the tarim basin

RESEARCH ARTICLE Open Access

Evidence that a West-East admixed populationlived in the Tarim Basin as early as the earlyBronze AgeChunxiang Li1,2, Hongjie Li2, Yinqiu Cui1,2, Chengzhi Xie2, Dawei Cai1, Wenying Li3, Victor H Mair4, Zhi Xu5,Quanchao Zhang1, Idelisi Abuduresule3, Li Jin4, Hong Zhu1, Hui Zhou1,2*

Abstract

Background: The Tarim Basin, located on the ancient Silk Road, played a very important role in the history ofhuman migration and cultural communications between the West and the East. However, both the exact period atwhich the relevant events occurred and the origins of the people in the area remain very obscure. In this paper,we present data from the analyses of both Y chromosomal and mitochondrial DNA (mtDNA) derived from humanremains excavated from the Xiaohe cemetery, the oldest archeological site with human remains discovered in theTarim Basin thus far.

Results: Mitochondrial DNA analysis showed that the Xiaohe people carried both the East Eurasian haplogroup (C)and the West Eurasian haplogroups (H and K), whereas Y chromosomal DNA analysis revealed only the WestEurasian haplogroup R1a1a in the male individuals.

Conclusion: Our results demonstrated that the Xiaohe people were an admixture from populations originatingfrom both the West and the East, implying that the Tarim Basin had been occupied by an admixed populationsince the early Bronze Age. To our knowledge, this is the earliest genetic evidence of an admixed populationsettled in the Tarim Basin.

BackgroundThe Tarim Basin in western China, positioned at a criti-cal site on the ancient Silk Road, has played a significantrole in the history of human migration, cultural develop-ments and communications between the East and theWest. It became famous due to the discovery of manywell-preserved mummies within the area. These mum-mies, especially the prehistoric Bronze Age Caucasoidmummies, such as the Beauty of Loulan, have attractedextensive interest among scientists regarding who werethese people and where did they come from.Based on analyses of human remains and other

archaeological materials from the ancient cemeteries(dated from approximately the Bronze Age to the IronAge), there is now widespread acceptance that the firstresidents of the Tarim Basin came from the West. This

was followed, in stages, by the arrival of Eastern peoplefollowing the Han Dynasty [1,2]. However, the exacttime when the admixture of the East and the Westoccurred in this area is still obscure [3]. In 2000, theXinjiang Archaeological Institute rediscovered a veryimportant Bronze Age site, the Xiaohe cemetery, by uti-lizing a device employing the global positioning system.The rediscovery of this cemetery provided an invaluableopportunity to further investigate the migrations ofancient populations in the region.The Xiaohe cemetery (402011"N, 884020.3"E) is

located in the Taklamakan Desert of northwest China,about 60 km south of the Peacock River and 175 kmwest of the ancient city of Kroraina (now Loulan;Figure 1). It was first explored in 1934 by Folke Berg-man, a Swedish archaeologist, but the cemetery was lostsight of until the Xinjiang Archaeological Institute redis-covered it in 2000. The burial site comprises a total of167 graves. Many enigmatic features of these graves,such as the pervasive use of sexual symbolism

* Correspondence: [email protected] DNA Laboratory, Research Center for Chinese Frontier Archaeology,Jilin University, Changchun 130012, PR China

Li et al. BMC Biology 2010, 8:15http://www.biomedcentral.com/1741-7007/8/15

2010 Li et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative CommonsAttribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction inany medium, provided the original work is properly cited.

represented by tremendous numbers of huge phallus-posts and vulvae-posts, exaggerated wooden sculpturesof human figures and masks, well-preserved boat coffinsand mummies, a large number of textiles, ornamentsand other artifacts, show that the civilization revealed atXiaohe is different from any other archaeological site ofthe same period anywhere in the world [3].The entire necropolis can be divided, based on the

archeological materials, into earlier and later layers.Radiocarbon measurement (14C) dates the lowest layer ofoccupation to around 3980 40 BP (personal communica-tions; calibrated and measured by Wu Xiaohong, Head ofthe Laboratory of Accelerator Mass Spectrometry, PekingUniversity), which is older than that of the Gumugou cem-etery (dated to 3800). To date, these are the oldest humanremains that have been excavated in the Tarim Basin [3].A genetic study of these invaluable archeological materialswill undoubtedly provide significant insights into theorigins of the people of the Tarim Basin.We examined the DNA profiles on both the maternal

and the paternal aspects for all the morphologically

well-preserved human remains from the lowest layer ofthe Xiaohe cemetery. We used these data to determinethe population origins, to provide insights into the earlyhuman migration events in the Tarim Basin and, finally,to offer an expanded understanding of the human his-tory of Eurasia.

MethodsSamplingThe excavation of the Xiaohe cemetery began in 2002.The lowest layer of the cemetery, comprising a total of41 graves of which 37 have human skeletal remains, wasexcavated by the Xinjiang Archaeological Institute andthe Research Center for Chinese Frontier Archaeologyof Jilin University from 2004 to 2005. After the appro-priate recording, the skeletal remains of 30 well-pre-served individuals, together with sandy soil, were packedin cardboard boxes and sent to the ancient DNA labora-tory of Jilin University, where they were stored in a dryand cool environment. All the samples were collected bytwo highly skilled scientists in our group, equipped with

Figure 1 The geographical position of Xiaohe cemetery. The larger map shows Xinjiang, shown also in the shaded section of the map ofChina.


Page 2 of 12

gloves and facemasks. As a result of the saline and alka-line character of the sand, the dry air and good drai-nage, the human remains are in excellent conditions.One intact femur and two tooth samples for each set ofhuman remains were selected for DNA analysis, exceptfor samples 84 and 121, which have only tooth samples.The archaeological information regarding the samplesused in this study is summarized in Additional File 1.

Contamination precautions and decontaminationPrevious studies have shown that the recovery ofauthentic ancient human DNA is possible [4,5] whenstrict precautions are taken to prevent contamination.The following is a summary of the measures taken toavoid contamination and to ensure authenticity in thepresent study.(1) Bone powdering, DNA extraction and amplifica-

tion were carried out in three separate rooms in ourlaboratory which is dedicated solely to ancient DNA stu-dies; all staff wore laboratory coats, facemasks andgloves and strict cleaning procedures [frequent treat-ment with bleach and ultraviolet (UV) light] wereapplied.(2) In order to prevent contamination, polymerase

chain reaction (PCR) tubes, tips, microcentrifuge tubesand drills were sterilized by autoclaving. Some of thereagents were exposed to UV light at 254 nm for atleast 30 min. Tip boxes were soaked in 10% sodiumhypochlorite solution. Extraction and amplificationblanks were included in every PCR assay in order todetect any potential contamination from sample proces-sing or reagents even though they were guaranteedDNA-free by the manufacturers.(3) Multiple extractions and amplifications from the

same individual were undertaken at different times andfrom two different parts of the skeleton by three differ-ent laboratory members.(4) Three samples were sent to Fudan University in

Shanghai, China, for an independent repetition.(5) Cloning analysis was performed with all the sam-

ples, in order to detect potential heterogeneity in theamplification products due to contamination, DNAdamage or jumping PCR.(6) Different length fragments were amplified. Since

there is an inverse correlation between fragment lengthand amplification efficiency for ancient DNA, contamina-tion from modern DNA could be identified by this assay.(7) Ancient DNA from animal remains (goat or cattle)

found at the same site was isolated and amplified usingthe same procedures as those used for the human ancientDNA, again providing a negative control for our study.(8) The sex of some of the morphologically intact

individuals was determined by amplifying the amelo-genin (AMG) gene and the results were compared to

that of the morphological examination in order to moni-tor any potential contamination in the extraction.(9) DNA samples from all laboratory excavators and

staff members involved in the project were geneticallytyped and recorded for comparison with the haplotypesof all ancient samples. This is critical in order to ensurethe accuracy of the generated ancient DNA results [6-9].The information for people involved in this project islisted in Table 1.

Sample preparation and DNA extractionThe bone and tooth samples were processed indepen-dently. A fragment of bone, about 3 cm long, was cutfrom the intact femur or tibia by sawing. In order toremove any possible surface contamination of the sam-ples by external DNA, each bone was drilled three timeswith three different drills to remove a layer about 1-3mm from the top after removing the external soil usingbrush, and then soaked in a 5% sodium hypochloritesolution for 10 min, rinsed with distilled water andabsolute alcohol successively and UV-irradiated (254nm) on all sides for at least 45 min in a clean room.The samples were then pulverized by Freezer Mill 6850

Table 1 Mitochondrial DNA haplotypes of all personsinvolved in processing Xiaohe samples.

Investigators Sex HVRI polymorphism site Appendix

Excavators

1 Male 16189 16223 16278

2 Male 16093 16124 16223 16311 16316

3 Male 16223 16294 16362

4 Male 16223 16260 16298 *

5 Male 16092 16111 16261

6 Male 16300 16362

7 Female 16111 16129 16266 16304 *

8 Male 16221

9 Male 16126 16294 16296 16304

10 Male 16085 16209 16311

11 Male 16356

12 Male 16136 16356

Laboratoryresearchers

1 Female 16136 16183 16189 16217 1621816239 16248

*

2 Female 16223 16245 16362 16367

3 Male 16183 16189 16223 16234 1629016362

4 Female 16126 16174 16223 16311 16362 *

5 Male 16112 16223 16362

6 Male 16213 16223 16298 16327

7 Male 16189 16304

In the laboratory, the numbers 1, 2, 3 and 4 represent the staff participatingin this study, 5, 6 and 7 represent the staff working in the laboratory but notdirectly concerned with this study. The *represents the primary researchers


Page 3 of 12

after immersion in liquid nitrogen. Intact teeth werehandled differently: they were soaked in a 5% sodiumhypochlorite solution for 15 min after a preliminarytreatment in which they were wiped with 10% sodiumhypochlorite and then rinsed with absolute alcohol.After that, all sides of the samples were exposed to UVradiation (254 nm) for a minimum of 20 min before thesample was ground to powder by Freezer Mill 6750.DNA was extracted by means of a silica-based protocol[10]. One extraction blank was included for every threeancient samples. In brief, 0.5-2 g tooth/bone powderwas incubated about 20 h at 50C in lysis solution (1mL 10% SDS, 4 ml EDTA (pH 8; 0.5 M, Promega, WI,USA), 100 uL of 10 mg/ml proteinase K (Merck, Darm-stadt, Germany). After centrifugation, the solution wassubsequently concentrated with centricons (Millipore,MA, USA) up to about 100 L volume, and then theextraction proceeded according to the handbook of theQIAquick DNA Purification Kit (Qiagen, Hilden,Germany).

DNA amplification, cloning, and sequencingThe nucleotide positions 16035-16409 of the mitochon-drial genome was amplified by two overlapping primerpairs. In addition, a number of coding-region mtDNApolymorphisms were typed, which are diagnostic formajor branches in the mtDNA tree: Haplogroups R(12705C), UK(12308G), HV(14766T), H(7028C), R1(4917G), R11(10031C) and C4(11969A) were identifiedby direct sequencing and haplogroups M(10400T), F(3970T) and C(14318C) were examined by using ampli-fied product-length polymorphisms method [11-13]. TheB haplogroup was identified based on 9-bp deletion innp8280. Some Y-chromosomal single nucleotide poly-morphisms (Y-SNPs) were typed, which are diagnosticfor major branches in the Y chromosome haplogrouptree [14,15]: Haplogroups F(M89T), K(M9G), P(M45A),R1(M173A), and R1a1a(M198A) were identified bydirect sequencing. The primers used in HVRI and diag-nostic SNP markers are shown in Table 2.PCR amplifications were performed in 20 L reactions

with 3 l of extract, 1 U Taq DNA polymerase (Fermen-tas, Ontario, Canada), and 1.5buffer (Fermentas), 1.5mg/ml BSA, 2.5 mM MgCl2, 0.2 mM dNTP (Promega,USA), and 400 pmol for each primer (Sangong, China).The cycle conditions used a Mastercycler gradient(Eppendorf, Germany) consisting of 40 cycles at 94Cfor 1 min, 59C -52C for 1 min, and 72C for 1 min,with a first denatured step of 94C for 5 min and a lastextended step of 72C for 10 min. PCR products werepurified with QIAamp quick DNA Purification Kit (Qia-gen) and sequenced with BigDye 3.1 in an ABI 310DNA sequencer (Applied Biosystems, CA, USA). ThePCR products were cloned with pGEM-T (Promega),

following the suppliers instructions. Extraction, amplifi-cation, cloning, and sequencing were undertakenin slightly varying conditions for different samples(Table 3).

Data analysisSequence alignments were performed using the Clus-talx1.8 software. Comparison of DNA sequence homol-ogy was performed with Blast from the National Centrefor Biotechnology Information. Median networks wereconstructed by Network 4.5 using a reduction thresholdand the different weights for SNPs loci but the sameweight for all HVSI polymorphism loci. No statisticalanalysis was performed in this study due to the smallsample size.

ResultsAuthenticity of resultsA total of 23 reproducible mtDNA fragments (360 bp)were obtained from 30 individual sets of the Xiaohehuman remains, after discarding seven samples due tofailed amplification or irreproducible results. Three ofthe 23 DNA fragments were similar to the DNA of twopeople involved in the study and were also removedfrom the study, even though they yielded consistentresults through three or more independent extractions.The remains of 20 individuals were selected for cloning

analysis. Eight to twelve clones from two independentamplifications of the 20 individuals were selected for auto-mated DNA sequencing. Although a few positions weredifferent from direct sequencing of the PCR products,which could be due to random Taq misincorporation orDNA damage, the consensus sequence from cloning wasconsistent (see Additional File 2). In order to validate theresults generated in our laboratory, human remains fromthree Xiaohe individuals (100, 119, and 127) were sent tothe ancient DNA laboratory of Fudan University forfurther analysis and identical results were obtained.The following facts further confirm the authenticity of

our results: (1) an inverse correlation between the sizeof the PCR amplicons and the amplification efficiencyfor the Xiaohe samples (209 bp > 235 bp > 399 bp) wasfound; (2) molecular sexual identification results were inaccordance with morphological sex assignments; (3)HVR-I sequences match well with the key coding regionSNPs according to the well-defined mtDNA phyloge-netic tree [16,17]; and (4) parallel studies were also per-formed on Xiaohe animal samples, and no human DNAwas detected. Collectively, 20 mtDNA fragments from30 human remains were obtained that were inferred tobe authentic (Table 3). The sequences have been sub-mitted to GenBank with accession numbers FJ719792-FJ719811. This high success rate suggests that the DNAfrom the Xiaohe human remains is well preserved, as


Page 4 of 12

would be expected in samples originated from dry envir-onmental conditions.

MtDNA haplogroup profile and distributionThe 20 mtDNA fragments containing eight differenthaplotypes that can be further assigned to five hap-logroups, which belong to subhaplogroups of macroha-plogroups M and N (Figure 2).The dominant haplogroup in the Xiaohe people was

the East Eurasian lineage C, shared by 14 Xiaohe indivi-duals who were associated with two different mtDNAhaplotypes (S1 and S2). According to the coding region11969 G to A, all lineage C found in the Xiaohe peoplewas further changed to subhaplogroup C4, which had

D-loop group-specific polymorphisms at nucleotidepositions (np) 16298 (T to C) and 16327 (C to T) [18].Interestingly, the haplotype S1 shared by these 10 of the14 Xiaohe individuals did not have the 16223T, a muta-tion had been found in the majority of modern lineageC populations. This haplotype was found merely inmodern Evenks and Udegeys of southeastern Siberia butthe frequency is low [18]. It is interesting to note thatour study found a mutation, unique to the Xiaohe peo-ple but rare among lineage C, 16309 G (see AdditionalFile 3). To the best of our knowledge, the lineage Cwith 16309 G was observed only in three people frommodern central Asia to date, who also possess anothertwo mutations in HVRI region [19].

Table 2 The primers used in this study.

Haplogroup/AMG Primer SNP Length

HVRI-AB L16017 5-TTCTCTGTTCTTTCATGGGGAH16251 5-GGAGTTGCAGTTGATGTGTGA

Sequencing 235 bp

HVRI-CD L16201 5-CAAGCAAGTACAGCAATCAACH16409 5-AGGATGGTGGTCAAGGGA

Sequencing 209 bp

M 10400T 5-taattaTACAAAAAGGATTAGACTGtgCT10400C 5-TACAAAAAGGATTAGACaGAACC10400R 5-GAAGTGAGATGGTAAATGCTAG

10400T 149 bp/142 bp

R L12604 5-ATCCCTGTAGCATTGTTCGH12754 5-GTTGGAATAGGTTGTTAGCG

12705C 151 bp

UK L12247 5-TAACAACATGGCTTTCTCAACTH12377 5-GAAGTCAGGGTTAGGGTGGT

12308G 132 bp

C L14318T 5-CCTTCATAAATTATTCAGCTTCCaACACTATL14318C 5-aaaaagctaCATAAATTATTCAGCTTCCTACtCTACH14318R 5-TTAGTGGGGTTAGCGATGGA

14318C 110 bp/115 bp

C4 L11845 5- AAGCCTCGCTAACCTCGCCH12120 5- GGGTGAGTGAGCCCCATTG

11969A 176 bp

B L8215 5 ACAGTTTCATGCCCATCGTC H8297 5 ATGCTAAGTTAGCTTTACAG

CoII/tRNAlys9-bp deletion

121 bp/112 bp

R1 L4812 5- GTCCCAGAGGTTACCCAAGH4975 5- CCACCTCAACTGCCTGCTA

4917G 164 bp

R11 L9920 5- CGCCTGATACTGGCATTTTGTH101075 -GTAGTAAGGCTAGGAGGGTGTTG

10031C 188 bp

HV L14668 5- CATCATTATTCTCGCACGGH14831 5- CGGAGATGTTGGATGGGGT

14766T 164 bp

F 3970T 5 taaaaTGTATTCGGCTATGAAGAtTAA3970C 5 GTGTATTCGGCTATGAAGtATAG3970R 5 AGTCTCAGGCTTCAACATCG

3970T 70 bp/66 bp

H L6966 5-GGCATTGTATTAGCAAACTCATH7118 5-TAGGGTGTAGCCTGAGAATAG

7028C 152 bp

AMG AMG1 5-CCTGGGCTCTGTAAAGAATAGAMG2 5-CAGAGCTTAAACTGGGAAGCTG

115 bp/121 bp

Paternal hg F Forward 5 CCACAGAAGGATGCTGCTCAReverse r 5 CACACTTTGGGTCCAGGATCAC

M89T 125 bp

Paternal hg K Forward 5 GGACCCTGAAATACAGAACReverse 5 AAGCGCTACCTTACTTACAT

M9G 128 bp

Paternal hg P Forward 5 GGGTGTGGACTTTACGAACReverse 5 AAATCCTACTATCTCCTGGC

M45A 129 bp

Paternal hg R1 Forward 5 TTACTGTAACTTCCTAGAAAATTGGReverse 5 ATCCTGAAAACAAAACACTGG

M173C 126 bp

Paternal hg R1a1a Forward 5 CTCTTTAAGCCATTCCAGTCAReverse 5 AAACATTACATGAGAAATTGCTG

M198A 113 bp


Page 5 of 12

Besides the East Eurasian lineage, two West EurasianmtDNA haplogroups H and K were found among theXiaohe people. H lineage is the most common mtDNAhaplogroup in West Eurasia [20], but haplogroup Hwith a 16260T was shared by only nine modern peoplein Genbank, including one Italian, one German, oneHungarian, one Portuguese, one Icelander and four Eng-lish people. Haplogroup K, a western Eurasian-specifichaplogroup, is mainly distributed in Europe, centralAsia, and Iran [20,21]. However, haplogroup K with16134T, found in the Xiaohe people, has not beenfound in modern people to our knowledge.Among the Xiaohe people, three sequences with the

unique HVRI motif 16189-16192-16311 formed a sub-cluster (Figure 2) and were not shared by modern peo-ple. They are identified as macrohaplogroup R throughsequencing the PCR amplicons at np10400 andnp12705 in the coding region. The np12308, np14766,np10031, np4917, np3970, and 9 bp deletion, whichare the diagnostic sites for the main subhaplogroups ofR, were further examined [15]. The results showedthat they are related neither to the West Eurasianhaplogroups UK, TJ, HV, R11 and R1, nor to the EastEurasian haplogroups B and F. So we designatedthem as haplogroup R* temporarily. Another sequencewith motif 16223-16304, shared by some people fromEast Asia, India, and Europe, was assigned tohaplogroup M*.

Y chromosome haplogroup profiling and distributionFifteen individuals AMG amplicons were obtained fromthe 20 Xiaohe individuals (whose mtDNA was success-fully amplified), among which seven individuals wereidentified as male and eight as female. The Y chromo-some haplogroup of the seven males were all assignedto haplogroup R1a1a through screening the Y-SNPs atM89, M9, M45, M173 and M198 successively. Hap-logroup R1a1a is widely distributed in Eurasia: it ismainly found in Eastern Europe, Central Asia, SouthAsia, Siberia, ancient Siberia, but rare in East Asia[22-24].

DiscussionThe Xiaohe cemetery is the oldest archeological sitewith human remains discovered in the Tarim Basin todate. Our genetic analyses revealed that the maternallineages of the Xiaohe people were originated fromboth the East and the West, whereas paternal lineagesdiscovered in the Xiaohe people all originated from theWest.The East Eurasian lineage C, which was widely dis-

tributed in modern Asian populations, was the domi-nant haplogroup in the remains recovered from thelowest layer of the Xiaohe cemetery. This lineage ismost frequently found in modern Siberian populations(Evenks, Yakut, Evens, Tuvinian, Buryat, Koryak andChukchi) and to a lesser extent in modern East Asian

Table 3 Analysis strategy of the samples.

Sample MtDNA-HVRI MtDNA Y chromosome Sexing Independent

No. haplotype haplogroup haplogroup Morphological Molecular repetition

100 298-327 C4 Female Female

102 298-327 C4 Female -

106 298-327 C4 R1a1a Male Male

107 223-298-309-327 C4 Female -

109 298-327 C4 Female -

110 298-327 C4 Female -

111 223-298-309-327 C4 R1a1a Male Male


117 223-304 M* Female Female

119 93-134-224-311-390 K Female Female

120 189-192-311 R* R1a1a Male Male

121 183-189-192-311 R* R1a1a Male Male

127 223-298-309-327 C4 Female Female

128 260 H Female Female

131 189-192-311-390 R* Female Female

132 298-327 C4 Female Female

135 223-298-309-327 C4 Female Female


138 298-327 C4 - Female -


Note: means we performed this kind of strategy to the sample; - indicates that the targeted DNA fragment could not be amplified for a given sample.


Page 6 of 12

(Mongolian, Daur and Korean) and Central Asianpopulations [25-29] (Figure 3). It was also found in theancient Qinghai (4000BP) of China [30] and ancientSouth Siberian populations [31,32]. In order to tracethe original wellspring of lineage C in the Xiaohepopulation, a phylogenetic tree was constructed using14 ancient Xiaohe samples and 522 modern hap-logroup C samples from surrounding areas of theXiaohe cemetery, including Siberian, Mongolian, Cen-tral Asian, northern Chinese and northern minoritiesof East Asia (see Additional File 3). The phylogeneticnetwork displays a star-like distribution within theSouth Siberian population, which has an ancestral hap-lotype motif 16223-16298-16327. The ancestral haplo-type was found mainly in South Siberian whosediversity of haplotypes C is very high (Figure 4).Therefore, the original source of haplogroup C wasinferred to South Siberian. It is important to note thatthe C haplotypes of the Xiaohe people had only a sin-gle mutation compared with the ancestral haplotype.The shared sequences of the Xiaohe C haplotype (S1)

were distributed in southeastern Siberia. It implies thatthe east Eurasian component in the Xiaohe people ori-ginated from the Siberian populations, especially thesouthern or eastern Siberian populations.The mtDNA haplogroup H is the most common

mtDNA haplogroup in Europe, especially in northwes-tern Europe, and its frequency can be as high as 65% inIberia. Frequencies gradually decrease from the north-west to the southeast of Europe. By contrast, the fre-quency of haplogroup H rises to only 20% in the NearEast, and to less than10% in Central Asia, and is verylow in East Asia [33,34]. All of the shared sequences ofthe Xiaohe H haplotype, however, were distributed inWestern Europe. Haplogroup K is also common in Eur-ope, particularly around the Alps and the British Isles. Itis found with less frequency in North Africa, the MiddleEast, and South Asia [21,35-37]. Considering the pre-sence of haplogroups H and K in the Xiaohe people andthe geographical distribution of shared sequences, weconclude that the west Eurasian component observed inthe Xiaohe people originated from western European,

Figure 2 Reduced median network of Xiaohe sequences. Node size is proportional to frequencies. HVR1 positions are numbered relative toCambridge reference sequence (CRS). Single nucleotide polymorphism diagnostic positions are in black italics; green represents East Eurasianlineage C, containing 14 individuals. Xiaohe R* is the cluster under the macrohaplogroup R.


Page 7 of 12

Figure 3 Map of Eurasia, showing the approximate distribution of haplogroup C. Black sections reflect the frequency of haplogroup Cdata taken from references listed in Additional File 3.

Figure 4 Phylogenetic tree of haplogroup C, based on HVS-I sequences in the region 16050-16391. For references for the mitochondrialDNA sequences in this study see Additional File 3; the length difference mutations were excluded from this analysis.


Page 8 of 12

and maternal ancestry of the Xiaohe people might haveclose relationship with western European.Regarding the Y chromosomal DNA analyses, the

seven males identified all belonged to haplogroupR1a1a. It is most frequently found in Eastern Europe,South Asia and Siberia. In contrast, it is relativelyuncommon in Middle Easterners and rare in East Asian[22-24]. It is thought to be a trace of the migrationevents of early Indo-European [38,39]. The presence ofhaplogroup R1a1a in the ancient Xiaohe people impliesthat the parental ancestry of the Xiaohe people origi-nated from somewhere in Siberia or Europe, which isconsistent with the origin of maternal ancestry.It is generally agreed that the origin of modern

populations in Xinjiang and Central Asia is the resultof the admixture of people from the West and the East[19,25,40]. When and where this admixture firstoccurred has long been of interest to geneticists andarchaeologists [41-44]. The year 132 BC is often con-sidered to be the beginning of contact between the

East and the West along the Great Silk Road, since theChinese explorer Zhang Qian went westward into Cen-tral Asia at that time. However, Mair has suggestedthat the date should be even earlier, based on the factthat silk appeared in Europe at 1000 BC [1]. In thisstudy, the East and West Eurasian lineages are seen tocoexist in the Xiaohe people, implying that the Easthad contacted the West during the early Bronze Age.It is noteworthy that the maternal lineage of five maleindividuals (106, 111, 115, 136 and 139) originatedfrom East Eurasian, whereas their paternal lineage ori-ginated from the West Eurasian, implying that theXiaohe population had been an admixture of peoplefrom both the West and the East. Given the uniquegenetic haplotypes and the particular archaeologicalculture, the time of this admixture could be much ear-lier than the time at which the Xiaohe people were liv-ing at the site. This means that the time of theirmingling was at least a 1000 years earlier than pre-viously proposed.

Figure 5 Map of Eurasia, showing ancient populations from the Tarim Basin and surroundings. Number 1 represents Xiaohe cemetery,data from this study; number 2 represents Xinjing Hami cemetery, data not published; Number 3 represents ancient Xiongnu, data fromreference 46; Numbers 4 and 5 represent ancient South Siberian people, data from reference 38, Numbers 6 and 7 represent ancient CentralAsians, data from reference 41; Numbers 8 and 9 represent ancient Lake Baikal people, data from reference 45. The red colour represents thatthe data was generated from samples from about Bronze Age and/or the prehistory era, while blue represents that the data was generated fromsamples from Iron Age.


Page 9 of 12

However, the mtDNA haplogroups H, K and C all arevery ancient lineages, over 10,000 years old in vast northEurasia, whereas the civilization of the Tarim Basin,according to the archaeological materials, arose verylate. The admixture therefore probably occurred else-where, before immigration into the Tarim Basin. TheXiaohe people might well have been an admixture at thetime of their arrival. Where did the initial admixtureoccur?The admixture from people of the West and the East

was also found in ancient Central Asia, Siberia, andMongolia [16,38,45,46]. The extent of the admixturevaried in different regions and at different periods (Fig-ure 5). Central Asia has always been the crossroads ofcontact between the West and the East. Lalueza-Fox etal. proved that Eastern lineages coexisted with Westernlineages in Central Asia after 700 BC [41], whereas theWest had met the East in south Siberia in the BronzeAge [38], and even earlier at Lake Baikal [45]. Xinjiangand the surrounding areas, especially south Siberia,were places at which the contact between western andeastern populations occurred earlier than in CentralAsia. Given the fact that the mtDNA haplogroup C wasdistributed mainly in south Siberia, and that hap-logroups H, K and R1a1a already had spread eastwardinto south Siberia during the Bronze Age, it is possiblethat the initial admixture occurred somewhere in south-ern Siberia. Considering that the cultural characteristicsof the Xiaohe cemetery are similar to those of theAndronovo or Afanasevo culture that appearedthroughout the southern Russian steppe, Kazakhstan,and western Central Asia during the second millenniumBC [1,46], the admixed population might have had rela-tionship with populations settled South Siberia duringthe Bronze Age.

ConclusionsOur results demonstrated that the Xiaohe people wasan admixture from populations originating from boththe West and the East, implying that the Tarim Basinhad been occupied by an admixed population since theearly Bronze Age. Considering the unique genetic hap-lotypes and particular archaeological culture, theadmixed population might have had relationship withpopulations settled South Siberia during the BronzeAge. To our knowledge, this is the earliest genetic evi-dence of an admixed population settled in the TarimBasin.

Additional file 1: Table S1. Archaeological information for 30 Xiaoheindividuals.Click here for file[ http://www.biomedcentral.com/content/supplementary/1741-7007-8-15-S1.DOC ]

Additional file 2: Figure A1. The results of clone sequencing.Click here for file[ http://www.biomedcentral.com/content/supplementary/1741-7007-8-15-S2.PDF ]

Additional file 3: Table S2. Estimated frequencies of mitochondrial DNAhaplogroup C in modern populations.Click here for file[ http://www.biomedcentral.com/content/supplementary/1741-7007-8-15-S3.DOC ]

AbbreviationsPCR: polymerase chain reaction; mtDNA: mitochondrial DNA: SNP: singlenucleotide polymorphism; CRS: Cambridge reference sequence.

AcknowledgementsThis work was supported by the National Natural Science Foundation ofChina, grant Nos: 30871349 and J0530184. We thank Xinjiang Cultural Relicsand the Archaeology Institute, for providing the human remains and theSchool of Life Sciences, Fudan University, for the independent replication.Our special thanks go to Professor Yubin Ge for reading and commentingon the manuscript.

Author details1Ancient DNA Laboratory, Research Center for Chinese Frontier Archaeology,Jilin University, Changchun 130012, PR China. 2College of Life Science, JilinUniversity, Changchun 130023, PR China. 3Xinjiang Cultural Relics andArchaeology Institute, rmchi 830000, PR China. 4Department of East AsianLanguages and Civilizations, University of Pennsylvania, Philadelphia, PA19104, USA. 5Key Laboratory of Genetic Engineering and Center forAnthropological Studies, School of Life Sciences, Fudan University, Shanghai200433, PR China.

Authors contributionsCXL and HJL contributed equally to this work, they performed the moleculargenetic studies and data analysis and wrote the manuscript. YQC and VHMhelped to draft the manuscript. CZX and DWC participated in performingexperiments. WYL and IA provided materials and background documents.QCZ participated in the statistical analysis. ZX and LJ provided independentreplication. HZ participated in conceiving and designing the study. HZdesigned the study and wrote the manuscript. All authors read andapproved the final manuscript.

Received: 21 September 2009Accepted: 17 February 2010 Published: 17 February 2010

References1. Mair VH: Prehistoric Caucasoid corpses of the Tarim Basin. J Indo Eur Stud

1995, 23:281-307.2. Hemphill BE, Mallory JP: Horse-mounted invaders from the Russo-Kazakh

steppe or agricultural colonists from western Central Asia? Acraniometric investigation of the Bronze Age settlement of Xinjiang. AmJ Phys Anthropol 2004, 124:199-222.

3. Mair VH: The rediscovery and complete excavation of rdeks Necropolis.Jf Indo-European Stud 2006, 34(3-4):273-318.

4. Cooper A, Poinar HN: Ancient DNA: do it right or not at all. Science 2000,289:1139.

5. Haak W, Forster P, Bramanti B, Matsumura S, Brandt G, Tnzer M, Villems R,Renfrew C, Gronenborn D, Alt KW, Burger J: Ancient DNA from the firstEuropean farmers in 7500-Year-Old Neolithic Sites. Science 2005,310:1016-1018.

6. Pbo S, Poinar H, Serre D, Jaenicke-Despres V, Hebler J, Rohland N,Kuch M, Krause J, Vigilant L, Hofreiter M: Genetic analyses from ancientDNA. Annu Rev Genet 2004, 38:645-679.

7. Willerslev E, Cooper A: Ancient DNA. Proc R Soc B 2005, 272:3-16.8. Sampietro ML, Gilbert MT, Lao O, Caramelli D, Lari M, Bertranpetit J,

Lalueza-Fox C: Tracking down human contamination in ancient humanteeth. Mol Biol Evol 2006, 23:1801-1807.


Page 10 of 12

9. Xie CZ, Li CX, Cui YQ, Zhang QC, Fu YQ, Zhu H, Zhou H: Evidence ofancient DNA reveals the first European lineage in Iron Age centralChina. Proc Biol Sci 2007, 274:1597-1602.

10. Yang DY, Eng B, Waye JS, Dudar JC, Saunders SR: Improved DNAextraction from ancient bones using silica-based spin columns. Am JPhys Anthropol 1998, 105:539-543.

11. Shinoda K, Adachi N, Guillen S, Shimada I: Mitochondrial DNA analysis ofancient Peruvian highlanders. Am J Phys Anthropol 2006, 131(1):98-107.

12. Van Oven M, Kayer M: Updated compnenensive phylogenetic tree ofglobal human mitochontrial DNA Variation. Hum Mutat 2009, 30(2):E386-E394.

13. Malyarchuk B, Grzybowski T, Derenko M, Perkova M, Vanecek T, Lazur J,Gomolcak P, Tsybovsky I: Mitochondrial DNA phylogeny in Eastern andWestern Slavs. Mol Biol Evol 2008, 25(8):1651-1658.

14. Underhill PA, Myres NM, Rootsi S, Metspalu M, Zhivotovsky LA, King RJ,Lin AA, Chow CE, Semino O, Battaglia V, Kutuev I, Jrve M, Chaubey G,Ayub Q, Mohyuddin A, Mehdi SQ, Sengupta S, Rogaev EI,Khusnutdinova EK, Pshenichnov A, Balanovsky O, Balanovska E, Jeran N,Augustin DH, Baldovic M, Herrera RJ, Thangaraj K, Singh V, Singh L,Majumder P, Rudan P, Primorac D, Villems R, Kivisild T: Separating thepost-Glacial coancestry of European and Asian Y chromosomes withinhaplogroup R1a. Eur J Hum Genet 2009, doi:10.1038..

15. Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL,Hammer MF: New binary polymorphisms reshape and increaseresolution of the human Y-chromosomal haplogroup tree. Genome Res2008, 18(5):830-838.

16. Macaulay V, Richards M, Hickey E, Vega E, Cruciani F, Guida V, Scozzari R,Bonn-Tamir B, Sykes B, Torroni A: The emerging tree of West EurasianmtDNAs: a synthesis of control-region sequences and RFLPs. Am J HumGenet 1999, 64:232-249.

17. Kivisild T, Tolk HV, Parik J, Wang Y, Papiha SS, Bandelt HJ, Villems R: Theemerging limbs and twigs of the East Asian mtDNA tree. Mol Biol Evol2002, 19:1737-1751.

18. Torroni A, Schurr TG, Cabell MF, Brown MD, Neel JV, Larsen M, Smith DG,Vullo CM, Wallace DC: Asian affinities and continental radiation of thefour founding Native American mtDNAs. Am J Hum Genet 1993,53:563-590.

19. Comas D, Calafell F, Mateu E, Prez-Lezaun A, Bosch E, Martnez-Arias R,Clarimon J, Facchini F, Fiori G, Luiselli D, Pettener D, Bertranpetit J:Trading genes along the Silk Road: mitochondrial DNA sequences andthe origin of Central Asian populations. Am J Hum Genet 1998,63:1824-1838.

20. Torroni A, Richards M, Macaulay V, Forster P, Villems R, Norby S,Savontaus ML, Huoponen K, Scozzari R, Bandelt HJ: MtDNA haplogroupsand frequency patterns in Europe. Am J Hum Genet 2000, 66:1173-1177.

21. Kivisild T, Bamshad MJ, Kaldma K, Metspalu M, Metspalu E, Reidla M, Laos S,Parik J, Watkins WS, Dixon ME, Papiha SS, Mastana SS, Mir MR, Ferak V,Villems R: Deep common ancestry of Indian and western-Eurasianmitochondrial DNA lineages. Curr Biol 1999, 9:1331-1334.

22. Comas D, Plaza S, Wells RS, Yuldusheva N, Lao O, Calafell F, Bertranpetit J:Admixture, migrations, and dispersals in Central Asia: evidence frommaternal DNA lineages. Eur J Hum Genet 2004, 12(6):495-504.

23. Koryakova LN, Epimakhov AV: The Urals and Western Siberia in theBronze and Iron Ages. Cambridge: Cambridge University Press 2007.

24. Balanovsky O, Rootsi S, Pshenichnov A, Kivisild T, Churnosov M, Evseeva I,Pocheshkhova E, Boldyreva M, Yankovsky N, Balanovska E, Villems R: TwoSources of the Russian Patrilineal Heritage in Their Eurasian Context. AmJ Hum Genet 2008, 82(1):236-250.

25. Sharma S, Rai E, Sharma P, Jena M, Singh S, Darvishi K, Bhat AK,Bhanwer AJ, Tiwari PK, Bamezai RN: The Indian origin of paternalhaplogroup R1a1(*) substantiates the autochthonous origin of Brahminsand the caste system. J Hum Genet 2009, 54(1):47-55.

26. Torroni A, Sukernik RI, Schurr TG, Starikorskaya YB, Cabell MF, Crawford MH,Comuzzie AG, Wallace DC: mtDNA variation of aboriginal Siberiansreveals distinct genetic affinities with Native Americans. Am J Hum Genet1993, 53:591-608.

27. Starikovskaya EB, Sukernik RI, Derbeneva OA, Volodko NV, Ruiz-Pesini E,Torroni A, Brown MD, Lott MT, Hosseini SH, Huoponen K, Wallace DC:Mitochondrial DNA diversity in indigenous populations of the southernextent of Siberia, and the origins of Native American haplogroups. AnnHum Genet 2005, 69:67-89.

28. Kolman CJ, Sambuughin N, Bermingham E: Mitochondrial DNA analysis ofMongolian populations and implications for the origin of New Worldfounders. Genetics 1996, 142(4):1321-1334.

29. Kong Q-P, Yao Y-G, Liu M, Shen S-P, Chen C, Zhu C-L, Palanichamy MG,Zhang Y-P: Mitochondrial DNA sequence polymorphisms of fiveethnic populations from northern China. Hum Genet 2003,113:391-405.

30. Gao SZ, Yang YD, Xu Y, Zhang QC, Zhu H, Zhou H: Tracing the genetichistory of the Chinese people: Mitochondrial DNA analysis of aneolithic population from the Lajia site. Am J Phys Anthropol 2007,133:1128-1136.

31. Ricaut FX, Fedoseeva A, Keyser-Tracqui C, Crubzy E, Ludes B: Ancient DNAanalysis of human neolithic remains found in northeastern Siberia. Am JPhys Anthropol 2005, 126:458-462.

32. Schurr TG: Molecular genetic diversity of Siberian populations:Implications for ancient DNA studies of archeological populations fromthe Cis-Baikal region. Prehistoric Foragers of the Cis-Baikal, Siberia:Proceedings from the First Conference of the Baikal Archaeology ProjectCanadian Circumpolar Institute: EdmontonMcKenzie H, Weber A 2003,153-186.

33. Achilli A, Rengo C, Magri C, Battaglia V, Olivieri A, Scozzari R, Cruciani F,Zeviani M, Briem E, Carelli V, Moral P, Dugoujon JM, Roostalu U,Loogvli EL, Kivisild T, Bandelt HJ, Richards M, Villems R, Santachiara-Benerecetti AS, Semino O, Torroni A: The molecular dissection of mtDNAhaplogroup H confirms that the Franco-Cantabrian glacial refuge was amajor source for the European gene pool. Am J Hum Genet 2004,75(5):910-918.

34. Simoni L, Calafell F, Pettener D, Bertranpetit J, Barbujani G: Geographicpatterns of mtDNA diversity in Europe. Am J Hum Genet 2000, 66:262-278.

35. Richards M, Macaulay V, Hickey E, Vega E, Sykes B, Guida V, Rengo C,Sellitto D, Cruciani F, Kivisild T, Villems R, Thomas M, Rychkov S, Rychkov O,Rychkov Y, Glge M, Dimitrov D, Hill E, Bradley D, Romano V, Cal F, Vona G,Demaine A, Papiha S, Triantaphyllidis C, Stefanescu G, Hatina J, Belledi M, DiRienzo A, Novelletto A, Oppenheim A, Nrby S, Al-Zaheri N, Santachiara-Benerecetti S, Scozari R, Torroni A, Bandelt HJ: Tracing European founderlineages in the Near Eastern mtDNA pool. Am J Hum Genet 2000,67(5):1251-1276.

36. Picornell A, Gimnez P, Castro JA, Ramon MM: Mitochondrial DNAsequence variation in Jewish populations. Int J Legal Med 2006,120(5):271-281.

37. Behar DM, Metspalu E, Kivisild T, Achilli A, Hadid Y, Tzur S, Pereira L,Amorim A, Quintana-Murci L, Majamaa K, Herrnstadt C, Howell N,Balanovsky O, Kutuev I, Pshenichnov A, Gurwitz D, Bonne-Tamir B,Torroni A, Villems R, Skorecki K: The matrilineal ancestry of AshkenaziJewry: portrait of a recent founder event. Am J Hum Genet 2006,78(3):487-497.

38. Keyser C, Bouakaze C, Crubzy E, Nikolaev VG, Montagnon D, Reis T,Ludes B: Ancient DNA provides new insights into the history of southSiberian Kurgan people. Hum Genet 2009, 126(3):395-410.

39. Semino O, Passarino G, Oefner PJ, Lin AA, Arbuzova S, Beckman LE, DeBenedictis G, Francalacci P, Kouvatsi A, Limborska S, Marcikiae M, Mika A,Mika B, Primorac D, Santachiara-Benerecetti AS, Cavalli-Sforza LL,Underhill PA: The genetic legacy of Paleolithic Homo sapiens sapiens inextant Europeans: a Y chromosome perspective. Science 2000,290:1155-1159.

40. Yao YG, Kong QP, Wang CY, Zhu CL, Zhang YP: Different matrilinealcontributions to genetic structure of ethnic groups in the silk roadregion in China. Mol Biol Evol 2004, 21(12):2265-2280.

41. Lalueza-Fox C, Sampietro ML, Gilbert MT, Castri L, Facchini F, Pettener D,Bertranpetit J: Unravelling migrations in the steppe: mitochondrial DNAsequences from ancient Central Asians. Proc Biol Sci 2004, 271:941-947.

42. Mair VH: Genes, geography, and glottochronology: the Tarim Basinduring late prehistory and history. The Journal of Indo-European StudiesMonograph Series. No. 50 Washington DC: Institute for the Study of Man2005, 1-47.

43. Francalacci P: DNA analysis of ancient desiccated corpses from Xinjiang. JIndo Eur Stud 1995, 23:385-398.

44. Francalacci P: DNA analysis on ancient desiccated corpses from Xinjiang(China): further results. The Bronze Age and Early Iron Age Peoples of EasternCentral Asia Washington, DC: Institute for the Study of ManMair VH 1998,537-547.


Page 11 of 12

45. Mooder KP, Schurr TG, Bamforth FJ, Bazaliiski VI, Savelev NA: Populationaffinities of neolithic Siberians: a snapshot from prehistoric Lake Baikal.Am J Phys Anthropol 2006, 129:349-361.

46. Keyser-Tracqui C, Crubzy E, Ludes B: Nuclear and mitochondrial DNAanalysis of a 2,000-year-old necropolis in the Egyin Gol Valley ofMongolia. Am J Hum Genet 2003, 73(2):247-260.

doi:10.1186/1741-7007-8-15Cite this article as: Li et al.: Evidence that a West-East admixedpopulation lived in the Tarim Basin as early as the early Bronze Age.BMC Biology 2010 8:15.

Submit your next manuscript to BioMed Centraland take full advantage of:

Convenient online submission

Thorough peer review

No space constraints or color figure charges

Immediate publication on acceptance

Inclusion in PubMed, CAS, Scopus and Google Scholar

Research which is freely available for redistribution

Submit your manuscript at www.biomedcentral.com/submit


Page 12 of 12

AbstractBackgroundResultsConclusion

BackgroundMethodsSamplingContamination precautions and decontaminationSample preparation and DNA extractionDNA amplification, cloning, and sequencingData analysis

ResultsAuthenticity of resultsMtDNA haplogroup profile and distributionY chromosome haplogroup profiling and distribution

DiscussionConclusionsAcknowledgementsAuthor detailsAuthors' contributionsReferences

the tarim basin

Documents