THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1994 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 269, No. 39, Issue of September 30, pp. 24000-24006, 1994 Printed in U.S.A.

Multiple Proteins Interact at a Unique &-Element in the 3”Untranslated Region of Amyloid Precursor Protein mRNA*

(Received for publication, March 30, 1994, and in revised form, July 14, 1994)

Syed H. E. ZaidiS, Robert Denman§, and James S. Maltera From the $Department of Pathology and Laboratory Medicine, Neuroscience Program and Institute of Aging, University of Wisconsin, Madison, Wisconsin 53792-2472 and the §New York State Institute for Basic Research in Developmental Disabilities, Staten Island, New York 10314-6399

Growing evidence suggests that Alzheimer’s disease results from dysregulated production and deposition of P-amyloid in the central nervous system. P-Amyloid is derived from proteolytic processing of one of multiple amyloid precursor protein (APP) isoforms. “he produc- tion of APP in many somatic tissues and tumor cell lines provides a more accessible model to study the regula- tion of APP gene expression. Recent data suggest that APP mRNAs accumulate in activated lymphocytes and neuronal tumor lines. We are interested in defining the contribution of alterations in stability to changes in steady-state APP mRNA levels in these model systems. Herein we demonstrate by mobility shift assay that the 3”untranslated region of APP RNAs which contain a contiguous 29-base region interacts in vitro with multi- ple m.R.NA-binding proteins found in cytosolic lysates prepared from normal and transformed human cells. UV cross-linking of radiolabeled APP RNAs to cytosolic pro- tein extracts followed by sodium dodecyl sulfate-polyac- rylamide gel electrophoresis identified six distinct RNA- protein complexes of 42, 47, 65, 73, 84, and 104 m a . Competition assays with APP, AU-rich, or irrelevant RNAs demonstrated that binding was specific and in some cases preferential for AU- or U-rich sequences by which we tentatively place the binding site of the pro- teins along the 29-base region. APP mRNA-binding pro- teins were constitutively active in all tumor lines exam- ined as well as at diminished levels in whole human brain cytosolic lysates. The core element is AU-rich and highly conserved between human and some murine APP mRNAs. In the accompanying paper (Zaidi, S. H. E. and Malter, J. S. (1994) J. Biol. Chem. 269, 24007-24013) we show that this 29-base element in the 3”untranslated region regulates the stability of APP mRNk Cumula- tively these data suggest that steady-state APP mRNA levels are modulated by cytosolic protein-RNA interac- tions.

Alzheimer’s disease (AD)’ is characterized by the deposition of amyloid in neuritic plaques within the parenchyma and ves-

ROI-AG 10675 (to J. S. M.) and National Institutes of Health Program * This work was supported by National Institutes of Health Grant

Project Grant AGO-4221 and the New York State Ofice of Mental Re- tardation and Developmental Disabilities (to R. D.). The costs of publi- cation of this article were defrayed in part by the payment of page

in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. charges. This article must therefore be hereby marked “uduertisement”

ll To whom correspondence should be addressed: A4/204-CSC, Dept. of Pathology and Laboratory Medicine, University of Wisconsin Hospital and Clinics, 600 Highland Ave., Madison, WI 53792-2472. Tel.: 608-263-

The abbreviations used are: A D , Alzheimer’s disease; APP, amyloid A4 precursor protein; AUBF, adenosine-uridine-binding factor; UTR, untranslated region; PAGE, polyacrylamide gel electrophoresis; PCR, polymerase chain reaction.

6043; Fax: 608-263-0910.

sels of the brain. The major constituent of amyloid is the PIA4 peptide (42 amino acids) derived from one of several overpro- duced or aberrantly processed P-amyloid precursor proteins (APPs) (1). Individuals with Down syndrome (trisomy 21) also exhibit accelerated neuropathology similar to that in AD, which may be due to excess gene dosage (2). Recently conserved mu- tations at amino acid 717 of APP have been identified in indi- viduals with familial AD (3). These data cumulatively implicate dysregulation of APP production, structure, and processing as important events in the etiology of AD.

Excess APP production in AD patients is in part due to over- expression of APP mRNAs (4). This increase in APP mRNA steady-state levels could be due to an increase in transcription or a decrease in mRNA turnover or both. Approximately 65 bases downstream from the stop codon of human and murine APP mRNAs is the first of four AUUUA elements in the context of AU-rich regions. The A U W A motif is frequently identified in a similar location in many cytokine, lymphokine, oncogene, and inducible growth factor mRNAs (5 , 6). In quiescent cells, multiple AUUUA elements confer rapid cytoplasmic degrada- tion (6) probably through a large (720 S) degradative complex (7) possibly containing AU- (8, 9) or U-specific (10) mRNA- binding proteins. In lymphocytes activated by phorbol esters, ionophore, or cytokines including interleukin 1, AUUUA-con- taining mRNAs are generally stabilized (6, 11). We have de- scribed previously a cytosolic AUUUA-specific, mRNA-binding protein denoted as the adenosine-uridine-binding factor (AUBF) (12). AUBF is up-regulated by cell activation and likely mediates the stabilization of AU-containing mRNAs under these growth conditions (13, 14).

As APP and cytokine mRNAs are up-regulated in phytohe- magglutinin-stimulated human peripheral mononuclear blood leukocytes (15, 16) or phorbol ester-treated human umbilical vein epithelial cells (17), we investigated if APP mRNA was stabilized in activated cells. As shown in the accompanying paper (261, the degradation ofAPP mRNA was rapid in resting lymphocytes and inhibited in activated lymphocytes or tumor cell lines. Herein, we have employed RNA gel mobility shift assays to identify regions of APP mRNA which interact with cytoplasmic proteins. Sites of APP RNA-protein interaction likely map determinants responsible for regulated APP mRNA decay. We demonstrate that APP mRNA forms specific com- plexes with multiple cytosolic, mRNA-binding proteins. The core cis-element is 29 bases in length, approximately 200 bases from the stop codon and is highly conserved between murine and human APP mRNAs. The data demonstrate that protein- RNA interaction sites predict critical regions for the regulated stability of APP mRNA in cells.

MATERIALS AND METHODS Cell Culture-The human neuroblastoma IMR32 cell line (obtained

from the American Type Culture Collection) was grown in minimum

24000

APP mRNA Binds Cytosolic Proteins 24001 essential medium (Eagle's with nonessential amino acids and Earl's balanced salt solution; Life Technologies, Inc.) containing 10% fetal bovine serum (HyClone Laboratories), supplemented with 0.1 mM L- glutamine and penicillin-streptomycin (50 unit450 pg/ml). Human neu- roglioma H4 cells (obtained from the American Type Culture Collection) were cultured in Dulbecco's modified Eagle's medium with 4.5 gfliter glucose, 10% fetal bovine serum (Life Technologies, Inc.), 0.1 mM L- glutamine, and penicillin-streptomycin (50 units/50 pg/ml). Human my- elogenous leukemia K562 cell line was grown in RPMI 1640 supple- mented with 10% fetal bovine serum, 0.1 mM L-glutamine, and penicillin-streptomycin (50 units/50 pg/ml). All cell lines were grown a t 37 "C in a 5% CO, incubator.

Preparation of Cytoplasmic Lysates-Cells from a confluent 25-cm2 flask were detached from plastic by a 3-min incubation in lx trypsin- EDTA(Life Technologies, Inc.) at 37 "C, transferred to a 15-ml tube, and pelleted a t 400 x g for 10 min a t 4 "C. Nonadherent K562 cells were centrifuged a t 400 x g for 10 min. The cell pellet was washed with phosphate-buffered saline without Ca" or Mg2' prior to freeze-thaw lysis in 25 mM Tris, pH 7.9, 0.1 mM phenylmethylsulfonyl fluoride (Sigma), and 0.1 mM EDTA as described previously (12). Nuclei and intact cells were removed by centrifugation a t 15,000 x g for 15 min at 4 "C. The supernatant was carefully removed, snap frozen, and stored a t -80 "C. Human or mouse tissues were homogenized on ice in a buffer containing 15 mM HEPES, pH 8, 10% glycerol, 1 mM dithiothreitol, and 0.1 M phenylmethylsulfonyl fluoride. Homogenates were centrifuged a t 15,000 x g for 15 min a t 4 "C. The supernatant was removed carefully, dialyzed overnight against homogenization buffer, snap frozen, and stored a t -80 "C. The protein concentration was determined using the Bio-Rad Micro assay as described by the manufacturer.

Preparation of the DNA Templates for in Vitro Danscription-The plasmid vector pK4, which contains full-Iength APP-751 cDNA(18), was provided by Dr. Narayan Ramakrishna, New York State Institute for Basic Research in Developmental Disabilities, Staten Island, NY. Full- length APP-695 cDNA was provided by D. Goldgaber, Health Science Center, SUNY a t Stony Brook, NY. 3'-UTR APP cDNA templates were prepared by PCR (1 min a t 94 "C, 1 min a t 54 "C, and 1 min a t 72 "C for 35 cycles) from pK4 using the following oligonucleotide primers. All nucleotides are numbered as in (19) for APP-695 and shared the iden- tical 3'-UTR with APP-751. The 5' primers included a T7 RNA polym- erase promoter sequence, which is underlined. Oligonucleotide UT1 (APP cDN&,,,,,,,): 5'4ATACGACTCACTATAGGGAGATA- TAGACCCCCGCCACAGCAGCCTCT-3'. Oligonucleotide 40b (APP cDN&,,,,,,,,,): 5'-CACAATACGACTCACTA?AGGGCTGTGCTGTAA- CACAAGT-3'. Oligonucleotide 40c (APP cDN&,,~,,,~,): 5"CACAATAC- GACTCACTATAGGGAACTTGAATTAATCCACA-3'. Oligonucleotide

Oligonucleotide AP5 (APP cDN&,,,,,,,,): 5"TACAGTACACAAAAC- CCAlTAAT-3'. Oligonucleotide 19b (APP cDN&~,,,,,,): 5'-TGTAG TATAGAGACCAAAA-3'. Oligonucleotide 20 (APP c D N & , , ~ , ~ ~ ~ , ) : 5'-GATAGAATACATTACTGATG-3'. Oligonucleotide 20b (APP cDNA,,,,,,,,): 5'-CCAAAATGTAAAGAGAGATA-3'. Oligonucleotide

TAlTT-3'. PCR-amplified DNA fragments were excised after electro- phoresis in NuSieve 3:l agarose, precipitated, and used for in vitro transcription. Oligonucleotide AP52 (APP cDN&,,,~,,~,,: 5"GGTAA-

ACA-3') and its complement oligonucleotide AP-anti-52 (APP

ATAGTGAGTCGTATTACC-3') were mixed together, denatured by boil- ing for 5 min, annealed a t 59 "C for 30 min in TE buffer containing 200 mM NaCl, and used for in vitro transcription of 29-nucleotide APP RNA.

In Vitro Danscription-Radiolabeled and unlabeled APP RNA frag- menta were produced by in vitro transcription from PCR-amplified APP cDNA templates produced as described above. After transcription a t 37 "C for 1 h as described previously (12), cDNA templates were di- gested with 1 unit of RNase-free DNase (Promega), extracted with phenol-chloroform, and passed through a Sephadex G-50 minispin col- umn. t32PlUTP-labeled RNA was quantified by liquid scintillation counting and diluted to 5 x 10' c p d p l and used as such in band shift assays. Unlabeled APP RNA was precipitated with ethanol, resus- pended in diethyl pyrocarbonate-treated H,O, and quantified by absor- bance a t 260 nm. The integrity of the transcripts were verified on NuSieve 3:l agarose gels. Band Shift Assay and Polyacrylamide Gel Electrophoresis-Band

shift assays were performed essentially as described (12). Briefly, cyto- plasmic lysates (0.5-2 pg of total protein) were incubated with radiola- beled APP RNA(0.5 x 105-1.25 x lo5 cpm) in 10 pl of a solution composed of 15 mM HEPES, pH 8 , 2 pg of yeast tRNA, 10 mM KCl, 10% glycerol,

UT2 (APP CDN&,~~~-~,,~,): 5'-CTTAAAGCATATTTAAAGTAGGAC-3'.

29 (APP 5"TGCTCTAGAGCTCCTCCAAGAATG-

TACGACTCACTATAGGGTCTCTTTACATTTTGGTCTCTATACT-

c D N & ~ ~ ~ ~ ~ , ~ ) ) : 5"TGTAGTATAGAGACCAAAATGTAAAGAGACCCT-

2 " H4 2 IMR32 Lysate

+ - " . .. + Heat treatment . ~. --

the 3'-UTR of APP RNA and cytoplasmic lysates from H4 and FIG. 1. Formation of specific RNA-protein complexes between

IMR32. Radiolabeled APP RN&,,,,,,,,, was incubated with cytosolic lysates (0.5 pg/lane) from H4 (neuroglioma) or IMR32 (neuroblastoma) cell lines as shown before the addition of RNase T1 and continued incubation for 45 min. Mixtures were then electrophoresed on 5% native polyacrylamide gels and subjected to autoradiography. For heat treat- ment, lysates were preheated a t 70 "C for 15 min.

and 1 mM dithiothreitol at 30 "C for 10 min prior to the addition of 20 units of RNase T1 (Sigma). For competition studies, unlabeled APP or control RNAs were added 10 min before radiolabeled RNA to cytosolic lysate in the buffer described above. Following a 45-min incubation a t 37 "C, 2 p1 of 6 x native gel loading buffer (30% glycerol, 0.025% of bromphenol blue, and xylene cyanol) was added, and the RNA-protein complexes were resolved on a 5% polyacrylamide gel. W cross-linking studies were performed by exposing reaction mixtures for 6 min on ice to 254 nm W light in a Stratalinker (Stratagene) on the automatic settings. Subsequently, the cross-linked samples were boiled for 3 min. 3.4 p1 of 4 x SDS gel loading buffer (20) was added and RNA-protein complexes resolved by 12% SDS-PAGE. After electrophoresis, gels were dried and exposed to x-ray film for 15-20 h with intensifying screens.

RESULTS Identification of Proteins Forming Complexes with the 3'-

UTR of APP mRNA-To determine if cytosolic proteins existed which bind to the 3'-UTR ofAPP mRNA, band shift assays were performed. Radiolabeled, in vitro transcribed APP RNA start- ing from the UAG translational stop codon (nucleotide 2085) and terminating a t nucleotide 2471 (CZaI site) or extending to the end of the 3'-UTR (nucleotide 3207) were incubated with cytosolic extracts from IMR32 (human neuroblastoma) or H4 (human neuroglioma) cell lines. These cells make easily detect- able levels of APP mRNA. After 10 min a t 30 "C, 20 units of RNase T1 were added to eliminate unprotected radiolabeled RNA. The band-shifted RNA-containing complexes were re- solved on 5% native polyacrylamide gels and visualized by au- toradiography. As shown in Fig. 1, when radiolabeled APP RN&,,,,,,,,, was incubated with RNase T1 in the absence of protein, a variety of rapidly migrating fragments was produced. When radiolabeled APP RN&2,,,,,, was preincubated with either H4 or IMR32 lysates prior to RNase T1 treatment, mul- tiple RNA-containing, band-shifted complexes were observed. The electrophoretic migration of RNA complexes was very sim- ilar irrespective of the source of the lysate, suggesting that related or identical binding activities were present in H4 and IMR32 cells. Band-shifted complexes were not observed with lysates that were preheated at 70 "C for 15 min prior to the addition of APP RNA or those pretreated with proteinase K (data not shown). Identical results were produced when radio- labeled APP RNA spanning the entire 3'-UTR was used (not shown). These data demonstrate that APP RNA forms com- plexes with heat-sensitive cytosolic factors that are most likely proteins. Except for the fastest migrating complex, each com- plex demonstrated a distinct and nonoverlapping migration from RNase T1-digested APP RNA fragments. The single par-

24002 APP mRNA Binds Cytosolic Proteins

FIG. 2. Proteins bind between nucleotides 2219 and 2332 of APP RNA. IMR32 lysates (0.5 pg) were preincubated for 10 min with unlabeled competitor APP RNAs (3.2 pmol) (300-fold molar excess) as shown. Radiolabeled APP RNA,2o,,,,,, (1 x lo5 cpm = 10 fmol) was then added, and band shifts were carried out as described in the legend to Fig. 1.

tially overlapping complex was eliminated by heat treatment of the lysate, suggesting that it was also composed of RNA and protein. As RNA encompassing the entire 3'-UTR and the first 400 bases gave identical results, the binding site must be lo- calized in the first 400 bases.

Mapping of the Binding Region in the 3'-UTR ofAPP RNA- Unlabeled APP RNAs of various lengths (RN&,o,,,,,,,

ginning from the stop codon were transcribed in vitro after linearization of the APP 3'-UTR cDNA template with MboII, PuuII, RsaI, SpeI, or ClaI, respectively (see Fig. 4). These APP RNAs were assessed as competitors of radiolabeled RN&,,,, 2471), derived from ClaI-digested APP cDNA template. Band shift assays of radiolabeled APP RN&,,,,,,, were carried out with IMR32 cytosolic lysates that were preincubated a t 30 "C for 10 min with 3.2 pmol of unlabeled competitor RNA. As

2332) prevented complex formation, whereas APP RNA(2085-2218, or RN&,,~,,,,,, had no effect. These data demonstrate that cyto- solic proteins interact with a region of APP RNA spanning nucleotides 2218-2332. Furthermore, this interaction was spe- cific since other regions of APP RNA failed to suppress binding. Identical results were also obtained with H4 lysates (not shown).

We analyzed the ability of APP RN&2219-2338, without addi- tional 5' or 3' sequences to interact with the cytosolic proteins described above. This region of APP cDNA was amplified by PCR with the 5' amplimer containing a T7 RNA polymerase promoter at the 5' end. Radiolabeled RN&,,,,,,,,, produced directly from this APP cDNA template was used for band shift assays with H4 and IMR32 cytosolic lysates. As shown in Fig. 3, radiolabeled APP RN&z,,,,,,,, and RN&,,,,,,,, produced indistinguishable band-shifted patterns with multiple RNA- protein complexes. To eliminate the possibility that the APP RNA ligands bound electrophoretically similar but otherwise unrelated proteins, we performed cross-competition studies with unlabeled APP RN&,o~,,,,~ and RN&,,,,,,,,. Fig. 3 shows that RNA-protein complexes formed with radiolabeled APP RN&,,,,,,,, were entirely competed by 3.2 pmol of unla- beled APP RNA(,,,,,,,,. In the reciprocal experiment, radiola- beled APP RN&208s-2471,-protein complexes were entirely com- peted by the addition of 3.2 pmol of unlabeled APP RN&z,,,3,,, (not shown). These data demonstrated that both APP RNA species complex with the same cytosolic proteins and that APP RN&,,,,,,,, was necessary and sufficient for this interaction. The results of these experiments are summarized in Fig. 4.

RN&208&2218P RN&208%2332), RN&208&2358P and RN&208&2471)) be-

shown in Fig. 2> RNAs(2,8%%71), (208&2358), Or (208%

None IMR32 - - + + + + + + - + - + - - - + - + - + +

+ - " " _

H4 Lysate + + + RNaseT1 + - - 32P-RNA(2085-2471) - + + 32P-RNA(2219-2338) " + unlabelled RNA(2085-2471)

FIG. 3. Nucleotides 2219-2338 are sufficient to bind all of the APP RNA cytosolic binding proteins. Band shifts and competition in the presence of IMR32 or H4 cytosolic lysates were performed as described in the legends to Figs. 1 and 2. The components in each band shift reaction are as indicated. Unlabeled competitor APP RNA,2,,,,,,, was added prior to the addition of radiolabeled RNAs.

APP RNA-Protein Complexes Are Specific and Have Masses of 42,47, 65, 73,84, and 104 kDa-To determine the molecular sizes of APP RNA-protein complexes, reaction mixtures were incubated as described above and exposed to UV light prior to resolution on SDS-PAGE. As shown in Fig. 5A, (leftmost lane) RNase T1-protected fragments of APP RN&,,,,,,,, were pre- dominantly cross-linked to multiple cytosolic proteins with ag- gregate, complex masses of approximately 47, 65, 73, 84, and 104 kDa. The wide 47-kDa complex was resolved into two bands of 42 and 47 kDa on larger gels (see Fig. 10). Although not easily appreciated in Fig. 5A, the 42-kDa RNA-protein com- plex was also present in IMR32 lysates under the 47-kDa band (see Fig. 10). In the absence of lysate, RNase T1 cleaved radio- labeled APP RNA into a ladder of rapidly migrating fragments, the largest of which is approximately 27 kDa. This band can be seen in Figs. 5 and 6. Interestingly, proteins were differentially cross-linked with radioactive APP RNA (compare the intensity of the bands seen in Fig. 5 A ) . This may reflect differential proximity of the APP RNA ligand to the protein's binding site (cross-linking efficiency) or concentration differences of the var- ious proteins in the cytosol. Identical cross-linking patterns were observed when radiolabeled APP RN&20,,,,,,, was em- ployed in place ofAPP RN&2,,,3,3, with the exception that p73 migrated faster with APP RN&,,,,,;, (not shown). This likely reflects mass differences in RNase T1-protected APP RNA frag- ments rather than a novel protein. To map the binding region more closely, unlabeled APP

from the PCR-amplified cDNA templates and allowed to com- pete with radiolabeled APP RN&,,,,,,,,. Increasing amounts of unlabeled APP RN&,,,,,,,, or RNA(,,,,,,,, progressively inhibited radiolabeled APP RN&2,,,3,,, binding (Fig. 5 A ) . However, APP RN&,,,,,,, was unable to compete these com- plexes effectively. These results demonstrate that nucleotides 2285-2313 of the 3'-UTR ofAPP mRNA specifically produce six protein-RNA complexes. The intensities of the bands with un- labeled APP RN&,,,,,,, present are modestly darker than the control shift without competitor RNAs (Fig. 5A). This is due to the variability and relative inefficiency of U V cross-linking of RNA-protein complexes. As unlabeled APP RN&,,,,,,, failed to compete with radiolabeled APP RN&,,,,,,,,, it cannot con- tain the relevant binding site.

However, these results were directly verified by evaluating the ability of different, radiolabeled APP RNA probes contain- ing nucleotides 2285-2313 to bind the cytosolic proteins specif- ically. As shown in Fig. 5B, the pattern and intensity of binding of APP RN&,,,,,,,,, and RN&,,,,,,,, probes were virtually

RN&2246-2313P RN&221%2338P and RN&2219-2284) were produced

APP mRNA Binds Cytosolic Proteins 24003

A 2184 2218 2332 2358 2471

2085 MboII PvuII RsaI Spel

B Binding of Competition of 32P-APPRNAs 32P-APP RNA 2085-2471 2219-2338 - ND - ND - ND - ND

* ND + ND * ND + ND - + + +

I I + + + * I 1 I I

Binding site

FIG. 4. Restriction map of APP cDNA (3'-UTR) and summary of band shift results. Panel A, the 3'-UTR of APP mRNA from the TAG stop codon to the unique ClaI site (bases 2085-2471) was amplified by PCR using a 5' primer that contained a T7 RNA polymerase promoter sequence. The resulting cDNA transcription cassette was linearized with each of the indicated unique restriction enzymes and used to generate APP RNAs of varying lengths (as indicated). Nucleotide numbers used are as described in (19). Panel B, results of the band shifts of radiolabeled APP RNAs with or without unlabeled APP RNA competitors (as shown). Arrows represent APP RNAs of various lengths and are drawn to scale. Below APP RNA,,,,,,4,,, is shown the likely protein binding site. Aplus sign denotes the presence or competition of all band shift complexes, and a minus sign denotes the failure to compete. ND means not determined.

A

c

106 kDa - 80 kDa - 49 kDa - 32 kDa - 27 kDa -

Competitor RNAs (2219-2338) (2246-2313) (2219-2284)

B

106 kDa - 80 kDa - 49 kDa -

- S@ - ma

32 kDa - 27kDa - a

otides 2285-2313. SDS-PAGE of UV cross-linked APP RNA-protein FIG. 5. The binding region in APP RNA is localized to nucle-

complexes. Panel A, competition of radiolabeled APP RNA,,,,,,,,,, with unlabeled APP RNAs. IMR32 lysate (2 pgllane) was preincubated for 10 min with increasing concentrations of unlabeled APP RNAs as shown prior to the 10-min incubation with radiolabeled APP RNA,,,,,,,,. After RNase T1 treatment, the reaction mixture was W cross-linked and resolved on 12% SDS-PAGE. Panel B, IMR32 lysates (2 pgflane) were incubated with radiolabeled APP RNAs as shown and electro- phoresed on 12% SDS-PAGE as described above. The migration of mo- lecular mass standards is shown to the left. Bands observed below 32 kDa are RNase T1-protected fragments of free APP RNA.

identical. By contrast, cross-linking carried out in the presence of APP RN&,,,,,,, did not generate complexes. These data indicate that nucleotides 2285-2313 are necessary and possibly

- " + + + IMR32Lysate " - + + + RNaseT1

- 106 kDa - 80 kDa - 49 kDa

- 32 kDa - 27 kDa

FIG. 6. p42, p47, p84, and p104 bind to nucleotides 2285-2300 in APP RNA and p65 and $73 additionally required nucleotides 2301-2313. IMR32 lysates (2 &lane) were incubated with radiolabeled RNAs, UV cross-linked, and electrophoresed on 12% SDS-PAGE as described in the legend to Fig. 1. Radiolabeled RNAs alone are also shown in the three left lanes. The migration of molecular mass stan- dards is shown to the right.

sufficient to form all cytosolic protein-APP RNA complexes. To delineate further the protein binding sites within nucle-

otides 2285-2313, we produced radiolabeled APP RN&2219-2300), which terminated in the middle of this region. We performed band shift assays with APP RN&,,,,,,,,, RN&,,,,,,,,, and RN&,,,,,,,,. As expected, APP RN&,,,,,,, failed to cross link any proteins (Fig. 6), whereas APP RN&2,,,,,,,, which con- tains the entire element, bound all proteins. Radiolabeled APP RN&,,,,,,,,, however, bound p42, p47, p84, and p104 but not p65 or p73. These data demonstrate that the region spanning nucleotides 2285-2300 are sufficient for the binding of p42, p47, p84, and p104, whereas the adjacent region is also re- quired for p65 and p73 binding. APP RN&,,,,,,,, did not pro- duce any band-shifted complexes (not shown), suggesting that the immediate 5"flanking sequences are important. The re- sults of these fine mapping studies are summarized in Fig. 7.

Competition with AUUUA and Poly(U) RNA-AUBF is a 33-kDa polypeptide found in many tumor cell lines or activated normal lymphocytes which binds to multiple AUUUA elements

24004

A

IJ-XWJUUACAUWUGG,UCUC!UAUACUACA " " -" -.- ""_ "".

I 2219 27.46 2285 2300 231.3 2338

APP mRNA Binds Cytosolic Proteins

Competitor RNA AUUUA Poly U

0 7.2 1.2 7.2 1.2 Pmole

106 kDa - B

32 P.APPRNA Band shim wilh

(2219-2313) "P-APPRNA

Competition of

- ND + * - -

+ ND + + - - if- if- - ND -

FIG. 7. Fine mapping of protein binding region in the 3'-UTR of APP RNA. Panel A, schematic diagram of the 3'-UTR of APP mRNA spanning residues 2219-2338. The sequence of human APP mRNAfrom bases 2285 to 2313 is shown along the top. Panel B, summary of band shifts and competition of radiolabeled APP RNAs indicated by arrows with unlabeled APP RNAs. + indicates competition or band shift of all proteins; - indicates no competition or band shifts; ND indicates not determined. +/- indicates competition of or band shifts of proteins p42, p47, p84, and p104 but not p65 and p73.

or a single AUUUA box in the context of an AU-rich region (6). Messages containing this motif include interferon-y, granulo- cyte-macrophage colony-stimulating factor, and interleukin 3 mRNAs. As mentioned above, the 3'-UTR of APP mRNA con- tains AU-rich sequences as well as four AulTuA boxes, each separated by approximately 50 nucleotides. The region from 2285 to 2313 is relatively AU-rich (69%), although it lacks the canonical AUUUA motifs. The 42-kDa APP RNA-protein com- plex migrates in the vicinity of AUBF.AUUUA RNA complexes. This suggests that APP RNA may be an AUBF ligand. To assess this possibility, we attempted to compete the binding of radio- labeled APP RN&221,23,3, with unlabeled poly(U) or AUUUA RNAs. Previously we have shown that AUUUA RNAs, and to a lesser extent poly(U), competed with radiolabeled AUUUA RNA for binding to AUBF (12). As shown in Fig. 8, 1.2 pmol of competitor RNA successfully prevented the interaction of APP RNA with p42 and p47 but had no effect on its binding to p84 and p104. p65 and p73 were also inhibited by AUUUARNAbut less so by poly(U). These data suggest that p42, p47, p65, and p73 interact with AU-rich sequences, but p84 and p104 do not. In addition, they suggest p42 is AUBF, although p42 could be a distinct AU-specific, binding activity of similar molecular weight.

Presence of APP mRNA-binding Proteins in Murine Cell Lines-Computer alignment of the 3'-UTR of mouse (BALB/c) and human APP mRNAs showed a significant sequence homol- ogy in the region we have mapped (Fig. 9). Therefore, we an- ticipated that murine cell lines would also express APP RNA- binding proteins. Lysates prepared from two murine lines (NIW3T3 and embryonal carcinoma F9 cells) band shifted hu- man APP RNA in a fashion analogous to lysates from human cells (not shown). All six protein-APP RNA complexes were present in approximately the same stoichiometry as that seen in human cells (not shown). A search of the GenBank for addi- tional mRNAs with significant homology to APP RN&228,313, failed to identify any obvious candidates.

Tissue and Cell Distribution of APP mRNA-binding Proteins-We have assayed several human and mouse tumor cell lines (not shown) and tissues for the presence of APP mRNA-binding proteins. Regardless of the origin and species, all tumor cell lines constitutively expressed APP mRNA-bind- ing proteins to levels similar to those observed in the IMR32 cell line (Fig. 1OA). These proteins were present in cytosolic

49 kDa -

32 kDa - 27 kDa -

FIG. 8. p42, p47, p65, and p73 bind AU-rich RNAs. Competition of radiolabeled APP RN~2219-23131 with unlabeled poly(U) and AUUUA RNAs. AUUUAor poly(U) RNAs were preincubated for 10 min with 2 pg of IMR32 lysate prior to a 10-min incubation with 5 x lo4 cpm of APP RNA,,,,,,,,,,. After RNase T1 treatment, the reaction mixture was W cross-linked and electrophoresed on 12% SDS-PAGE. The positions of protein molecular mass standards are shown to the left.

extracts from human brain but absent from human liver or kidney (Fig. 1OB) or mouse kidney, liver, intestine, muscle, heart, or lung (not shown). Of note, whole human brain cyto- solic lysate contained approximately 1/20 as much aggregate APP RNA binding activity as tumor cell lines. All six APP RNA-protein complexes can be seen with brain lysates except that p42 migrated more quickly, and an additional RNA-pro- tein complex was present between p47 and p42. This additional complex could be another brain-specific APP RNA-binding pro- tein or reflect modification of one of the other complexes. Cy- tosol from brain contains a variety of generic nucleases such as RNase Y, A, and R and several other brain-specific nucleases (21, 22). These activities may further cleave the RNase T1 protected APP RNA and generate complexes with novel mobil- ity. The absence of shifts with kidney and liver lysates further suggests that the shifts observed with brain are not due to nonspecific RNA-protein interactions.

DISCUSSION

Here we report that multiple cytosolic activities specifically bind to a 29-base region in the 3'-UTR of APP mRNA. Essen- tially identical data were observed with cytosolic lysates de- rived from different human and murine cell lines, suggesting that these activities may be widely distributed. Activity was detected in normal human brain albeit a t levels far less than seen in tumor lines. We have concluded that the binding factors are proteins based upon their sensitivity to heat and proteinase K and their ability to be covalently cross-linked to APP RNA by U V light.

To identify grossly the location of the APP cis-element(s), progressively shorter 3"UTRAPP RNAs were produced by run- off transcription and used as competitors of radiolabeled APP RN&208,24,1,. Protein binding was unaffected by unlabeled APP RN&208,1,, or RN&208,218, but completely inhibited by unla-

fore, the cis-element must be located between nucleotides 2218 and 2332. We confirmed this directly by demonstrating that radiolabeled APP RN&221,338, was alone sufficient to produce APP RNA-protein complexes. In addition, unlabeled APP RN&221,338, specifically competed with labeled APP RN&,,,, 2471) and RN&221,2338, for binding.

To map the binding element more closely, APP RN&221,2,,,

RN&224,338, were used as competitors of radiolabeled APP

vented the binding of radiolabeled APP RN&221,313,, but APP RN&221,2,, did not. Therefore the core cis-element resides

beled RN&208S2471P RN&2085-2332P and RN&2085-2368Y There-

RN&2219-2300)? RN&2219-2313)2 RN&2219-2338P RN&224€-2313P and

RN&2219-2313)* RN&2219-2338) and RN&2246-23131 pre-

APP mRNA Binds Cytosolic Proteins 24005

(2285) 197

I (23 13)

225

I Human

UC~CUUUCUCUCUUUACAUUCUGGUCUCUACAUUAC~UCTAU Mouse A U U ~ ~ A ~ ~ U C U C U U U A C A U U U U G G U C U C U A U A C U A C A ~ ~ A U . .

I I 209 237

FIG. 9. Human and murine APP RNA share a similar cia-element located equidistant from the stop codon. The boxed sequences are required for binding of all proteins in human APP RNA. Capital letters represent the human sequence. In the mouse sequence, capital letters designate conserved sequences. Numbers on the top and bottom refer to the distance from the stop codon. Numbers in parentheses are as in (19).

B

106 kDa - 80 k D a - 1 11 49 kDa - 32 kDa

27 kDa

1 20 10 40 106 kDa - 80 kDa - 49 kDa - 32 kDa -

Liver 10 40

FIG. 10. Expression of APP mRNA-binding proteins in human tissues and neuronal and leukemia cell lines. Panel A, IMR32, H4, and K562 lysates (2 pgflane) were incubated with radiolabeled APP RN&zz4,,,,,, digested with RNase T1, UV cross-linked, and electro- phoresed on 12% SDS-PAGE as described in the legend to Fig. 1. Panel B, human brain, kidney, and liver lysates were assayed for APP RNA binding activities as described above using radiolabeled APP RNh2,, 2513). The amount of total protein per lane is indicated along the top. H4 lysate is also shown for comparison.

between nucleotides 2285 and 2313. This hypothesis is also consistent with the fact that radiolabeled APP RN&,,,,,,,, RN&,,,,,,,,, and RN&,,,,,,, produced identical RNA-protein complexes after resolution on SDS-PAGE. The only exception to this statement was that p73 exhibited a slightly increased mo- bility with APP RN&,,,,4,,,. This could be due to differential folding and protection from RNase T1 digestion by the two individual RNAs. Radiolabeled APP RN&2219-2284, did not pro- duce any band shifts. These results demonstrated that the re- gion bounded by nucleotides 2285 and 2313 was essential for binding of all proteins. Binding studies as well as competition with unlabeled APP RNAs split the essential region and dem- onstrated that four complexes (p42, p47, p84, and p104) re- quired nucleotides 2285-2300, whereas complexes p65 and p73 also required the region spanning nucleotides 2301 and 2313. Failure of 29 nucleotide APP RN&,,,,,,,, to produce any shift suggests that the element spanning nucleotides 2285 and 2313 is necessary but not sufficient for binding. Such data imply that the folding of the RNAmay be a necessary prelude to successful binding. Alternatively, the entry point for APP RNA-protein interactions is from nucleotides 2285-2313, but the proteins subsequently move upstream. Detailed biophysical studies must await purification of the RNA-binding proteins.

Competition studies with unlabeled AUUUA RNA suggested that four of these complexes (p42, p47, p65, and p73) must recognize similar regions in APP RNA. The AUUUA motif is an

instability determinant located in the 3'-UTR of many labile cytokine and protooncogene mRNAs (5, 6) and may be neces- sary for poly(A) tail shortening (23). Multiple AU-specific mRNA-binding proteins have recently been described (8,9, 12, 24) which have molecular masses between 32 and 50 kDa. These activities are thought to mediate the rapid decay of c-myc mRNA in a cell-free mRNA decay system (8) or phorbol ester- induced, cytokine mRNA stabilization in lymphoid cells (13, 14). Therefore, the interplay of multiple factors with similar binding specificities likely determines the decay rate of differ- ent AU-rich mRNAs. These data predict that p42, p47, p65, and p73 may play a similar role in mediating the decay of APP mRNA. To our knowledge, this is the first time that AU-specific mRNA-binding proteins have been reported in brain-derived cell lines or normal brain tissue. A search of GenBank revealed that a large number of AU-rich mRNAs are expressed in the central nervous system. These include nerve growth factor, insulin, APP, and growth-associated protein 43 mRNAs. The prevalence of cis-elements and trans-factors in brain suggests that post-transcriptional regulation of mRNA stability may play an important role in determining the steady-state levels of these AU-rich mRNAs.

Interestingly, there are no canonical AUUUA motifs in the core APP RNA element we have described. The sequence CU- UUACAUUUU is present from nucleotides 2288 to 2298 and, based upon competition and binding data, may serve as the entrybinding site for complexes with aggregate masses of 42, 47,65, and 73 kDa. The A or C residues are likely important in this element as poly(U) RNA was not a good competitor of p65 and p73, and these nucleotides are highly conserved between murine (BACB/c) and human APP mRNAs. p42 and p47, how- ever, were competed by poly(U) as well as AUUUA RNA. These data suggest that the 42- and 47-kDa complexes must have different binding specificities from the 65-and 73-kDa com- plexes. Possibly the region from 2285 to 2300 merely serves as an entry site for the protein associated with the 42- and 47-kDa complex with subsequent migration upstream. Previously we have shown that AUBF weakly interacts with RNAs containing multiple AUCUA reiterations (25). Therefore, it is possible the CUUUACAUUUU element can substitute for AUUUA motifs.

At this time we cannot definitively determine how many proteins comprise the APP RNA-protein complexes described here. The maximal number is clearly six if each complex is composed of a unique protein. Alternatively, the larger molec- ular complexes may be composed of homo-or heterodimers. For example, the 104-kDa complex could be a dimer of the proteins comprising the 47- and 65-kDa complexes. Different binding requirements of p42, p47, p84, and p104 compared with p65 and p73 indicate that at least two proteins are involved in the formation of these multiple complexes. Moreover, competition experiments utilizing poly(U) and AUUUA RNA suggest in- volvement of at least three different proteins. It is unlikely that all binding proteins can simultaneously occupy one 29-base region at the same time. We propose that each RNA molecule interacts with a t most three proteins a t a time. The combina- tion of affinity and prevalence of binding proteins will then

24006 APP mRNA Binds

determine the quantity of individual complexes observed on SDS-PAGE. It may be possible that the region 5' to this ele- ment is also essential for binding but not required for recogni- tion. Another possibility is that all of these proteins may not be binding to the same RNA molecule and require different motifs in the 29-base element. Purification of and band shift assays with individual activities will answer this issue definitively.

We have identified APP RNA-binding proteins in tumor lines from multiple lineages. However, normal tissues with the no- table exception of brain fail to express detectable levels of bind- ing proteins. These data suggest that transformation or cell growth may up-regulate the activity of these proteins. This hypothesis is consistent with data in the accompanying paper (261, which shows binding protein up-regulation on entry of lymphocytes into the cell cycle. The widespread distribution of these proteins was initially unexpected. However, although the data demonstrate multiple proteins bind APP RNA, this may not be the only available RNA ligand. Second, many cell types outside the brain express APP mRNA and protein. Further study of the regulation of APP mRNA in diverse tissues will be necessary to explain these observations.

The role of the APP-specific, mRNA-binding proteins in the pathogenesis of AD is currently unknown. As shown in the accompanying paper (26), the region that we have mapped appears to act in cis as a destabilizer of APP mRNA in resting cells. This suggests that masking the region would stabilize the message and contribute to an increase in the steady-state levels of APP mRNA. If APP mRNA is comparably translated in rest- ing versus activated cells, enhanced steady-state APP mRNA levels could direct increased APP production and potentially deposition of P-amyloid in the brains of AD patients. Agents that stimulate neurons, glia, or other resident cells to activate this post-transcriptional pathway would be candidate media- tors. As interleukin l and tumor necrosis factor-a are increased in patients with AD (17), these proinflammatory cytokines could potentially subserve this role.

The identified element of APP mRNA is highly conserved between murine and human and is located a t roughly the same distance from the stop codon, 196 nucleotides in human and 208 in mice. Band shif? assays with murine or human cytosolic extracts and human APP RNA demonstrated identical reactivi- ties, suggesting that these proteins subserve similar functions. Construction of chimeras using this protein binding region with different genes and at different positions will be helpful in

Cytosolic Proteins

establishing the function of these proteins. It has been shown recently that globin mRNA chimeras containing the AUUUA motifs of granulocyte-macrophage colony-stimulating factor are unstable only when the destabilizing elements are outside the coding region (7). Cumulatively, these results suggest that the APP mRNA-binding proteins may play an important role in the regulation of APP gene expression.

Acknowledgments-We thank Jennifer Proud and Tingyun Lu for

L. Miller for helpful discussions. expert technical assistance and Drs. Narayan Ramakrishna and David

REFERENCES 1. Ishiura, S. (1991) J. Neurochem. 66, 363-369 2. Neve, R. L., Finch, E. A., and Dawes, L. P. (1988) Neuron 1,669-677 3. Chartier-Harlin, M. C., Crawford, F., Houlden, H., Warren, A,, Hughes, D.,

Fidani, L., Goate, M., Rossor, M., Roques, P., and Hardy, J. (1991) Nature

4. Johnson, S. A., McNeill, T., Cordell, B., and Finch, C. E. (1990) Science 248, 353,844446

854-857 5. Caput, D., Beutler, B., Hartog, K., Thayer, R., Brown-Shimer, S., and Cerami,

6. Shaw, G., and Kamen, R. (1986) Cell 46,659467 A. (1986) Proc. Natl. Acad. Sci. U. S. A . 83, 1670-1674

8. Brewer, G. (1991) Mol. Cell. Biol. 11, 2460-2466 7. Savant-Bhonsale, S., and Cleveland, D. W. (1992) Genes & Deu. 6, 1927-1939

9. Vakalopoulou, E., Schaack, J., and Shenk, T. (1991) Mol. Cell. Biol. 11,3355- 3364

10. You, Y., Chen, C. A., and Shyu, A. (1992) Mol. Cell. B i d . 12, 2931-2940 11. Wodnar-Filipowicz, A., and Moroni, C. (1990) Proc. Natl. Acad. Sci. U. S . A. 87,

12. Malter, J. S. (1989) Science 246, 664-666 13. Malter, J. S., and Hong, Y. (1991) J. Biol. Chem. 266, 3167-3171 14. Stephens, J . M., Carter, B. Z., Pekala, P. H., and Malter, J. S. (1992) J. B i d .

15. Monning, U., Konig, G., Prior, R., Mechler, H., Schreiter-Gasser, U., Masters, Chem. 267,833-341

16. Monning, U., Konig, G., Banati, R. B., Mechler, H., Czech, C., Gehrmann, J., C. L., and Beyreuther, K. (1990) FEBS Lett. 277,261-266

Schreiter-Gasser, U., Masters, C. L., and Beyreuther, K. (1992) J. Bid. Chem. 267,23950-23956

17. Goldgaber, D., Harris, H., Hla, T., Maciaz, T., Donnelly, R., Jacobsen, J., Vitek, M., and Gajdusek, D. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 7606-7610

18. Ramakrishna, N., Saikumar, P., Potempska, A,, Wisniewski, H., and Miller, D. (1991) Biochem. Biophys. Res. Commun. 174,983-989

19. Kang, J . , Lemaire, H. G., Unterbeck, A,, Salbaum, J. M., Masters, C. L., Grzeschik, K. H., Multhaup, G., Beyreuther, K., and Muller-Hill, B. (1987) Nature 326, 733-736

777-781

20. Laemmli, U. K. (1970) Nature 227,680-685 21. Pantopoulos, K., and Georgatsos, J. G. (1992)Eur. J. Biochem. 207,1045-1051 22. Sasso, M. P., Carsana, A,, Confalone, E., Cosi, C., Sorrentino, S., Viola, M.,

Palmieri, M., Russo, E., and Furia, A. (1991) Nucleic Acids Res. 19,6469- 6474

23. Shyu, A.-B., Belasco, J. G., and Greenberg, M. E. (1991) Genes & Deu. 6, 221-231

24. Bohjanen, P. R., Petryniak, B., June, C. H., Thompson, C. B., and Lindsten, T. (1991) Mol. Cell. B i d . 11, 32883295

26. Zaidi, S. H. E., and Malter, J. S. (1994) J. B i d . Chem. 269,24007-24013 25. Gillis, P., and Malter, J. S. (1991) J. Biol. Chem. 266, 3172-3177