THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 261, No. 8, Issue of March 15, pp. 3548-3555 1986 Printed in C?..S.A.

P 1 Plasmid Replication PURIFICATION AND DNA-BINDING ACTIVITY OF THE REPLICATION PROTEIN RepA*

(Received for publication, July 12, 1985)

Ann L. Abeles From the Laboratory of Genetics and Recombinant DNA, Litton Bionetics Znc., Basic Research Program, National Cancer Institute Frederick Cancer Research Facility, Frederick, Maryland 21 701

The minimal P1 replicon encompasses an open read- ing frame for the essential replication protein, RepA, bracketed by two sets of multiple 19-base pair repeated sequences, incA and in&.

This study focused on the interaction of RepA with the incC and incA repeated sequences because earlier studies suggested that incA might control P1 copy num- ber by titrating limiting amounts of RepA and because the incC repeats, which are part of the origin of repli- cation, contain the promoter for repA. RepA is essen- tial for origin function, autoregulates its own synthesis from the promoter, and, when overproduced, blocks origin function.

In this study, RepA was overproduced from an expression vector and purified to 90% homogeneity. The binding of RepA to the DNA encompassing repeat sequences was assayed by monitoring the mobility of protein-DNA complexes on polyacrylamide gels. Dis- tinct species of retarded bands were seen with the maximum number of bands corresponding to the num- ber of repeats present in the target fragment. No evi- dence was found for RepA binding to fragments ,not containing the repeats. This suggests that the specific binding of RepA to the repeats may be involved in each of the diverse activities of RepA.

Stable, unit-copy-number plasmids like F (Timmis et al., 1975, Lovett and Helinski, 1976) and the prophages of P1 and P7 (Prentki et al., 1977; Hedges et al., 1975) are subject to accurate controls over their replication that ensure a low rate of plasmid loss despite their low copy number. Miniplasmids derived from the plasmid prophage of P1 are ‘also stably maintained at 1-2 CopieslEscherichia coli chromosome (Sternberg and Austin, 1981 and 1983). The region of P1 responsible for the stable plasmid maintenance can be divided into two functional units (Austin et al., 1982). One includes the origin and elements controlling replication (Abeles et al., 1984). The other encompasses the genes and site required for accurate partitioning of the daughter plasmids to daughter cells (Austin and Abeles, 1983a, 198313; Abeles et al., 1985). The P1 DNA responsible for the controlled replication of the miniplasmid has been mapped to a region of about 1.5 kilo-

* This research was sponsored by the National Cancer Institute, Department of Health and Human Services, under Contract N01- CO-23909 with Litton Bionetics, Inc. The contents of this publication do not necessarily reflect the views or policies of the Department of Health and Human Services, nor does mention of trade names, commercial products, or organizations imply endorsement by the United States government. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

bases, and its DNA sequence has been determined (Abeles et al., 1984; Austin et al., 1985). This region consists of a 245- base pair origin region, a 959-base pair region encompassing the gene for the essential replication protein, RepA, and a dispensable regulatory element, imA (Fig. 1, Chattoraj et al., 1984).

Part of the origin region, designated incC, and the regula- tory incA determinant contain sets of an imperfect repeated 19-base pair sequence which exert an incompatibility effect on P1 when cloned into’a high-copy-number vector such as pBR322 (Abeles et al., 1984). The incA determinant contains repeats 1-9 with repeats 9-7 oriented in the opposite direction to that of repeats 1-6. The incC determinant contains repeats 10-14 all in the same orientation (Fig. 1). The incA repeats are involved in the control of plasmid copy number. The deletion of seven and a half of the incA repeats raises the copy number to five or six, whereas completely deleting incA results in a copy number of about 10 per host chromosome (Chattoraj et al., 1984; Chattoraj et al., 1985b). In uiuo studies suggest that the incA repeats are responsible for limiting replication by titrating or binding the essential replication protein RepA (Chattoraj et al., 1984). Replication of the mini- P1 plasmids is blocked by an amber mutation in the repA gene (Sternberg and Austin, 1981; Abeles et al., 1984), by additiona1 copies of the incA element in the cell and, surpris- ingly, by overproduction of the RepA from a foreign promoter (Chattoraj et al., 1985a). Studies with protein and operon fusions of repA have shown that the promoter for RepA synthesis is autoregulated (Chattoraj et al., 1985a, 1985b). The promoter for RepA has been mapped to the origin region and the 5’ end of the repA transcript has been located within repeat 10 (Chattoraj et a i , 1985a; Fig. 1).

The minimal P1 origin is located between base pair 366 and the Hind111 site at base pair 606 (Fig. 1) (Chattoraj et al., 1985a). In addition to the five 19-base pair incC repeats, this region contains several interesting features. The repA-distal end contains 2 tandem copies of the sequence TTATCCACAI T at base pairs 387-404. This sequence is proposed to be the recognition sequence for the host dnaA protein (Hansen et al., 1982; Fuller and Kornberg, 1983). This sequence has been found in the origin regions of several other replicons such as F (Murotsu et al., 1981), Rtsl (Kamio et al., 1984), pSClOl (Vocke and Bastia, 1983; Bernardi and Bernardi, 1984), and oriC (Sugimoto et al., 1979). A central 55-base pair region (base pairs 410-464) contains 5 copies of the sequence GATC in the same strand. This sequence is the recognition site for the E. coli deoxyadenine methylase (Marinus and Morris, 1973). These GATC sequences are also found in the origin region of several Enterobacteriaceae (Zyskind et al., 1983) and in Rtsl (Kamio et al., 1984). Since P1 miniplasmids cannot lysogenize a dam- strain, it is thought that the methylation

3548

Purification and DNA-binding Activity of the P1 RepA Protein A

3549

FIG. 1. A, a schematic map of the P1 replicon. The minimal origin fragment is indicated by the bracketed region and labeled ori. The incC and incA repeated sequences are marked by small arrows and labeled. The large solid arrow marks the repA open reading frame. Aha111 and Hind111 sites are included as landmarks. The numbers indicating base pairs cor- respond to those in the sequence below. B, the DNA sequence of the replication region of P1. The DNA sequence for the P1 AhaIII-Hind111 fragment encompass- ing the P1 replicon is shown with the predicted amino acid sequence for RepA shown below the DNA sequence. The minimal origin extends from base pair 366 to base pair 611 and is marked by bent arrows. The postulated dnaA rec- ognition sequence and the methylation sites are boxed. The 19-base pair repeat sequences of imC and incA are under- lined with arrows and numbered. The C- T change at base pair 457 for the rep-30 mutant is indicated above the sequence. The DNA region deleted in the rep-11 mutant is base pairs 556 to 598. The -35 and -10 regions of the repA promoter are ouerlined and labeled. The start of the repA message is indicated by a zigzag arrow beginning at base pair 598 and the proposed Shine and Dalgarno (1974) se- quence begins at base pair 653. The lo- cation and base change for the amber mutant repA103 (base pair 997, Abeles et al., 1984) is shown above the sequence. Several restriction sites used for isolat- ing DNA fragments are indicated above their recognition sequences. The pre- dicted amino acids in RepA are shown by the abbreviations all in lower case letters.

A h a l l l

~PIPIP.ACACCCGGATTGCATTGAGCATGTATTTCCGACCTATGCTGATGAGCAATGT~CTCATGTTCTTACCGAAGAGGATT~TTCAGCACTGAAGAACGAGAAGGCG 110 130 1 50 170 190

TTGATCGCTGCATTGGTGTGATTTGTTCTTCGGTAAGTGATGAGTTATTCCCTAATGTGCCTGAATATGGTGGTATTGGATACCAA~CCTGTACGAGGGCGATGAGCTT 210 230 250 270 290

310 Taql Hinll 370 390 410

430 450 (rep-301 Haelll

C A A T A A T C A G G T C C A T A C ~ C A A T T ~ A T A T ~ C T ~ T T G C A ~ G C G C C A C G T C T G G ~ A A G T G T A T C G C G A T G T G T G C T G G A G G G A A A A

Ddel 510

530 550 -35 irOp-71) -10 Hied1 630 '

C G A T G T G T G C T G G A G G G A T A A A A A T G T G T G ~ ~ C G G ~ A T ~ T ~ T ~ G G C Q W k T A ~ T G T ~ C G G G A A A G C T T GGTAGTTATCACCACTTATAA *

710

met a s n gln ser p h e i l e r e r a s p i l e l e u t y r a l a a s p i l e glu s e r l y s a l a l y r g l u

CTA ACA GTT AAT TCA AAC AAC ACT GTG CAG CCT GTA GCG TTG ATG CGC TTG GGG GTA TTC GTG CCG AAG CCA TCA AAG AGC AAA l e u l h r "a1 as" s e r 8511 a s n I h r v e l g1n p r o v a l a l a I D Y met a r g l e u g l y V a l p h e v e l p r o l y s p r o s e r l y s $ e l l y s

GGA GAA AGT AAA GAG A T 1 GAT GCC ACC AAA GCG TTT TCC CAG CTG GAG ATA GCT AAA GCC GAG GGT TAC GAT GAT ATT AAA ATC 810 830 850 870 890

g l y g l u s e r l y s glu i l e a s p a l a l h r l y s a l a phe ser g l n l e u g l u i l e a l a l y s 818 g l u g l y t y r a s p a s p i l e l y s i l e

730 750 770 790

910 ACC GOT CCT CGA CTC GAT ATG GAT ACT GAT TTC AAA ACG TOG ATC GGT GTC ATC T I C GCG TTC AGC AAA TAC GGC TTG TCC TCA t h r g1y p r o a r g l e u a s p met a s p t h r a s p p h e l y s l h r l r p i l e g l y v a l i l e l y r a l a p h e s e r l y s t y r g l y l e u s e r r e r

930 950 970

AAC ACC ATC CAG TTA TCG TTT CAG GAA TTC GCT AAA GCC TGT GGT TTC CCC TCA AAA CGT CTG GAT GCG AAA CTG CGT TTA ACC a s n I h r i l e g l n l e u E e l p h e g I n Q1u p h e a l a l y E a l a c y s g l y p h e P r o s e ( l y S a r g l e u a s p a l a l y s l e u erg l e u I h r

990 irePA 103); E 1030 I050

1070 ATT CAT GAA TCA CTT GGA CGC TTG CGT AAC AAG GGT ATC GCT TTT AAG CGC GOA AAA GAT GCT AAA GGC GGC TAT CAG ACT GOT i l e h i 9 g1u s e r l e u g1y a r g l e u a r g a s n l y s g l y i l e a l a phe l y s a r g g l y l y s a s p 818 l y r g l y g l y t y r gln l h r g1y

1090 1110 1130

1150 CTG CTG AAG GTC GGG CGT TTT GAT GCT GAC CTT GAT CTG ATA GAG CTG GAG GCT GAT TCG AAG TTG TGG GAG CTG TTC CAG CTT l e u l e u l y s V a l g l y a.9 p h e a s p a l a a s p l e u a s p l e u i l e 91" l e u g l u 818 asp % e l l y 0 l e u t r p g I u I C " p h e gln l e u

1230 1250 1270 1290 1310 GAT TAT CGC GTT CTG TTG CAA CAC CAC GCC TTG CGT GCC CTT CCG AAG AAA GAA GCT GCA CAA GCC AT1 TAC ACT TTC ATC GAA a s p t y r a r g v e l l e u l e u gln h i s h i s a l a l e u a r g a l a l e u p r o l y s l y r g l u a l a 818 gln a l a l i e t y r t h r phs i l e g l u

1170 1190 1210

AGC CTT CCG CAG AAC CCG TTG CCG CTA TCG TTC GCG CGA ATC CGT GAG CGC CTG GCT TTG CAG TCA GCT GTT GGC GAG CAA AAC s e r l e u p r o gin a s n p r o l e u p r o l e u s e r p h e 818 a r g i l e a r g g l u a r g l e u a l a l e u gln s e r a l a Y B I g l y g l u g i n asn

1330 1350 1370 - 1390 PVUll

COT ATC ATT AAG' AAA GCG ATA GAA CAG CTT AAA ACA ATC GGC TAT CTC GAC TOT TCT ATT GAG AAG AAA GGC COG GAA AGT TTT 1410 1430 1450 1470

a r g i l e i l e l y s l y a a l a i l e g i u gln l e u l y r t h r i l e g l y t y r l e u a s p c y s s e r i l e g l u l y s lyr g l y a r g g l u s e r p h e

1490 A M

~

GTA ATC GTC CAT TCT CGC AAT CCA AAG CTG AAA CTC CCC GAA TAA GTGTGTGCTGGAGGGAAACCGCATTAAAAAGATGTGTGCTGCCGGGAAGG v a l i l e v a I h i s s e r a r g asn p r o l y s l e u l y s l e u p r o glu .

1530 1550 1570

0 , /

1590 1610 Ddel 1630 1650 1670 CTTGTCCAATTTCCTGTTTTTGATGTGCGCTGGAGGGGGACGCCCCTCAGT~GCCCAGACTTTCCCTCCAGCACACATCTGTCCATCCGCTT~CCCTCCAGTGC~

HgiAl

- 1

1830 CTCCAGCACACATCGAAGCTGCCGGGCAAGCCGTTCTCACCAGTTGATAGAGAGTGAAGC~

0 status of these sites may play a role in origin function. Additionally, a single C-T base change in one of the GATC sequences at base pair 45" blocks origin function (Austin et al., 1985). The five 19-base pair repeated sequences compris- ing incC are found between base pairs 504 and 607. This region includes the repA promoter whose most likely position puts the beginning of the -35 segment at base pair 562, the -10 at base pair 586, and the beginning of the repA message at base pair 598 (Chattoraj et al., 1985a). A mutation that blocks replication, rep-11, is a deletion that effectively re- moves 2 of the repeats including the putative repA promoter. The replication defect is not complemented by supplying RepA in trans, showing that this segment is essential for origin function as well as RepA synthesis (Austin et al., 1985).

I n uiuo studies indicated that the minimal P1 origin requires RepA for function and that the regulatory activity of the incA control locus could be overcome by increasing RepA concen- tration (Chattoraj et al., 1984, 1985a). This study explored the hypothesis that RepA interacts with the DNA in both of these sequences.

EXPERIMENTAL PROCEDURES Chemicals-Affi-Gel blue, 100-200 mesh, and Bio-Gel P-60, 50-

100 mesh, were obtained from Bio-Rad. Cellulose phosphate P-11

was obtained from Whatman. The heparin-agarose was a gift from Robert Yuan (University of Maryland). The set of protein standards used for SDS'-polyacrylamide gel electrophoresis was the low-molec- ular-weight electrophoresis calibration kit from Pharmacia. The 32P- nucleotides (triethylammonium salts) obtained from Amersham were the >5000 Ci/mmol adenosine 5'-[y-32]triphosphate, the >800 Ci/ mmol cytidine 5'-[a-32P]triphosphate, and the >800 Ci/mmol thy- midine 5'-[a-32P]triphosphate.

Enzymes-Restriction enzymes were obtained from Bethesda Re- search Laboratories, Boehringer Mannheim, or New England Biolabs and were used as recommended by the suppliers. T4 polynucleotide kinase was from PL-Biochemicals. Lysozyme and bovine serum al- bumin were obtained from Sigma. Calf intestine alkaline phosphatase and E. coli DNA polymerase I Klenow fragment were obtained from Boehringer Mannheim and T4 DNA ligase from Bethesda Research Laboratories.

Media and Buffers-The cells were grown in L broth (Gottesman and Yarmolinsky, 1968) with 20 to 150 gg/ml ampicillin. Plasmid DNA and DNA fragments for binding reactions were suspended in TE buffer (Maniatis et aL, 1982). The sample buffer dye for the protein gels was 0.125 M Tris, pH 6.8; 4% SDS; 40% glycerol; 0.14 M P-mercaptoethanol; and 0.01% bromphenol blue. The binding reac- tions were performed in binding buffer which was 20 mM Tris, pH 8;

The abbreviations used are: SDS, sodium dodecyl sulfate; L broth, Luria broth; RPB, RepA purification buffer; TE, TE buffer.

3550 Purification and DNA-binding Activity of the P1 RepA Protein 40 mM KCl; 10 mM MgC12; 1 mM dithiothreitol; 0.1 mM EDTA; 0.3 pg/ml bovine serum albumin; and NaC1, (50 mM if not otherwise indicated). The stop dye for the binding reactions was 20 mM Tris, pH 8; 40 mM KCl; 10 mM MgC12; 0.1 mM EDTA; 0.1% bromphenol blue; and 50% glycerol. The buffer for the polynucleotide kinase reactions was described by Maxam and Gilbert (1980). The buffers used for the RepA purification (RPB) were 50 mM Tris, pH 7.5; 10% glycerol; 1 mM EDTA; 1 mM P-mercaptoethanol; and various amounts of NaCl. These buffers are referred to as 50 mM NaC1-RPB, etc., to indicate the concentration of NaCl present in the buffer.

Strains and Vectors-The strain of E. coli K12 for the Xp, expres- sion vector was OR1265 which is F-strRhis-su-ilu-galp308::IS2 (hN7N53~1857cro27-cryptic) (Reyes et al., 1979). The XpL vector pRK16-F (Fig. 2 4 ) was a gift from Kenneth Abremski and Ronald Hoess (Dupont). The M13mplO and M13mpll were from Messing and Vieira (1982). X-P1:5Rrep-ll was described by Austin et al., 1985. The P1 repA sequences cloned into the expression vector were excised from pALA102 (wild-type sequence) and pALA137 (repA103 muta- tion), (Fig. 2 A ) (Abeles et al., 1984). Other plasmids used for DNA fragments for the binding reactions were pBR322 (Bolivar et al., 1977), pALA12, pALA18, and pALA145 (Abeles et al., 1984). The constructions of pALA148 and pALA335 are described in Fig. 2, B and C. pALA318 is a modification of pALA139 (Chattoraj et al., 1984) in which the pBR322 XmaIII site at pBR322 base pair 939 was converted to a BamHI site by the addition of a linker.

Gel Electrophoresis-Gel electrophoresis for isolating DNA frag- ments or for monitoring the DNA-RepA binding reactions was done in 5% polyacrylamide gels in Peacock buffer (Peacock and Dingman, 1968). The SDS-polyacrylamide gels for observing RepA were cast according to the method of Laemmli (1970) and contained 12.5% acrylamide. The SDS-polyacrylamide gels were run in a Tris-glycine buffer (25 mM Tris, pH 8.8; 0.19 M glycine; 0.05% SDS), stained in 2.5% Coomassie Blue, 45% methanol, 9% acetic acid, and fixed in 10% methanol, 15% acetic acid.

Determination of Protein Concentration-Protein concentrations of RepA in the various fractions were estimated visually by comparing the band intensities on the gels to that of the M, 30,000 standard. The protein concentrations in the fractions used for the binding studies were determined by the method of Schaffner and Weissmann (1973).

P-60 Bio-Gel Columns-These columns were prepared as described by Silhavy et al. (1984) using Bio-Gel P-60 equilibrated with TE. The columns were packed by centrifuging at 800 X g for 5 min in the swinging bucket rotor and were washed 3 times with 100 pl of TE. The DNA samples were loaded on the columns and centrifuged again for 5 min. The columns were washed twice with 50 pl of TE and centrifuged again each time for 5 min. The DNA was precipitated from the 150-pl effluent with ethanol.

Preparation of DNA-Plasmid DNA purification was described previously (Abeles et al., 1984). The plasmids were digested by restric- tion enzymes, and the desired DNA fragments were isolated and extracted according to the method of Maxam and Gilbert (1980). After ethanol precipitation, the fragments were resuspended in TE and used for cloning. The methods for cloning the DNA fragments and subsequent transformations have been described earlier (Abeles et al., 1984). Fragments to be labeled with 32P were resuspended in 50 p1 of TE and purified over a 1-ml Bio-Gel P-60 column.

Labeling and Purification of DNA Fragments-Approximately 1 pg of DNA was end-labeled with 300 to 500 pCi of [32P]ATP in 30-50 pl of kinase buffer (Maxam and Gilbert, 1980) with 10-20 units of polynucleotide kinase. After the reaction, the mixture was purified over Bio-Gel P-60 columns to remove the unincorporated ATP and then precipitated with ethanol. Fragments with single-end label were isolated by resuspending the DNA in the appropriate buffer and digesting it with restriction enzymes. The digests were submitted to electrophoresis on 5% polyacrylamide gels, and the gels were placed against Kodak XAR-5 film for 3-5 min. The developed film was then placed over the gel, the desired bands were located and excised, and the DNA was extracted by the crush-and-soak method of Maxam and Gilbert (1980). The extracted DNA was precipitated with ethanol and then resuspended in TE and diluted for the binding reactions.

Labeling of DNA-Preliminary experiments were done with DNA that had been labeled at the 3' end with 32P. The reactions were performed at 15 "C for 1 to 2 h in 50-pl volumes containing 1 pg of DNA; 50 mM Tris, pH 7.5; 5 mM MgC12; 10 mM P-mercaptoethanol; 0.1 mg/ml bovine serum albumin; 10 mM each dATP and dGTP; 7 pl

(70 pCi) each of the [32P]dTTP and [32P]dCTP; and 5 units of DNA polymerase I Klenow fragment.

Induction of RepA-For small preparations, 5 ml of L broth con- taining 20 pg/ml ampicillin were inoculated with 50 pl of a fresh overnight culture of the desired strain. The culture was grown with shaking at 31 "C until the A6w = 0.6 (about 2 h). A portion of the cells was removed and the rest of the culture was placed in a 42 "C shaker for up to 3 h. The proteins present in samples of these cells are shown in Fig. 3.

For large preparations, 250 ml of L broth with 150 pg/ml ampicillin in 2-liter flasks were inoculated with 2.5 ml of fresh overnight cultures and shaken at 31 "C until the A ~ w = 0.6. The flasks were then transferred to another air shaker that had been preheated to 42 "C, and the incubation was continued for about 3 h. The cultures were centrifuged at 2000 X g for 10 min. The cell pellets were resuspended in 15-20 ml of 10 mM MgSO,. Pellets from a pair of flasks were combined and centrifuged again at 7700 X g for 10 min. The super- natant fluid was removed, and the pellets were stored at -70 "C.

Protein-DNA Binding Reactions-The selective binding of DNA fragments by the RepA protein was assayed in 20 p1 of binding buffer containing 0.1-5 ng of linear DNA, end-labeled with 32P. The reaction mixtures without the RepA were placed in the bottom of 1.5-ml Eppendorf tubes and placed in a centrifuge. The RepA solutions were diluted before use to give ahout 4 ng/pl. Portions of diluted protein solutions containing 4-80 ng of RepA were pipetted onto the sides of the tubes, and the reactions were started by a 10-s centrifugation. The components were allowed to react at room temperature 20-22 "C for 2-20 min. 3 p1 of the stop dye was added to the side of each tube and centrifuged for 5 s. 50 pl of Peacock buffer with 50 mM NaCl was placed in each well of the gel just before the samples were added. Six to 10 pl of the samples were immediately loaded on a premn 5% polyacrylamide gel and submitted to electrophoresis at 1 v/cm for several h. The gels were dried and autoradiographed with Kodak XAR-5 film with an intensifying screen at -70 "C for 18-48 h.

RESULTS

Cloning and Overproduction of the RepA Protein The construction of pALA131, the plasmid used for the

overproduction of RepA, is illustrated in Fig. 2 A . The EcoRI- BamHI fragment of pALA102 (Abeles et al., 1984) containing the P1 repA gene was cloned into the inducible expression vector pRKl6-F under the control of the phage XpLpromoter. The cloned fragment contains 29 base pairs of pBR322 pre- ceding the 1245-base pair PI-Hind111 fragment encompassing repA (Abeles et al., 1984; Chattoraj et al., 1985a) and 346 additional base pairs of pBR322. The fragment does not contain the normal promoter for repA. As a control, plasmid pALA150 was constructed (Fig. 2 4 ) using the equivalent DNA fragment from pALA137 which contains the amber mutation repA103 (Abeles et al., 1984). Plasmids pALA131 and pALA150 were transformed into OR1265, a strain containing a cryptic X with the e1857 repressor. An SDS-polyacrylamide gel of total cellular proteins from these strains with no plas- mid, the vector alone, and the P1 plasmids is shown in Fig. 3. A novel M, 32,000 protein is visible in lane f (from plasmid pALA131) and appears to comprise about 5% of the total cellular proteins. No similar band is visible in uninduced cells or other controls. Previous studies indicated that the product of the repA gene had an apparent weight of M, 32,000 on acrylamide gels (Abeles et al., 1984).

RepA Purification Step 1. Preparation of Lysate-The cell pellet from a 500-

ml induced culture (1.8 g wet weight) was thawed on ice for 1 h and then resuspended by stirring with a glass rod in 5 ml of 0.2 M NaCI-RPB containing 2 mg/ml lysozyme. After 20-min incubation on ice, the suspension was transferred to a 7 X 1.5-cm plastic tube and sonicated at a power rating of 5.5 with a Branson sonifier equipped with a microtip. Five 30-s soni- cations were performed interspersed with 1-min cooling pe-

Purification and DNA-binding Activity of the PI RepA Protein 3551

A

D

Hindlll

EcoRl f i Hindlll

Hincll

Hincll

pALA 140

I 5.2 kb I

&J c P V U l l

FIG. 2. Plasmids constructed for this work. A, cloning the repA and repA 103 genes into an expression vector. Plasmids pALA102 (containing the wild-type repA sequence) and pALA13T (containing the amber mutant, repA103, Abeles et al., 1984) were digested with HamHI and partially digested with EcoRI. The fragments encom- passing repA were isolated on the gel and ligated into pRKlG-F, which had also been digested with RamHI and EcoRI, to form pALA131 (wild-type sequence) and pALAl50 (repAl03). pRK16-F is a deriva- tive of pRK6 (Abremski and Hoess, 1983). B, pALA148. The HincII fragment from the P1 origin region, base pairs -228 to 598, was cloned into M13mplO (Messing and Vieira, 1982) and excised as the EcoRI-Hind111 fragment which was then cloned into pBR322 between the EcoRI and HindIII sites. C, pALA335. The HincII to HindIII fragment of X-Pl:SRrep-ll (Austin et al., 1985) was isolated from the phage and cloned into the HincII-Hind111 site of M13mplO. It was then excised as the EcoRI-Hind111 fragment and cloned into pK04 (McKenny et al., 1981). The striped segments represent P1 DNA; the solid segments, X DNA; the thin line, pBR322 DNA; and the dotted segment, the E. coli galactokinase gene. The location of the repAlO3 mutation and the Xp, promoter are indicated. The numbers inside each circle are the dimensions in kilobase pairs.

riods in ice water. The proteins present in the sonicate are shown in Fig. 4, lane b. 4 M NaCl was added dropwise with stirring to bring the final NaCl concentration to 0.9 M. The high-salt conditions were needed to release the RepA from the cell debris. The suspension was stirred over ice for 1 h and then was centrifuged at 35,000 X g for 1 h. The proteins in a sample of the supernatant fluid are shown in Fig. 4, lane c. RPB buffer with no NaCl was added dropwise to the supernatant fluid with stirring until the conductivity was equal to that of 0.2 M NaCl-RPB. This solution was stirred slowly for 1-12 h at 5 "C.

Step 2. Affi-Gel Blue Chromatography-The solution was loaded on a 3-ml (4 x 1 cm diameter) Affi-Gel blue column equilibrated with 0.2 M NaCl-RPB, washed with 50 ml of 0.2 M NaCl-RPB and eluted with a 40-ml gradient of 0.2-2.5 M NaCl-RPB. 2-ml fractions were collected and every second one was analyzed by SDS-polyacrylamide gel electrophoresis. The fractions containing RepA, as judged by the M , 32,000 band, were pooled (Fig. 4, lane d, fractions 5-15, about 20 ml)

a b c d e f g h i - 94

- 67

-43

- 30

- 20

-14

FIG. 3. Overproduction of RepA. 5-ml cultures of OR1265 cells without plasmid or with pALA150, pALA131, orpRK16-F were grown a t 31 'C in L broth containing 20 palm1 ampicillin to an A m = 0.2. 1-ml samples were removed and the remaining culture was incubated a t 42 "C for 3 h. Half-ml samples were placed into Eppendorf tubes and centrifuged for 30 s. The supernatant fluid was removed, and the cell pellet was resuspended in sample buffer dye and vortexed for 30 s. The samples were placed in a boiling water bath for 3-5 min, vortexed again for 30 s, and centrifuged for 30 s. 10-pI aliquots were assayed for RepA by SDS-polyacrylamide gel electrophoresis. RepA was identified by the presence of a M , 32,000 band on the gels. Lane g contains the Pharmacia low-molecular-weight electrophoresis standards. The sizes of the hands in kilodaltons are marked along the side. The M,30,000 band contains 1.6 pg of protein. The lanes contain aliquots of the following OR1265 lysates. With no plasmid: lane a, induced; lane b, uninduced. With pRK16-F: lane c, uninduced; lane d , induced. With pALA131: lane e, uninduced; lane f , induced. With pALA1.50: lane h, uninduced; lane i, induced. The RepA protein is visible in lane f as an intense band at about M. 32,000.

a b c d e f g h i

94 - 87 -

43 -

30 -

20 -

14-

FIG. 4. Sample fractions from steps during the purification of RepA. Lanes a and i contain the protein molecular weight stand- ards. Their respective sizes in kilodaltons are shown along the sides of the figure. Lune b, 1 pl of the cell sonicate. Lane c, 2 p1 of the supernatant after the 35,000 X g centrifugation. Lane d. 10 pl of the pooled fractions from Affi-Gel blue column. Lune e, 10 p1 of super- natant remaining after low-salt precipitation. Lane f, 3 p1 of the resuspended pellet after low-salt precipitation (step 3). Lane g, 10 pl of the pooled phosphocellulose fractions. Lune h, 5 p1 of fraction 11 from the heparin-agarose column.

and dialyzed at 5 "C overnight against 3 changes of 0.1 M NaCl-RPB.

Step 3. Precipitation of RepA-During the dialysis, material containing most of the RepA formed a precipitate. This was collected by centrifugation at 17,000 x g for 25 min. After

" "

' C I ?!I"-

3552 Purification and DNA-binding Activity of the P1 RepA Protein

removing the supernatant fluid (Fig. 4, lane e), the pellet was resuspended in 3 ml of 0.5 M NaCl-RPB and transferred to a 20-ml beaker on ice. The suspension was gently stirred at 5 "C overnight or until most of the protein had gone back into solution. The solution was then dialyzed overnight against 0.25 M NaCI-RPB to lower the NaCl concentration and ensure RepA binding to the phosphocellulose column (step 4). The proteins present are shown in Fig. 4, lane f.

Step 4. Phosphocellulose Chromatography-The solution was loaded on a 4-ml (5 X 1 cm diameter) phosphocellulose column which was equilibrated with 0.25 M NaCl-RPB. The column was washed with 20 ml of the same buffer and the RepA was eluted with a 30-ml gradient of 0.25 to 1.15 M NaCl-RPB. One-ml fractions were collected and 10-pl aliquots were analyzed by SDS-polyacrylamide gel electrophoresis, as before. The fractions judged to have RepA because of the presence of the M , 32,000 band were pooled (Fig. 4, lane g, fractions 15-26, about 12 ml) and dialyzed against 0.25 M NaCl-RPB at 5 "C overnight.

Step 5. Heparin Agarose Chromatography-The protein solution was next loaded on a 2.5-ml (3 x 1 cm diameter) heparin agarose column. The column was washed with 30 ml of 0.25 M NaCl-RPB and the protein was eluted with a 16-ml gradient of 0.25-1.15 M NaCl-RPB buffer. One-ml fractions were collected and analyzed as above. The peak fractions (9- 13) containing RepA were stored at 0 "C (Fig. 4, lane h).

Typical peak fractions contained 0.3-0.5 mg of protein/ml as judged by Schaffner and Weissmann (1973) protein con- centration determinations. The protein in these fractions was judged by SDS-polyacrylamide gel electrophoresis to be greater than 90% homogenous. The recovery of RepA is approximately 20% as judged by the intensity of the gel bands in the crude and purified extracts. A sample of the protein solution was used for amino terminus sequence analysis which showed the first 15 amino acids to be those predicted by the DNA sequence for RepA (Abeles et al., 1984 and Fig. 1). The amino acid composition was also determined and is consistent with that predicted (Table I).

DNA-binding Actiuity of RepA

Earlier genetic studies suggested that RepA interacts with the 19-base pair repeat sequences present in both the incC

TABLE I Amino acid composition of RepA

Predicted Found"

Ala 24 23 A rg 16 14 Asn Asp 1: } 26 cys 2 NDb Gln Glu ;; } 33

G ly 17 29 His 4 5 Ile 22 18 Leu 34 31 Lys 29 23 Met 3 4 P he 14 13 Pro 11 10 Ser 21 19 Thr 11 10

Ty r 8 8 Val 11 11

The amino acid analysis was based on one 24-h hydrolysis. ND, not determined.

Trp 2 ND

origin and incA control sites (Chattoraj et al., 1984, 1985a). The DNA-protein binding assay described under "Experimen- tal Procedures" was used to look for this binding in uitro. In this assay, RepA is allowed to bind to various 32P-labeled linear DNA fragments and the mixtures are submitted to electrophoresis in a 5% polyacrylamide gel. Under these con- ditions, the protein-DNA complexes remain together and migrate more slowly through the gel than the free DNA fragments. The positions of the protein-DNA complexes and the free DNA can be visualized by autoradiography.

Binding to the Origin Region-An earlier report indicated that partially purified RepA bound to P1 DNA containing the origin region (Austin et al., 1985). The DNA sequence of the origin region is shown in Fig. 1. The functional origin lies between base pairs 366 and 611 and includes the five 19-base pair repeat sequences which constitute incC. The ability of RepA to bind subfragments of the origin region was examined to determine whether the binding was limited to the region encompassing the incC repeats. Fig. 5 (IV and V) shows the binding reaction for the origin-region fragment with all 5 repeats compared with the remaining portion that contains

I

350-488 bp

a b c d

I

0 102050 ng RepA

0 I02050 0102050 0 102050 0 35 58

ng RepA ng RepA ng RepA ng RepA

VI

350-608 bp

a b c

WL,

M

Y

c- 0 35 56

ng RepA

FIG. 5. Comparison of RepA binding to parts of the origin region. The RzP-labeled DNA fragments were mixed with RepA and allowed to bind for 5 min a t 20 "C as described under "Experimental Procedures." Groups I and II: the P1-Aha111 (base pair 87) to HindIII (base pair 606) fragment of pALA335 was isolated on the gel and digested with Hinfl. The mixture of fragments was end-labeled with [R'P]ATP and then digested with DdeI. The Hinfl to DdeI and DdeI to HindIII bands were isolated for the binding studies. Groups I I I and I V the P1-Aha111 to HindIII fragment of pALA148 was isolated and digested with TaqI. The mixture of fragments was end-labeled with ["PJATP and then digested with DdeI. The TaqI to DdeI and DdeI to HindIII bands were isolated for the binding studies. Group V the RamHI to EcoRI fragment of pALA145 was isolated on a gel and end-labeled with ["'PIATP. Group VI: the Hinfl to HindIII fragment of pALA335 was isolated on a gel and end-labeled with [B2P] ATP. The amounts of RepA used are shown beneath each lane. Group I 0.4 ng of the origin region HinfI to DdeI fragment. Group II: 0.2 ng of the incC D d d to HindIII fragment of the rep-11 mutant which has a 43-base pair deletion (see Fig. 1). Group III: 0.5 ng of the origin region TaqI to DdeI fragment. Group I V 0.4 ng of the incC DdeI to HindIII fragment (wild-type sequence). Group V: 0.8 ng of the wild- t m e incC fragment. Group VI: 0.7 ng of the rep-11 mutant incC fragment. The base-pair numbers shown at the top of each group give the endpoints for the fragments. The fragments used in goups I I and VI have an internal 43-base pair deletion in incC. For groups V and VI, the electrophoresis was performed for a longer time in order to spread out the complexes for easier visibility.

Purification and DNA-binding Activity of the P1 RepA Protein 3553

no repeats (111). The autoradiograph also shows the binding for the equivalent 2 subfragments from the origin mutant rep- 11 (Austin et al., 1985) that has a deletion that removes about two of the repeat sequences (base pairs 556 to 598, Fig. 1). For both sets of DNA, the RepA only bound the fragments containing the repeat sequences and not the remaining origin fragments. There are 5 distinct retarded species when RepA is bound to the wild-type incC region (Fig. 5, V) and 3 distinct species when RepA is bound to the rep-11 DNA (three repeats, Fig. 5, I1 and VI). Since the number of distinct bands equals the number of repeats present in the DNA, it seems likely that each band corresponds to a unique DNA-RepA complex; the least retarded DNA-RepA complex corresponds to a form in which RepA is bound to one site, and the next complex represents RepA bound to 2 sites, and so forth. As expected, at the low RepA concentrations, the lower order (least re- tarded) complexes are more numerous, and the higher orders increase at higher concentrations.

Binding to the incA Control Region-A similar set of exper- iments was performed with a fragment containing all 9 of the incA repeats (Fig. 6) and with fragments of the incA region (Fig. 7). Binding of RepA to the intact incA region did not result in distinct retarded species as seen for incC but in a complex pattern of bands and smears (Fig. 6). These are probably due to the structure of the fragment, which contains 9 repeats in 2 groups of different orientation (Fig. 1). If the loading order of individual repeats is not fixed and the mobil- ity of species is dependent on which repeats are occupied, a complex pattern would be expected. Subfragments that had groups of incA repeats in a single orientation, such as the fragment that contained repeats 1 through 4 (base pairs 1682- 1806, Fig. 7, IO, again showed distinct species corresponding to the individual repeats present. Similar results were ob- tained with repeats 1 through 3 (Fig. 7, ZV). The data indicate that RepA binds specifically to DNA encompassing the repeat sequences in both the incC and incA regions. RepA formed a series of complexes with all the fragments of incA that con- tained repeat sequences but did not bind the neighboring PuuII to Tag1 (base pairs 1379 to 1442) fragment from the end of the repA open reading frame, which does not contain the repeats (Fig. 7, V). RepA can bind to DNA fragments if they contain a t least one intact repeat (Chattoraj et al., 1985a). Thus, RepA binds to the fragment from the end of incA (base

I I1 Inc C Inc A

a b c d e a b c d e **

I t ' e . .

"

FIG. 6. Binding of RepA to complete incC and incA DNA. The incC fragment was the 168-base pair BamHI-EcoRI fragment from pALA145, and the incA fragment was the 312-base pair RamHI fragment from pALA18. The DNA was labeled with '*P a t both ends. The amounts of RepA added were: lane a, 0; lane b, 4; lane c, 12; lane d, 24; and lane e, 40 ng. Group I, 0.8 ng of incC; group 11, 0.8 ng of the incA fragment.

incl

I I1 111 Iv V VI bp bP bp bp bp bP

1U2-1(u)i 1(u)2-1000 1507-1721) 1728-1812 1379-1U1 1379-1571 a b e d b e d a b e d a b e d a b a b e d e

- r" I

' I - 0 8 1 8 4 0 0 8 1 6 4 0 0 8 1 6 4 0 0 8 1 8 4 0 U 4 0 0 4 8 1 8 3 2

WRWA W R W A W R W A WRWA W Rep* W R W A

FIG. 7. Binding to the incA fragments. The reactions were performed as for Fig. 5. Groups I, II, and V: the P1-PuuII (base pair 1379) to Hind111 (base pair 1851) fragment of pALA12 was isolated on the gel and digested with HgiAI. The mixture was end-labeled with ["PIATP and digested with TaqI. The PuuII to TaqI, TaqI to HgiAI, and HgiAI to Tag1 fragments were isolated. Groups III and IV: the P1 AluI fragment (base pairs 1507-1812) which contains the entire incA sequence was ligated to BamHI linkers and cloned into pBR322 (Abeles et al., 1984). This BamHI fragment was isolated and end-labeled with [32P]ATP. The fragment was then digested with Sau3A, and the two fragments were isolated. Group V I the PuuII to BomHI (BglI) fragment of pALA318 was isolated on the gel and labeled with [32P]ATP. The amounts of RepA used are as shown beneath each lane. Group I, 0.4 ng of the TaqI to HgiAI fragment containing repeats 9 to 5 (partial). Group I I 0.2 ng of the HgiAI to Tag1 fragment containing repeats 5 (partial) to 1. Group I I I 0.6 ng of the RamHI (AluI) to Sau3A fragment containing repeats 9 to 4. Group IV: 0.2 ng of the Sau3A to BamHI (AluI) fragment containing repeats 3 to 1. Group V: 0.1 ng of the PuuII to TaqI fragment from the end of repA. Group VI: 0.7 ng of the fragment from pALA318 containing repeat 9 and part of 8.

pairs 1729 to 1812, Fig. 7, IV) and to the incA fragment (PuuII to BgZI, base pairs 1379 to 1571, Fig. 7, VZ) which has repeat 9 and part of 8.

Binding to Repeats Requires Intact RepA Protein-Binding assays were performed using crude fractions derived from induced cells containing equivalent constructs with the wild- type (pALA131) and amber repA (pALA150) plasmids to demonstrate that the binding was due to RepA and not contaminants. Fractions were prepared by step elution from Affi-Gel blue columns. Fig. 8A shows the proteins present in these fractions. Fig. 8B shows the results of the binding experiments using the fractions eluted at 2.0 M NaCl and dialyzed against 0.15 M NaCl-RPB. The wild-type extract formed larger-molecular-weight complexes with the P1 incA fragment (upper band) but not with the pBR322 BamHI-SalI fragment (lower band). Similar amounts of extract from the cells with the mutant plasmid failed to show specific binding under these conditions.

Properties of the RepA Binding Reaction-RepA-DNA bind- ing was performed at various salt concentrations. These ex- periments indicate that RepA binds more efficiently to incA and incC DNA at the lower salt concentration, about 60 mM, than at 250 mM NaCl (data not shown). An attempt to measure the time required for RepA to bind the DNA showed that the binding to incA or incC is essentially complete within 2 min (data not shown).

Estimated Molar Ratio of RepA to DNA-Fig. 6 shows the

Purification and DNA-binding Activity of the PI RepA Protein 3554 a

04-

87 -

43-

30-

20-

14 -

b c d e f g

A B

FIG. 8. Preliminary RepA purification and DNA binding. A. SDS-polyacrylamide electrophoresis of Affi-Gel blue fractions from RepA purification. Sonicated extracts of induced cells carrying plas- mids pALA131 or pALA150 (amber mutant) were centrifuged and the supernatent fluid was loaded onto Affi-Gel blue columns equili- brated with 0.15 M NaCI-RPH. The proteins were eluted off in four steps with 4 ml each 0.5 M - , 1.0 M-, 2.0 M - , and 3.0 M-NaCI RPR. The gel displays the proteins found in 2-pl aliquots of the 1.0 and 2.0 M NaCI-RI’H fractions. Lane a, protein standards; lanes b and d, 1.0 M NaCI-RPR fractions from two different lysates of induced cells carrying pALA131; lanes c and e, 2.0 M NaCI-RPR fractions from the same induced cells; lanes f and g, 1.0 and 2.0 M NaCI-RPR fractions, respectively, from lysates of induced cells with pALA150 (amber mutant ). The fractions were dialyzed against 0.15 M NaC1-RPB before gel analysis. R, RepA binding assay comparing the 2.0 M NaCI-RPR Iractions from cells with pALA131 and pALA150. The protein ex- tracts shown in A, lanes e and g, were each diluted in the binding buffer to give estimated protein concentrations of 150 pg/ml. The DNA used was a mixture of the BarnHI-in4 fragment (312 base pair) and the RamHI-Sal1 (276 base pair) pBR322 fragment from pALA18 (Aheles rt a!., 1984). The gel-isolated hands were mixed, and the DNA was end-labeled with [?’P]ATP by DNA polymerase I, Klenow frag- ment. Each reaction contained 20 ng of DNA. Lane a, DNA only; lanrs h-r, DNA with 2, 3, 4, and 5 1 1 of the diluted RepA solution; lonrs f a n d g, 3 and 5 pl of the diluted 2.0 M NaC1-RPR fraction from the cells with the amber mutant pALA1SO. The binding reaction was performed and assayed as described under “Experimental Proce- dures.”

binding reactions using different amounts of RepA. Forty ng (1.25 pmol) of RepA was able to form binding complexes with nearly 0.8 ng (4 fmol) of the complete incA fragment (Fig. 6, ZZ). The incC reactions (Fig. 6, I ) also contained about 0.8 ng (7 fmol) of DNA. The 40 ng of RepA only bound about half this DNA or approximately the same number of moles of incC as incA. The maximum estimate of the number of protein molecules bound per DNA would be 312 molecules or approx- imately 35 per incA repeat. It should be emphasized that there is no indication as to the proportion of the RepA molecules that retain binding activity during isolation, or the proportion of bound versus free protein a t equilibrium in the assays. The actual number of molecules bound per repeat might, therefore, be considerably less than the maximum estimate.

DISCUSSION

The data presented here indicate that the purified RepA protein binds specifically to P1 DNA that contains the re-

peated sequences found in the incA and origin (incC) regions. Binding to the incA repeats may explain the regulatory effect of the incA locus on replication. It has been suggested that RepA concentration limits replication and that the incA re- peats are responsible for limiting RepA concentration by binding the protein (Chattoraj et al., 1984). The effects of RepA binding to the repeats in the origin (incC) are more complex. Three different activities at the origin have been proposed. First, RepA is required for origin function, suggest- ing that origin-RepA binding is essential for the formation of an initiation complex (Abeles et al., 1984). Second, RepA acts to regulate its own synthesis from a promoter located within the incC repeats. Third, RepA, when overproduced, can block origin function (Chattoraj et al., 1985a). Under the conditions used here, RepA binding to the origin occurs exclusively on DNA fragments encompassing 19-base pair repeats. Thus, it seems probable that all three of the RepA activities are caused by binding to the repeats. Binding to one or more of the three repA proximal repeats (10-12) is presumably responsible for autoregulation, as this binding would occlude the promoter that spans the repeats. However, the role of these three repeats is not exclusively for autoregulation of RepA synthe- sis, as shown by the fact that the rep-11 deletion that is internal to them is cis acting and origin defective. Blocking of origin function occurs at high RepA concentration, sug- gesting that initiation is prevented when all the repeats are occupied. Thus, the remaining function, initiation, may re- quire some (unknown) subset of repeats to be occupied with others left free. Alternatively, RepA might bind to these repeats and then migrate to some other position to initiate replication.

The presence of repeated sequences in the vicinity of rep- lication origins is a feature common to a large group of plasmids. In the cases of pSClOl (Vocke and Bastia, 1985) and R6K (Kelley and Bastia, 1985; Filutowicz et al., 1985), these repeats have been shown to be binding sites for plasmid- encoded proteins required for replication. A subset of plasmids also have a second group of repeats, homologous to those of the origin, that seem to be exclusively involved in copy- number control. P1, F, and Rtsl fall into this class (Chattoraj et al., 1984; Tsutsui et al., 1983; Terawaki and Itoh, 1985). Since these are all low-copy-number plasmids, it is possible that, during the evolution of the replicons, the control repeats arose by duplication of the origin repeats as a strategy to limit copy number.

The precise nature of the interactions at the origin that lead to initiation and shut-off of origin function remain to be resolved. It is probable that specific host factors involved in replication bind to the essential origin sequences outside the region of the repeats.

Acknoudedgments-1 would like to thank my colleagues Stuart Austin and Dhruba Chattoraj for helpful advice and careful reading of this manuscript, Daryl MacCrehan for technical assistance, Judith Swack for the Schaffner-Weissmann assays, and Alokesh Mazumdar for help with the DNA-protein binding assays. I also thank Ronald Hoess and Kenneth Abremski for the gift of their vector pRK16-F, Robert Yuan for the heparin agarose, Terry Copeland for the amino acid sequence analysis, and Julie Ratliff for secretarial assistance.

REFERENCES

Abeles, A. L., Snyder, K. M., and Chattoraj, D. K. (1984) J. Mol. Biol.

Abeles, A. L., Friedman, S. A., and Austin, S. J. (1985) J. Mol. Bid.

Abremski, K., and Hoess, R. (1983) Gene 25.49-58 Austin, S., and ALeles, b.. (1983a) J. Mol. Riol. 169, 353-372 Austin, S., and Aheles, A. (1q83b) J. Mol. Riol. 169, 373-387

173.307-324

185,261-272

Purification and DNA-binding Activity of the PI RepA Protein 3555 Austin, S., Hart, F., Abeles, A., and Sternberg, N. (1982) J. Bacteriol. Marinus, M. G., and Morris, N. R. (1973) J. Bacteriol. 114 , 1143-

Austin, S. J., Mural, R. J., Chattoraj, D. K., and Abeles, A. L. (1985) Maxam, A,, and Gilbert, w. (1980) Methods EnzYmol. 65,499-560 152,63-71 1150

J. Mol. Biol. 1 8 3 , 195-202 McKenny, K., Shimatake, H., Court, D., Schmeissner, U., Brady, C., Bernardi A., and Bernardi, F. (1984) Nucleic Acids Res. 12 , 9415- and Rosenberg, M. (1981) in Gene AmPlification and Analysis

9426 (Chirkijian, J. G., and Papas, T. S., ed) Vol. 2, pp. 384-417, Bolivar, F., Rodriguez, R. L., Green, P. J., Betlach, M. C., Boyer, H. E1sevier/North-Holland~ Amsterdam

W., Crosa, J. H., and Falkow, S. (1977) Gene 2 , 95-113 Chattoraj, D., Cordes, K., and Abeles, A. (1984) Proc. Natl. Acad. Sci. Murotsu* T'y Matsubarat K'7 'Wisake> H.3 and Takanami3 M. (1981)

Peacock, A. C., and Dingman, C. W. (1968) Biochemistry 7,688-674

Messing, J., and Vieira, J. (1982) Gene 19, 269-276

U. S. A. 81,6456-6460 Gene 15,257-271

Chattoraj, D. K., Snyder, K. M., and Abeles, A. L' (1985a) Prentki, p., Chandler, M., and Care, L. (1977) Mol. Gen. Genet. 152 , Acad. Sci. U. S. A. 82,258&2592

A. L. (1985b) in Sequence Specificity in Transcription and Trans- 408

Series (Calendar, R., and Gold, L., ed) Vol. 30, pp. 271-280, Alan 514 R. Liss, Inc., New York

Filutowicz, M., Davis, G., Greener, A., and Helinski, D. R. (1985) 1342-1346 Shine, J., and Dalgarno, L. (1974) Proc. Natl. Acad. Sci. U. S. A. 7 1 ,

Nucleic Acids Res. 13, 103-114 Silhavy, T. J., Berman, M. L., and Enquist, L. W. (1984) Experiments Fuller, R. S., and Kornberg, A. (1983) Proc. Natl. Acad. Sci. U. S. A. with Gene Fusions, pp. 203-204, Cold Spring Harbor Laboratory,

Gottesman, M. E., and Yarmolinsky, M. B. (1968) J. Mol. Biol. 3 1 , Sternberg, N., and Austin, S. (1981) Plasmid 5 , 20-31 487-505 Sternberg, N., and Austin, S. (1983) J. Bacteeriol. 153, 800-812

Hansen, E. G., Hansen, F. G., and von Meyenburg, K. (1982) Nucleic Sugimoto, K., Oka, A., Sugisaki, H., Takanami, M., Nishimura, A., Acids Res. 10, 7373-7385 Yasuda, Y. , and Hirota, Y. (1979) Proc. Natl. Acad. Sci. U. S. A.

Hedges, R. W., Jacob, A. E., Barth, P. T., and Grinter, N. J. (1975) 76* 575-579 Mol. Gen. Genet. 141,263-267 Terawaki, Y., and Itoh, Y. (1985) J. Bacteriol. 162, 72-77

Kamio, Y., Tabuchi, A., Itoh, Y., Katagiri, H., and Terawaki, Y. u. s, A, 72, 2242-2246 Timmis, K., Cabello, F., and Cohen, S. (1975) Proc. Natl. Acad. Sci. (1984) J. Bacteriol. 158 , 307-312

Kelley, W., and Bastia, D. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, Bacterial, 155, 337-344 Tsutsui, H., Fujiyama, A., Murotsu T., and Matsubara, K. (1983) J.

2574-2578 Laemmli, U. K. (1970) Nature 2 2 7 , 680-685

Vocke, C., and Bastia, D. (1983) Proc. Natl. Acad. Sci. U. S. A. 80,

Lovett, M. A., and Helinski, D. R. (1976) J. BacterioL 127,982-987 Vocke, C., and Bastia, D. (1985) Proc. Natl. sei. u. s. A. 8 2 , Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) MoEecuZar 2252-2256

Cloning: A Laboratory Manual, PP. 448, Cold Spring Harbor Labo- Zyskind, J. W., Cleary, J. M., Brusilow, W. S. A., Harding, N. E., and ratory, Cold Spring Harbor, NY Smith, D. W. (1983) Proc. Natl. Acad. Sci. U. S. A. 80, 1164-1168

Chattoraj, D. K.7 Pal, s. K.9 Swack, J. A.3 Mason, R. J.3 and A b e k Reyes, o., Gottesman, M., and A & ~ ~ , s. (1979) virology 95, 400- 71-76

lation UCLA Symposia On and New Schaffner, W., and Weissmann, C. (1973) Anal, Biochem, 5 6 , 502-

80,5817-5821 Cold Spring Harbor, NY

6557-6561