THE JOURNAL OF BIOLOGICAL CHEMISTRY

Printed in U. S. A. Val. 258, No. 4, Issue of February 25. pp. 2357-2363,1983

Cloning and Nucleotide Sequence Analysis of the Dog Insulin Gene CODED AMINO ACID SEQUENCE OF CANINE PREPROINSULIN PREDICTS AN ADDITIONAL C-PEPTIDE FRAGMENT*

(Received for publication, September 13, 1982)

Simon C. M. Kwokl, Shu Jin Chang, and Donald F. Steiner From the Department of Biochemistry, University of Chicago, Chicago, Illinois 60637

A 4.0-kilobase HindIII/EcoRI-cleaved dog genomic DNA fragment was shown to contain the dog insulin gene by restriction mapping using a human insulin cDNA probe. This fragment was subsequently cloned in a X vector, and the nucleotide sequence of the dog insulin gene was determined. As in several other spe- cies, the insulin gene of the dog is interrupted by two intervening sequences, one of 151 base pairs located in the 5’ untranslated region and the other of 264 base pairs occurring within the codon of the 7th amino acid of the C-peptide. Translation of the nucleotide sequence in one frame revealed the primary structure of canine preproinsulin. An interesting feature of the coded amino acid sequence is that it predicts a C-peptide of 31 amino acids, 8 residues longer than that reported by Peterson et aL (Peterson, J. D., Nehrlich, S., Oyer, P. E., and Steiner, D. F. (1973) J. BioL Chem 247,4866-4871). The additional octapeptide sequence, Glu-Val-Glu-Asp- Leu-Gln-Val-Arg, is located NHz-terminal to the 23-res- idue C-peptide sequence described in the earlier report. Its coding sequence is interrupted by the second inter- vening sequence. The arginine at position 8 suggests that a trypsin-like cleavage may separate the NH2-ter- minal octapeptide from the remainder of the C-peptide during the post-translational processing of dog proin- sulin in the pancreas. The revised C-peptide sequence suggests that the proinsulin C-peptide is more highly conserved in length and overall sequence than was previously supposed.

The development of recombinant DNA techniques and their successful application to the cloning and nucleotide sequence determination of the rat I and I1 (1 ,2) , human (3,4), chicken ( 5 ) , and hagfish’ insulin genes have provided valuable information on the molecular evolution of insulin at the nu- cleotide level. With the exception of the gene for rat insulin I, all insulin genes studied so far are interrupted by two IVS,2 a smaller one within the 5’ untranslated region of the mature mRNA and a larger one of considerably more variable length

* This work was supported by Grants AM 13914 and AM 20595 from the United States Public Health Service. The costs of publica- tion of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertise- ment” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

$ Recipient of‘ United States Public Service Postdoctoral Fellow- ship AM06577. 0 Recipient of United States Public Service Postdoctoral Fellow-

ship AM06154. ’ S. J. Chan, personal communication.

__

The abbreviations used are: IVS, intervening sequence; EDTA, ethylenediamine tetraacetic acid; SSC, 150 mM NaCl, 15 mM sodium citrate, pH 7.0; kb, kilobase; bp, base pair.

which splits the codon of the seventh amino acid of the C- peptide. The rat insulin I gene lacks the second intron.

The dog insulin gene is of particular interest in this connec- tion. In 1972, Peterson et al. reported the sequence of a comparatively short dog proinsulin C-peptide which contained only 23 rather than the usual 31 amino acids (6). They suggested that an apparent deletion of 8 amino acid residues at or near the NH2 terminus of the dog proinsulin C-peptide might have been due to a deletion in the gene or, alternatively, could have resulted from further proteolytic processing of the C-peptide or from autolytic degradation during its isolation. However, since the sequence which apparently had been deleted wouId be expected to contain the splicing site of the second IVS, this shortened C-peptide could also have resulted from a deletion event involving the entire second IVS as well as portions of the surrounding coding sequence.

In order to investigate these possibilities, we have cloned and determined the nucleotide sequence of the dog insulin gene. We report here the entire nucleotide sequence of this gene and the primary structure of dog preproinsulin derived from the nucleotide sequence.

EXPERIMENTAL PROCEDURES

Materials-Bacteriophage Charon 21A and host strains were kindly provided by Dr. F. Blattner, University of Wisconsin. Strains for preparing in. uitro packaging extracts, NS428 and NS433, were gifts from Dr. N. Sternberg, Frederick Cancer Research Center. Restriction endonucleases were purchased from New England Biolabs or Bethesda Research Laboratories. Plasmid pBR322 DNA was ob- tained from Bethesda Research Laboratories. Escherichia coli DNA polymerase I, T4 DNA ligase, calf alkaline phosphatase (lyophilized), and T4 polynucleotide kinase were products of either New England Biolabs or Boehringer Mannheim. Proteinase K and ribonuclease A were obtained from Beckman Instruments and P-L Biochemicals, respectively. [a-””P]dCTP and [y-”‘P]ATP (specific activity, 3000 Ci/ mmol) were purchased from New England Nuclear and Amersham

Preparation of Dog Genomic DNA-Intact dog genomic DNA was prepared by a modified procedure of Blin and Stafford (7). Briefly, spleen tissue from an adult mixed breed dog was frozen in liquid nitrogen and pulverized with dry ice. The pulverized tissue was then added slowly, with mixing, to a 100-ml solution containing 100 mM NaCl, 50 mM Tris-HC1, 100 mM EDTA, pH R.0,0.5% sodium dodecyl sulfate, and 100 pg/rnl of proteinase K, prewarmed to 55 “C. After mixing thoroughly, the solution was allowed to stand at 55 “C over- night. The mixture was then extracted three times with redistilled phenol, once with chloroform, and dialyzed against 10 mM Tris-HC1, pH 7.5, 1 mM EDTA. The dialyzed DNA was further purified by digestion with 100 pg/ml of ribonuclease A at 37 ”C for 2 h and then with 100 pg/ml of proteinase K in the presence of 0.510 sodium dodecyl sulfate and 25 mM EDTA at 55 “C for 2 h. The DNA solution was extracted twice with phenol, once with chloroform, and dialyzed extensively against 1 m M Tris-HC1, pH 7.5, and 0.1 mM EDTA. DNA concentration was determined by its absorbance at 260 nm.

Restriction En.donuclease Mapping of Dog Insulin Gene-DNA samples (30 pg) were digested with various restriction endonucleases (2 units/pg of DNA) overnight under the conditions suggested by the

Corp.

2357

by guest on June 12, 2020http://w

ww

.jbc.org/D

ownloaded from

2358 Dog Preproinsulin Gene

manufacturers. The DNA fragments were then separated on a 1 or 2% agarose gel and transferred to nitrocellulose by the method of Southern (8). Hybridization was carried out essentially as described previously (9), except 0.5 X SSC was used instead of 0.1 X SSC in the washing steps.

Preparation of HindIII/EcoRI-digested 4.0-kb Dog DNA Frag- ment-Dog genomic DNA were digested sequentially with restriction endonucleases HindIII and EcoRI. The digested DNA samples were extracted with phenol, applied to an 8-mm thick 18 agarose (Seakem) gel. and electrophoresed at 20 mA for 15 h. The lane containing size marker (HindIII-digested ADNA) was cut out, stained with 1 pg/ml of ethidium bromide, and visualized under UV light. Three 5-mm thick slices covering the range of 3.4-4.6 kb were then cut from the remaining unstained lanes containing the dog DNA fragments. The three fractions of dog DNA fragments were then electroeluted sepa- rately inside a dialysis tubing a t 20 mA for 15 h. The eluted DNA samples were concentrated with 2-butanol, extracted with phenol, and then with chloroform and dialyzed against 1 mM Tris-HCI, pH 7.5,O.l mM EDTA. Aliquots from each fraction were taken to check for insulin-related sequences by the restriction endonuclease mapping procedure described above. Only the fraction containing the insulin gene was used in cloning as described below.

Preparation of Phage Charon 21A DNA and HindIII/EcoRI- cleaved Arms-Phage Charon 21A were propagated as described in the detailed protocol provided by Dr. F. Blattner. The phage DNA and phage arms were prepared according to the procedure of Maniatis et al. (IO). For the preparation of phage arms, purified phage DNA was digested sequentially with HindIII and EcoKI. The phage arms were then isolated by sucrose gradient centrifugation, dialyzed, and ethanol precipitated.

Formation and in Vitro Packaging of Recombinant DNA-The partially purified 4.0-kb HindIII/EcoRI-cleaved dog DNA fragments containing the insulin gene were ligated to the purified Charon 21A phage arms by a modified procedure of Maniatis et al. (IO). A mixture of 1.2 pg of dog DNA fragments and 11.6 pg of phage arms was first annealed a t 42 "C for 1 h in 22.5 pl of ligase buffer, then 1 pl of 25 mM ATP, 1 pl of 25 mM dithiothreitol and 0.5 1-11 of T4 DNA ligase (2 units) were added, and the mixture was incubated a t 9 "C for 15 h. The ligated DNA was heated a t 70 "C for 10 min followed by chilling in ice before packaging, in order to increase the efficiency of in vitro packaging (11). For in vitro packaging, the procedure of Enquist and Sternberg (11) was followed exactly, using 0.5 or 1 pg of ligated DNA per packaging reaction.

Screening, Isolation, and Analysis of the Recombinant Phage- The recombinant phages were plated on 15-cm NZCYM Petri dishes as described by Maniatis et al. (IO) and were screened with the in situ plaque hybridization technique of Benton and Davis (12) as modified by Blattner et al. (13). It was found that most of the false positive plaques can be eliminated by using 1 X SSC instead of 3 X SSC in the washing step. A positive clone was picked and rescreened at low plaque density for two more cycles to achieve high purity. Large amounts of DNA were then prepared in I-liter lysates and analyzed by restriction endonuclease mapping as described above.

Nucleotide Sequencing of the Cloned DNA-The cloned 4.0-kb HindIII/EcoRI insert was subcloned into the HindIII/EcoRI sites of plasmid pBR322 as follows. A mixture of 1 pg of recombinant phage DNA and 0.1 pg of plasmid pBR322 DNA was digested sequentially with restriction endonucleases HindIII and EcoRI. After phenol extraction and ethanol precipitation, the digested DNA fragments were religated with T4 DNA ligase as described above. Aliquots of the ligated DNA were used for the transformation of freshly thawed frozen competent HBlOl cells prepared by the method of Morrison (14). Tetracycline-sensitive colonies were further screened by analyz- ing DNA prepared from 2-ml overnight cultures.

Large scale preparation of plasmid DNA was carried out by the cleared lysate method (15) and equilibrium centrifugation in ethidium bromide-CsC1 gradients (16). DNA sequence analysis was performed using the chemical modification method of Maxam and Gilbert (17). All experiments were camed out in accordance with National Insti- tutes of Health guidelines for recombinant DNA research.

RESULTS AND DISCUSSION

T o detect the dog insulin gene, we used human preproin- sulin cDNA as the hybridization probe. Since the amino acid sequence of dog insulin differs from that of human by only 1 residue (alanine instead of threonine at the COOH terminus of the B-chain), human preproinsulin cDNA should cross-

hybridize readily with the dog insulin gene under reduced stringency conditions. When dog genomic DNA was digested with various restriction endonucleases and the DNA frag- ments were subsequently electrophoresed on agarose gels, transferred to nitrocellulose, and hybridized with ,"'P-labeled cloned human preproinsulin cDNA, distinct hybridizing bands were observed (Fig. 1). From the results of single and double digestion procedure, a partial restriction endonuclease map of the dog insulin gene was constructed as shown in Fig. 2. Restriction endonucleases, EcoRI, BclI, and BgZII, used in- dividually, produced single hybridizing bands of approxi- mately 16,28, and 33 kb, respectively. However, no hybridizing band was observed with restriction endonucleases, SalI, XhoI, and XbaI, probably because fragments produced by these enzymes were too large to enter the agarose gel or to be transferred efficiently to nitrocellulose. Since only one hybrid- izing band was observed in either single or double digestions of dog genomic DNA with restriction endonucleases, BamHI, HindII, KpnI, EcoRI, BclI, and BglII, it is likely that there is only one insulin gene in the dog genome.

The restriction map suggested that three fragments con- taining the dog insulin gene would be suitable for cloning. These were the 4.5-kb BamHI fragment, the 12.0-kb Hind11 fragment, and the 4.0-kb HindII/EcoRI fragment. The latter was chosen for cloning because it could be readily inserted

0 s \ I: I

FIG. 1. Insulin-specific hybridizing fragments in dog ge- nomic DNA digests. Dog genomic DNA (30 pg) was digested with the indicated restriction endonucleases. The digested DNA was elec- trophoresed on a 1% agarose gel, transferred to nitrocellulose, and hybridized with '"P-labeled human preproinsulin cDNA. After wash- ing, the nitrocellulose filter was exposed to x-ray film with intensifying screens for 7 days.

omHI EcoRI BclI KpnI BqIX Hindm 4 . b c 4 . c .1

-4.0 Kb-

FIG. 2. Restriction endonuclease map of the dog insulin gene within genomic DNA. The map was constructed by single and double digestions of dog genomic DNA with various restriction en- donucleases as described under "Experimental Procedures." The box encloses the coding sequence of the dog insulin gene.

E i!i \ C ii

16 kb

1 2

4.5 4 3

by guest on June 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Dog Preproinsulin Gene 2359

into phage Charon 21A after cleavage with the same enzymes. The 4.0-kb HzndIII/EcoRI fiagment was partially purified from total genomic DNA by agarose gel electrophoresis and electroelution. From 240 pg of genomic DNA, 3.9 pg of the 4.0-kb HindIII/EcoRI fragment was obtained. This fragment was subsequently ligated into phage Charon 21A HindlII/ EcoRI-cleaved arms, packaged in vitro, and recombinant phages were screened as described under “Experimental Pro- cedures.”

After screening 65,000 recombinant phages, one positive clone was identified. It was plaque-purified and designated Ch21A-DI278 or simply D1278. A restriction endonuclease map of DI278 is shown in Fig. 3A. Preliminary DNA sequence analysis indicated that Dl278 contained the entire coding sequence of the dog insulin gene in the 5’ to 3‘ orientation as shown. In order to simplify the DNA sequencing work, the 4.0-kb HindIII/EcoRI insert was subcloned into the HindlII/ EcoRI sites of pBR322. The recombinant plasmid, designated pD1284, was used for DNA sequencing employing the strategy outlined in Fig. 3B. The nucleotide sequence of the 1.29-kb Sstl fragment containing the entire insulin gene was deter- mined, in most cases, for both strands. The sequence of the dog insulin gene and its translation into preproinsulin in one reading frame are shown in Fig. 4.

The length of the dog insulin gene is estimated to be 899 bp, including the putative capping and poly(A) addition sites which have been assigned on the basis of their homology with

the rat, human, and chicken insulin genes (1-5). Thus at the 5‘ end of the gene we have identified a “Goldberg-Hogness” box (TATAAAG) (18) at position -27 which is identical in sequence with those of the rat and human insulin genes, although the chicken insulin gene has the alternative sequence (TATAATT). Located 21 bp downstream fiom the “Goldberg- Hogness” box is a tetranucleotide, AGCC, which is identical with the transcription initiation sites of the rat 11, human, and chicken insulin genes. The distance between the “Goldberg- Hogness” box and AGCC sequence varies only from 21 to 23 bp in length in the insulin genes sequenced thus far. We have tentatively assigned the “A’ in the AGCC sequence as the capping site.

In eukaryotes the hexanucleotide sequence, AATAAA, is believed to be a signal for termination of mRNA transcription with poly(A) addition beginning about 20 bp further down- stream (19). The distance between the termination codon and the AATAAA box varies considerably; it is 32-33 bp in rat, 53 bp in human, 60 bp in chicken, and 83 bp in dog insulin gene. In the case of the anglerfish (20) and hagfish (21), these distances are 198 bp and 503 bp, respectively. Inasmuch as the distance between the AATAAA box and poly(A) addition site is 14 bp in both the rat and human insulin genes, we have tentatively assigned the poly(A) addition site at the corre- sponding position in the dog insulin gene.

Like all insulin genes studied so far with the exception of the gene for rat insulin I, the dog insulin gene is intempted

A 5’- 3‘

n U Y W

- < 3 c“---------l t”--------, - - f 3 < I > - c--“-----.L

FIG. 3. Restriction endonuclease map and strategy tor nucleotide sequence analysis of the dog insulin gene. A. restriction endonuclease map of clone DI278. The restriction endonuclease sites within the 4.0-kb HindIII/ EcoRI insert of clone DI278 were determined by restriction endonuclease mapping analysis using the unique sites of HindII, AccI, and EcoRI as reference points. The filled and opened boxes represent coding and untranslated sequences, respectively, of the dog insulin gene as determined by DNA sequencing. The 5’ to 3’ orientation of the gene is indicated by the arrow. B, strategy for nucleotide sequence analysis of the dog insulin gene. Either intact plasmid pD1284 DNA or isolated 1.29-kb SstI fragment was cleaved with the enzyme indicated by the uerticaE arrows, labeled at, the 5‘ end and eleaved again with a second enzyme to produce single-end labeled fragment(s1 for nucleotide sequence analysis by the procedure of Maxam and Gilbert (17). The horizontal arroujs indicate the direction of each sequence analysis; approximately 200 bp were determined per sequence analysis. IVS-1 and IVS- 2 denoh the positions of the two intervening sequences while P, B, C, and A indicate coding regions for prepeptide, B-chain, C-peptide, and A-chain of insulin, respectively.

by guest on June 12, 2020http://w

ww

.jbc.org/D

ownloaded from

2360 Dog Preproinsulin Gene

tcccgcagacccagcactggggaaatgatccagaaa

t t g c a g c c l c a g c c t c c g ~ c c a t c t g c c ~ c c c c c t c a t ~ g c c a g g c ~ g ~ g g g c t c g g g ~ g

- 1 e o

- 5 0

1 C-g~aggagggtC~agCagC~Cc~AGCCCCCGG~ACCATCTGC~CCCCGACAC~G

C C C C C A A A ~ A C g t c t g t c c c c a c g g g c t b c c c g c c g c c ~ c c t c c c c g ~ ~ a g c c t g t g c ~ c

1,o 1 5 0

t c a a g g c a g c a g g a g g a g ~ a g a g c t g c ~ ~ c g g g g c c t t l g c g g g g t g g ~ c ~ c ~ g g g t g ~ g

50

r e o

g g g g c c g t g c c c c t t a c c a g c c t c a a c c c t g c c t g t c c c c a g G T C G C C A T G G C C c T c T G G MetAlaLeuTrp

2 7 0 M e t A r g L e u L e u P r o L e u L e u A l a L e u L e u A l a L e u r r p R l a P r o A l a P ~ o T h ~ A r g A l a ATGCCCCTCCTGCCCCTGCTGGCCCTGCTGGCCCTCTGGGCGCCCGCGCCCACCCGAGCC

3 ? 0 P h e V a l A s ~ C l n H i s L e u ~ y s C l y S e r H l s L e ~ V a ~ G l ~ A l a L ~ u T y r ~ ~ ~ v a l c y ~ ~ ~ y TTCGTTAACCAGCACCTGTGTGGCTCCCACCTGGTAGAGGCTCTGTACCTGGTGTGCGGG

3 5 0 C l u A r g C 1 ~ P h e P h e T y r T h r P r o L ~ ~ A i a A r g A r g G l ~ V ~ ~ ~ l " n ~ ~ i ~ ~ ~ ~ ~ ~ C A G C C C G C C T T C T T C T A C A C G C C T A A G G C C C G C A G G G ~ G G T G G A G G A C C T G C A G G g t g ~ g

4 ? 0 4 2 0 c c c c c g c c g c c c c c g c c c t g g c t c c c t a c c t g g c c c c a g g g g c a g g c c a g g t g g ~ a ~ t a t

5 ? 0 taaaaagaaaaatgactttcccttggtctacatcctgcaagggaccagctccttggtcag

5 7 0 g g t c a g a c ~ c c a a a a g c c l g a g g g c a g c ~ t c c c a c c t t g g c a c c a c c t ~ g g g g c c t g g ~ =

6 ? 0 g c c a c t g g E a t g g g g t t g ~ a g t a g g c g g g a c a c a c t c t ~ t c c c t g a c c ~ t g a c c c g c t ~ t

650 , a ~ ~ r g A s p V ~ l ~ ~ u L e u A 1 e C l y A l a P r o ~ l y ~ l u ~ l y ~ ~ y

ccgcctgg~tcctccgcagTGAGGGACGTGGAGCTGGCCGGGGCGCCTGGCGAGGGCGGC

7 ? 0 7 7 0 L e u C l n P r o L e u A l a L e u ~ l u C l y A l a L ~ u G l n L y ~ A ~ ~ G l y I l e V a l ~ l ~ G l n C y s C y ~ CTCCAGCCCCTGGCCCTGGAGGGGGCCCTGCAGAAGCGAGGCATCGTGGAGCAGTGCTGC

T h r S e r 1 l k C y s S e r L e u ~ y r G l ~ L e ~ G i ~ A ~ ~ T y r C y ; A ~ ~ 800 A C C A G C A T C T G C T C C C T C T A C C A G C T G G A G A A T T A C T G C A A C T A G G G G ~ G C G G G G G G C ~ G

G A C ~ T G G C ~ G C A C C T G C T ~ C A G G T C A C G ~ T G G C C G C A A ~ C C T T C G G C T ~ T C T G C A C C C ~ A

AGTGATTC-CCCT~TGAATGAGCcctagtggtgCtgtctgtgc~gcgcagggg~t . 1

850

9 0 0

950 g a g g t g t g g g c c a g g g g t c c t t c c a g g ~ a c ~ c c ~ t g t t t ~ c t g t t c t c t ~ a c a c ~ ~ g ~ ~ ~

10,o 1 0 7 0 ccccaaacttggcccctgcccactgggtgcccaaaggcaagctcctgcccattgtcggct

1 l e 0 g c c c c c t g c c c c a g g t g c t a g ~ a g g t c c c a t g g c c c c t g c t g c t t c a g c a c a g g a c a g a g

1170

a a g g a c c t c t t t t t c t c t g c g g g g c c t g g g g g c t g g t t g g g a g c a g a t t t c c c t a g c t c a

aaagcctt

FIG. 4. Nucleotide sequence of the dog insulin gene. The complete sequence of the dog insulin gene and its translation into preproinsulin are presented in the 5' to 3' direction. Flanking regions

coding regions are shown in capital letters. TATAAA and AATAAA and intervening sequences are displayed in lower case letters while

boxes are underlined. The putative capping site is labeled as position 1 and the poly(A) addition site is indicated by an asterisk (*). Amino acid residues shown in bold type represent a portion of the C-peptide previously considered to be deleted ( 6 ) .

by two IVS. The first IVS starts 42 bp downstream from the putative capping site, as in the case of the human insulin gene. In the case of the rat and chicken insulin genes the first IVS begins at 43 bp and 37 bp downstream, respectively, from the capping site. According to the generalization that an IVS begins with GT and ends with AG (22), the first IVS probably ends at position 193, only 6 nucleotides from the initiation codon. Another possible acceptor AG sequence occurs at position 171, 28 nucleotides from the initiation codon. How- ever, in view of the extensive homologies among the dog, human, and rat sequences, upstream from the acceptor site

(Fig. 5 4 , the latter site is less likely to be used for splicing. If this prediction is correct, the first IVS of the dog insulin gene is 151 bp in length, a little shorter than its human counterpart (179 bp) but longer than those in both the rat and chicken genes (119 bp). A similar AG sequence 6 bp before the initia- tion codon is also present in the chicken insulin gene (Fig. 5A), and there is also considerable homology upstream from this possible alternative but apparently unutilized splice site (5). Other AG sequences are probably too far away from the initiation codon, since the distance between the end of the first IVS and the initiation codon is only 14 bp in rat or 17 bp in both human and chicken insulin genes. The second IVS (264 bp) occurs at exactly the same position as in other insulin genes, interrupting the codon of the 7th amino acid residue of the C-peptide (Fig. 5B). This is the smallest second IVS in any of the insulin genes reported thus far. The second IVS in other species varies from 499 bp (rat 11) to 3500 bp (chicken).

Our results not only establish the nucleotide sequence of the dog insulin gene but also predict the primary structure of canine preproinsulin, which has not yet been fully determined by amino acid sequence analysis. The deduced amino acid sequence of dog insulin agrees with that determined earlier by Smith (23) and is identical with those of porcine and whale insulins. However, the deduced amino acid sequence of the C- peptide predicts thxt the intact dog C-peptide is actually 31 residues long. The C-peptide isolated from canine pancreas by Peterson et al. (6) lacks the NHe-terminal octapeptide se- quence, Glu-Val-Glu-Asp-Leu-Gln-Val-Arg, probably because the presence of an arginine residue at position 8 of the pre- dicted sequence renders it unusually sensitive to proteolytic degradation. This is in accord with the suggestion of Peterson et al. that the shortened C-peptide they isolated and se- quenced may have been a product either of further post- translational processing of the C-peptide or of autolytic deg- radation during purification (6). The presence of the arginine residue suggests that a trypsin-like enzyme may be involved in further processing of the dog C-peptide. However, it is not yet clear whether this cleavage occurs within the secretion granules of the ,I3 cell during the processing of dog proinsulin to insulin and whether it is mediated by the same trypsin-like converting enzyme which normally cleaves at the pairs of basic residues on either side of the C-peptide (24). Additional processing of the C-peptide to smaller fragments has been demonstrated previously in intact rat islets by Tager et al. (25), but this cleavage appears to involve a chymotrypsin-like enzyme. To confirm the revised C-peptide structure and proc- essing pathway it will be necessary to isolate either the intact C-peptide or the predicted octapeptide fragment from fresh canine pancreas.

The C-peptide is the most highly variable region in pre- proinsulin. A comparison of the revised dog C-peptide with various other mammalian C-peptide sequences (Fig. 6) reveals a similar degree of variability, e.g. there are eight differences between human and dog and nine between dog and rabbit sequences. All mammalian C-peptides studied so far have an NH2-terminal glutamic acid residue while those of birds and lower animals have aspartic acid at the NH:! terminus. How- ever, the dog C-peptide differs from most of it.s mammalian counterparts in having arginine at position 8, aspartic acid at position 9, and glutamic acid at position 18. Either of these additional acidic residues may serve to neutralize the change in net charge due to the arginine. Nonetheless, the dog C- peptide is more acidic than most other mammalian C-peptides except for that of rat proinsulin I which is associated with an unusually basic insulin molecule. Thus, the net negative charge at neutral pH (6.0) for the dog C-peptide would be expected to confer a lower isoelectric point to dog proinsulin

by guest on June 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Dog Preproinsulin Gene

A. I N T R O N - E X O N JUNCTION: IVSl

2361

Met ~ & c t g t t c c a ( l 7 9 b p ) c c t g c c t c a g c c c t g c c t g t c t c c c s A T ~ ~ E fhman

Met C A ~ c t g t c c c c ( l S l b p ) c c ~ c c t c a a c c c t g c c t g t c - c c c ~ - - - - - - - - - - - ~ E Dog

Met C A ~ a t g t a c t c ( l l 9 b p ) c t a g c c t c a a c c c t g a c t a t c t t c C ~ - - - ~ ~ ~ ~ Rat I 1

5' Comparisonofintron-exon AAAccatttgc( l l9bp)cgtgtctcctttgcttcctacctct- Met

junctions of the dog insulin gene - GCKAKATG C h i c k e n

-&th those of the rat (1,2), human (3, 4), and chicken (5) insulin genes. A, first intervening sequence (IVS 1) B , sec- ond intervening sequence (IVS 2). Intron and exon regions are displayed in lower case and capital letters, respectively. Dashed lines indicate gaps introduced to maximize homology.

B. IIWRON-EXON JUNCTION: IVS2

Asp Leu G l n V a 1 G l y GAc a CAG C w c c a a c ( 7 8 6 b p f g t c c t g g c a g TG GGG Human

Asp Leu G l n V GAC CPG CAG 9 ~ c c c c c ( 2 6 4 b p ) t c c t c c m 3 AOG Dog

Asp Pro G l n V a 1 A l a GAC CCA CAA G g t a a g c t c t g ( 4 9 9 b p ) t c c c t g g c a g E GCA Rat I 1

G l n Pro Leu V CAG CCC CPA G gtaap;tcagt(3500bp)cccttggeag n; AGC Chicken

a1 Arg

a1 S e r

I 2 3 4 5 6 7 8 9 10 I1 12 13 14 15 16 17 18 19 2021 2223 2425262728293031 32333435363738 HUMAN ~ ~ ~ - ~ ~ ~ - ~ ~ ~ - ~ ~ ~ - ~ ~ ~ . ~ ~ ~ - ~ ~ l - G ~ y - G l n - V o l - G l u - L e u - G l y - G l y - G l y - P r o - G l y - A l a - G l y - S e r - L e u - G l n - P r o - L e u - A b - L e u - G l u - G l y - S e r - L e u - G l n

MONKEY ~ ~ u ~ ~ ~ - ~ ~ u - ~ ~ p - p m - ~ ~ ~ - ~ ~ ~ - ~ ~ y - ~ l n - v a l - G ~ u - ~ e ~ - G ~ y - G l ~ - G l y - P r o - G l y - A l a - G l y - S e r - L e u - G l n - P r o - L e u - A l a - L e u - G ~ u - ~ ~ y - S e r - L e u - G l n

HORSE ~~~-~~~-G~~-~~~-~~-G~~-~al -G~y-Glu-Val -Gl~-Leu-Gly-Gly-Gly-Ro-Gly-Leu-Gly-Gly-Leu-Gln-Pro-Leu-Ala-Leu-Alo-Gly-Pra-Gln-Gln

PIG Glu-Alo-Glu-Asn-~o-Gln-Ala-Gly-Ala-Val-Glu-Leu-Gly-Gly-Gly-Leu-Gly - Gly - Leu-Gh-Ala-Leu-Ab-Leu-Glu-Gly-Pro-Pro-Gln

COW, LAMB Glu-MI-Glu-Gly-Pro-Gh-Vol-Gly-Ab-Leu-Glu-Leu-Ala-Gly-Gly-Pro-~-Alo-Gly-Gly-Leu - - - - - Glu-Gly- Pro-Pro-Gln

RABBIT Glu-Val-Glu-Glu-~~u-Gl~-Val-Wy-Gln-Ala-Glu-Leu-Gly-Gly-Gly-Pro-Gly-Alo-Gly-Gly-Leu-Gln-Pro-Ser-Ala-Leu-Glu - Ala-Leu-Gln

DOG Glu-Val-Glu-Dsp-Leu-Gln-Val-~q-Plsp-Val-Glu-Lsu-~a-GIy-~a-Ra-Gly-Glu-Gly-Gly-Leu-Gln-Pro-Lcu-lla-Leu-Glu-GIy-Ab-Leu-GIn

RAT I Glu-Val-Glu-Asp-Pro-Gln-Vol-Ro-Gln-Leu-Wu-Leu-Gly-Gly-Gly-Pro-Glu-Ala-Gly-Asp-Leu-Gln-Thr-Leu-Alo-~-GIu-VaI-AIa-Arg-GIn

RAT I1 Glu-Val-Glu-Asp-Ro-Gln-Val-Ala-Gln-Lsu-Glu-Leu-Gly-Gly-Gly-Pro-Gly-Alo-Gly-Arp-Leu-Gln-Thr-Leu-Alo-Lsu-Glu-Val-Ab-Arq-Gln

GUINEA Pffi Glu-Lau-Glu-~-Pm-Gln-Val-Glu-Gln-Thr-Glu-Leu-Gly-Met-Gly- Leu-Gly- Ala-Gly-Gly-Leu-Gln-Pro-Leu - - Gln-Gly-Ala-Leu-Gln

CHINCHILLA Glu-Leu-Glu-Psp-Pro-Gln-Val-Gly-Gln-Ala-Asp-Ro-Gly-Val-Val-Pro-Gkr-Ab-Gly-Puq-Leu-Gln-Pro-Lsu-Ala-Leu-Glu-Mst-Thr-Leu-Gln

WCK Psp-Val-Glu-Gln-Pro-Lsu-Val-Am-Gly-Pro - Leu-HIS-Gly-Glu-Val-Gly-Glu - - Leu-F'ro-Phe-Gln-Ho-Glu-Glu - - Tyr-Gln

CHICKEN Asp-Val-Glu-Cln-Pro-Leu-Val-Ser-Ser-Pro - Lsu-Arq-Gly-Glu-Ab-Gly-Val - - Leu-Pro-Phc-Gln-Wn-Glu-Glu-Tyr-Wu-Lys-Val

ANGLERFISH Asp-VaI-A~Gln-Leu-Leu~ly-PhbLsu-Pro-Pro-Lys-Ser-Gly-Gly-Ala-Ah-Alo-Ala-Gly-Ala-Asp-A~-Glu-Vol-Ala-Glu-Phe-Ala-Phe-Lys-Asp-Gln-Met-Glu- Met-Met-Val

HAGFISH Dsp-Thr-Gly-Ala-Leu-Ab-Ab-Phc-Leu-Ro-Leu-Ab-Tyr-Ala-Glu-Plsp-Asn-Wu-Ser-Gln-Asp-Asp-GIu-Ser-Ils-Gly-Ile-Asn-Wu-~al-Leu-Lys-Ser

FIG. 6. Comparison of amino acid sequence of dog proinsulin C-peptide with those of human (26,27), monkey (6), horse (2% pig (29), cow (30, 31), lamb (6), rabbit (32). rat (28, 33, 34), guinea pig (35). chinchilla (36), duck (37), chicken (5), anglerfish (20), and hagfish (21) proinsulin C-peptides. The C - peptides are grouped arbitrarily according to their sequence homology near the NH2 terminus. Dashed lines indicate gaps introduced to maximize homology.

(about 5.0-5.1) than for the corresponding insulin (5.3). An- other interesting feature of the C-peptides is that their overall lengths are relatively well conserved despite considerable variation in their amino acid sequences. With the revision of the dog proinsulin C-peptide, the shortest C-peptide is now the 26 amino acid peptides seen in cows, sheep, and ducks. This may well represent a minimum length of the C-peptide, consistent with the general hypothesis that secretory protein precursors must maintain a minimum overall peptide chain length in order to be segregated effectively into the cisternae of the rough endoplasmic reticulum during biosynthesis (38).

In contrast to the C-peptides, the proinsulin prepeptides show a greater degree of sequence conservation (Fig. 7), intermediate between that of insulin and the C-peptides. The dog and human sequences are identical at 20 out of 24 sites (83% homology) and there is considerable homology between the mammalian and avian prepeptides in the first 14 amino acids. All six prepeptides contain a central leucine-rich hydro- phobic region, extending from positions -7 to -17, which is believed to be functionally important for sequestration of the nascent preproinsulin (44). The more hydrophilic region near the cleavage site between the prepeptide and the B-chain of

by guest on June 12, 2020http://w

ww

.jbc.org/D

ownloaded from

2362 Dog Preproinsulin Gene

-20 -I5 -10 -5 -I 1 +I

I I I I I I I I I I I ~ I I I I I I I I I

I I I I I I I I I I I I I I I I I I 1

HUMAN Met-AIa-Leu-Trp-Met-Arg-Lau-Leu-Pro-Leu-Leu-Ala-Leu-L~u-Ala-Lcu-Trp-Gly-Pro-Asp-Pro-A~~-A~a-A~a-Ph~

DOG ~t-Aia-Leu-Tr~-Met-Arg-Leu-Leu-Pro-Leu-Lau-Aia-Leu-Leu-Ala-Leu-Trp-Ala-Pro-Ala-Pro-Thr-Arg-Ala-~

RAT I 3t

"_ Met- Ala-Leu-Trp-Met-Arg-Phe-Leu-Pro-Leu- Leu-Ala-Leu- Leu-Val-Leu- Trp-Glu-Pro-Lys-Pro- Ala-Gln- Ala-Phe

I I I P i e I I I / / l l l ~ e I Arg I 1 CHICKEN ~t-Ala-Leu-Trp-Ile-Arg-&r-Leu-Pro-Leu-Leu-Aia-Leu-Leu-Val-Phe-Ser-Gly-Ro-Gly-Thr-Ser-Tyr-Ala-Phe

ANGLERFISH Met-Ala-Ala-Leu-Trp-Leu-Gln-Ser-Phe-kr-Leu-Leu-Val-Lw-Leu-Val-Val-Ser-Trp-Pro-Gly-Ser - Gin-Ala-Val

HAGFISH Met-Ala-~-Sor-Pro-Phe-Leu-Ala-Ala- Val- 110-Pro- Leu-Val-Leu- Leu- Leu-Sw- Arg- Ala-Pro-Pro-Ser- Ala-Asp-Thr-Arg

FIG. 7. Comparison of amino acid sequence of dog proinsulin prepeptide with those of human (39, 40), rat I and I1 (41-43), chicken (5), anglerfish (20), and hagfish (21) proinsulin prepeptides. Vertical lines indicate residues identical with human sequence. Arrow denotes position of cleavage by the signal peptidase. A gap is introduced at position -3 in the anglerfish sequence to maximize homology. The highly conserved NH2- terminal Met-Ala-Leu sequence is underlined.

I l l 1 1 I 1 I I

I I 1 I

proinsulin also contains a highly conserved proline residue (position -6) and, in some instances, additional proline or threonine residues. The presence of these or similar residues results in a high predicted probability for a p-turn in the region from -3 to -7. It has been proposed that this region and the strongly hydrophobic segment may facilitate the formation of a transmembrane loop structure and may thereby also provide important aligning parameters for cleavage by the signal peptidase (44). It is more difficult to explain the high degree of conservation of the NHz-terminal tripeptide sequence Met. Ala. Leu in 5 of the 6 prepeptides (Fig. 7) since this region does not appear to be required for segregation (44). This sequence, however, may possess other desirable proper- ties; for example, it may facilitate the removal of the initiator methionine residue and provide a highly susceptible substrate for further cleavage by membrane-associated peptidases which normally degrade the free prepeptides very rapidly (45). Clearly the conservation of certain important physical and secondary structural properties within the prepeptides of proinsulin throughout vertebrate evolution is consistent with the conclusion that the mechanisms for export and proteolytic processing of precursors are of ancient phylogenetic origin.

Acknowledgments-We wish to thank Drs. F. Blattner and N. Steinberg for kindly providing the phage and bacterial strains used in this work. We also thank Janet M. Kramer for valuable technical assistance, Lisa Fuller and Valerie Payne for secretarial help, and Raymond J. Carroll and Albert MacKrell for assistance with com- puter analysis of DNA sequences.

REFERENCES 1. Lomedico, P., Rosenthal, N., Efstratiadis, A., Gilbert, W., Kolod-

ner, R., and Tizard, R. (1979) Cell 18, 545-558 2. Cordell, B., Bell, G., Tischer, E., DeNoto, F. M., UIlrich, A.,

Pictet, R., Rutter, W. J., and Goodman, H. M. (1979) Cell 18, 533-543

3. Bell, G. I., Pictet, R. L., Rutter, W . J., Cordell, B., Tischer, E., and Goodman, H. M. (1980) Nature (Lond.) 284,26-32

4. Ulirich, A,, Dull, T. J., Gray, A,, Brosius, J., and Sures, I. (1980) Science 209,612-615

5. Perler, F., Efstratiadis, A., Lomedico, P., Gilbert, W., Kolodner, R., and Dodgson, J. (1980) Cell 20, 555-566

6. Peterson, J . D., Nehrlich, S., Oyer, P. E., and Steiner, D. F. (1972) J. Biol. Chem. 247,4866-4871

7. Blin, N., and Stafford, D. W . (1976) Nucleic Acids Res. 3,

8. Southern, E. M. (1975) J. Mol. Biol. 98, 503-517 9. Kwok, S. C. M., Chan, S. J., Rubenstein, A. H., Poucher, R., and

Steiner, D. F. (1981) Biochem. Biophys. Res. Commun. 98,

10. Maniatis, T., Hardison, R. C., Lacy, E., Lauer, J., O'Connell, C.,

2303-2308

844-849

687-701 Quon, D., Sim, G. K., and Efstratiadis, A. (1978) Cell 15,

11. Enquist, L., and Sternberg, N. (1979) Methods Enzymol. 68,

12. Benton, W. D., and Davis, R. W. (1977) Science 196, 180-182 13. Blattner, F. R., Blechl, A. E., Denniston-Thompson, K., Faber,

H. E., Richards, J . E., Slightom, J . L., Tucker, P. W . , and Smithies, 0. (1978) Science 202, 1279-1284

281-298

14. Morrison, D. A. (1979) Methods Enzymol. 68, 326-331 15. Katz, L., Kingsbury, D. T., and Helinski, D. R. (1973) J. Bacteriol.

16. Radloff, R., Bauer, W . , and Vinograd, J. (1967) Proc. Natl. Acad.

17. Maxam, A. M., and Gilbert, W. (1979) Methods Enzymol. 65,

18. Goldberg, M. (1979) Ph.D. thesis, Stanford University 19. Proudfoot, N. J., and Brownlee, G. G. (1976) Nature (Lond.) 263,

20. Hobart, P. M., Shen, L.-P., Crawford, R., Pictet, R. L., and Rutter,

21. Chan, S. J., Emdin, S. O., Kwok, S. C. M., Kramer, J . M., Falkmer,

22. Breathnach, R., Benoist, C., O'Hare, K., Gannon, F., and Cham-

23. Smith, L. F. (1966) Amer. J. Med. 40,662-666 24. Docherty, K., Carroll, R. J., and Steiner, D. F. (1982) Proc. Natl.

25. Tager, H. S., Emdin, S. O., Clark, J. L., and Steiner, D. F. (1973)

26. Oyer, P. E., Cho, S., Peterson, J . D., and Steiner, D. F. (1971) J .

27. KO, A. S. C., Smyth, D. G., Markussen, J., and Sundby, F. (1971)

28. Tager, H. S., and Steiner, D. F. (1972) J. Biol. Chem. 247,

29. Chance, R. E., Ellis, R. M., and Bromer, W. W . (1968) Science

30. Steiner, D. F., Cho, S., Oyer, P. E., Terris, S., Peterson, J. D., and Rubenstein, A. H. (1971) J. Biol. Chem. 246, 1365-1374

31. Nolan, C., Margoliash, E., Peterson, J . D., and Steiner, D. F. (1971) J. Biol. Chem. 246,2780-2795

32. Chance, R. E., Hoffmann, J. A,, Johnson, M. G., Wolfe, T. M., Blix, P. M., and Rubenstein, A. H. (1979) in Proinsulin, Insulin, C-peptide (Baba, S., Kaneko, T., and Yanaihara, N., eds) pp. 99-105, Excerpta Medica, Amsterdam-Oxford

33. Sundby, F., and Markussen, J . (1972) Eur. J. Biochem. 25, 147-152

34. Markussen, J., and Sundby, F. (1972) Eur. J. Biochem. 25, 153-162

35. Smyth, D. G., Markussen, J., and Sundby, F. (1974) Nature

36. Snell, C. R., and Smyth, D. G . (1975) J. Biol. Chem. 250,

37. Markussen, J., and Sundby, F. (1973) Eur. J. Biochem. 34,

38. Steiner, D. F. (1978) Diabetes 27 Suppl. 1 , 145-148 39. Bell, G. I., Swain, W. F., Pictet, R., Cordell, B., Goodman, H. M.,

114, 577-591

Sci. U. S. A. 57, 1514-1521

499-560

211-214

W . J. (1980) Science 210, 1360-1363

S., and Steiner, D. F. (1981) J. Bwl. Chem. 256, 7595-7602

bon, P. (1978) Proc. Natl. Acad. Sci. U. S. A. 75,4853-4857

Acad. Sci. U. S. A . 79,4613-4617

J. Biol. Chem. 248, 3476-3482

Biol. Chem. 246,1375-1386

Eur. J. Biochem. 20, 190-199

7936-7940

161, 165-167

(Land.) 248, 151-152

6291-6295

401-408

and Rutter, W. J. (1979) Nature (Lond.) 282,525-527

by guest on June 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Dog Preproinsulin Gene 2363

40. Sures, I., Goeddel, D. V., Gray, A., and Ullrich, A. (1980) Science 43. Chan, S. J., Noyes, B. E., Agarwal, K. L., and Steiner, D. F. (1979) 208,57-59 Proc. Natl. Acad. Sei. U. S. A. 76, 5036-5040

41. Ullrich, A., Shine, J., Chirgwin, J., Pictet, R., Tischer, E., Rutter, 44. Steiner, D. F., Quinn, P. S., Chan, S. J., Marsh, J., and Tager, H. W. J., and Goodman, H. M. (1977) Science 196,1313-1319 S. (1980) Ann. N. Y. Acad. Sei. 343, 1-16

42. Villa-Komaroff, L., Efstratiadis, A,, Broome, S., Lomedico, P., 45. Patzelt, C. , Labrecque, A. D., Duguid, J. R., Carroll, R. J., Keim, Tizard, R., Naber, S. P., Chick, W. L., and Gilbert, W. (1978) P., Heinrikson, R. L., and Steiner, D. F. (19781 Proc. Natl. Proc. Natl. Acad. Sei. U. S. A . 75, 3727-3731 Acad. Sci. U. S. A. 75, 1260-1264

by guest on June 12, 2020http://w

ww

.jbc.org/D

ownloaded from

S C Kwok, S J Chan and D F Steineracid sequence of canine preproinsulin predicts an additional C-peptide fragment.

Cloning and nucleotide sequence analysis of the dog insulin gene. Coded amino

1983, 258:2357-2363.J. Biol. Chem. 

  http://www.jbc.org/content/258/4/2357Access the most updated version of this article at

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/258/4/2357.full.html#ref-list-1

This article cites 0 references, 0 of which can be accessed free at

by guest on June 12, 2020http://w

ww

.jbc.org/D

ownloaded from