Plant Molecular Biology 14: 537-548, 1990. © 1990 Kluwer Academic Publishers. Printed in Belgium. 537

The isolation and sequence analysis of two seed-expressed acyl carrier protein genes from Brassica napus

Jacqueline de Silva, Neil M. Loader, Carl J a r m a n , John H.C. Windust, Stephen G. Hughes ~ and Richard Safford* Biosciences, Unilever Research, Colworth House, Sharnbrook, Bedford, MK44 1LQ, England, UK (* author for correspondence); 1 present adress : Nuovo CraL La Fagianaria, 81015 Piana Di Monte Verna, Caserta, Italy

Received 15 August 1989; accepted in revised form 20 November 1989

Key words: Brassica napus, acyl cartier proteins, seed-expressed, genomic clone, developmentally regu- lated

Abstract

Genomic Southern blot analysis ofBrassica napus DNA indicates that seed-expressed acyl cartier protein (ACP) is encoded by a multigene family of some 35 genes/haploid genome. Two genomic clones encoding B. napus ACP have been isolated and sequenced. The coding sequences of the 2 respective genes were found to be perfectly homologous to 2 distinct B. napus seed-expressed cDNAs and therefore represent seed-expressed forms of ACP. The 2 genomic ACP sequences share 94~ homology within their coding sequences. Both genes are interrupted by 3 intervening sequences whose position within the 2 coding sequences is conserved. RNase protection studies were used to map the transcription start site of one of the genes and to provide further evidence that the gene is seed-expressed. The expression of a sub-group of the ACP gene family was found to be developmentally regulated in concert with the storage lipid synthetic phase of seed development. The coding sequence of both B. napus genes are highly homologous (96 ~o and 93 ~o respectively) to a Brassica campestris ACP cDNA sequence, suggesting that they may have evolved from this ancestral gene.

Introduction

Fatty acid biosynthesis in plants is intracellularly compartmentalised and regulated in a tissue- specific and developmental manner [3]. Our interests lie in understanding the genetic basis of this regulation, particularly in relation to storage lipid synthesis in oil-bearing crops. To this end we have chosen to study one of the key components of the plant lipid biosynthetic machinery, namely acyl carrier protein (ACP). ACP serves to bind the growing acyl chain, via a covalently bound pantetheine prosthetic group, during all the steps

of de novo fatty acid biosynthesis [4]. In addition, ACP participates in elongation, desaturation and acyl transfer reactions [5]. In contrast to the situation in yeast and animal systems, where ACP is part of a large multifunctional fatty acid synthetase, ACP in plants exists as a small (-~ 10 kDa) soluble protein. ACP has been puri- fied from Escherichia coli [6] and various plant sources [4, 7, 8, 9] and cDNA clones have been isolated from spinach leaf [10], barley leaf [11], Brassica campestris seed [2] and Brassica napus embryo [ 1 ]. In B. napus we have shown embryo ACP to be synthesized as a precursor [ 1 ] contain-

538

ing an N-terminal extension which functions to transport ACP into plastids [ 12], the site of fatty acid biosynthesis as identified by immunogold labelling with ACP antibodies [ 13].

In barley [14] and spinach [7], 2 major iso- forms of ACP have been reported and, in the case of spinach, these have been shown to be differen- tially expressed in a tissue-specific manner [ 15]. In B. napus, eDNA cloning studies [1] have revealed embryo ACP to be encoded by a multi- gene family, which is not expressed in leaf, and which shows considerable heterogeneity both at the nucleotide and deduced amino acid level. Analysis of 10 eDNA clones revealed 6 unique genes encoding 5 different ACP polypeptides. The presence of multiple ACP genes could provide a mechanism to control levels of ACP in response to highly variable cellular demands for fatty acid biosynthesis which occur during oil seed develop- ment. In B. napus seed development, the level of ACP rises dramatically prior to the onset of storage lipid synthesis [ 16], suggesting activation of a specific subset of ACP genes. To gain further insight into the regulation of ACP expression dur- ing seed development requires the analysis of individual or sub-groups of the ACP gene family. In this paper we begin an analysis of the ACP gene family by determining the number of seed- expressed ACP genes and by isolating and sequencing 2 members of the family. Through homology with seed-expressed cDNA sequences we show the 2 ACP genes to be seed-expressed and have mapped the transcription start site of 1 of the genes. The expression of a sub-group of the ACP gene family has also been monitored throughout seed development.

Materials and methods

Southern blot analysis

Total DNA was isolated from Brassica napus cv. Jet Neuf leaves [ 17] and digested to completion with Hpa I and Hind III. Fragments were fractio- nated by agarose gel electrophoresis and trans- ferred to nitrocellulose [18]. The resultant blot

was hybridised to a rape-embryo-expressed ACP eDNA [clone 28F10], labelled by hexanucleotide priming (Amersham), at 65 °C in 5 x SSC. A 3.4 kbAcc I fragment of ACP eDNA clone 28F10 in pBR322 was used as gene copy number con- trol.

Construction and screening of B. napus genomic library

Nuclear DNA was isolated from leaves of young field grown B. napus plants. Approximately 50 g of fresh leaf material was surface-sterilised and homogenised in 250 ml buffer (0.6 M sucrose, 50 mM Tris-HCl pH 8, 10 mM MgCI2, 10 mM fl-mercaptoethanol). Nuclei were pelleted by cen- trifugation at 500 x g, washed twice in homo- genisation buffer/1.2~ Triton X-100 and then resuspended in lysis buffer (50 mM Tris-HC1 pH 8, 20 mM EDTA, 1~o Sarkosyl). Nucleic acids were purified by phenol extraction/CsC1 centrifugation [ 19]. DNA was partially digested with Sau3A and fractionated by sucrose density gradient centrifugation [ 19]. DNA of size range 15-20 kb was ligated to Barn HI digested lambda EMBL4 arms purified by electroelution from agarose, packaged using Gigapack Plus extracts (Stratagene) and propagated in Escherichia coli strain K803. A library of 5 x 105 plaque.forming units was screened with a 32p-labelled SP6 RNA probe derived from ACP eDNA clone 29C08 [ 1 ] in 5 x SSC, 5 x Denhardt's solution, 5 m M EDTA, 0.2~ SDS, 100/~g/ml denatured salmon sperm DNA at 65 °C. Following washing in 1 x SSC at 63 °C, 30 positive plaques were obtained. Two of these (designated ACP05 and ACP09) were plaque purified, DNA isolated and subcloned into pTZ18R, then char~er i sed by restriction mapping and DNA sequencing.

DNA sequencing

Fragments spanning the coding sequences of ACP05 and ACP09 were subcloned into M13mp8, mp9 or mpl8 and sequenced using a

modified T7 DNA polymerase [20] and chain- terminating dideoxynucleotides [ 21]. The reactions were electrophoresed on 6~o acryl- amide/urea gels and sequence data analysed by using DNAStar software on an IBM AT com- puter.

RNA isolation

Total RNA was isolated from B. napus leaf according to Logemann etal. [22] and from staged embryos according to Hall et al. [23]. Poly (A) + RNA was purified using Poly U Sephadex chromatography.

RNA slot blot

RNA (1/zg) was denatured in 1 M glyoxal, 10 mM sodium phosphate pH 7.5 for 60 min at 50 °C, mixed with an equal volume 0.1~o SDS and loaded onto Zeta probe membrane mounted in a Biorad slot blot apparatus. Blots were pre- hybridised in 5 x SSC, 20 mM sodium phosphate pH 7.5, 7~o SDS, 0.25~o milk powder, 1 mM EDTA at 50 °C overnight, hybridised to a 7-32p -

labelled 'Group 2-specitic' ACP oligonucleotide probe (see Fig. 6) at 60 °C overnight followed by washing in 5 x SSC at 50 °C and autoradio- graphy.

539

teinase K (125 #g/m1) and SDS (0.5 ~o) for 30 min at 37 °C. Protected RNA was recovered by phenol/chloroform extraction and ethanol precip- itation and analysed on a 6~o acrylamide/urea sequencing gel.

Results

Analysis of B. napus A CP gene family by quantita- tive Southern hybridisation

To determine the number of seed expressed ACP genes in the B. napus genome, quantitative Southern blot analysis was performed. Rape DNA digested with Hpa I and Hind III was Southern blotted and hybridised to a seed- expressed ACP cDNA (clone 29C08) probe. Eight hybridising fragments were observed with Hpa I digest and 9 with the Hind III digest

RNase protection studies

A 1001 bp Pst I-Sal I fragment of genomic clone ACP05, spanning the predicted transcription start site of the gene, was ligated into SP65 tran- scription vector and used as a template to pro- duce full-length 32p-labelled anti-sense ACP RNA. The anti-sense probe was hybridised to B. napus leaf and embryo poly(A) + RNA (1 #g) in 50~o formamide, 40 mM PIPES pH 6.4, 0.4 M NaCI, 1 mM EDTA at 45 °C overnight followed by treatment with RNase A (40#g/ml) and RNase T1 (2 #g/ml) for 30 min at 30 °C. RNase activity was destroyed by treatment with pro-

Fig. 1. Quantitative Southern analysis of B. napus genomic DNA probed with the seed-expressed ACP cDNA clone 28F10. Rape DNA was digested with Hpa I (lane 2) and Hind III (lane 3), fragments electrophoresed on agarose and trans- ferred to nitrocellulose [18]. Hybridisation stringency: 5 x S SC at 65 ° C; washing stringency 0.5 x S SC at 65 ° C. Lanes 4, 5, 6 and 7 represent gene copy reconstructions of 1, 2, 5 and 10 ACP genes/haploid genome (using a 3.4 kb Acc I fragment derived from ACP eDNA clone 28F10 in pBR322).

Lane 1 shows size markers.

540

(Fig. 1). Quantification of gene number by scanning laser densitometry and comparison to gene copy controls gave respective values of 34 and 36 ACP genes/haploid genome for the Hpa I and Hind III digests. The same Southern hybrid- isation pattern was observed whether the rape DNA was isolated from a single plant or from several plants, thereby showing that the pattern is not due to population polymorphism. Based on known seed ACP cDNA sequences [1], Hpa I and Hind III would produce only 1 hybridising fragment per ACP gene, although it is possible

that sites for these enzymes could be present in ACP genes not represented amongst the cloned cDNA sequences or that restriction cleavage could occur within intron sequences. The probe might hybridise to inactive genes or to some leaf expressed ACP genes, although the latter is unlikely on the basis of Northern hybridisation data [ 1 ]. However, since there was a very good correlation between gene copy numbers from the 2 respective digests we would conclude that, in B. napus, seed-expressed ACP is encoded by a family of some 35 genes per haploid genome. This

III P I

IV

B P H S I I I

4

q G H GS I I

540 ' ~ " I,I .. -- " 1000

T SH S B I I I I I

, ~ ~ g I

0

D .4 . ~ ~ •

" ; i SP ,. : ..

T S H G I I I I i

i ! i i ~ i

1500 2000 \

\

s

1 .- .. ~ 70 117 388 495 572 694 797 920 1095

G G C A T C A T C G A C A A T G T C G I I G , G T A T T A - - o A A C A G , G T G A ?

2 G: G T A T GT- - - A T T A G = G

J 3 T = G T A A T T - - - T G C A G = G

Fig. 2. Structural analysis of ACP05 genomic clone. I. Restriction map, B = Barn HI, P = Pst I, H = Hind III, S = Sa l I, T = Sst I. II. Genomic fragments subcloned into pTZ series plasmids. III. Sequencing strategy: fragments cloned into M 13 and sequenced using modified T7 DNA polymerase and chain terminating dideoxynucleotides. IV. Structure of ACP 05 gene as determined by comparison with ACP eDNA 29C08 [1]. Boxes indicate exons; open boxes = non-coding sequences; hatched boxes = transit peptide sequences; dashed boxes = mature protein sequences. V. Regulatory features of ACP 05 gene: Plant consensus sequences are given on the top line with the corresponding sequence(s) in ACP 05 listed below, a) Transcription initiation sequence [29]; b) translation start sequence [29]; c) intron-exon junction sequences [33]; d) translation stop signal;

e) Poly (A) addition signal [27].

541

appears to be a relatively large number of genes when compared, for example, to a family of about 10-16 genes encoding the abundant rape storage protein, napin [24, 25]. However, since this is the first quantification of gene family size for a plant fatty acid biosynthetic gene, no comparisons to the situation in other plant species are possible.

Isolation and characterisation of A CP genomic frag- ments

A 2EMBL 4 genomic library of B. napus DNA, consisting of 5 x 105 clones and representing

approximately 3 genome equivalents, was screened with an embryo-expressed ACP eDNA derived RNA probe and 30 strongly hybridising clones were identified. Following 3 rounds of plaque purification, DNA was isolated from 5 of these clones and Southern blotted. Of the 5 clones, 2 (ACP09 and ACP19) were found to contain a 5 kb Eco RI-Bam HI fragment and 1 (ACP05) a 5.2kb Barn HI fragment which hybridised strongly to the ACP probe. Restriction mapping of the 3 hybridising clones showed ACP09 and ACP 19 to have identical maps, which differed from that of ACP05. Clones ACP05 and

I

U

i l l

IV

E H I I

G I

! I I

s s

/

T ., i

4

I I

I I

H S T S I I I

. - " " ' " sbo lo'oo "%

%

1 ~ 68 115 410 517 589 711 814 937 "1083 l 'q /

C T C A T C A

GACATCA

T A A A C A A T G G C T G : G T A A G T - - - T G C A G = G TAA,TAC,TGA GATAA1-3

T C G A C A A T C T C G 1G G T A A T C - - - A C C A G G TAA ?

2G G T A T G T - - o T A T A G G 3T G T A A C T - - - T G C A G G

Fig. 3. Structural analysis of ACP 09 genomic clone. I. Restriction map, E = Eco RI, H = Hind III, G = Bgl II, S = Sal I, T = Sst I, B = Bam HI. II. Genomic fragments subcloned into pTZ series plasmids. III. Sequencing strategy - see Fig. 2. IV. Structure o f A C P 0 9 gene as determined by comparison to ACP e D N A clone 22C01 [1]. Boxes indicate exons; open boxes = non-coding sequences; hatched boxes = transit peptide sequences; dashed boxes = mature protein sequences. V. Regulatory features o fACP09 gene; plant consensus sequences are given on the top line with the corresponding sequence(s) in ACP09 listed below, a) Transcription initiation sequence [29]; b)translation start sequence [29]; c) intron-exon junction sequences [33];

d) translation stop signal; e) Poly (A) addition signal [27].

542

ACP09 were chosen for further characterisation by sub-cloning and DNA sequencing using universal and specially synthesized oligonucle- otide primers.

The 5.2 kb hybridising Bam HI fragment of ACP05 contained a single Sst I site and 3 Sal I sites (Fig. 21). A 2.3 kb Bam HI-Sst I fragment, an overlapping 1 kb Sal I fragment and a 2 kb Sal I fragment were subcloned into high copy number plasmid vectors (Fig. 211). Following further sub- cloning into M13, fragments were sequenced as shown in Fig. 2111. The 5 kb hybridising Barn HI-Eco R1 fragment of ACP09 contained a single Sst I site and 2 Sal I sites (Fig. 31). An over- lapping 3.7 kb Eco RI-Sst I fragment and 1 kb Sal fragment were cloned directly into M 13 (mp 18 and mp9 respectively) and sequenced. Sub- sequently, double stranded RF DNA of the larger M13 recombinant was used to prepare Hind III fragments for sequencing (Fig. 3111).

Nucleotide sequence analysis of genomic A CP clones

Previous cDNA cloning studies in our laboratory identified a heterogeneous family of seed- expressed ACP genes which encode several ACP isoforms [ 1 ]. Comparison of the nucleotide sequences of the 2 genomic clones, ACP05 and ACP09, with the ACP cDNA sequences showed the 2 clones to contain distinct seed ACP genes encoding 2 different ACP isoforms (Fig. 4). Thus ACP05 was found to contain 4 coding regions (corresponding to nucleotides 1-117, 388-495, 572-694 and 797-1095) which were 100~o homologous to a 'full-length' 639 bp ACP cDNA clone, 29C08. Clone ACP09 was also found to contain 4 coding regions (corresponding to nucle- otides 1-115, 410-517, 589-711 and 814-1083). This gene was found to share 100~o homology with a partial cDNA clone (22C01) lacking the 5' non-coding sequence and the coding sequence for 42 amino acids of the transit peptide (see Fig. 4).

The nucleoide sequence analyses indicate that the 2 ACP genes encode identically sized protein precursors of 134 amino acids, consisting of a 51 amino acid N-terminal transit peptide and an 83

amino acid mature protein moiety. The nucleotide homology for the coding regions of the 2 genes is 94.1 ~o. At the deduced amino acid level there are 6 variant residues between the 2 ACP precursor sequences, each one the product of a single base change. Four of the substitutions occur in the mature protein and only 2 in the transit peptide. In the mature protein, 2 substitutions are con- servative (Thr/Ala, Asp/Glu), one a neutral/basic change (Asn/Lys) and the fourth a His/Asp change. The 2 substitutions in the transit peptide are Ala/Gly and Ser/Arg.

Both ACP genes are interrupted by 3 introns, whose positions are conserved within the respec- tive coding sequences. The first intron occurs within the transit peptide region between amino acids 16 and 17. In ACP05 the intron is 270 bp long whilst in ACP09 it is 294 bp in length. Both introns are 65 ~o AT and exhibit 88 ~o homology. Intron II occurs between amino acids 1 and 2 of the mature ACP protein, a position similar to that observed in other nuclear-encoded chloroplast protein genes [26]. In ACP05 the intron is 76 bp long and 69~o AT, whilst in ACP09 it is 71 bp in length and 69~o AT; the 2 introns exhibit 75~o homology. The position of intron III is somewhat surprising, since it occurs in the middle of the most highly conserved region of the protein, namely the pantetheine-binding domain through which the fatty acyl moiety is esterified. Intron III is 102 bp long in both genes, but they share only 67~o homology. In ACP05 it is 74~ AT and in ACP09 it is 73 ~ AT.

The 5' non-coding regions of the two genes are highly homologous (64 out of 67 ACP09 nucle- otides are conserved). The sequenced portions of the 3' non-coding regions are more divergent with only 117 out of 147 ACP09 nucleotides con- served. Nevertheless these two ACP genes are more homologous to one another than they are to any of the other identified members of the rape ACP gene family [ 1 ].

The nucleotide sequence of ACP05 extends 208 nucleotides downstream from the 3' end ofcDNA 29C08 which is believed to be a near full-length clone [ 1 ], however we can find no homology with the plant consensus polyadenylation signal,

ATCACGCT•TTTGTACACT•CGCCATCTCTCTCTCCTTCGAGCACAGATCTCTCTCGTGAATATCGACAATGTCGACCACTTTCTGCTCT 90 GENS GEN9 ATCACGCT•TTTGTACA•TC•GC•ATCTCTCTCT•TCT•GAGCA••GATCTCTCTCGGGAATATCGACAATGTCGACCACTTTCTGCTCC PROS NetSerThrThrPheCysSer PRO9 . . . . . . . . . . . . . . . . . . . . .

GENS TCCGTCTCCATGCAAGCCACTTCTCTGgta . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . t t a g a t c a t t t t 180 GEN9 T C T G T C T C C A T G C A A G C C A C T T • T C T G g t a a t c t c a t c t • c c t c t t g t g t t t c c a g a t c g c t c t g • t c a t • c t t t c t t t t • g a t c a t t t •

PRO5 SerVatSerHetGtnAtaThrSerLeu PRO9

GEMS g c c t c t g a t c t g a t t c t t g c t g t t t g t c a c c g t t c a a a a c t c t c g a c g c a t g t t t t g a t t a t g t t g a g a a t t a g a a a a a • • • t g t t a g c t 270 GEN9 g c c t c t g a t c t g t t g c t t g c t g t t t g t t . . . . . . . . . a a c t c t c g a c g c a t g t t t - g a t t a t g t t g a g a a t t a g a a a a a a a a t g t t a g c t

GEN5 t t a c g a a t c t t t a g t g a t c a t t t c a a t t g g a t t t g c a a t c c t g t g t g a t c . . . . . . . . . t g t a t t c a t t t t g a t c t g t a t t c a t t t t g a a 360 GEN9 t t a c • a a t c t t t a g t g • t • a t t t • a a t t g g a t t t g C a a t c t t g t g t g a • a t t • a a g • c t t g t g t a g a t t t c g a t c t g t a t t • a t t t t • a a

GENS t ~ a ~ a c t t g c g t g c g a g c t g t a a t a g t g t ~ a t t g a g t a g t a g t g t t t t t g a a t g a a a c a t g t t t t g t t ~ t g t a t a g t g g a a c ~ a a a c a g 450 GEN9 t c a c a a c t t g c g a g c . . . . . . . . . . . . t g t g a t t g t t a g t g a g t . . . . . . . a a t g t t t g t t g t a t t g a . . . . . . . . . tggaacaaaccag

GENS GCAGCAACAACGAGGATTAGTTTCCAGAAGCCAGCTTTGGTTTCAAGGACTAATCTCTCCTTCAATCTAAGCCGTTCAATCCCCACTCGC 540

543

GEN9 GCAG•AA•AA•GAGGATTAGTTT••AGAAG•CAGGTTTGGTTTCAAGGACTAATCTCTCCTTCAATCTCCGCCGTTCAATCCCCACTCGC PROS At~A~ThrThrArg~teSerPheG~nL~sP~A~aLeuVatSerAr~ThrAsnLeu~erPheAsnLeuSerArgSe~[tePr~ThrAr~ PRO9 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Gty . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Arg . . . . . . . . . . . . . . . . . .

GENS CTCTCAGT•TCCTGCGCGgta t • t t c t t t t c taaca•cac tc tca•ca t t tg t t t cgagat t t c t taa9 t t t t t • t c ta t t t t • • t t t ta 630 GEN9 •TCTCAGT•TC•TGCGCGgta•gttct t t tctaa•a•atgtca••att t t t t t t tcgag•t tg•t ta••• t t t t • tctat t t ••gt t ta• PROS LeuSerVatSerCysAta PRO9 . . . . . . . . . . . . . . . . . .

GEN5 ttagGCCAAACCAGAGACAGTTGAGAAAGTGTCTAAGATCGTCAAGAAGCAGCTATCACTCAAAGACGATCAAAACGTCGTTGCGGAAAC 720 GEN9 PRO5 PRO9

•ta•GC•AAA•CAGAGACGGTAGAGAAAGTGTCTAAGATAGTTAAGAAGCAGCTATCACTCAAAGACGACCAAAAGGTCGTTGCGGAGAC A • • L • s P r • G t u T h r • a • G t • L • s V a t • e r L y s • • e V a • L • s L y s G t n L e u • e • L e u L • s A s p A s p G t n A s n V a t V a • A t a G t u T h r

. . . . o . o ° . o . . . o . o . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . , , , . . . . . . . . . . . . . . .

GLENS CAAATTTGCTGATCTTGGAGCAGATTCTCTCGACA~T~taattcacc~aat~aat~actctctatgtg~attaaacaactt~t~t~ttt 810 GEN9 ~AAGTTTGCTGATCTTGGAGCAGATTCTCTCGA~ACTgtaact~ccat~aat~attct~ttatgt~attaaga~accttgtagagt PROS LysPheAtaAspLeuGtyAtaAspSerLeuAspThr PRO9

GENS t t t t t t t t t t t t t t t t t aa t ae - tga t t aga t - - tgag tg t t t t gca . . . . . tgcagGTTGAGATAGTGATGGGTTTAGAGGAAGAGTTT GEN9 t t t t t t t t t t t t a . . . . aatacctgattattaactgagtgtttttttttttttgcagGTTGAGATTGTGATGGGTTTGGAGGAAGA~TTT PRO5 VatGtulteVatNetGtyLeuGtuGLuGtuPhe PRO9 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

900

GENS CATATCGAAATGGCTGAAGAAAAAGCACAGAAGATCACAACGGTGGAGGAAGCTGCTGAGCTCATTGATGAGCTCGTGCAAGCCAAGAAG 990 GEN9 GATATCGAAAT•GCTGAAGAGAAA•CGCAGAAGATTGCAACCGTGGAGGAAGCTGCTGAACTCATTGAAGAGCTCGTGCAAGCCAAGAAG PROS H1s••eGtU•4etAtaG•uG••LysA•aG•nLYs••eThrThr•atG••G•uALaA•aG•uLeu•teAspGtuLeuVa•G•nA•aLYsLYs PRO9 Asp . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Ata . . . . . . . . . . . . . . . . . . . . . . . . . . . Gtu . . . . . . . . . . . . . . . . . . . . .

GENS TGACTTTTAGTATTAAGAGAAGAACCAAAGGCTTTGTTG . . . . . . . . . TTTTCATAATCTTTCTGTCATTTTCTTTTATTATGATGTCAA 1080 GEM9 T A A • T T T T A G T A T T A A G A G C A G C C - • • A A G G C T T T G T T G G G T T T G T T G T T T T C A T A A T C T T T C T G T C A T T T T C T T T T T T T T T A A T G T • - -

GENS GTCAAGCGACTCTTTGCTAGTAA . . . . . . . TCTGTATGCCATGGATCTCTCTCTCTATTTGTCGACTGAAAACTTTTGGGTTACACATGA 1170 GEN9 GTCAAGCGACTCTGTTGGTTTAAAGTAGTATCTGTTTGCCATGGATCTCTCTCT--ATTTGTCGAC

OENS AAGCTTTTTCTTTTTCTA/~ATCCAAAATGAAAGAGTTGTATTAACAGATACATAAGTGAAAGAGTA~TCCCTAAGATGACACTAGCTTC 1260

GEN5 ATTTATAAACAATCCTATCACATTGTATATA•AGGTTATGATTTATTCCCAATCAGCGTCAAAGAATCCAGCATCTTTCATCTCTGAATA 1350

GENS GTAGACATTCTCCAAGTTTAGATCTTCCTCCTCGATCAAA

Fig. 4. Comparison of the nucleotide (GEN) and deduced amino acid (PRO) sequences of ACP05 and ACP09 genes. Capital letters denote exon sequences, small letters intron sequences. Underlining is used to indicate overlapping eDNA sequence. Dashes in the nucleotide sequences indicate gaps arising from computer alignment of the 2 sequences. Dots in the protein

sequence of ACP09 (PR09) indicate identical amino acids to those in ACP05 (PR05).

544

(G/A)ATAA [27]. The absence of such a signal from this and other plant genes [28] suggests that there are other, as yet unidentified, features that can determine polyadenylation.

Determination of the transcription start site of ACP05

A gene-specific antisense RNA probe, spanning the 5' end of the homologous clone 29C08 ACP cDNA, was prepared from genomic clone ACP05. The probe was hybridised to rape embryo and leaf poly(A) ÷ RNA and to an RNA tran- script of ACP cDNA clone 29C08. The resulting hybrids were subjected to RNase digestion and

the protected fragments analysed on a 6~o acrylamide/urea sequencing gel (Fig. 5). The major fragment protected by embryo poly(A) + RNA was found to be 12 bases longer than the major fragment protected by the cDNA-derived transcript. This result therefore identifies the start of transcription of ACP05 as 12 bases upstream from the 5' end of ACP cDNA 29C08, at the first adenine within the sequence GGCATCA, and defines the length of the 5' non- coding sequence as 69 nucleotides. The tran- scription start site sequence shares 5/7 nucleotide homology with the consensus sequence for plant genes (CTCATCA) and 6/7 nucleotide homology with the consensus sequence for dicot storage protein genes, CGCATCA [29]. No protected fragment was obtained from the leaf poly(A) ÷ RNA hybridisation, providing further evidence that ACP05 is a seed-expressed gene.

Expression of ACP genes in B. napus

Fig. 5. Determination of the transcription start site of ACP05 gene. A full-length, gene-specific antisense RNA probe, spanning the 5' end of the homologous clone 29C08 ACP eDNA, was prepared from genomic clone ACP05 and hybridised to rape leaf poly(A) + RNA (lane 1), rape embryo poly(A) + RNA (lane 2) and an RNA transcript of ACP cDNA clone 29C08 (lane 3). Hybrids were subjected to RNase digestion and protected fragments analysed on a 6 % acrylamide/urea sequencing gel. Lanes A, C, G, T are sequencing reactions of M 13 mp8 used as size markers. NB. The fragment protected by embryo poly(A) + RNA is 12 nucleotides longer than the major fragment protected by

ACP eDNA clone 29C08.

Southern blot analysis of rape DNA suggests that seed ACP is encoded by a family of about 35 genes. Several seed-expressed ACP cDNAs have been cloned and have been shown not to hybridise to rape leaf poly(A) ÷ RNA [ 1 ], suggesting that ACP gene expression is controlled in a tissue- specific manner. The occurence of multiple ACP genes also raises the possibility that ACP expres- sion could be differentially regulated during oil seed development in order to meet the highly variable demands for fatty acid synthesis which occur during this process. As a first step towards understanding the regulation of this complex gene family, we have monitored the expression of a particular sub-group of the ACP gene family at various stages during embryo development. The seed expressed ACP cDNAs that have been cloned [1] can be divided into 2 sub-groups, based on the structure of their transit peptides (see Fig. 6). Members of group 1, typified by cDNA 28F10, encode amino acids Asn-His-Gly at residues 32-34 of the transit peptide. Members of group II, typified by cDNA 22C01 (gene ACP09) and cDNA 29C08 (gene ACP05), encode

545

( i ) 28FI0

10Hll

05E01

34F12

IOC04

34C02

22C01

29C08

~tATTFSASVSHQATSLATTTRISFQKPVLVSNHGRTNLSFNLSR---TRLS I SCA 1

MATTFSASVSHQATS LATTTRI S FQKPVLVSNHGRTNLS FNLSR- - -TRLSISCA

MATTFSASVSHQATSLVTTTRI S FQKPVLVSNHGRTNLS FNLSR- - - TRLS I S CA

TSLVTTTRI S FQKPVLVSNHGRTNLS FNLSR- - -TRLS I S CA

QKPALVS---RTNLSFNLRRS IPTRLSVSCA 1

HATTFSASVSTLATSLATPTROS FQKPALVS--- RTNLS FNLRRS I PTRLSVS CA

MATTFCSSVSHQATSLAATTRI SFQKPALVS--- RTNLS FNLSRS IPTRLSVS CA

MATTFCSSVSHQATSLAATTRISFQKPALVS---RTNLS FNLSRS IPTRLSVS CA

GROUP 1

GROUP 2

( ii ) 29C08 GCCGTTCAATCCCCACTCGCCTCTCAGT

Fig. 6. Design of an oligonucleotide probe specific for a sub-group of the ACP gene family. (i) Amino acid sequences of the transit peptides deduced from 8 ACP cDNA clones [ 1 ] arranged into 2 sub-groups based on the presence or absence of NHG sequence (residues 32-34) and SIP sequence (residues 42-44). (ii) Sequence of a 28-mer oligonucleotide probe which spans the SIP sequence and is thus specific for Group 2 of the ACP gene family. The oligonucleotide was used to probe an RNA slot blot

of staged rape embryo RNA (see Fig. 7).

amino acids Ser-Ile-Pro at residues 42-44 of the transit peptide. To investigate the expression of the sub-group representing genes ACP05 and ACP09 (Group 2) a 28 base oligonucleotide probe, spanning the Ser-Ile-Pro region was synthesized (see Fig. 6) and hybridised to a slot blot of rape poly(A) ÷ RNA isolated from embryos at various stages of development.

Quantification of the resultant autoradiographic signals (Fig. 7) shows that expression of this sub- group of ACP genes increases throughout embryo development, with a timing that precedes the onset of lipid synthesis [ 16], and that in 30 + day embryos the level of expression is 25 x higher than in leaf. We therefore conclude that this sub- group of ACP genes is expressed in a tissue-

Autoradlography signal 120

0 0 ...................................................................................................................................................................

80

00

40

20

Poly A- 20-25d 25-30d 30d+ Leaf

Fig. 7. RNA slot blot of staged rape embryo poly(A) ÷ RNA hybridised to a Group 2 specific ACP oligonucleotide (see Fig. 6). The 28-mer oligonucleotide was hybridised to a slot blot ofpoly(A) ÷ RNA isolated from 20-25 days post anthesis (dpa), 25-30 dpa and 30 + dpa rape embryos, rape leaf poly(A) + RNA and rape embryo poly(A)- RNA as in Materials and methods. An

autoradiograph of the blot was scanned by laser densitometry and the results presented in histogram form.

546

specific and developmentally regulated fashion. Further work is in progress to analyse the expres- sion of individual members of the ACP family during embryo development.

Discussion

As part of our continuing studies aimed at under- standing the genetic regulation of fatty acid biosynthesis in developing oil seeds, we report here on the quantification of the B. napus seed ACP gene family, the isolation and sequence analysis of 2 members of that family and the mode of expression of a sub-group of the ACP gene family during seed development.

Previous cDNA cloning studies have shown [ 1 ] that seed-expressed B. napus ACP is encoded by a heterogeneous multigene family. Quantitative Southern blot data presented here estimates the gene family to contain some 35 ACP copies/ haploid genome. This relatively large number of genes may exist as a mechanism for regulating the levels of ACP in response to the highly variable cellular demands for fatty acid synthesis which occur during oil seed development. Fatty acids need to be synthesized constitutively during seed development for membrane synthesis but, in addi- tion, fatty acids required for storage lipid are synthesized in a developmentally regulated fashion. ACP levels have been shown to increase dramatically prior to the onset of the lipid synthesis phase of rape seed development [ 16]. It is of obvious interest to identify those members of the gene family which are specifically activated during this phase of seed development and to isolate the regulatory elements of these genes. To this end, we have identified a sub-group of the ACP gene family, containing both of the ACP genes described here, which is seed-expressed and regulated in concert with the lipid synthetic phase of rape seed development. Further studies are in progress to monitor the expression of indi- vidual members of the ACP gene family.

Through perfect homology with 2 seed expressed ACP cDNA sequences, the 2 genomic ACP clones reported here were shown to repre-

sent 2 distinct seed-expressed ACP genes. Although the 2 genes encode different isoforms of ACP their overall structures are similar. Both encode protein precursors of 134 amino acids, each of which contains a 51 amino acid transit peptide, there being 6 variant residues between the 2 precursors. Both genes contain 3 intervening sequences which occur in identical positions within the 2 respective coding sequences. All three introns are of the class III type and consist of AT-rich DNA containing a number of protein synthesis termination codons. The 5' and 3' splice junctions exhibit strong homology with the plant consensus sequences (see Fig. 2V and 3V). It is of interest to consider the positions of the introns relative to the structure of the ACP molecule. Intron I occurs between amino acids 16 and 17 of the transit peptide sequence and separates the conserved, uncharged N-terminal domain, com- mon to many plastid-imported precursors, from the remainder of the sequence which may be more specific to the particular protein which it is target- ing. Intron II is located between amino acids 1 and 2 of the mature protein, effectively dividing the transit peptide domain from the mature pro- tein and consistent with the hypothesis that exons encode separate functional domains [30]. The position of intron III is most interesting, since it occurs within the most highly conserved region of the ACP molecule, the pantetheine binding domain through which the fatty acyl group is esterified. The intron occurs in the centre of a 17 amino acid sequence, surrounding the pantetheine binding serine residue, which is perfectly con- served between E. coli and various plant ACP molecules [1]. However, this finding is not unprecedented, an intron is located within the most conserved region of a gene coding for Triosephosphate isomerase in Aspergillus nidulans [311.

A genomic ACP clone fromArabidopsis thaliana has recently been sequenced [ 32 ] which, based on alignment with heterologous ACP sequences, is predicted to have the same pattern of introns as has been found in the 2 B. napus ACP genes, although it is not known if the Arabidopsis gene is expressed.

B.Campes t r i s B.napus B.napus B.napus A r a b i d o p s i s Spinach 22C01 29C08 28FI0

B.Campestris 0 4.4 6.9 12.3 16.7 42.1

B.napus 22C01 0 5.9 11.6 16.8 41.8

B.napus 29C08 0 I1.3 18.0 39.4

B.napus 28F10 0 14.6 44.6

Arabidopsis 0 43.0

Spinach 0

547

Fig. 8. The percentage nucleotide divergence in pairwise comparison between B. campestris seed eDNA [2], B. napus embryo eDNA clones 29C08 ( - ACP05 exons), 22C01 (= ACP09 exons) and 28F10 [1], the predicted coding sequence from an

Arabidopsis genomic ACP clone [25] and a spinach leaf ACP eDNA [10].

The observation that the B. napus ACP cDNA clones can be classified into 2 major sub-groups, based primarily on their transit peptide structures (see Fig. 6), raises the question as to whether these 2 groups represent the 2 ancestral genomes (B. campestris and B. oleracea) of the allo- tetraploid B. napus. The recent publication of a B. campestris seed ACP cDNA sequence [2] allows an interesting comparison to be made with B. napus ACP cDNAs from the 2 sub-groups. Figure 8 shows that B. napus cDNAs 29C08 (ACP05) and 22C01 (ACP09), members of sub- group 2, are only 6.9~o and 4.4~o divergent from the B. campestris cDNA compared to the 12.3 ~o divergence of ACP cDNA 28F10, a member of sub-group 1. Since B. napus ACP05 and ACP09 are no more diverged from each other than they are from B. campestris ACP, this could suggest that they are both evolved from this parental genome.

We have described the isolation and sequencing of 2 seed-expressed ACP genes that are part of a sub-group of the ACP gene family which is dif- ferentially regulated through seed development. Further studies are in progress to evaluate the ability of the 5' upstream region of these genes to direct tissue-specific, developmentally regulated gene expression in transgenic plants.

References

1. Safford R, Windust JHC, Lucas C, de Silva J, James CM, Hellyer A, Smith CG, Siabas AR, Hughes SG: Plastid localised seed acyl carrier protein of Brassica napus is encoded by a distinct, nuclear multigene family. Eur J Biochem 174:287-295 (1988).

2. Rose RE, DeJesus CE, Moylan SL, Ridge NP, Scherer DE, Knauf VC: The nucleotide sequence of a cDNA clone encoding acyl carder protein (ACP) from Brassica campestn's seeds. Nucleic Acids Res 15:7197 (1987).

3. Stumpf PK: Fatty acid biosynthesis in higher plants. In: Fatty Acid Metabolism and Its Regulation. Elsevier Press, Amsterdam, Numa S (ed) 155-179 (1984).

4. Matsumura S, Stumpf PK: Fat metabolism in higher plants XXXV Partial primary structure of spinach acyl carrier protein. Arch Biochem Biophys 125:932-941 (1968).

5. Ohlrogge JB: Biochemistry of plant acyl carder proteins. In: The Biochemistry of Plants. Stumpf PK, Corm EE (eds) Vol 9:137-157 (1987).

6. Vanaman TC, Wakil S J, Hill RL: The complete amino acid sequence of the acyl carder protein of Escherichia coil J Biol Chem 243:6420-6431 (1968).

7. Kuo TM, Ohlrogge JB: The primary sequence of spinach acyl carder protein. Arch Biochem Biophys 234: 290-296 (1984).

8. Hej PB, Svendsen I: Barley acyl carrier protein: its amino acid sequence and assay using purified malonyl- CoA: ACP transacylase. Carlsberg Res Comm 48: 285-305 (1983).

9. Slabas AR, Harding J, Hellyer A, Roberts P, Bambridge HE: Induction, purification and characterisation of acyl carrier protein from developing seeds of oil seed rape (Brassica napus). Biochem Biophys Acta 921:50-59 (1987).

10. Scherer DE, Knauf VC: Isolation of a cDNA clone for

548

the acyl carrier protein-I of spinach. Plant Mol. Biol. 9: 127-134 (1987).

11. Hansen L: Three eDNA clones for barley leafacyl carrier proteins I and III. Carlsberg Res Comm 52:381-392 (1987).

12. Slabas AR, Smith CG, Sheldon P, Kekwick RGO, de Silva J, Lucas C, Windust JHC, James C, Hughes SG, Safford R: Molecular structure of plant fatty acid synthesis enzymes. In: Plant Molecular Biology. Nato Series A, Life Sciences, von Wettstein D, Chua N (eds) 140:265-278 (1987).

13. Slabas AR, Smith CG: Immunogold localization of acyl carrier protein in plants and Escherichia coli: Evidence for membrane association in plants. Planta 175:145-152 (1988).

14. H~j PB, Svendsen IB: Barley chloroplasts contain two acyl carrier proteins coded for by different genes. Carlsberg Res Comm 49:483-492 (1984).

15. Ohlrogge JB, Kuo TM: Plants have isoforms of acyl carrier protein that are expressed differently in different tissues. J Biol Chem 260:8032-8037 (1985).

16. Hughes SG, Safford R, Slabas AR, de Silva J, Windust JHC: The molecular genetics of seed lipid biosynthesis. Proceedings of the International Congress of Plant Physiology, New Delhi, India: 15-20 (1988).

17. Dellaporta SL, Wood J, Hicks JB: A plant DNA mini- preparation: Version II. Plant Mol Biol Reporter 1 (4): 19-21 (1983).

18. Southern EM: Detection of specific sequences among DNA fragments separated by gel electrophoresis. J Mol Biol 98:503-517 (1975).

19. Maniatis T, Fritsch EF, Sambrook J: Molecular Cloning. Cold Spring Harbor Laboratory Publ. (1982).

20. Tabor S, Richardson CC: DNA sequence analysis with a modified bacteriophage T7 DNA polymerase. Proc Natl Acad Sci USA 84:4767-4771 (1987).

21. Sanger F, Nicklen S, Coulson AR: DNA sequencing with chain terminating inhibitors. Proc Natl Acad Sci USA 74:5463-5467 (1977).

22. Logemann J, Schell J, Willmitzer L: Improved method for the isolation of RNA from plant tissue. Anal Biochem 163:16-20 (1987).

23. Hall TC, Ma Y, Buchbinder BV, Pyne JW, Sun SM, Bliss FA: Messenger RNA for G1 protein of french bean seeds: cell free translation and product characterisation. Proc Natl Acad Sci USA 75:3196-3200 (1978).

24. Josefsson L-G, Lenman M, Ericson ML, Rask L: Struc- ture of a gene encoding the 1.7S storage protein, napin, from Brassica napus. J Biol Chem 262:12196-12201 (1987).

25. Scofield SR, Crouch ML: Nucleotide sequence of a member of the napin storage protein family from Brassica napus. J Biol Chem 262:12202-12208 (1987).

26. Fluhr R, Moses P, Morelli G, Corruzi G, Chua NH: Expression dynamics of the pea rbcS multigene family and organ distribution of the transcripts. EMBO 5: 2063-2071 (1986).

27. Heidecker G, Messing J: Structural analysis of plant genes. Ann Rev Plant Physiol 37:439-466 (1986).

28. Shah DP, Hightower RC, Meaghor RB: Complete nucle- otide sequence of a soybean actin gene. Proc Natl Acad Sci USA 79:1022-1026 (1982).

29. Joshi CP: An inspection of the domain between the putative TATA box and translation start site in 79 plant genes. Nucleic Acids Res 15:6643-6653 (1987).

30. Gilbert W: Why genes in pieces. Nature 271: 501 (1978). 31. Gilbert W, Marchionni M, McKnight G: On the antiquity

ofintrons. Cell 46:151-154 (1986). 32. Post-Beittenmiller MA, Hlousek-Radojcic A, Ohlrogge

JB: DNA sequence of a genomic clone encoding an Arabidopsis acyl cartier protein (ACP). Nucleic Acids Res 17:1777 (1989).

33. Brown JWS: A catalogue of splice junction and putative branch point sequences from plant introns. Nucleic Acids Res 14:9549-9559 (1986).