the human genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · affymetrix...
TRANSCRIPT
![Page 1: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/1.jpg)
The Human Genomeand its Dynamics
Matthias Platzer
Genome AnalysisLeibniz Institute for Age Research
- Fritz-Lipmann Institute (FLI)
![Page 2: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/2.jpg)
Genetic variationLexicon
Scherer et al., Nat Genet Suppl 39:s7 2007
![Page 3: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/3.jpg)
Genetic variationTerminology
Mutation= event causing genetic variation
substitution, insertion, deletion, inversion
Polymorphism= condition of a variation, when it is established
with frequency ≥1% in a population
Mutation in medical genetics= rare variation with a population frequency <1%
![Page 4: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/4.jpg)
• 12 Mio SNPs genom-wide 1/250 bp
• 2 individuals differ in ~300.000 SNPs 1/10.000 bp
• ~5% of SNPs, e.g. 600.000 SNPs with phenotyp (?)50-100.000 SNPs with clinical relevance (?)
ATTCGACGTATTGATTCGATGTATTG
SNP
• as a rule bi-allelic
Genetic variationSingle Nucleotide Polymorphism (SNP)
![Page 5: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/5.jpg)
International academic consortium
Private EnterpriseCelera
2001 2001
2004
Sequencing of the Human GenomePublications
![Page 6: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/6.jpg)
overall coverage: 94% quality of unfinished data : < 1 error/10kb in 91%
Private
2.72 Gb Sequenced Bases 2.65 Gb1,000 Clone gaps 54,000
146,000 Sequence gaps 116,000
147.000 Gaps 170,000
Academic
Initial Sequencing & Analysis… The Sequence of …
Human GenomeWorking Draft versions February 2001
![Page 7: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/7.jpg)
Private
2.72 Gb 2.85 Gb Sequenced Bases 2.65 Gb1,000 283 Clone gaps 54,000
146,000 58 Sequence gaps 116,000
147.000 341 Gaps 170,000
Initial Seq…
Academic
Finishing the euchromatic sequence… The Sequence of …
near-complete sequence: 99% of euchromatinextremely high quality: < 1 error/100kb
Human GenomeFinal version October 2004
![Page 8: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/8.jpg)
~50%of the
273 interior euchromatic gaps
located in
segmentally duplicated regions
Segmental DuplicationsProblems of the human reference sequence
![Page 9: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/9.jpg)
Human genome
5.3% segmentally duplicated
87% of all segmental duplications >50 kb
genomic regions >1kb
with nt identity >90%
Segmental DuplicationDefinition
![Page 10: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/10.jpg)
locus A locus Bid. 99%
allele 1
locus Aalignment
locus A locus B
id. 99%
allele 2
Segmental Tandem DuplicationsAssembly problems
![Page 11: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/11.jpg)
locus A locus Ballele 2
id. 99%
locus A locus Balignment
locus A locus Bid. 99%
allele 1
Segmental Tandem DuplicationsAssembly problems
![Page 12: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/12.jpg)
locus A locus Ballele 2
id. 99%
locus Aalignment
locus B
locus A locus Bid. 99%
allele 1
gap
Segmental Tandem DuplicationsAssembly problems
![Page 13: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/13.jpg)
Hurles, Plos Biology 2:900 (2004)
Segmental duplicationsMechanisms
![Page 14: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/14.jpg)
Hurles, Plos Biology 2:900 (2004)
Segmental duplicationsFate of duplicated genes
origin
heterogeneous human population
![Page 15: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/15.jpg)
2-13 copies / genome1-8 copies / chromosome
Taudien et al., BMC Genomics 5:92 (2004)
chr 8
gapDEF b2DEF b1DEF a
DEF cluster at 8p23.1hg16: 6.3-8.3 Mb
![Page 16: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/16.jpg)
Repeat clusters
Taudien et al., BMC Genomics 5:92 (2004)
chr 8
gapDEF b2DEF b1DEF a
DEF cluster at 8p23.1hg16: 6.3-8.3 Mb
2-12 copies / genome1-7 copies / chromosome
![Page 17: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/17.jpg)
Taudien et al., BMC Genomics 5:92 (2004)
Genomic variability of 8p23.1 DEF locusHypothetical organisation
![Page 18: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/18.jpg)
Yang et al., 2001. Cell. Mol. Life Sci. 58, 978-989
Immunity & Cancer
Defensins (DEF)Multiple roles
![Page 19: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/19.jpg)
Complex phenotypes / diseasesStructural variations
Eichler et al., Nature 447:161 (2007)
![Page 20: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/20.jpg)
Complex phenotypes / diseasesStructural variations
FCGR3 copy number & glomerulonephritis in humans and rats
Nature 439:851 (2006)
Strong association of de novo copy number mutations with autism
Science 316: 445 (2007)
![Page 21: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/21.jpg)
Segmental duplicationsContent of sequenced animal genomes
Bailey & Eichler, Nat Rev Genet 7:552 (2006)
![Page 22: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/22.jpg)
Segmental duplication content of hominoidsHyperexpansions in chimpanzee
Bailey & Eichler, Nat Rev Genet 7:552 (2006)
![Page 23: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/23.jpg)
News Feature, Nature 437:1084 (2005)
Genome DynamicsPatchwork people ?
![Page 24: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/24.jpg)
Conclusions
Genomes of any two individuals in the human population differ more at the structural level than at the
nucleotide sequence level.
Sebat, Nat Gen Suppl 39:s3 (2007)
Differences between individuals• CNV: >4 Mb >1/800 bp > 0.12 %• SNP: 2.5 Mb 1/1,200 bp 0.08 %
![Page 25: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/25.jpg)
AffymetrixHuman SNP Array 6.0
>1.8 million markers906,600 SNPs
946,000 for CNVs
High-throughput SNP genotypingHigh-throughput array-based genotyping
IlluminaHuman 660W-Quad BeadChip2.6 million markers / four samples550,000 tag SNPs100,000 for CNVs5,000 common CNVs
![Page 26: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/26.jpg)
Copy number variation (CNV)Detection by DNA microarrays
Lee et al., Nat Genet Suppl 39:s48 (2007)
• 0.5-2 Mio data points• comparative hybridization
vs. a reference
![Page 27: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/27.jpg)
ABI 3730xl4/2004 & 6/2006
1 Mb/day, 850 nt reads
Roche/454 GS FLX12/2006
Illumina/Solexa GAIIx12/2008 & 11/2009 80 Gb/14d, 2x150 nt reads
HiSeq 200012/2010
Genome analysisDNA sequencing platforms
600 Gb/10d, 2x100 nt reads
800 Gb/23h, 800 nt reads
![Page 28: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/28.jpg)
Completing the map of human genetic variationMapping structural variations
Eichler et al., Nature 447:161 (2007)
![Page 29: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/29.jpg)
Illumina/SolexaPaired ends & Mate pairs
![Page 30: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/30.jpg)
Human Genome ResequencingPerformance
• launched by mid-2010
• 2010: ~600 human genomes• 2011: ~4,000 genomes
• end 2011: 800-1200 genomes/month• mid 2012: new machines with 6 genomes/day • end 2012: <3,000 $/genome
![Page 31: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/31.jpg)
Genetic VariabilityStructural variations
Chromosome A Chromosome B
Inversion
InDel
Allele variation
Combination
![Page 32: The Human Genomegenome.fli-leibniz.de/lectures/download/120111... · 2012. 1. 12. · Affymetrix Human SNP Array 6.0 >1.8 million markers 906,600 SNPs 946,000 for CNVs High-throughput](https://reader033.vdocuments.us/reader033/viewer/2022060717/607d8581b920633378783484/html5/thumbnails/32.jpg)
genome.fli-leibniz.deLectures