the of biological chemistry no. by printed u. s.a. ha-ras ... · mutant ha-ras message; this time...

THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1992 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 267, No. 28, Issue of October 5, pp. 19954-19962,1992 Printed in U. S.A.

Selective Inhibition of Mutant Ha-ras mRNA Expression by Antisense Oligonucleotides*

(Received for publication, April 15, 1992)

Brett P. MoniaS$, Joseph F. Johnston$, David J. Eckers, Mary Ann Zounesn, Walt F. Lima& and Susan M. FreierQ From the 6DeDartment of Molecular and Cellular Biolozv and the YDepartment of Medicinal Chemistry, ISIS Pharmaceuticals, Carlsbad, kal$ornia 92008

Y“

A biological reporter gene assay was employed to determine the crucial parameters for maximizing selective targeting of a Ha-ras codon 12 point mutation (G + T) using phosphorothioate antisense oligonucleotides. We have tested a series of oligonucleotides ranging in length between 5 and 25 bases, each centered around the codon 12 point mutation. Our results indicate that selective targeting of this point mutation can be achieved with phosphorothioate antisense oligonucleotides, but this selectivity is critically dependent upon oligonucleotide length and concentration. The maximum selectivity observed in antisense experiments, &fold for a 17-base oligonucleotide, was closely predicted by a simple thermodynamic model that relates the fraction of mutant to wild type target bound as a function of oligonucleotide concentration and affinity. These results suggest thermodynamic analysis of oligonucleotide/target interactions is useful in predicting the specificity that can be achieved by an antisense oligonucleotide targeted to a single base point mutation.

Antisense oligonucleotides hold great promise as chemo- therapeutics for the treatment of a variety of diseases (reviewed in Refs. 1-6). These compounds, which target RNA, have many advantages over more traditional protein-targeted drugs. One advantage is the ease by which drugs can be rationally designed. If a disease is known to be caused by inappropriate production or abnormal function of a specific protein, antisense oligonucleotides can be designed and tested simply on the basis of the sequence of the gene encoding that protein. A second, and possibly greater advantage is the specificity by which they act on their target receptor. A drug is specific if it has a strong binding affinity for its receptors relative to other sites. Traditional drugs typically have certain limitations because of their relative lack of specificity. Anti- sense oligonucleotides have the potential to be many orders of magnitude more specific than traditional drugs. This is mainly due to the many points of interaction between an antisense oligonucleotide and its mRNA receptor when bound. Since specificity is dependent upon the number of interactions between a drug and its receptor, specificity of an antisense oligonucleotide is expected to depend on its length. Predictions for the minimum length of an oligonucleotide to

* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. + To whom correspondence should be addressed ISIS Pharmaceu- ticals, 2280 Faraday Ave., Carlsbad, CA 92008. Tel.: 619-931-9200.

achieve specific recognition of a single eukaryotic mRNA sequence have previously been reported (7).

Typically, when we refer to antisense specificity, we are describing the fraction of oligonucleotide bound to its target message relative to the fraction bound to unrelated messages and nonnucleic acid targets. However, it is sometimes neces- sary to selectively target a message in a population of both unrelated and highly related messages. Examples of this include the treatment of certain autosomal dominant genetic diseases and oncogene-mediated cancers that may result as a consequence of single base point mutations in the coding regions of genes (8-14). In these cases, inhibiting expression of the disease-causing, mutation-carrying gene is desired with- out affecting expression of the normal gene, which is generally believed to be essential for cell survival. In theory, selective mRNA targeting of this nature could be achieved through the use of properly designed antisense oligonucleotides.

Mutations in ras genes have been found in a large percent- age of human tumors (reviewed in Refs. 15-18). Mammalian ras genes acquire transformation-inducing properties by single base point mutations within their coding sequences (19). Although the biochemical mode of action and the biological target molecules of ras proteins are unknown, they have been shown to bind GTP and GDP, contain intrinsic GTPase activity, and are thought to play a central role in the regulation of signal transduction processes that are important for the control of cell proliferation (reviewed in Refs. 20-22).

Naturally occurring mutations in ras oncogenes associated with human neoplasms have been localized to codons 12, 13, 61, 117, and 146 (15-19). One of these mutations involves a change from GGC to GTC in codon 12 of the Ha-ras oncogene, resulting in a glycine to valine substitution in the GTPase regulatory domain of the Ha-ras protein product (8, 23-27). This single amino acid change is thought to abrogate normal control of ras protein function, thereby converting a normally regulated cell protein to one that is constitutively active (20- 22, 24-27). It is believed that such deregulation of normal ras protein function is responsible for the transforming activity of the mutated oncogene product.

There have been several reports in which antisense oligonucleotides have been employed to inhibit expression of ras genes (28-35). In most of these studies, employed oligonucleotides were designed to target regions of the ras message not typically associated with activating point mutations (28-30, 32, 35). Therefore, these oligonucleotides would not be expected to confer selective inhibition of mutant ras expression relative to normal ras. Two recent reports, however, have demonstrated selective targeting of mutant ras messages using chemically modified oligonucleotides (33, 34). Helene and co- workers (33) have demonstrated selective inhibition of activated (codon 12 G + T transition) Ha-ras mRNA expression

19954

Inhibition of Ha-ras Expression 19955

using a 9-mer phosphodiester linked to an acridine intercalating agent and/or a hydrophobic tail. This compound displayed selective targeting of mutant ras message in both RNase H and cell proliferation assays at low micromolar concentrations. A second set of studies by Chang and co- workers (34) has also demonstrated selective targeting of mutant Ha-ras message; this time the target was Ha-ras codon 61 containing a A -+ T transversion and the oligonucleotide that was employed was either an 11-mer methylphosphonate or its psoralen derivative. These compounds, which required very high concentrations for activity (7.5-150 pM) , were shown to selectively inhibit mutant Ha-ras p21 expression relative to normal p21 using immunoprecipitation procedures.

Here, we describe studies in which phosphorothioate oligonucleotides of varying length were employed to selectively target mutant Ha-ras sequences containing a G-T transition at codon 12. We have taken a thermodynamic approach coupled with a biological assay to determine the parameters that are crucial for maximizing selective targeting of this point mutation. Our results indicate selective targeting of the ras codon 12 point mutation can be achieved for a phosphorothioate, but this selectivity is critically dependent upon oligonucleotide length and concentration. Furthermore, our findings suggest that thermodynamic analysis of oligonucleotide/target interactions is useful in predicting the selectivity that can be achieved by an antisense oligonucleotide targeted to a single base point mutation.

MATERIALS AND METHODS

Oligonucleotide Synthesis-Phosphorothioate and phosphodiester oligodeoxynucleotides were synthesized using an Applied Biosystems 380B automated DNA synthesizer as previously described (36). Oli- goribonucleotides were synthesized using the automated synthesizer and 5’-dimethoxytrityl 2’-tert-butyldimethylsilyl 3’-O-phosphoram- idites (American Bionetics, Hayward, CA) (37). The protecting group on the exocyclic amines of A, C, and G was phenoxyacetyl (38). The standard synthesis cycle was modified by increasing the wait step after the pulse delivery of tetrazole to 900 s. Oligonucleotides were deprotected by overnight incubation at room temperature in metha- nolic ammonia. After drying in uacuo, the 2’-silyl group was removed by overnight incubation a t room temperature in 1 M tetrabutylam- monium fluoride (Aldrich) in tetrahydrofuran. Oligonucleotides were purified using a C-18 Sep-Pak cartridge (Waters; Milford, MA) (39) followed by ethanol precipitation. Analytical denaturing polyacryl- amide electrophoresis demonstrated the RNA oligonucleotides were greater than 90% full length material.

ras-luci/erase Reporter Gene Assembly-The plasmids pT24-C3, containing the c-Ha-rasl-activated oncogene (codon 12, G G b GTC), and pbc-N1, containing the c-Ha-ras proto-oncogene, were obtained from the American Type Culture Collection. The plasmid pT3/T7 luc, containing the 1.9-kb‘ firefly luciferase gene, was obtained from Clontech Laboratories (Palo Alto, CA). PCR technology was employed for the construction of ras-luciferase fusion genes encoding firefly luciferase fused on its 5’-side to Ha-ras genomic sequences under regulation of the glucocorticoid-responsive mouse mammary tumor virus (MMTV) promoter (40). 5”sequences of exon 1, including nucleotides -53 (relative to the translation initiation site) to +65, of normal and activated Ha-ras genomic clones were PCR-amplified using the primers 5’-ACA-TTA-TGC-TAG-CTT-

(sense) and 5‘-GAG-ATC-TGA-AGC-TTC-TGG-ATG-GTC-AGC- GCA-CT (antisense). In order to facilitate subcloning procedures,

these primers (sense, NheI; antisense, HindIII). The 155-bp DNA restriction endonuclease sites were engineered into the 5”regions of

PCR product containing Ha-ras 5”sequences (22) was gel-purified, digested with NheI and HindIII endonucleases, and gel-purified once again prior to cloning. T o obtain firefly luciferase coding sequences (41,42), the 1.9-kb coding region of the luciferase gene was amplified

TTT-GAG-TAA-ACT-TGT-GGG-GCA-GGA-GAC-CCT-GT

The abbreviations used are: kb, kilobase(s); T,, melting temperature for nucleic acid hybridization; PCR, polymerase chain reaction; MMTV, mouse mammary tumor virus promoter; bp, base pair(s).

by PCR using the primers 5’-GAG-ATC-TGA-AGC-TTG-AAG- ACG-CCA-AAA-ACA-TAA-AG (sense) and 5’-ACG-CAT-CTG- GCG-CGC-CGA-TAC-CGT-CGA-CCT-CGA (antisense). The sense PCR primer was designed so that initiation of polymerization would begin at the second codon of luciferase (Glu) thereby eliminating the natural luciferase translation initiation codon from the PCR product. Furthermore, each of the primers was designed with a unique restriction endonuclease site in its 5”sequence in order to facilitate cloning (sense, HindIII; antisense, BssHII). The 1.9-kb DNA PCR product containing the coding region of the firefly luciferase gene was gel- purified, digested with HindIII and BssHII, and gel-purified once again prior to cloning. The ras-luciferase fusion expression vectors were completed by three-part ligations in which the Ha-ras PCR product was ligated to the luciferase PCR product at HindIII and cloned into the pMMTVpap expression vector (43) with the restriction enzymes NheI and BssHII. The resultant plasmid constructions contain sequences encoding amino acids 1-22 of activated (RA2) or normal (RA4) Ha-ras proteins fused in-frame with sequences coding for firefly luciferase. The two coding domains are separated by an HindIII site, which itself is predicted to code for two amino acids at the site of fusion (Lys and Leu). The DNA sequence and corresponding amino acid sequence of the fusion gene at the HindIII ligation site is shown as follows.

acc-atc-cag-aag-ctt-gaa-gac Thr-Ile-Gln-Lys-Leu-Glu-Asp

Expression of this fusion gene is under regulation of the glucocorticoid-responsive MMTV promoter, and translation initiation of the ras-luciferase fusion mRNA is dependent upon the natural Ha-ras AUG codon. Both mutant and normal Ha-ras luciferase fusion constructions were confirmed by DNA sequence analysis using standard procedures.

Melting Curves-Absorbance versus temperature curves were measured a t 260 nm using a Gilford 260 spectrophotometer interfaced to an IBM PC computer and a Gilford Response I1 spectrophotometer. The buffer contained 100 mM Na+, 10 mM phosphate, and 0.1 mM EDTA, pH 7. Oligonucleotide concentration was 4 p ~ ; and each strand was determined from the absorbance a t 85 “C, and extinction coefficients were calculated according to Puglisi and Tinoco (44). T,, values, free energies of duplex formation, and association constants were obtained from fits of data to a two-state model with linear sloping baselines (45). Reported parameters are averages of at least three experiments. For some oligonucleotides, free energies of duplex formation were also obtained from plots of T,,” us. logln (concentration) (46).

DNA Transfections-HeLa cells were maintained as monolayers on 6-well plates in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum and 100 units/ml penicillin. Transient DNA transfections were performed by the calcium phosphate-precipitation technique (47) with 12 pg of total DNA per plate (2 pglwell), including 11 pg of ras-luciferase reporter DNA and 1 pg REP-6, a plasmid that expresses the rat glucocorticoid receptor under control of the Rouse sarcoma virus long terminal repeat (48). Cells were treated with DNA precipitate for 4 h and glycerol-shocked (47), and expression of ras-luciferase reporter plasmids was induced with dexamethasone (0.2 pM) 2 h following oligonucleotide treatment. Fifteen h after induction of reporter gene expression, the transiently transfected cells were harvested and assayed for luciferase activity (47, 49).

Luciferase Assay-Luciferase expression in transiently transfected HeLa cells was determined using the triton lysis method as described previously (47,491. Luciferase activity was normalized to total protein concentration as determined by the Bradford protein assay (Bio- Rad). Data was expressed as total light units per fig of protein or as percent control activity, which was the luciferase activity per pg of protein in oligonucleotide-treated cells relative to the luciferase activity per pg of protein in untreated cells.

Oligonucleotide Treatment of Cells-Cells were treated with oligonucleotide in the presence of N-[l-(2,3-dioleyloxy)propyl]-N,N,N- trimethylammonium chloride (5 pg/ml) approximately 12 h following plasmid transfection as described previously (36, 50). Following oligonucleotide treatment, cells were stimulated with dexamethasone, and luciferase activity was assayed 15 h later.

RESULTS

Hybridization of Phosphorothioate Antisense Oligonucleo- tides to Single Stranded 25-mer RNA Targets-Fig. 1 shows

19956

gggactcctcgc I a c tgcct

FIG. 1. Antisense oligonucleotide design. Phosphorothioate oligonucleotides targeted to either the Ha-ras translation initiation codon or the codon 12 region are shown aligned with the complementary rus RNA sequences. Nucle- otides -15 to +35 (relative to the translation initiation codon) of Ha-ras mRNA are shown (21). Ha-ras mRNA is shown

5' . 5' to 3'; oligonucleotides are shown 3' to

the sequences of 15 phosphorothioate oligonucleotides each targeted to Ha-ras mRNA containing the codon 12 G 4 . J point mutation. These oligonucleotides range between 5 and 25 bases in length and are centered around the point mutation. Melting temperatures for these antisense phosphorothioates against mutant and wild type 25-mer RNA targets at 4 ,AM strand concentration are plotted in Fig. 2 A . T,,, increased with increasing chain length, and, for any chain length, T,,, for hybridization to the mutant target was greater than that for the wild type target. Oligonucleotide 2907 is a phosphorothioate 17-mer derivative of 2570 in which the central adenosine residue was replaced with cytosine, making this oligonucleotide perfectly complementary to the wild type Ha-ras target. As expected, the melting temperature for hybridization of this oligonucleotide to the wild type target was greater than that for the mutant target, which now contains a single mismatch in the oligonucleotide/RNA duplex at the site of the point mutation. For the 17-mer phosphorothioate that is perfectly complementary to the mutant Ha-ras target (2570), thermodynamic parameters were also obtained from dependence of T,,, on oligonucleotide concentration (Fig. 2B). These data were used to determine the free energy difference (AAG,,) between hybridization of oligonucleotides to the mutant target and to the wild type target.

According to the nearest neighbor model for nucleic acid hybridization (51, 52), the free energy difference between the perfectly complementary duplexes in Fig. 2 containing an A . U match and those containing a single A.G mismatch is independent of chain length. For the oligonucleotide duplexes in Fig. 2, using values obtained from thermodynamic fits, the average A A P 3 , for conversion of an A.U match to an A.G mismatch is +2.3 kcal/mol. Using AGO3, values obtained from the plots in Fig. 2B, the A A e s 7 for 2570 is +1.8 kcal/mol, suggesting that hybridization of 2570 to wild type target is between 1.5 and 2.5 kcal/mol less favorable than hybridization to the mutant target.

Thermodynamic Model for Selectivity of Antisense Oligo- nucleotides against a Point Mutation-For any antisense oligonucleotide targeted against a point mutation,

Kmlsmateh = Kmsteh.

2503 20 AUG

gcagc 2563 5 CODON 12

ggcagcc 2564 7 CODON 12

cggcagcca 2565 9 CODON 12

gcggcagccac 2567 11 CODON 12

cgcggcagccaca 2568 13 CODON 12

ccgcggcagccacac 2569 15 CODON 12

ccgcggcagccacacc 3426 16 CODON 12

cccgcggcagccacac 3427 16 CODON12

cccgcggcagccacacc 2570 17 CODON 12

cccgcggcagccacaccc 3428 18 CODON 12

acccgcggcagccacacc 3429 18 CODON 12

acccgcggcagccacaccc 2571 19 CODON12

cacccgcggcagccacacccg 2566 21 CODON 12

ccacccgcggcagccacacccgt 2560 23 CODON 12

accacccgcggcagccacacccgtt 2561 25 CODON 12

cccgcggccgccacacc 2907 17 CODON 12 (wild type)

where Kmismateh and Kmateh are, respectively, association constants for the oligonucleotide to wild type and mutant RNA targets, AA@3, is the free energy difference between the mismatch and the match, R is the gas constant, and T i s the temperature in Kelvin. For hybridization of antisense oligonucleotide to target,

Fraction of target hybridized = K.C/(l + K.C)

where K is the association constant of the oligonucleotide to the target, and C is the concentration of oligonucleotide. Thus, the fraction of target RNA bound by oligonucleotide is a function of the product between the affinity (Kas8) of an oligonucleotide for its target and the concentration (C) of the oligonucleotide at its target. This expression is valid when the concentration of antisense oligonucleotide exceeds that of the target.

In Fig. 3, fraction of target bound is plotted as a function of Kmateh. C for three values of AA@37. As AAG",, increases, the difference between the curves for mutant and wild type target increases. For any value of AAP3,, the difference is maximum when log,, (Kma*h*C) = AAQ3,/2.303/2RT. For AAGS7 = +2.0 kcal/mol, the difference is maximum when log&,,atch.C = 0.71; at this point, the fraction of mutant target hybridized is 5-fold greater than the fraction of wild type target hybridized. This maximum difference represents the maximum selectivity that theoretically can be achieved for a simple phosphorothioate oligonucleotide targeted to the Ha-ras codon 12 region containing a G 4 . J transversion.

According to this simple thermodynamic model, for any given values of AA@37 and the oligonucleotide binding constant, there is a single oligonucleotide concentration at which the selectivity of binding is predicted to be maximum,

Cmax-8e~ = exp(AAG037/2RT/Km.~h)

Fig. 4 plots this predicted concentration of maximum selectivity as a function of oligonucleotide chain length. For each chain length, the association constants were determined from absorbance versus temperature curves described above, and AAP3, was assumed to be +2.0 kcal/mol. For chain lengths


7s

f 60 ss

2907 + wI R N A (CG Match) *

2907 + ml RNA (CU Mmmalch)

I I I I I I I I 10 14 18 22 26

Length

B 3.06 1

-7 -6 S

Log Tolal Swnd Concenwlion (M)

-4

FIG. 2. T, analysis of antisense phosphorothioate oligonucleotides complementary to the codon 12 region of Ha-rus mRNA. A , T, uersus oligonucleotide length for oligonucleotides complementary to the codon 12 region of mutant human Ha-ras mRNA. Each sample contained equimolar mixtures of antisense oligonucleotide and a 25-residue RNA fragment corresponding to residues 23-47 (relative to the translation initiation site) of Ha-ras mRNA. The antisense oligonucleotide sequences are centered about the A complementary to the mutation site in codon 12; specific sequences are listed in Fig. 1. A, hybridization of phosphorothioate oligonucleotides targeted against mutant RNA with mutant R N A 0, hybridization of phosphorothioate oligonucleotides targeted against mutant RNA with wild type RNA; A, hybridization of a phosphorothioate 17-mer targeted against wild type RNA with wild type RNA; 0, hybridization of a phosphorothioate 17-mer targeted against wild type RNA with mutant RNA. Other conditions are given in the text. R, concentration dependence of melting temperature for hybridization of 2570, the phosphorothioate 17-mer targeted against residues 27-43 (relative to the translation initiation site) of mutant Ha-ras mRNA, with RNA 25-mer fragments corresponding to mutant (A) or wild type (0) Ha-rus mRNA. Hybridization was performed in 100 mM Na+, 10 mM phosphate, 0.1 mM EDTA, pH 7.0.

of 15-19 nucleotides, maximum selectivity for the mutant target is predicted to occur at oligonucleotide concentrations at the target site between lo-’ and M.

Construction and Expression of a ras-luciferase Reporter Gene-To establish a system for rapid screening of antisense oligonucleotides targeted to the codon 12 point mutant (G+ T) of Ha-ras mRNA, we constructed a ras-luciferase reporter gene fusion in which a 134-bp segment of the Ha-ras gene, containing 68 bp of 5’-nontranslated sequences, the natural ras translation initiation codon and sequences coding for the first 22 amino acids of wild type or activated Ha-ras p21, is fused in-frame with the firefly (Photinus pyralis) luciferase reporter gene (Fig. 5A). The resultant ras-luciferase gene fusion encodes a hybrid protein containing the first 22 amino acids of p21 fused to luciferase. The translation initiation

codon of luciferase was removed during PCR gene construction so that translation of the fusion mRNA is dependent on initiation at the Ha-ras AUG. Expression of this fusion gene is under regulation of the steroid-inducible mouse mammary tumor virus (MMTV) promoter (40).

Fig. 5B demonstrates that the ras-luciferase fusion proteins produced by expression of either mutant or wild type ras- luciferase were active in luciferase activity and that the levels of luciferase activity produced by the two proteins, which differ by only a single amino acid at position 12, were virtually identical. These fusion proteins displayed activity approximately 70% of unfused luciferase (Fig. 5B). The lower activity of the fusion proteins may be explained by differences in translation initiation efficiency between Ha-ras and luciferase AUG sites, RNA or protein stability, or a detrimental effect of amino-terminal fusion of amino acids 1-22 of Ha-ras p21 on the enzymatic activity of luciferase. Nevertheless, the luciferase activity produced by expression of the fusion genes was highly reproducible and valuable for monitoring activity of antisense oligonucleotides targeted to the 5‘-end of Ha-ras mRNA.

Antisense Oligonucleotide Inhibition of ras-luciferase Gene Expression-To identify antisense oligonucleotides capable of selectively inhibiting expression of mutant Ha-ras mRNA relative to wild type Ha-ras, a series of 11 phosphorothioate oligonucleotides, ranging in length between 5 and 25 bases, were tested for inhibition of mutant and wild type ras-luciferase in transient transfection assays. In addition, two 20- base phosphorothioate oligonucleotides, targeted to the Ha- ras AUG codon, were designed and tested (Fig. l). These 13 oligonucleotides were tested initially for inhibition of ras- luciferase expression at a single dose (100 nM) in HeLa cells. The cells were pretreated for 4 h with oligonucleotide plus cationic lipid (as described under “Materials and Methods”) to enhance cellular uptake. As shown in Fig. 6, both AUG- targeted oligonucleotides were effective in inhibiting ras-luciferase expression. Although these two compounds were designed to target similar regions of Ha-ras mRNA, they displayed marked differences in activity a t 100 nM oligonucleotide concentration, with compound 2503 being far more effective in inhibiting expression of ras-luciferase as compared with 2502. Although the reason for the difference in activity of these very similar oligonucleotides is unknown, it may be explained by subtle differences in secondary structure of the Ha-ras mRNA at the two AUG target regions. Differences in mRNA secondary structure may in turn affect oligonucleotide affinity to target mRNA sequences.

Oligonucleotides targeted to the Ha-ras codon 12 point mutation also were effective in inhibiting expression of ras- luciferase. As shown in Fig. 6, antisense activity of oligonucleotides targeted to this region of Ha-ras mRNA was dependent on oligonucleotide chain length. Oligonucleotides less than 15 bases in length were inactive, whereas all oligonucleotides 15 bases or greater in length were active against the mutant Ha-ras target. Above 15 bases in length, antisense activity increased with oligonucleotide chain length. Selective inhibition of mutant over wild type ras-luciferase expression was also observed. This selectivity, however, did not increase with oligonucleotide chain length but required a specific length between 15 and 19 bases. The maximum selectivity observed for inhibition of mutant ras-luciferase relative to wild type was for the 17-mer 2570 and was approximately 4- fold. In order to demonstrate that 2570 was acting sequence specifically, a derivative of this compound was tested (2907) in which the central adenosine residue was replaced with cytosine, making this oligonucleotide perfectly complemen-

19958

FIG. 3. Fraction of target hybridized as a function of hybridization constant and oligonucleotide concentration. Kmstch is the association constant for the antisense oligonucleotide to the matched (mutant) target.

is the difference in duplex stability between the mismatched (wild type) and matched (mutant) target. C is the oligonucleotide concentration, which is assumed to be in excess. a, AAG037 = 1.0 kcal/mol; b, AA@37 = 2.0 kcal/mol; c,

= 3.0 kcal/mol.

~~ ~ ~~~ ~~~ :: 1 r....: -.

I U n k

I O 1 i-

IO -9

! [ 6 " & l O l [ ' I n 10 l l y 12' -I~ 6 l " . 1 3 ~ € \

\

Inhibition of Ha-ras Expression

,"\,\GO i + 2 iCdlirn0l

1 ~ L~ ~~~ I

I 1 13 I5 17 19 21 23 25

Oligo Length

FIG. 4. Concentration of maximum binding specificity predicted by a simple thermodynamic model as described in text. Association constants for phosphorothioate oligonucleotides targeted to the point mutation of ras were determined from absorbance uersus temperature profiles as described in the text. A value of +2.0 kcal/ mol was used for AA@37, the free energy difference between hybridization to mutant and wild type targets.

tary to the wild type Ha-ras target. Hence, this oligonucleotide will contain a single mismatch at the center of the oligonucleotide/RNA duplex when fully hybridized to the mutant Ha- rm sequence. As shown in Fig. 6, oligonucleotide 2907 selectively inhibited expression of wild type ras-luciferase relative to mutant rus-luciferase, with the difference being approximately 5-fold.

The results described above show that antisense selectivity of phosphorothioates against mutant Ha-ras sequences is dependant upon oligonucleotide chain length. Although oligonucleotides of length 15, 17, and 19 bases all displayed significant antisense selectivity against mutant ras-luciferase, the 17-mer was clearly optimal. To determine whether the maximum selectivity observed for the 17-mer could be further improved, two 16-mers and two 18-mers were designed and tested (Fig. 1). Fig. 7 shows the results of an experiment in which antisense activity and mutant selectivity was determined for oligonucleotides of length 13, 15, 16, 17, 18, and 19 bases in a dose-dependent manner. The results demonstrate that all of the compounds that displayed activity against mutant Ha-ras sequences showed some degree of selectivity and that the relative amount of selectivity observed for a given compound was dependent upon both oligonucleotide chain length and concentration. Oligonucleotides of length 16 and 17 bases displayed the greatest selectivity (4- and 5-fold, respectively). However, the 16-mers 3426 and 3427 did not inhibit wild type ras-luciferase, whereas the 17-mer 2570 did inhibit the wild type target to a small extent a t the highest concentration employed (250 nM). Oligonucleotides greater than length 17 bases were all far less selective for the mutant Ha-ras target than the 16- and 17-base compounds, and the

F-

13-base compound, 2568, did not display antisense activity at any of the tested concentrations.

DISCUSSION

In the present study, we determined the ability of phosphorothioate antisense oligonucleotides of varying length to selectively inhibit expression of mutant over wild type Ha-ras codon 12 sequences containing a G+T transversion. We employed synthetic fusion genes encoding target Ha-ras sequences fused in-frame to the reporter gene luciferase to facilitate screening of antisense compounds. In separate studies, we have utilized co-transfection, ras-luciferase transactivation systems (53, 54) in which antisense effects of oligonucleotides targeted to the full length Ha-ras transcript were monitored using ras-responsive enhancer elements fused to luciferase. We have found that all of the active oligonucleotides identified using the ras-luciferase fusion assay system displayed similar activity profiles against the full length Ha- rm transcript. Furthermore, oligonucleotides that were inactive against the ras-luciferase fusion target were also inactive in the transactivation system.' This result strongly suggests that the rus-luciferase fusion gene is a valid model for iden- tifying active oligonucleotides targeted to the 5"region of full length Ha-ras transcripts.

For oligonucleotides targeted to Ha-ras codon 12, antisense potency was found to correlate directly with oligonucleotide length. As length was increased, antisense potency increased. Oligonucleotides under 15 bases in length showed no activity against Ha-ras sequences, whereas an oligonucleotide 25 bases in length, the longest one tested, showed the greatest activity. This observation can be explained by a simple thermodynamic model that predicts the affinity of an oligonucleotide for its target (Kass) increases with oligonucleotide length. Increased binding affinity will result in an increase in the fraction of target bound. This correlation between antisense potency and oligonucleotide affinity is expected if target binding is important in the mechanism of action of antisense oligonucleotides.

Selective antisense inhibition of mutant over wild type Ha- ras target sequences was achieved for only a subset of oligonucleotides ranging between 15 and 19 bases in length. The degree of selectivity achieved for these compounds was found to depend on oligonucleotide concentration. Longer oligonucleotides showed maximum selectivity at lower concentrations, whereas shorter oligonucleotides required higher concentrations to achieve maximum selectivity. That these oligonucleotides are acting through an antisense mechanism is demonstrated by the dependence of their activity on oligonucleotide sequence. Oligonucleotides containing scrambled sequences showed no activity. Furthermore, mutant selectivity could be reversed to wild type selectivity by a single base substitution in the oligonucleotide at the site of the point

'B. P. Monia, J. F. Johnston, D. J. Ecker, M. A. Zounes, W. F. Lima, and S. M. Freier, unpublished experiments.


A

CIY

JI &! 7hr Clu Tyr Lyr Leu Val Val Val Gly Ala Val Gly Val Cly Lys Ser Ala Leu 7hr Ue Gln Lyr L e u

2.00

r

- - - Luciferase RAS-Luciferase US-Luciferase

Mum1 Wild-Type

FIG. 5. Construction and expression of a ras-luciferase fusion reporter gene. A , reporter gene construction. 5”Regions of mutant (codon 12 G+T) and wild type Ha-ras genomic clones, including nucleotides -53 to +65 (relative to the translation initiation codon), were amplified by PCR and inserted 5’ to and in-frame with the firefly (P. pyralis) luciferase gene (21, 40, 41), as described under “Materials and Methods.” The resulting fusion gene expresses a ras-luciferase fusion mRNA that codes for amino-terminal amino acids 1-24 of mutant or wild type Ha-ras p21 fused to the amino terminus of luciferase. The translation initiation codon of luciferase was removed during PCR plasmid construction so that mRNA translation is dependent upon initiation at the Ha-ras AUG. Expression of these fusion genes is under under control of the steroid-inducible MMTV promoter (47). B, steroid regulated expression of luciferase and ras-luciferase reporter genes. HeLa cells were transfected with reporter plasmids expressing either the natural luciferase gene, mutant ras-luciferase (codon 12 G-T) fusion gene, or the wild type ras-luciferase fusion gene in the absence (-) or the presence (+) of 0.2 ~ L M dexamethasone, as described under “Materials and Methods.” Cell extracts were prepared, and luciferase activity was determined 15-h post-dexamethasone treatment. Results are expressed as the mean f S.D. ( n = 4).

mutation making it perfectly complementary to the wild type Ha-ras target.

The maximum selectivity observed for targeting mutant Ha-rm was for a 17-mer, which displayed approximately 5- fold selectivity for this target at 200 nM oligonucleotide concentration (Fig. 7). This difference in antisense activity against mutant over wild type Ha-ras agrees with the maximum selectivity predicted by a simple thermodynamic model that relates fraction of mutant target bound to fraction of wild type target bound as a function of oligonucleotide concentration and affinity. For a given oligonucleotide, the difference in free energy of binding to mutant over wild type Ha-ras target sequences ( A A e , , ) can be obtained from T, dependence on oligonucleotide concentration (46). For any AAG“‘:,,, this model predicts a concentration a t which the difference in fraction of mutant target bound and fraction of wild type target bound is maximum. At this concentration, the fraction of mutant to wild type target bound can be calculated. As shown in Table I, the maximum antisense selectivity observed for targeting mutant over wild type Ha- r m sequences (5-fold) agrees well with that predicted for a AAG03, of +2.0 kcal/mol, as measured by oligonucleotides binding to a 25-mer synthetic RNA target.

Thermodynamic measurements of affinity (Kass) and AAG“37 for antisense oligonucleotides binding to a 25-base synthetic RNA target can be used to predict the concentration of oligonucleotide required to achieve maximum selectivity for a given oligonucleotide length. This relationship between

~~

oligonucleotide length and concentration predicts that longer oligonucleotides should require lower concentrations to achieve maximum selectivity and shorter oligonucleotides should require higher concentrations to achieve the same degree of selectivity. Although this trend was observed in actual antisense experiments (Fig. 7), it is clear that, for a given oligonucleotide length, there is a large discrepancy between the observed concentration of maximum selectivity and that predicted from the thermodynamic model. Since phosphorothioates are quite stable in serum and inside of cells (55, 56), it is unlikely that this difference can be explained by nucleolytic degradation of the oligonucleotides. We offer two alternative explanations for this discrepancy. First, the concentration of oligonucleotide at the site of action is substantially less than the concentration added to cells in culture. This may occur by inefficient cellular uptake of oligonucleotide and/or subcellular compartmentalization of oligonucleotide at sites distinct from the target RNA.

A second possibility is that the association constant for oligonucleotide binding to target RNA in cells is substantially weaker than that measured for binding to a 25-mer synthetic RNA outside of cells. This could be caused by differences between the cell environment (ionic conditions, proteins, etc.) and the environment used to determine T, outside of cells. In addition, the existence of secondary structure in the target RNA in cells can compete with oligonucleotide binding and weaken K,,,. This possibility is supported by reports claiming the existence of secondary structure in Ha-ras mRNA in the

19960 Inhibition of Ha-ras Expression

FIG. 6. Single dose activity and specificity of phosphorothioate antisense oligonucleotides targeted to Ha-rua sequences of rus-luciferase mRNA. HeLa cells transfected with either wild type rm-luciferase (filled bars) or mutant ras-luciferase (hatched bars) expression plasmids were treated with oligonucleotide (100 nM) in the presence of N-[l-(2,3-dioleyloxy)propyl]-N,N,N- trimethylammonium chloride (5 pg/ml), as described under "Mate- rials and Methods." Following oligonucleotide treatment ras-luciferase expression was induced with dexamethasone (0.2 FM), and luciferase activity was determined 12-15 h later. Oligonucleotide sequences are shown in Fig. 1. Sequence of the randomized "control" oligonucleotide is GAT-CGA-GAT-CTG-ATC-CTT-AG. Numbers in parentheses represent length of oligonucleotides. Results are expressed as the mean of the percent control activity f S.D. (n = 6).

codon 12 region (32)." Thus, quantitative discrepancies between the predicted and observed concentration of oligonucleotide required to achieve maximum mutant selectivity may be explained by inappropriate estimates of oligonucleotide concentration and/or affinity inside the cell. Qualitatively, however, the thermodynamic model predicts accurately the oligonucleotide concentration dependence for selectively targeting a point mutation.

As Table I shows, the maximum degree of selectivity that can be achieved theoretically for targeting mutant over wild type Ha-ras increases significantly as A A p s 7 increases. Hence, novel approaches to increase this parameter may be of great value in future studies aimed at selective targeting of point mutations by antisense oligonucleotides. Chemical mod- ification of the antisense strand may increase AAG'37 and therefore enhance selectivity. For example, Helene and co- workers (33) used an intercalating agent tethered to an antisense oligonucleotide to increase selectivity. Other possibili- ties include modified nucleosides such as 2,6-diamino purine, which may bind more tightly than dA to U and less tightly than dA to G, thus increasing AAGOs7 for the A.U + A.G mismatch.

Selectivity may also be enhanced by taking advantage of RNA secondary structure. In general, hybridization of an antisense oligonucleotide to RNA will require disruption of RNA secondary structure. If differences exist between the structures of mutant and wild type targets, use of carefully designed oligonucleotides may result in selective disruption of the mutant structure relative to the wild type structure. In this case, AAG037 for binding to structured RNA is greater than that for binding to unstructured RNA.

Finally, targeting of other point mutations may also allow for a greater AAGOs7 and hence greater selectivity. The free energy difference for a mismatch compared to a match has been systematically measured for mismatches in DNA + DNA

W. F. Lima, S. M. Freier, B. P. Monia, and D. J. Ecker, manuscript submitted for publication.

0 I 0 I 0 0 2 0

I50

12s

E 2510 (L= I71 I 300

IS0 2569

IS0

12s

M28 tL= 18)

12u (L= IS)

T I

Ol8go Conc InMI Ohgo Conc InMI

FIG. 7. Dose-response activity and specificity of phosphorothioate antisense oligonucleotides targeted to the Ha-rus codon 12 region of rus-luciferase mRNA. HeLa cells were transfected with plasmids and treated with oligonucleotide as described in Fig. 6. Solid lines represent wild type ras-luciferase expression; hatched lines represent mutant rm-luciferase expression. Oligonucle- otide numbers are shown; oligonucleotide sequences are shown in Fig. 1. Numbers in parentheses represent oligonucleotide length. Results are expressed as the mean of the percent control activity -C S.D. (n = 6).

TABLE I Fraction of mutant versus wild type Ha-rm target bound as a

AAGo:,7 Selectivity*

function of

kcallmol -fold +1.0 2.25 +1.5 3.38 +2.0 5.07 +2.5 7.60 +3.0 11.40

* Maximum difference.

duplexes (58), DNA. RNA hybrids, and phosphorothioate RNA hybrids.' Free energy differences for RNA. RNA mismatches have also been tabulated (59). In all cases, AAGOS7 ranges from 1-2 kcal/mol for the most stable mismatches to 5-6 kcal/mol for the least stable mismatches. When possible, therefore, to maximize selectivity for the mutant target, mutations that generate stable mismatches (e.g. G+A) should be avoided and mutations that generate unstable mismatches (e.g. C+G, U-G, A+C) should be targeted. An example of this can be found in the autosomal dominant mutations associated with familial Alzheimer's disease (12-14). Three different point mutations of the ,&amyloid precursor gene have been shown to cosegregate with this disease. These mutations include G-A (AAGos7 = +1.2 kcal/mol), G-T


(AAcO,, = +3.9 kcal/mol), and T+G (AAG“,, = +6.3 kcal/ mol).’ In this case, targeting the T+G mutation is predicted to yield the greatest selectivity for mutant @-amyloid by an antisense oligonucleotide.

In addition to the selectivity conferred by AAQ37 to an oligonucleotide targeted to a point mutation, it may be possible to obtain selectivity by taking advantage of the substrate requirements of RNaseH. This endonuclease, which cleaves the RNA strand of RNA.DNA duplexes, is believed to be the terminating event in the mechanism of action of some antisense oligonucleotides (60-62). Chimeric oligonucleotides containing 2’-O-methylribonucleotide/deoxyribonucleotide linkages have been shown to direct RNase H cleavage to specific sites within the hybridized RNA strand (63). Depend- ing on the substrate requirements of this enzyme, it may be possible to discriminate between a fully matched RNA. DNA duplex and a duplex containing a single mismatch by employing oligonucleotides of this nature that place the RNase H recognition site at the mismatch. If the enzyme is unable to bind or cleave a mismatch, additional selectivity will be obtained beyond that conferred by AAG‘37. We have found that, by employing oligonucleotides of this nature, RNase H can indeed discriminate between a fully matched duplex and one containing a single mismatch.’ Thus, in designing antisense molecules to achieve maximum selectivity for a point mutation, it may be important to consider both the mechanism of action of the oligonucleotide as well as its thermodynamic properties.

Most studies that have used antisense oligonucleotides to inhibit gene expression target either the 5”nontranslated region or the AUG initiation of translation region. Oligonu- cleotides targeted to these sites are generally believed to act through a “translational arrest” mechanism in which the oligonucleotide masks the ribosome binding site and prevents formation of the translation complex (5, 6). Successful targeting of the Ha-ras 5”untranslated region and the AUG codon by antisense oligonucleotides has been reported (28, 30, 32, 35). In addition to codon 12-directed oligonucleotides, we have reported here the identification of two more oligonucleotides targeted to the Ha-ras AUG codon that display significant antisense activity. As expected, these oligonucleotides do not discriminate between mutant and wild type Ha- ras target sequences in their antisense effects. However, although the target sequences of these oligonucleotides overlap considerably, their antisense potencies differ dramatically. One possible explanation for this finding is that subtle differences in RNA structure between the two hybridization sites for these oligonucleotides may cause dramatic differences in binding affinity. Alternatively, this observation may reflect differential effects on disruption of ribosome assembly or function based on position of hybridization in the region surrounding the AUG codon.

Unlike mRNA AUG regions and 5”nontranslated regions, studies reporting antisense inhibition of gene expression in mammalian cells using oligonucleotides targeted to internal coding regions of mRNA transcripts are relatively uncommon (33,34,64-69). That we and others (32) have shown the codon 12 region of Ha-ras to be amenable to antisense inhibition suggests that this target site is unusual. In fact, extensive screening in our laboratory of oligonucleotides targeted to coding regions outside of codon 12 of Ha-ras mRNA, as well as to coding regions of unrelated transcripts, have been largely unsuccessful.’ This trend may reflect differences between the mechanisms of action of oligonucleotides targeted to 5‘-nontranslated/AUG regions and coding regions. Hybridization of oligonucleotides to internal coding sequences has little effect

on the ability of ribosomes to translate mRNA (70). More likely, these oligonucleotides act by means of RNase H (60- 62). This possibility is supported by our finding that the antisense effects of oligonucleotides targeted to Ha-ras codon 12 are RNaseH-de~endent.~ Furthermore, treatment of Ha- ras transformed cells with phosphorothioate oligonucleotides targeted to codon 12 cause a reduction in Ha-ras mRNA levels and cellular proliferation rates.4 RNaseH-resistant methyl- phosphonates (57), however, have been successfully employed for targeting codon 61 of Ha-ras (34). Since a translational arrest mechanism by oligonucleotides targeted to coding sequences seems unlikely, the mechanism of action of this oligonucleotide is less clear.

We have demonstrated that phosphorothioate oligonucleotides can be employed successfully for selective inhibition of mutant Ha-ras mRNA sequences containing a G+U transversion. Furthermore, our results show that a simple thermodynamic model of binding of oligonucleotides to target RNAs quantitatively predicts the maximum selectivity at- tained in antisense experiments and qualitatively predicts the dependence of antisense activity and mutant selectivity on oligonucleotide length and concentration. Studies focused on increasing further the degree of selectivity that can be achieved for antisense oligonucleotides targeted to this and other point mutations are currently in progress.

Acknowledgments-We thank Drs. Stanley T. Crooke, Christopher K. Mirabelli, Claude Helene, and Bruno Tocque for encouragement and many helpful discussions during the course of these studies.

REFERENCES

2. Stein, C. A,, and Cohen, J. S. (1988) Cancer Res. 48,2659-2668 1. Zon, G. (1988) Pharm. Res. 5 , 539-549

3. Dolnick, B. J. (1990) Biochem. Pharmacol. 40, 671-675 4. Helene, C., and Toulme, J.-J. (1990) Biochim. Biophys. Acta 1049,99-125 5. Neckers. L.. Whitesell. L.. Rosolen. A,. and Geselowitz. D. A. (1992) Crit. , ,

Rev. Oncol. 3, 175-231 ’

, ,

6. Crooke, S. (1992) Annu. Reu. Pharmacol. Toxicol. 32 , 329-376 7. Helene, C., and Toulme, J.-J. (1989) in Oligonucleotides: Antisense Inhibi-

tors of Gene Expression (Cohen, J. S., ed) pp. 137-171, CRC Press, Boca Raton. FL

8. Reddy, E . P., Reynolds, R. K., Santos, E., and Barbacid, M. (1982) Nature

9. Shimizu, K., Birnbaum, D., Ruley, M. A,, Fasano, O., Suard, Y., Edlund, 300,149-152

L., Taparowsky, E., Goldfarb, M., and Wigler, M. (1983) Nature 304 ,

10. Capon, D. J., Seeburg, P. H., McGrath, J. P., Hayflick, J. S., Edman, U., 497-500

11. Taparowsky, E., Shimizu, K., Goldfarb, M., and Wigler, M. (1983) Cell 34, Levinson, A. D., and Goeddel, D. V. (1983) Nature 304,507-513

12. Goate, A., Chartier-Harlin, M. C., Mullan, M., Brown, J., Crawford, F., 581-586

Fidani, L., Giuffra, L., Haynes, A., Irving, N., James, L., Mant, R., Newton, P., Rooke, K., Roques, P., Talbot, C., Pericak-Vance, M., Roses, A., Williamson, R., Rossor, M., Owen, M., and Hardy, J. (1991) Nature 349, 704-706

13. Murrel, J., Farlow, M., Ghetti, B., and Benson, M. D. (1991) Science 254, 97-99

14. Chartier-Harlin, M.-C., Crawford, F., Houlden, H., Warren, A,, Hughes, D., Fidani, L., Goate, A., Rossor, M., Roques, P., Hardy, J., and Mullan, M. (1991) Nature 353,844-846

15. Bishop, J. M. (1987) Science 235,305-311 16. Weinberg, R. A. (1988) Cancer 61, 1963-1972 17. Bos, J. L. (1989) Cancer Res. 49, 4682-4689 18. Barbacid, M. (1990) Eur. J . Clin. Inuest. 20,225-235

20. McCormick, F. (1989) Cell 56, 5-8 19. Barbacid, M. (1987) Annu. Reu. Biochem. 5 6 , 779-827

21. Hall, A. (1990) Science 249,635-649 22. Cartwright, T., Morgat, A,, and Tocque, B. (1992) Chimicaoggi 32 , 26-33 23. Reddy, E. P. (1983) Science 220 , 1061-1063 24. Gihhs, J. B., Sigal, I. S., Poe, M., and Scolnick, E. M. (1984) Proc. Natl.

Acad. Sci. U. S. A . 81,5704-5708 25. McGrath, J. P., Capon, D. J., Goeddel, D. V., and Levinson, A. D. (1984)

Nature 310,644-649 26. Sweet, R. W., Yokiyama, S., Kamata, T., Feramisco, J. R., Rosenberg, M.,

and Gross, M. (1984) Nature 31 1, 273-275 27. Manne, V., Bekesi, E., and Kung, H. F. (1985) Proc. Natl. Acad. Sci. Sc. U.

S. A. 82,376-380 28. Tidd, D. M., Hawley, P., Warenius, H. M., and Gibson, I. (1988) Anti-

Cancer Drug Design 3 , 117-127 29. Brown, D., Yu, Z., Miller, P., Blake, K., Wei, C., Kung, H.-F., Black, R. J.,

Ts’o, P. 0. P., and Chang, E. H. (1989) Oncogene Res. 4 , 243-252

S. Le Brun, J . F. Johnston, and B. P. Monia, manuscript in preparation.

19962 Inhibition of Ha-ras Expression 30. Chang, E. H., Yu, Z., Shinozuke, K., Zon, G., Wilson, W. D., and Stre-

31. Yu, Z., Chen, D., Black, R. J., Blake, K.. Ts'o. P. 0. P.. Miller. P.. and kowska, A. (1989) Anti-Cancer Drug Design 4,221-232

Chang, E. H. (1989) J: Exp. Pathol. .4, 97-108 , .

33. Saison-Behmoaras. T.. Tocaue. B.. Rev. I.. Chassienol. M.. Thuone. N. T.. 32. Daaka, Y., and Wickstrom, E. (1990) Oncogene Res. 5 , 267-275

and Helene, C. (1991) EMBO J.'lO; 1111-1118- I I -~

34. Chang, E. H., Miller, P. S., Cushman, C., Devadas, K., Pirollo, K. F., Ts'o, P. 0. P.. and Yu. Z. (1991) Biochemistrv 30. R283-82Rfi

35. Giles, R. V., and Tidd, 6. M . 71992) Anti-Cancer Drug Design 7,37-48 36. Chiang, M.-Y., Chan, H., Zounes, M. A., Freier, S. M., Lima, W. F., and

Bennett, C. F. (1991) J. Biol. Chem. 266,18162-18171 37. Wu, T., and Oglivie, K. K. (1990) J. Org. Chem. 5 5 , 4717-4724 38. Wu, T., Oglivie, K. K., and Pon, R. T. (1989) Nucleic Acids Res. 17 , 3501-

39. Freier, S. M., Alkema, D., Sinclair, A., Neilson, T., and Turner, D. H.

40. Lee, F., Mulligan, R., Berg, P., and Ringold, G. (1981) Nature 2 9 4 , 228-

_I - -, "" ""

3517

(1985) Biochemistry 24,4533-4539

2R2 41.

42.

43.

44. 45. 46.

47.

48.

de-Wet, J. R., Wood, K. V., Helinski, D. R., and De Luca, M. (1985) Proc. Natl. Acad. Sci. U, S. A. 8 2 , 7870-7873

de Wet, J. R., Wood, K. V., DeLuca, M., Helinski, D. R., and Subramani,

Vickers, T., Baker, B. F., Cook, P. D., Zounes, M., Buckheit, R. W., S. (1987) Mol. Cell Biol. 7 , 725-737

Germany, J., and Ecker, D. J. (1991) Nucleic Acids Res. 19 , 3359-3368 Puglisi, J. D., and Tinoco, I., Jr. (1989) Methods Enzymol. 180,304-325 Petersheim, M., and Turner, D. H. (1983) Biochemistry 22,256-263 Borer, P. N., Dengler, B., Tinoco, I., Jr., and Uhlenbeck, 0. C. (1974) J.

Mol. Biol. 8 6 , 843-853 Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G.,

Smith, J. A,, and Struhl, K. (1987) Current Protocols in Molecular Biology,

Miesfeld, R., Rusconi, S., Godqwski, P. J., Maler, B. A,, Okret, S., Wiks- Greene Publishing Associates and Wiley-Interscience, New York

trom, A.-C., Gustafsson, J.-A,, and Yamamoto, K. R. (1986) Cell 4 6 , 389-399

49. Brasier, A. R., Tate, J. E., and Habener, J. F. (1989) BioTechnigues 7 ,

50. Bennett, C. F., Chiang, M.-Y., Chan, H., Shoemaker, J., and Mirabelli, C.

51. Tinoco, I., Jr., Borer, P. N., and Dengler, B. (1973) Nature New Biol. 246 ,

52. Turner, D. H., Sugimoto, N., and Freier, S. M. (1988) Annu. Reu. Biophys.

1116-1122

(1992) Mol. Pharmacol. 4 1 , 1023-1033

40-41

C h ~ m . 1'7. 1 fi7-192 53 Wasyiyk- B. Imler J. L. Chatton, B. Schatz C., and Waslyk, C. (1988)

54. Owen, R. D., and Ostrowski, M. C. (1990) Proc. Natl. Acad. Sci. U. S. A.

- - , ---

Proc. 'Nab. A C Q ~ Sci. b. S. A. 85, f952-795'6

F(7.386fi-3R70 55. Stein, C. A,, Subasinghe, C., Shinozuka, K., and Cohen, J. A. (1988) Nucleic

56. Hoke, G. D., Dra er K , Freier, S., Gonzalez, C., Driver, V. B., Zounes, M.

57. Maher, L. J., and Dolnick, B. J. (1988) Nucleic Accds Res. 16 , 3341-3353 58. Aboul-ela, F., Koh, D., Tinoco, I., Jr., and Martin, F. H. (1985) Nucleic

- . , . - . - - - . - Acids Res. 16,3209-3221

A,, and Ecker, b. >. (1992) Nucleic Acids Res. 19,5743-5748

59. Jaeger, J. A,, Turner, D. H., and Zuker, M. (1989) Proc. Natl. Acad. Sei. U. Acids Res. 13,4811-4824

S. A. 86. 7706-7710 60. Stein, H., and Hausen, P. (1969) Science 166,393-395 61. Hausen, P., and Stein, H. (1970) Eur. J. Biochem. 14 , 278-283 62. Kozak, M. (1991) J. Biol. Chem. 266,19867-19870 63. Inoue, H., Hayase, Y., Iwai, S., and Ohtsuka, E. (1987) FEBS Lett. 15 ,

137-11n 64.

65. 66.

67. 68. 69. 70.

Miles, S. A., Rezai, A. R., Salazarr-Gonzalez, J. F., Vander Meyden, M., Stevens, R. H., Logan, D. M., Mitsu asu, R. T., Taga, T., Hirano, T., Kishimoto, T., and Martinez-Maza, 8. (1990) Proc. Natl. Acad. Sci. U. S. A. 87,4068-4072

". I"

Manson, J., Brown, T., and Duff, G. (1990) Lymphokine Res. 9,35-42 Bavisotto, L., Kaushansky, K., Lin, N., and Hromas, R., (1991) J. Exp.

Morrison, R. S. (1991) J. Biol. Chem. 2 6 6 , 728-734

Tanaka, T., Chu, C. C., and Paul, W. E. (1992) J. Exp. Med. 175,597-607 Levy, Y., Tsapis, A,, and Brouet, J.-C. (1991) J. Clin. Inuest. 888,696-699

Kozak, M. (1991) J. Bid. Chem. 266,19867-19870

Med. 1 7 4 , 1097-1101

the of biological chemistry no. by printed u. s.a. ha-ras ... · mutant ha-ras message; this time...

Documents