the translational landscape of the mammalian cell cycle€¦ · activity of key molecular machinery...
TRANSCRIPT
Please cite this article in press as: Stumpf et al., The Translational Landscape of the Mammalian Cell Cycle, Molecular Cell (2013), http://dx.doi.org/10.1016/j.molcel.2013.09.018
Molecular Cell
Short Article
The Translational Landscapeof the Mammalian Cell CycleCraig R. Stumpf,1,2 Melissa V. Moreno,1,2 Adam B. Olshen,2,3 Barry S. Taylor,2,3,4,* and Davide Ruggero1,2,*1Department of Urology, University of California, San Francisco, CA 94158, USA2Helen Diller Family Comprehensive Cancer Center, University of California, San Francisco, CA 94158, USA3Department of Epidemiology and Biostatistics, University of California, San Francisco, CA 94158, USA4Department of Medicine, University of California, San Francisco, CA 94158, USA
*Correspondence: [email protected] (B.S.T.), [email protected] (D.R.)
http://dx.doi.org/10.1016/j.molcel.2013.09.018
SUMMARY
Gene regulation during cell-cycle progression is anintricately choreographed process, ensuring accu-rate DNA replication and division. However, thetranslational landscape of gene expression underly-ing cell-cycle progression remains largely unknown.Employing genome-wide ribosome profiling, weuncover widespread translational regulation ofhundreds of mRNAs serving as an unexpectedmechanism for gene regulation underlying cell-cycleprogression. A striking example is the S phase trans-lational regulation of RICTOR, which is associatedwith cell cycle-dependent activation of mammaliantarget of rapamycin complex 2 (mTORC2) signalingand accurate cell-cycle progression.We further iden-tified unappreciated coordination in translationalcontrol of mRNAs within molecular complexes dedi-cated to cell-cycle progression, lipid metabolism,and genome integrity. This includes the majority ofmRNAs comprising the cohesin and condensin com-plexes responsible for maintaining genome organi-zation, which are coordinately translated duringspecific cell cycle phases via their 50 UTRs. Our find-ings illuminate the prevalence and dynamic nature oftranslational regulation underlying the mammaliancell cycle.
INTRODUCTION
During cell division, exquisite temporal control of protein expres-
sion in distinct phases of the cell cycle underlies fundamental
checkpoints that ensure accurate completion of chromosome
duplication and segregation of a daughter cell. A central para-
digm that has emerged is that rapid, dynamic, and fine-tuned re-
programming of gene expression occurs during specific phases
of the cell cycle. For example, a large number of mRNAs,
including those involved in promoting cell-cycle progression,
are transcriptionally activated in a cell-cycle phase-dependent
manner (Cho et al., 2001; Whitfield et al., 2002). In addition,
degradation of many cell-cycle checkpoint proteins, primarily
through the ubiquitin proteasome pathway, at specific times dur-
ing the cell cycle is required for progression to subsequent
phases (Peters, 2006). Systems-level mass spectrometry ap-
proaches are also beginning to elucidate targets of the ubiqui-
tin-proteasome pathway, as well as cell-cycle-specific patterns
of posttranslational modifications on a large number of proteins
(Kim et al., 2011; Merbl et al., 2013). While these studies have
provided great insight into the highly coordinated gene expres-
sion program of the cell cycle, a key step in modulating protein
levels has remained undefined: the regulation of mRNA
translation.
To date, the study of translational control during the mamma-
lian cell cycle has generally focused on global reductions in pro-
tein synthesis during mitosis, monitored by a decrease in amino
acid incorporation into proteins (Fan and Penman, 1970; Konrad,
1963). Conversely, a relatively modest number of mRNAs have
been identified as actively translated duringmitosis (Qin and Sar-
now, 2004). Other studies have primarily investigated regulation
of single mRNAs, such as the translational regulation of cyclin E,
which is required for progression into S phase (Lai et al., 2010).
While limited in scope, these studies both highlight the impor-
tance of translational regulation during cell-cycle progression
and underscore the need for an unbiased, genome-wide analysis
of the translational landscape during the mammalian cell cycle.
Here, we have employed ribosome profiling (Ingolia et al.,
2009) to uncover widespread translational regulation during
cell-cycle progression. We defined remarkable levels of transla-
tional control of key cell cycle genes. Importantly, among these
mRNAs, we uncovered translational regulation of RICTOR,
which correlates with the cell-cycle phase-specific signaling of
the mammalian target of rapamycin (mTOR) kinase pathway
and suggests an important role in cell-cycle progression. More-
over, we identify surprising, coordinate regulation in translational
control of functionally related sets of mRNAs, suggesting a reg-
ulatory mechanism that dictates the coordinate expression and
activity of key molecular machinery in the cell. Among these
translationally controlled networks are mRNAs required for
metabolism, nuclear transport, and DNA repair, the latter of
which ensures genome fidelity. Together, this work highlights
both the prevalence and the dynamic nature of translational
regulation during cell-cycle progression. It further suggests a
multifaceted mechanism for differential regulation of transcript-
specific translational control in the execution of distinct steps
of the cell cycle.
Molecular Cell 52, 1–9, November 21, 2013 ª2013 Elsevier Inc. 1
Figure 1. Systematic and Multifaceted Translational Control of Gene Expression during the Mammalian Cell Cycle
(A) The cumulative fraction of ribosome-bound mRNA on all expressed transcripts in each phase of the cell cycle is shown as a function of increasing
ribosome-bound mRNA. The x axis represents the scaled fraction of total ribosome-bound reads, and the y axis represents the fraction of expressed
transcripts.
(B) Representative scatter plots illustrate ribosome occupancy as a function of mRNA abundance (measured as sequencing read counts). The dashed line
represents the expected level of ribosome occupancy givenmRNA abundance (see Supplemental Experimental Procedures). mRNAs with statistically significant
translational regulation are those with greater or less than the expected levels of ribosome occupancy given their mRNA expression (FDR < 1%; G1 is gray,
S phase is blue, and mitosis is green).
(C) The total number of genes with significantly increased (black) or decreased (gray) ribosome occupancy is shown, including those unique to a given phase or
shared between multiple phases of the cell cycle.
(legend continued on next page)
Molecular Cell
The Translational Landscape during the Cell Cycle
2 Molecular Cell 52, 1–9, November 21, 2013 ª2013 Elsevier Inc.
Please cite this article in press as: Stumpf et al., The Translational Landscape of the Mammalian Cell Cycle, Molecular Cell (2013), http://dx.doi.org/10.1016/j.molcel.2013.09.018
Molecular Cell
The Translational Landscape during the Cell Cycle
Please cite this article in press as: Stumpf et al., The Translational Landscape of the Mammalian Cell Cycle, Molecular Cell (2013), http://dx.doi.org/10.1016/j.molcel.2013.09.018
RESULTS
To understand the extent and impact of translational regulation
during cell-cycle progression, we employed ribosome profiling
to identify individual mRNAs exhibiting unexpected levels of
ribosome association during each phase of the cell cycle. After
synchronizing human HeLa cells in G1, S phase, or mitosis,
libraries for total mRNA and ribosome-protected RNA fragments
were prepared, sequenced, and analyzed using a sophisticated
statistical framework (see Experimental Procedures) (Figure S1A
available online) (Olshen et al., 2013). We initially characterized
global levels of ribosome occupancy in the expressed transcrip-
tome of each phase of the cell cycle. This data revealed a signif-
icant decrease in the overall level of ribosome-bound mRNAs
during mitosis compared to either G1 or S phase, which is
consistent with a decline in cap-dependent translation during
mitosis (Figure 1A) (Fan and Penman, 1970; Konrad, 1963).
Beyond these global changes in translation, our principal aim
was to understand the extent of gene-specific translational regu-
lation during cell-cycle progression. We therefore developed a
computational framework for determining the statistical signifi-
cance of relative ribosome occupancy of mRNAs within individ-
ual phases of the cell cycle. This analysis quantifies levels of
ribosome occupancy higher or lower than those predicted from
transcript abundance (Figure 1B, highlighted points; see Exper-
imental Procedures). This approach enabled us to quantify the
landscape of mRNA translation during a given cell cycle phase
or to directly assess differential translational regulation between
any two phases of the cell cycle.
Strikingly, we observed extensive and dynamic translational
control of individual mRNAs during different phases of the cell
cycle (Figure 1B, Table S1). In total, we identified 1,255 mRNAs,
representing 12% of the expressed transcripts in these cells,
that exhibit levels of ribosome occupancy in any cell cycle phase
higher or lower than those expected (false discovery rate [FDR] <
1%). We next sought to determine how the translation of these
1,255 mRNAs varies among cell cycle phases. Transcript-spe-
cific translational regulation was most prevalent in G1 and S
phases (Figure 1C). Indeed, genome-wide, there was far greater
similarity in the level of ribosome occupancy in mRNAs between
G1 and S phase than existed when comparing either of these to
mitosis (Figure 1D). Importantly, these differences in transcript-
specific translational control during the cell cycle are indepen-
dent from global changes in the levels of protein synthesis that
occur during specific cell cycle phases. Here, we measured
the levels of ribosome association for specific mRNAs relative
to the background level of ribosome association during each in-
dividual phase. This is especially relevant during mitosis, when
global protein synthesis levels are lower compared to those of
G1 or S phase (Figure 1A) (Fan and Penman, 1970; Konrad,
1963). Additionally, we identified core groups of mRNAs that
(D) Density plots of the nominal p value of ribosome occupancy for each gene betw
given region, where red and blue are the most and least dense, respectively).
(E) Unsupervised hierarchical clustering of mRNA translation across the phases o
between any two phases in direct comparisons. Genes and cell cycle phases
centered translational efficiency by gene, scales and colors indicate the directio
Figure S1 and Tables S1 and S2.
exhibit increased or decreased translation in all phases of the
cell cycle, suggesting that they may share a mechanism to main-
tain high or low levels of translation throughout the cell cycle (Fig-
ure 1C). Moreover, the specific patterns obtained by hierarchical
clustering of the 1,255 translationally regulated mRNAs were not
observed when comparing corresponding transcript expression
levels, indicating that translational regulation is indeed a distinct
regulatory system, uncoupled from transcription, controlling
gene expression during the cell cycle (Figure S1B).
In addition to defining the relative level of translation for spe-
cific genes within each cell cycle phase, we also identified a large
number of mRNAs that undergo significant changes in transla-
tion between phases of the cell cycle. We identified 353 mRNAs
with a statistically significant change in translation between any
two phases of the cell cycle (FDR < 5%) (Figure 1E, Table S2).
Among these, 112 mRNAs were translationally regulated exclu-
sively between specific phases of the cell cycle. These mRNAs
comprise a number of important cell-cycle regulatory genes,
including CLASP2 and KNTC1, which are involved in establish-
ing the mitotic spindle checkpoint. Overall, these data demon-
strate that systematic and multifaceted translational control of
gene expression exists during progression through the mamma-
lian cell cycle.
We next sought to understand the regulatory logic underlying
general changes in translational regulation observed among
specific phases of the cell cycle. To determine certain parame-
ters of cell cycle-dependent translational regulation, we exam-
ined specific structural characteristics of 50 UTRs, including their
length, percent of G + C content (%G+C), and minimum free en-
ergy (MFE). In the G1 phase of the cell cycle, there is a significant
association between ribosome occupancy and the length of 50
UTRs such that mRNAs with shorter UTRs had high levels of
ribosome occupancy. In bothG1 and S phase, there is an inverse
relationship between the G+C content of 50 UTRs and ribosome
occupancy levels. Finally, mRNAs with higher ribosome occu-
pancy in all phases of the cell cycle studied were associated
with higher predicted MFE, revealing that their 50 UTRs possess
less-complex secondary structures (Figure S1C). Together,
these findings suggest that several of the defining features of
50 UTRs may contribute to the translational efficiency of the
mammalian genome within specific phases of the cell cycle.
However, these very general characteristics of the 50 UTR do
not account for all the patterns of translational regulation
observed here. Therefore, it is likely that there are additional
important determinants of transcript-specific translational con-
trol (see below).
The translational dynamics of key cell-cycle regulators are still
poorly understood. We therefore assessed the pattern of statis-
tically significant translational regulation among bona fide cell-
cycle regulatory genes during each phase of the cell cycle (Fig-
ure 2A) (Subramanian et al., 2005). This analysis uncovered
een any two phases of the cell cycle (colors designate the density of genes in a
f the cell cycle using the 353 differentially translationally regulated transcripts
are clustered based on the level of normalized ribosome occupancy (mean-
n and magnitude of mRNA translation; S is S phase, M is Mitosis). See also
Molecular Cell 52, 1–9, November 21, 2013 ª2013 Elsevier Inc. 3
C
RenillaFirefly5’UTR
RICTOR
NUAK2
Test ControlB
D
Relative translation0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 3 5 7
RICTOR
NUAK2
G1S phaseMitosis
A
<1e-10N.S.
Significance (q value)
FBXO5 SMC4 KIF15
POLA1 MRE11A
OFD1 SASS6 KIF18A RINT1
RAD50 AHR
ROCK1 AHCTF1
LIN9 NEDD1 CENPF
RICTOR CENPC1
PLK1 CCNB1
ASNS PRIM1 BUB1B
TPX2 PRKDC
E2F5 BUB1 CUL2 EGF
PSMA3 NCAPH
RBL2 DOCK2
KIF23 RACGAP1
SYNE1 KIF4A
KIFAP3 PSMD14
CCNE2 CASC5
KIF11 CENPE
MYO6 ANAPC1
KIF2A TTK
ANLN LRPPRC NUP107
CENPI SGOL2
NUP133 PSMD1
SMC3 PCM1
CLASP1 SMARCA5
CEP135 HOOK3 CKAP5 RBBP4 STAG1 KIF20A
DYNC1I2 CDC26 RHOF E2F1
CRIPAK ARPC4 RUNX3 MRAS RAC1
RPS27 EVL
APITD1 MYL6B APOE
G1 S phase
Mitosis
*
<1e-10IncreasedDecreased
8 12 240
10
20
30
40
50
60wildtypeRictor-/-
Perc
ent o
f cel
ls in
Mito
sis
Hours post thymidine
total PKCα
total AKT
pAKT S473
pPKCα S657
RICTOR
Tubulin
pHistone H3 S10
G1 S phase
Mitosis
Figure 2. Phase-Dependent Translational
Control of Key Cell-Cycle Regulators,
Including RICTOR and mTOR Signaling
(A) A heatmap of the significance of translational
regulation among cell-cycle progression genes
(asterisk: RICTOR). Shading represents the sig-
nificance level of increased or decreased trans-
lational regulation (red and blue, as indicated).
(B) A diagram describing the 50 UTR luciferase
reporter assay (top panel). 50 UTRs cloned into the
firefly reporter are scaled to length. Capped
mRNAs are transfected into synchronized cells
prior to assaying reporter levels. Levels of trans-
lation directed by RICTOR or NUAK2 50 UTRs are
shown: y axis is reporter value relative to cells in
G1 (bottom panel).
(C) Western blots showing RICTOR protein levels
and phosphorylation of mTORC2 targets (AKT-
S473, PKCa-S657). pHistone H3 is a mitosis
marker. Tubulin is a loading control.
(D) Mitotic progression of thymidine-synchronized
MEFs: y axis is the percent of mitotic cells. Bars
represent the mean ± SD. See also Figure S2.
Molecular Cell
The Translational Landscape during the Cell Cycle
Please cite this article in press as: Stumpf et al., The Translational Landscape of the Mammalian Cell Cycle, Molecular Cell (2013), http://dx.doi.org/10.1016/j.molcel.2013.09.018
extensive translational regulation among these genes, high-
lighting the prevalence of translational control during cell-cycle
progression. For example, we observed high levels of ribosome
occupancy in G1 and S phase for CCNE2, a cyclin known to be
translationally regulated. On the contrary, our data revealed low
levels of ribosome occupancy of E2F1, also during G1 and S
phase, which is consistent with cell cycle-dependent miRNA-
mediated regulation of E2F1 (Pulikkan et al., 2010). Furthermore,
this analysis identified translational regulation among several
cell-cycle mediators, including PLK1 and BUB1, two mitotic
checkpoint kinases. Notably, RICTOR, the defining subunit of
4 Molecular Cell 52, 1–9, November 21, 2013 ª2013 Elsevier Inc.
mTOR complex 2 (mTORC2) (Laplante
and Sabatini, 2012), displayed a signifi-
cant change in the level of ribosome oc-
cupancy, with an almost 3-fold increase
from G1 to S phase and a greater than
13-fold decrease fromS phase tomitosis.
Our findings further show an accumula-
tion of RICTOR protein, but not other
components of mTORC2, that mirrors
this pattern of ribosome occupancy (Fig-
ures 2A, 2C, and S2B), which suggests
that RICTOR protein accumulation is, at
least in part, mediated by translational
control. To further investigate the mecha-
nisms responsible for cell cycle-depen-
dent translational control of RICTOR, we
assessed the activity of its 50 UTR. Strik-ingly, the 50 UTR of the RICTOR mRNA
is sufficient to direct increased protein
expression during S phase, which then
decreases upon entry into mitosis, a
pattern consistent with the cell cycle-
dependent ribosome occupancy we
observed (Figures 2A, 2B, and S2A). We
compared the translation directed by the RICTOR 50 UTR to
the 50 UTR of an mRNA that exhibits a distinct pattern of cell-
cycle phase-specific translation, NUAK2 (Figure 2B). In our
ribosome profiling experiments, NUAK2 showed a significant
increase in ribosome occupancy during mitosis compared to
either G1 or S phase (q values = 9.5 3 10�4 and 1.3 3 10�3,
respectively; Table S2). RICTOR and NUAK2 50 UTRs promote
unique patterns of translation in the luciferase reporter assay,
suggesting that translational regulation of these mRNAs is
specific and the patterns of translation we observe are not due
to global changes in protein synthesis (Figure 2B).
Molecular Cell
The Translational Landscape during the Cell Cycle
Please cite this article in press as: Stumpf et al., The Translational Landscape of the Mammalian Cell Cycle, Molecular Cell (2013), http://dx.doi.org/10.1016/j.molcel.2013.09.018
These data suggest that regulation of RICTOR mRNA transla-
tion and its accumulation at the protein level during S phase
could modulate the activity of mTOR during the cell cycle. To
test this hypothesis, we assessed phosphorylation levels of
mTORC2 targets AKT (S473) and PKCa (S657) in lysates from
synchronized cells (Figure 2C). We identified a strong correlation
between the levels of RICTORprotein and the phosphorylation of
these two mTORC2 targets during the S phase of the cell cycle.
Moreover, the phosphorylation of AKT during S phase is depen-
dent on RICTOR, since it does not occur in Rictor�/� mouse em-
bryonic fibroblasts (MEFs) (Figure S2C). Upstream signaling
pathways, such as phosphatidylinositol 3-kinase (PI3K)/
PDPK1, can activate AKT by phosphorylating T308 (Alessi
et al., 1996; Alessi et al., 1997). The fact that phosphorylation
of AKT at T308 does not change during the cell cycle further sug-
gests that the RICTOR-dependent phosphorylation of AKT at
S473 during S phase is independent from the induction of up-
streamPI3K signaling (Figure S2B). Importantly, we also observe
an increase in the phosphorylation of p27, a downstream target
of AKT, specifically during S phase (Figure S2B). Phosphoryla-
tion of p27 by AKT inhibits its activity, thereby promoting cell-
cycle progression (Shin et al., 2002). These findings suggest
that the accumulation of RICTOR protein levels in S phase may
have an important function in cell-cycle progression. Rictor�/�
MEFs have previously been shown to possess a proliferation
defect (Shiota et al., 2006). We therefore determined when the
proliferation defect in Rictor�/� MEFs manifests during the cell
cycle relative to the increase in translation of RICTOR observed
in S phase. Rictor�/� MEFs exhibit a defect in progression
through mitosis as evidenced by a lag in the accumulation of
diploid cells after synchronization in S phase (Figure 2D), associ-
ated with a marked decrease in S phase cells compared to wild-
type (p value = 0.0006, Student’s t test; Figure S2D). Together,
our findings suggest that translational regulation, at least in
part, leads to an increase in RICTOR protein that underlies cell
cycle-dependent mTORC2 activity and is associated with the
progression from S phase to mitosis.
An outstanding question is whether functionally related
groups of genes may be translationally coregulated as a means
by which to simultaneously control the expression of important
mRNA networks. Strikingly, we identified numerous clusters of
functionally related genes among translationally coregulated
mRNAs (Table S3). These include genes central to the control
of metabolism, nuclear transport, and DNA repair (Figure 3A,
Table S3). Among the metabolism genes identified, there was
a particular enrichment of genes involved in lipid metabolism
and the tricarboxylic acid cycle (TCA) cycle (Figure 3B). Further-
more, we identified a significant enrichment of translationally
regulated mRNAs, primarily during G1 and S phase, involved
in nuclear-cytoplasmic transport, including a large number of
core scaffolding components of the nuclear pore complex
(NPC) (Figure 3C). In fact, over 20% of NPC components are
translationally regulated during cell-cycle progression, primarily
during interphase, when the number of NPCs increases
dramatically (Antonin et al., 2008). Furthermore, translationally
regulated genes are components of multiple DNA repair path-
ways, including mismatch repair and double-strand break
repair pathways (Figure 3D). This suggests that translational
control may be a key contributor in regulating the response to
diverse types of DNA damage that arise during cell-cycle
progression.
Given this striking pattern of translational regulation among
genes involved in DNA repair, we sought to identify cell-cycle
phase-specific translational regulation of mRNAs required for
genome fidelity. Strikingly, the majority of genes comprising
the cohesin and condensin complexes are translated in a cell-
cycle phase-specific manner (Figure 4A). mRNAs from compo-
nents of both the condensin and cohesin complexes exhibit rela-
tively high levels of ribosome occupancy during G1 and S phase
that decrease in mitosis (Figure 4A). As these complexes are
loaded onto DNA during S phase or G2 in order to prepare chro-
mosomes for segregation during mitosis (Hirano, 2012; Wood
et al., 2010), the ribosome occupancy we observe is consistent
with the requirement for the condensin and cohesin complexes
to be produced prior to mitosis. We determined that the molec-
ular basis for these translational patterns in gene expression is,
at least in part, through 50 UTR-mediated regulation. For
example, the 50 UTRs of the core components of the condensin
complex, SMC2 and SMC4, direct similar patterns of transla-
tional activation during G1 and S phase that decrease in mitosis
and mirror the cell cycle ribosome occupancy profile. Likewise,
the 50 UTRs of SMC3, STAG1, and NIPBL, components of the
cohesin complex, direct translation that is high during G1 and
S phase and decreased during mitosis (Figure 4B). On the con-
trary, the 50 UTR from RANBP1, a control mRNA whose pattern
of ribosome occupancy is distinct from components of the con-
densin and cohesin complexes and is functionally unrelated,
does not (Figure 4B).
We further identified unique cell cycle-dependent patterns of
ribosome occupancy within specific regions of transcripts
belonging to the cohesin complex. For example, the density of
bound ribosomes on theNIPBLmRNA, a member of the cohesin
complex, shifts from the primary initiation codon of the coding
region to an upstream open reading frame (uORF) 59 nucleo-
tides upstream of the primary initiation codon in a highly evolu-
tionarily conserved region of the 50 UTR as cells progress
through the cell cycle into mitosis (Figures 4C, left, and S3A).
uORFs often act to decrease the translation of primary open
reading frames, which is consistent with the decrease in trans-
lation observed from the NIPBL 50 UTR in the luciferase reporter
assay (Figure 4B). In the case of WAPAL, a gene that promotes
dissociation of cohesin from sister chromatids during mitosis
(Gandhi et al., 2006; Kueng et al., 2006), we identified an unex-
pected peak of ribosome density downstream of the translation
termination codon in the 30 UTR that is only present during
mitosis (Figure 4C, right). This region of the WAPAL 30 UTR is
highly conserved and contains two additional in-frame stop co-
dons, suggesting that WAPAL could produce a C-terminally
extended protein product during mitosis (Figures 4C, right,
and S3B). Together, these data suggest that components of
the condensin and cohesin complexes utilize multiple modes
of translational regulation to coordinate their expression during
the cell cycle. Furthermore, translational regulation may help
to facilitate the assembly or modulate the activity of large protein
complexes by ensuring that individual components of these
complexes are coordinately expressed.
Molecular Cell 52, 1–9, November 21, 2013 ª2013 Elsevier Inc. 5
A B
C D
G1 S phase
Mitosis
G1S phaseMitosis
Cohesin andCondensin
Metabolism
NuclearTransport
DNARepair
NUP107 NUP205
NUP188 NUP93
NUP133
TPR KPNB1
NUP155
ST6GALNAC6 STS AGPAT1 NEU3 ECHS1 ADM ETNK1 ALG1 CPT1A
G1 S phase
Mitosis
SDHC
PDHA2 IDH3A
PCK1
FH IDH1 ACO2 PDK2 PDK3
G1 S phase
Mitosis
<1e-10
N.S.
Significance (q value)<1e-10
IncreasedDecreased
LipidMetabolism
TCA Cycle
G1 S phase
Mitosis
MSH2
POLA1 MRE11A
RAD50 LIG4
MSH6 MSH3 RECQL ERCC4 UBE2V1
DNA Repair
NuclearTransport
Figure 3. Translational Coregulation of Large Molecular Complexes during Cell-Cycle Progression
(A) Among translationally regulated genes during the cell cycle, a network of statistically significant functional enrichments (nodes, nominal p value < 0.05; radius
scaled to the number of genes) and their relatedness (edges, spearman correlation rR 0.3) indicate a highly interconnected set of modules of molecular function.
Groups of nodes closely related by function are highlighted in yellow and labeled. A Venn diagram overlay represents the relative overlap of enriched molecular
function between cell cycle phases (G1 is gray, S phase is blue, and mitosis is green).
(B–D) Heatmaps highlight the significance of translational regulation of genes that define representative functional categories, including lipidmetabolism and TCA
cycle (B), nuclear transport (C), and DNA repair (D). Shading represents the significance level of increased or decreased translational regulation (red and blue, as
indicated). See also Table S3.
Molecular Cell
The Translational Landscape during the Cell Cycle
Please cite this article in press as: Stumpf et al., The Translational Landscape of the Mammalian Cell Cycle, Molecular Cell (2013), http://dx.doi.org/10.1016/j.molcel.2013.09.018
DISCUSSION
Our work delineates the unexpected magnitude and dynamic
nature of translational regulation during the mammalian cell cy-
cle. We have presented a comprehensive network of interrelated
and coordinately translationally regulated mRNAs underlying
this fundamental biological process. These data suggest that
translational control is a particularly well-suited mechanism for
fine-tuning gene expression during dynamic processes such
as cell-cycle progression. For example, we uncovered unex-
pected translational regulation of a key component of the
mTOR pathway, a key regulator of cell growth. RICTOR be-
comes translationally induced specifically upon transitioning
into S phase of the cell cycle. Although we cannot exclude that
other mechanisms, such as control of protein stability, may
also cooperate in modulating RICTOR protein abundance during
the cell cycle, our findings show that accumulation of RICTOR
during S phase modulates mTORC2 signaling to promote the
phosphorylation of specific downstream targets, including AKT
6 Molecular Cell 52, 1–9, November 21, 2013 ª2013 Elsevier Inc.
and PKCa. Phosphorylation of both AKT and PKCa by mTORC2
during S phase is consistent with their roles in promoting cell
growth and proliferation and reveals how this process may be
regulated at the level of translational control. Moreover, we did
not observe overt translational regulation of other mTOR com-
plex components, highlighting the specificity in RICTOR 50
UTR translational activation in controlling mTOR signaling during
cell-cycle progression. Elucidating the precisemechanisms gov-
erning translational regulation of RICTOR will be an important
area of future research that may play an important role in
mTORC2 signaling during cell-cycle progression.
One surprising finding from our data is the translational core-
gulation of the molecular machinery responsible for maintaining
genome integrity. A number of translationally regulated genes
are involved in sensing multiple types of DNA damage, such as
base pair mismatches and double-strand breaks, that are specif-
ically translationally activated during S phase. Notably, multiple
orthogonal DNA repair pathways are controlled by translation,
suggesting a critical regulatory mechanism that maintains the
RenillaFirefly5’UTR
STAG1
SMC2
SMC3
SMC4
RANBP1
Test Control
Cohesin complex
-2
-1
0
1
2
3
G1 S phase Mitosis
SMC3
NIPBL
STAG1
WAPAL
Tran
slat
iona
l effi
cien
cy
p = 0.0015
A
-2
-1
0
1
2
3
G1 S phase Mitosis
SMC2
SMC4
Condensin complexTr
ansl
atio
nal e
ffici
ency
p = 0.027
B
C
SMC2 SMC4 SMC3 STAG1 NIPBL RANBP10.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4R
elat
ive
trans
latio
n
G1
S ph
ase
Mito
sis
WAPAL
88,194,980 88,197,970
1.0
0.5
0.0
Conservation
NIPBL
Rib
osom
e-bo
und
Rea
ds
36,954,000
1.0
0.5
0.0
36,953,650
Conservation
AUG
uORF
NIPBL
Figure 4. Condensin and Cohesion Complex Components Are Coordinately and Translationally Regulated during the Cell Cycle at the Level
of Their 50 UTR(A) The translational efficiency of components of the condensin (left) and cohesin (right) complexes during each cell cycle phase are indicated (specific genes
mentioned elsewhere are outlined for clarity).
(B) A diagram of the luciferase reporter assay with 50 UTRs scaled to length (left). Levels of translation directed by specific 50 UTRs are indicated: y axis is the
reporter value relative to cells in G1 (right). Bars represent mean ± SD from six replicates.
(C) The level of bound ribosome in the 50 UTR of NIPBL (left) and the 30 UTR of WAPAL (right), with peaks of interest denoted by red arrows (evolutionary
conservation is indicated). G1 is gray, S phase is blue, and mitosis is green. Representative gene features are indicated: uORF is designated by an orange box;
narrow or wide black bars represent UTRs and coding exons, respectively; black lines indicate introns; and arrows indicate the coding strand. Numbers represent
absolute genomic positions. See also Figure S3.
Molecular Cell
The Translational Landscape during the Cell Cycle
Molecular Cell 52, 1–9, November 21, 2013 ª2013 Elsevier Inc. 7
Please cite this article in press as: Stumpf et al., The Translational Landscape of the Mammalian Cell Cycle, Molecular Cell (2013), http://dx.doi.org/10.1016/j.molcel.2013.09.018
Molecular Cell
The Translational Landscape during the Cell Cycle
Please cite this article in press as: Stumpf et al., The Translational Landscape of the Mammalian Cell Cycle, Molecular Cell (2013), http://dx.doi.org/10.1016/j.molcel.2013.09.018
fidelity of the genome, adding a robust level of protection in
safeguarding the genome. This may also be true for protein com-
plexes that are responsible for organizing the higher-order struc-
ture of chromosomes, which also show coregulated patterns of
translational control. The primary role of the cohesin and con-
densin complexes is to package the genome to ensure faithful
segregation of chromosomes during cell division (Hirano, 2012;
Wood et al., 2010). The mRNAs comprising the majority of these
two complexes exhibit high levels of translation during both G1
and S phase that may ensure sufficient, stoichiometric amounts
of the proteins required to package chromosomes prior to their
segregation.
Interestingly, cohesins can promote transcription, and disrup-
tion of the cohesin complex impairs ribosomal RNA transcrip-
tion, thus leading to defects in protein synthesis (Bose et al.,
2012). Most notably, mutations in cohesin genes characterize
an entire class of human disorders termed cohesinopathies.
Cohesinopathies manifest as developmental disorders with
characteristic limb defects, including oligodactyly, and neurode-
velopmental delay. These features overlap with the phenotypic
spectrum of ribosomopathies where ribosome components are
found mutated, suggesting a possible relationship between
these two fundamental biological processes. Moreover, it is
notable that a mutation in a uORF in the 50 UTR of NIPBL leads
to a decrease inNIPBL translation and is associated with a cohe-
sinopathy known as Cornelia de Lange Syndrome, suggesting
that alterations in translational regulation may underlie this hu-
man disease (Borck et al., 2006). This mutation disrupts a
uORF in the 50 UTR of NIPBL, which could be responsible for
the observed decrease in translation. This finding is consistent
with our studies showing a critical role for the 50 UTR in regulating
the translation of mRNAs belonging to the cohesin complex.
These results also suggest a potential feedback mechanism be-
tween the cohesin complex and the translation machinery that
may be of great importance to the etiology of cohesinopathies.
Together, our studies shed light on the unexpected dynamics
of translational control in the regulation of gene expression dur-
ing fundamental cellular programs, such as the mammalian cell
cycle. The magnitude of this translational regulation, involving
hundreds ofmRNAs, suggests that currently unknown regulatory
mechanisms and transcript-specific translational regulators may
endow remarkable specificity to the posttranscriptional gene
expression program that is fundamental for accurate replication
and cell division.
EXPERIMENTAL PROCEDURES
Tissue Culture and Cell-Cycle Analysis
HeLa cells andMEFs were cultured under normal growth conditions. Synchro-
nization in specific cell cycle phases was achieved by release from thymidine
block (G1 and S phase) and nocodazole treatment (mitosis) as previously
described (Jackman and O’Connor, 2001). Cell-cycle analysis was performed
on cells fixed in 80% ethanol prior to ribonuclease (RNase) digestion and stain-
ing with 40 mg/ml propidium iodide or with the Click-iT EdU Flow Cytometry
Assay (Life Technologies).
Library Preparation and Sequencing
Next-generation sequencing libraries were prepared as described previously
(Hsieh et al., 2012). Briefly, synchronized cells were treated with cyclohexi-
mide, lysed, and split into pools for isolating total mRNA and ribosome-bound
8 Molecular Cell 52, 1–9, November 21, 2013 ª2013 Elsevier Inc.
mRNA. Ribosome-protected mRNA fragments were isolated by centrifuga-
tion. Total mRNA was alkaline fragmented and size selected. Both samples
were processed for small RNA library sequencing. Libraries from two biolog-
ical replicates per cell cycle phase were sequenced on an Illumina HiSeq
2000.
Alignment and Analysis of Ribosome Profiling Data
Sequencing reads were processed and aligned to the human genome using
standard procedures (see Supplemental Experimental Procedures). Transla-
tional regulation was inferred using an errors-in-variables regression model.
This analytical model estimates p values in each replicate to represent
ribosome-given-mRNA counts lower or higher than those expected. We simi-
larly developed methods for combining p values among replicates within cell
cycle phases and for testing differential translational regulation, all of which
is described in greater detail in the Supplemental Experimental Procedures.
50 UTR Characterizations
Genes were classified as having a level either higher than, lower than, or ex-
pected of ribosome occupancy given their mRNA levels within each phase
of the cell cycle as described in the Supplemental Experimental Procedures.
The length and %G+C content of the 50 UTR of each expressed gene was
computed fromGencode version 11, while the predicted minimum free energy
was computed with the Vienna suite; RNAfold version 1.8.4 (Gruber et al.,
2008). The significance of each 50 UTR feature was determined with Wilcoxon
rank sum test statistics.
Luciferase Reporter Assays
50 UTRs from HeLa cDNA were cloned upstream of firefly luciferase in pGL3-
T7. RNAs were in vitro transcribed using the T7 MEGAscript Kit (Life Technol-
ogies). Purified RNA was capped using a vaccinia RNA capping system (New
England Biolabs). Luciferase reporter RNA was transfected at a ratio of 20:1
with a control Renilla reporter RNA using the TransIT-mRNA Transfection Kit
(Mirus Bio). Luciferase levels were read after a 4 hr incubation using the Dual
Luciferase Assay (Promega). Firefly luciferase signal was normalized to
Renilla signal for each sample, averaged, and the signal relative to G1 was
calculated.
Western Blotting
Proteins were analyzed by standard western blotting protocols. Antibodies
used were as follows: RICTOR, AKT phospho-S473, total AKT, AKT phos-
pho-T308, total PKCa, and PROTOR-2 (Cell Signaling Technology); PKCa
phospho-S657 (Santa Cruz); PROTOR-1 (GeneTex); SIN1 (Bethyl Labora-
tories); phospho-p27 (R&D Systems); total p27 (BD Biosciences); histone H3
phospho-S10 (Millipore); and a-tubulin (Sigma-Aldrich).
ACCESSION NUMBERS
Sequencing data were deposited in the NCBI Short Read Archive under acces-
sion number SRA099816.
SUPPLEMENTAL INFORMATION
Supplemental Information includes Supplemental Experimental Procedures,
three figures, and three tables and can be found with this article online at
http://dx.doi.org/10.1016/j.molcel.2013.09.018.
ACKNOWLEDGMENTS
We thankMaria Barna andmembers of the Ruggero lab for critical insights dur-
ing this work and D. Byrd, K. Tong, and C. Milentis for reading the manuscript.
Mark Magnuson provided the Rictor�/� MEFs. C.R.S. is supported by NIH/
NRSA (F32CA162634). This work was supported by NIH R01CA140456
(D.R.), NIH R01CA154916 (D.R.), and NIH P30CA82103 (A.B.O.). B.S.T. is a
Prostate Cancer Foundation Young Investigator. D.R. is a Leukemia & Lym-
phoma Society Scholar.
Molecular Cell
The Translational Landscape during the Cell Cycle
Please cite this article in press as: Stumpf et al., The Translational Landscape of the Mammalian Cell Cycle, Molecular Cell (2013), http://dx.doi.org/10.1016/j.molcel.2013.09.018
Received: May 14, 2013
Revised: August 5, 2013
Accepted: September 17, 2013
Published: October 10, 2013
REFERENCES
Alessi, D.R., Andjelkovic, M., Caudwell, B., Cron, P., Morrice, N., Cohen, P.,
and Hemmings, B.A. (1996). Mechanism of activation of protein kinase B by in-
sulin and IGF-1. EMBO J. 15, 6541–6551.
Alessi, D.R., James, S.R., Downes, C.P., Holmes, A.B., Gaffney, P.R., Reese,
C.B., and Cohen, P. (1997). Characterization of a 3-phosphoinositide-depen-
dent protein kinase which phosphorylates and activates protein kinase
Balpha. Curr. Biol. 7, 261–269.
Antonin, W., Ellenberg, J., and Dultz, E. (2008). Nuclear pore complex assem-
bly through the cell cycle: regulation and membrane organization. FEBS Lett.
582, 2004–2016.
Borck, G., Zarhrate, M., Cluzeau, C., Bal, E., Bonnefont, J.P., Munnich, A.,
Cormier-Daire, V., and Colleaux, L. (2006). Father-to-daughter transmission
of Cornelia de Lange syndrome caused by amutation in the 50 untranslated re-
gion of the NIPBL Gene. Hum. Mutat. 27, 731–735.
Bose, T., Lee, K.K., Lu, S., Xu, B., Harris, B., Slaughter, B., Unruh, J., Garrett,
A., McDowell, W., Box, A., et al. (2012). Cohesin proteins promote ribosomal
RNA production and protein translation in yeast and human cells. PLoS
Genet. 8, e1002749.
Cho, R.J., Huang, M., Campbell, M.J., Dong, H., Steinmetz, L., Sapinoso, L.,
Hampton, G., Elledge, S.J., Davis, R.W., and Lockhart, D.J. (2001).
Transcriptional regulation and function during the human cell cycle. Nat.
Genet. 27, 48–54.
Fan, H., and Penman, S. (1970). Regulation of protein synthesis in mammalian
cells. II. Inhibition of protein synthesis at the level of initiation during mitosis.
J. Mol. Biol. 50, 655–670.
Gandhi, R., Gillespie, P.J., and Hirano, T. (2006). Human Wapl is a cohesin-
binding protein that promotes sister-chromatid resolution in mitotic prophase.
Curr. Biol. 16, 2406–2417.
Gruber, A.R., Lorenz, R., Bernhart, S.H., Neubock, R., and Hofacker, I.L.
(2008). The Vienna RNA websuite. Nucleic Acids Res. 36(Web Server issue),
W70–W74.
Hirano, T. (2012). Condensins: universal organizers of chromosomes with
diverse functions. Genes Dev. 26, 1659–1678.
Hsieh, A.C., Liu, Y., Edlind, M.P., Ingolia, N.T., Janes, M.R., Sher, A., Shi, E.Y.,
Stumpf, C.R., Christensen, C., Bonham, M.J., et al. (2012). The translational
landscape of mTOR signalling steers cancer initiation and metastasis.
Nature 485, 55–61.
Ingolia, N.T., Ghaemmaghami, S., Newman, J.R., and Weissman, J.S. (2009).
Genome-wide analysis in vivo of translation with nucleotide resolution using
ribosome profiling. Science 324, 218–223.
Jackman, J., and O’Connor, P.M. (2001). Methods for synchronizing cells at
specific stages of the cell cycle. Curr. Protoc. Cell Biol. Chapter 8, 3.
Kim,W., Bennett, E.J., Huttlin, E.L., Guo, A., Li, J., Possemato, A., Sowa, M.E.,
Rad, R., Rush, J., Comb, M.J., et al. (2011). Systematic and quantitative
assessment of the ubiquitin-modified proteome. Mol. Cell 44, 325–340.
Konrad, C.G. (1963). Protein Synthesis and Rna Synthesis during Mitosis in
Animal Cells. J. Cell Biol. 19, 267–277.
Kueng, S., Hegemann, B., Peters, B.H., Lipp, J.J., Schleiffer, A., Mechtler, K.,
and Peters, J.M. (2006). Wapl controls the dynamic association of cohesin with
chromatin. Cell 127, 955–967.
Lai, M.C., Chang,W.C., Shieh, S.Y., and Tarn,W.Y. (2010). DDX3 regulates cell
growth through translational control of cyclin E1. Mol. Cell. Biol. 30, 5444–
5453.
Laplante, M., and Sabatini, D.M. (2012). mTOR signaling in growth control and
disease. Cell 149, 274–293.
Merbl, Y., Refour, P., Patel, H., Springer, M., and Kirschner, M.W. (2013).
Profiling of ubiquitin-like modifications reveals features of mitotic control.
Cell 152, 1160–1172.
Olshen, A.B., Hsieh, A.C., Stumpf, C.R., Olshen, R.A., Ruggero, D., and Taylor,
B.S. (2013). Assessing gene-level translational control from ribosome profiling.
Bioinformatics. Published online September 18, 2013. http://dx.doi.org/10.
1093/bioinformatics/btt533.
Peters, J.M. (2006). The anaphase promoting complex/cyclosome: a machine
designed to destroy. Nat. Rev. Mol. Cell Biol. 7, 644–656.
Pulikkan, J.A., Dengler, V., Peramangalam, P.S., Peer Zada, A.A., Muller-
Tidow, C., Bohlander, S.K., Tenen, D.G., and Behre, G. (2010). Cell-cycle regu-
lator E2F1 and microRNA-223 comprise an autoregulatory negative feedback
loop in acute myeloid leukemia. Blood 115, 1768–1778.
Qin, X., and Sarnow, P. (2004). Preferential translation of internal ribosome en-
try site-containing mRNAs during the mitotic cycle in mammalian cells. J. Biol.
Chem. 279, 13721–13728.
Shin, I., Yakes, F.M., Rojo, F., Shin, N.Y., Bakin, A.V., Baselga, J., and Arteaga,
C.L. (2002). PKB/Akt mediates cell-cycle progression by phosphorylation of
p27(Kip1) at threonine 157 and modulation of its cellular localization. Nat.
Med. 8, 1145–1152.
Shiota, C., Woo, J.T., Lindner, J., Shelton, K.D., and Magnuson, M.A. (2006).
Multiallelic disruption of the rictor gene in mice reveals that mTOR complex
2 is essential for fetal growth and viability. Dev. Cell 11, 583–589.
Subramanian, A., Tamayo, P., Mootha, V.K., Mukherjee, S., Ebert, B.L.,
Gillette, M.A., Paulovich, A., Pomeroy, S.L., Golub, T.R., Lander, E.S., and
Mesirov, J.P. (2005). Gene set enrichment analysis: a knowledge-based
approach for interpreting genome-wide expression profiles. Proc. Natl.
Acad. Sci. USA 102, 15545–15550.
Whitfield,M.L., Sherlock, G., Saldanha, A.J., Murray, J.I., Ball, C.A., Alexander,
K.E., Matese, J.C., Perou, C.M., Hurt, M.M., Brown, P.O., and Botstein, D.
(2002). Identification of genes periodically expressed in the human cell cycle
and their expression in tumors. Mol. Biol. Cell 13, 1977–2000.
Wood, A.J., Severson, A.F., and Meyer, B.J. (2010). Condensin and cohesin
complexity: the expanding repertoire of functions. Nat. Rev. Genet. 11,
391–404.
Molecular Cell 52, 1–9, November 21, 2013 ª2013 Elsevier Inc. 9
Molecular Cell, Volume 52
Supplemental Information
The Translational Landscape of the Mammalian Cell Cycle
Craig R. Stumpf, Melissa V. Moreno, Adam B. Olshen, Barry S. Taylor, and Davide Ruggero
Supplemental Materials
Figure S1
p<0.001
p<0.0001
**
***
G1
Mitosis
S-phase
1
10
100
1000
5' U
TR
length
(bp)
10000**
Backg
rou
nd
Backg
rou
nd
Backg
rou
nd
Hig
h
Lo
w
Hig
h
Lo
w
Hig
h
Lo
w
0.0
0.2
0.4
0.6
0.8
1.0
5' U
TR
G+
C%
*** ******
Ba
ckg
round
Ba
ckg
round
Ba
ckg
round
Hig
h
Low
Hig
h
Low
Hig
h
Low
�·�875
�QRUPDOL]HG�0)(
0.0
-0.2
-0.4
-0.6
-0.8
*********
***
Ba
ckg
round
Ba
ckg
round
Ba
ckg
round
Hig
h
Low
Hig
h
Low
Hig
h
Low
C
A
0 200 400 600 800 1000
PI intensity
0
20
40
60
80
100
% o
f M
ax
G1 82%S-phase 89%Mitosis 73%
-1.75 1.75
0
Genes (
n=
1255)
P51$Translation
G1 S M G1 S M
B
Figure S1. Related to Figure 1. (A) Flow cytometry histogram plotting the
distribution of cells as a function of DNA content measured by propidium iodide (PI)
fluorescence intensity. (B) Heat maps representing the translational regulation
(left) and mRNA expression levels (right) for the 1255 translationally regulated
genes within any phase of the cell cycle. Genes and cell cycle phases are clustered
based on the level of normalized ribosome occupancy (mean-‐centered translational
efficiency by gene, left). mRNA expression levels (right) were ordered based on the
clustering of translational regulation. Scales and colors indicate the direction and
magnitude of mRNA translation or levels, respectively. (C) Box and whisker plots
denoting the 5’UTR length (left), %G+C content (middle), and minimum free energy
(MFE) (right) for genes with higher, lower, or expected levels of ribosome
occupancy. Y-‐axes are as labeled. Cell cycle phases are colored: Grey, G1; Blue, S-‐
phase; Green, mitosis.
Figure S2. Related to Figure 2. (A) The sequence of the RICTOR 5’UTR. The start
codon for the coding region is highlighted in red. (B) Western blots showing the
levels of mTORC2 components and the phosphorylation status of AKT and
downstream signaling targets. SIN1, PROTOR-‐1, and PROTOR-‐2 are components of
mTORC2. Phosphorylation of AKT T308 is independent of mTORC2. p27Kip1 is a
phosphorylation target of AKT. Tubulin is a loading control. (C) Western blots
Figure S2
A
B
RICTOR 5’ UTR sequence:
GUUUCCGGUGUUGUGACUGAAACCCGUCAAUAUG
C
D
G1
S-p
hase
Mito
sis
G1
S-p
hase
Mito
sis
p-AKT S473
total AKT
RICTOR: + + +- - -
Tubulin
WT
rictor-/-
0 20 40 60 80 100
p-value = 0.0006
Percent of cells
G1 S-phase Mitosis
SIN1
PROTOR-2
PROTOR-1
Tubulin
G1
S-p
hase
Mito
sis
total AKT
p-AKT T308
p-p27Kip1
total p27Kip1
illustrating the phosphorylation status of AKT in synchronized wildtype and Rictor-‐/-‐
MEFs. (D) Cell cycle analysis of asynchronous MEFs with the percentage of cells in
each phase of the cell cycle indicated along the Y-‐axis. The red box highlights the
magnitude of the difference between the number of WT and Rictor-‐/-‐ MEFs in S-‐
phase. Probability calculated by Student’s t-‐test. Cell cycle phases are colored as
labeled.
Figure S3. Related to Figure 4. (A) The sequence of the NIPBL 5’UTR. Potential
AUG start codons are bold. The uORF corresponding to the peak of bound ribosome
in Figure 4C is orange. The region of the CC > A mutation in Cornelia de Lange
syndrome is underlined. (B) The sequence of the WAPAL 3’UTR immediately
downstream of the stop codon. The region corresponding to the peak of ribosome
binding is underlined. In-‐frame stop codons are shown in red. The predicted amino
acid sequence of the putative C-‐terminal extension is shown below. The sequence
up to the first in-‐frame stop codon is red.
NIPBL 5’UTR sequence:
GGGCCCGCGGCGAUGCCCCCCCGGUAGCUCGGGCCCGUGGUCGGGUGUUUGUGAGUGU
UUCUAUGUGGGAGAAGGAGGAGGAGGAGGAAGAAGAAGCAACGAUUUGUCUUCUCGGCUG
GUCUCCCCCCGGCUCUACAUGUUCCCCGCACUGAGGAGACGGAAGAGGAGCCGUAGCCAC
CCCCCCUCCCGGCCCGGAUUAUAGUCUCUCGCCACAGCGGCCUCGGCCUCCCCUUGGAUU
CAGACGCCGAUUCGCCCAGUGUUUGGGAAAUGGGAAGUAAUGACAGCUGGCACCUGAACU
AAGUACUUUUAUAGGCAACACCAUUCCAGAAAUUCAGGAUG...
Figure S3
A
WAPAL 3’UTR sequence:
CTGCTTTACCTTTGCTTCAGGTGCTCGGTAATGCTGGAGCTATCCTTAGACAAAGAAAAGTCAAGTC
ATGAAAGAAGTCCTTGAAGATATACCAAGAACATTCATCAGTATCATTCGTGTTTGGATTTTTAA...
Putative amino acid sequence of C-terminal extension:
LLYLCFRCSVMLELSLDKEKSSHERSP*RYTKNIHQYHSCLDR*
B
Supplemental Tables
Table S1. Translationally regulated genes from each phase of the cell cycle, related
to Figure 1.
Table S2. Genes with significant changes in translation between G1 and S-‐phase, G1
and mitosis, and S-‐phase and mitosis, related to Figure 1.
Table S3. Functional enrichments of genes that are translationally regulated during
G1, S-‐phase, or mitosis, related to Figure 3.
Supplemental Experimental Procedures
Alignment and analysis of ribosome profiling data
Raw single-‐end sequencing reads were processed in the following manner. First,
reads were clipped of the known adaptor sequence (CTGTAGGCACCATCAAT) and
remaining 3’ sequence with the FASTX-‐Toolkit, retaining only reads of 24bp post-‐
clipping length or longer. Clipped reads were mapped to the human genome
assembly (NCBI build 36) with Burrows-‐Wheeler Alignment (BWA; ver. 0.5.9-‐r16,
default parameters)(Li and Durbin, 2009). Unaligned reads were then mapped to
known splice junctions with Tophat (ver. 1.4.1) (Trapnell et al., 2009) using a
transcriptome index created from version 11 of the Gencode gene set (Harrow et al.,
2006). Provisional merged BAM files (Li et al., 2009) were created from aligned and
unaligned reads from either the genome or spliced alignment and read groups were
enforced across lanes and experiments. BAM files were then indexed, coordinate
sorted, and had alignment metrics determined, all with the Picard suite
(http://picard.sourceforge.net/). Only those protein-‐coding transcripts of levels 1
or 2 of Gencode support (verified or manually curated loci respectively) were used
for all subsequent analyses. A unified gene model was created for each gene in
which the union of coding sequences across all isoforms of a given gene was
collapsed into a single model per gene. Gene-‐level translational regulation was
inferred for only those genes estimated to be expressed in the Hela transcriptome,
determined by comparing their observed expression level (calculated as a
normalized rpkM expression estimate) to a null distribution of similar expression in
randomly selected non-‐coding regions of the genome with a size distribution
sampled from the empirical size distribution (Olshen et al. submitted). In total,
10,814 genes were retained for further analysis.
We quantify mRNA translation for genes (ribosome-‐given-‐mRNA levels) with a
statistical framework called Babel. Briefly, this errors-‐in-‐variables regression model,
the details of which are presented elsewhere (Olshen et al.), assesses the
significance of translational regulation for every gene within and between samples
and conditions. For a transcript with a given abundance (mRNA counts), the
expected level of ribosome occupancy (RPF counts) is inferred from trimmed least-‐
squares regression (based on the monotonic relationship typified in Figure 1). We
model both mRNA levels and the level of bound ribosome given mRNA abundance
by the negative binomial distribution. The over-‐dispersion of the latter is modeled
using an iterative algorithm to prevent over-‐fitting. We then use a parametric
bootstrap based on the modeling described above to estimate a p-‐value for every
gene. It tests formally the null hypothesis that the level of bound ribosome is as
expected from mRNA abundance. These p-‐values are estimated for a one-‐sided test
in which both low and high p-‐values are of interest; low p-‐values correspond to
higher than expected ribosome-‐given-‐mRNA counts and high p-‐values correspond
to the opposite.
Since Babel quantifies this mRNA translation (ribosome-‐given-‐mRNA levels) as a p-‐
value in each sample of a given condition, we combine these p-‐values into a single
assessment of the significance of translational regulation in each condition (phase of
the cell cycle). Here, we developed an alternative methodology to Fisher’s method
first proposed by Edgington (Edgington, 1972). This approach, in which the
combined p-‐value is a function of the arithmetic mean of individual p-‐values,
maintains symmetry and convexity between each of two or more tests of
hypotheses and their p-‐values. It produces a small combined p-‐value from
consistently small p-‐values of ribosome-‐given-‐mRNA levels (and the reverse for two
or more large p-‐values). Once p-‐values are combined, two-‐sided p-‐values can be
estimated and genes are considered regulated at the translational level if their
corresponding p-‐values are low after adjusting for multiple comparisons [in this
study, those corresponding to a false discovery rate (FDR) less than 1% (Storey,
2002)].
Differences in ribosome occupancy given mRNA levels between conditions are
assessed utilizing a statistic based upon using the Gaussian quantile function to
transform the within condition p-‐values into z-‐statistics. Corresponding p-‐values
are estimated by comparison to the Gaussian distribution and again corrected for
multiple comparisons as described above. Significant differentially translationally
regulated genes are those corresponding to an FDR < 5% in any of the pair-‐wise
comparisons of cell cycle phases. For visualization purposes, the conventional
measure of translational efficiency was used and calculated as previously described
(Ingolia et al., 2009).
Supplemental References
Edgington, E.S. (1972). Additive Method for Combining Probability Values from
Independent Experiments. J Psychol 80, 351-‐&.
Harrow, J., Denoeud, F., Frankish, A., Reymond, A., Chen, C.K., Chrast, J., Lagarde, J.,
Gilbert, J.G., Storey, R., Swarbreck, D., et al. (2006). GENCODE: producing a reference
annotation for ENCODE. Genome Biol 7 Suppl 1, S4 1-‐9.
Ingolia, N.T., Ghaemmaghami, S., Newman, J.R., and Weissman, J.S. (2009). Genome-‐
wide analysis in vivo of translation with nucleotide resolution using ribosome
profiling. Science 324, 218-‐223.
Li, H., and Durbin, R. (2009). Fast and accurate short read alignment with Burrows-‐
Wheeler transform. Bioinformatics 25, 1754-‐1760.
Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis,
G., and Durbin, R. (2009). The Sequence Alignment/Map format and SAMtools.
Bioinformatics 25, 2078-‐2079.
Olshen, A.O., Hsieh, A.C., Stumpf, C.R., Olshen, R.A., Ruggero, D., and Taylor, B.S.
(2013). Assessing gene-‐level translational control from ribosome profiling.
Bioinformatics (in press).
Storey, J.D. (2002). A direct approach to false discovery rates. J Roy Stat Soc B 64,
479-‐498.
Trapnell, C., Pachter, L., and Salzberg, S.L. (2009). TopHat: discovering splice
junctions with RNA-‐Seq. Bioinformatics 25, 1105-‐1111.