J. (2008) Cancer Sci. 99, 1940–1949

38. Champliaud, M. F., Viel, A., and Baden, H. P. (2003) J. Invest. Dermatol.121, 781–785




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Wu, Hongxiu Yu, Jun O. Liu and Long YuPingzhao Zhang, Chenji Wang, Kun Gao, Dejie Wang, Jun Mao, Jian An, Chen Xu, Di

Thioredoxin-interacting Protein for Ubiquitin-dependent DegradationThe Ubiquitin Ligase Itch Regulates Apoptosis by Targeting

doi: 10.1074/jbc.M109.063321 originally published online January 12, 20102010, 285:8869-8879.J. Biol. Chem.

10.1074/jbc.M109.063321Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here

http://www.jbc.org/content/285/12/8869.full.html#ref-list-1

This article cites 38 references, 15 of which can be accessed free at


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M109.063321

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;285/12/8869&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/285/12/8869

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=285/12/8869&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/285/12/8869

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/content/285/12/8869.full.html#ref-list-1

http://www.jbc.org/

theubiquitinligaseitchregulatesapoptosisbytargeting … ·...

Documents