the good, the bad and the ugly of genetic engineering
TRANSCRIPT
![Page 1: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/1.jpg)
The Good, the bad and the ugly of Genetic Engineering
![Page 2: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/2.jpg)
• Genetic engineering
–Scientists change the DNA code of an organism in order to:
•Make transgenic organisms
•Clone an organism
![Page 3: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/3.jpg)
Transgenic Organisms
• Organisms which have a gene from another organism in their DNA
![Page 4: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/4.jpg)
Practical applications• Plants with “insecticide” genes
![Page 5: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/5.jpg)
Practical applications• Cows with
extra copies of growth hormones
![Page 6: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/6.jpg)
Practical applications• Bacteria that
make human insulin protein for diabetics
![Page 7: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/7.jpg)
Practical applications?• Cool Glow-in-the-dark Mice!!
![Page 8: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/8.jpg)
How?
• Jelly Fish have a protein called GFP (Green fluorescent protein)
• Gives them that “glow”
![Page 9: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/9.jpg)
How?
• So… They must have a gene (DNA) that has the info to make GFP
GFP Protein = glowing jelly fish
mRNA transcribed from GFP Gene
GFP Gene (DNA)
Transcription
Translation
![Page 10: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/10.jpg)
How?
• What makes us different is What genes we have not how we make the proteins!!!
• So all you need to do is give an organism a new gene and it will be able to make the protein!
![Page 11: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/11.jpg)
How?Jelly fish nucleus with GFP
gene Remove GFP gene
Mouse nucleus without GFP gene
Add GFP gene
Mouse nucleus with GFP gene
GFP protein made
Glowing Mice
![Page 12: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/12.jpg)
Insulin made by bacteria
• Diabetes: dysfunctional Insulin gene; no or low amounts of insulin protein made–Means we can’t regulate blood sugar
levels
– we can force bacteria to make insulin for us
![Page 13: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/13.jpg)
Insulin made by bacteria
• Same process: Tell me how!
![Page 14: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/14.jpg)
1.Find healthy insulin gene in human
2.Cut it out and insert it in bacteria
3.Bacteria then MAKE human insulin even though they have no use for it!
4.We extract the insulin from bacteria and use it in injections
![Page 15: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/15.jpg)
Cloning
• Creating an organism that is genetically identical to its only parent.
![Page 16: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/16.jpg)
Cloning
• Mammals usually mix info from two parents
• In cloning all the chromosomes of the baby come from 1 parent.
![Page 17: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/17.jpg)
Sheep 1 Take 1 body cell (udder)
Extract Nucleus
Sheep 2 Take 1 egg cell
Remove nucleus
![Page 18: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/18.jpg)
Inject nucleus into Egg
Zap to stimulate
cell division
Implant egg into
surrogate sheep
(sheep 3)
![Page 19: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/19.jpg)
Wait for Dolly to be born
Which sheep is Dolly identical to??Why?
Which sheep have to be female?
![Page 20: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/20.jpg)
Snuppy: cloned Afghan Hound
![Page 21: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/21.jpg)
![Page 22: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/22.jpg)
Genetic Testing
Checking a fetus to determine if the baby has any disease.
- Cystic fibrosis
- Tay Sach’s Disease
- Down Syndrome
![Page 23: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/23.jpg)
Genetic Testing
• Done BEFORE birth
• Can detect two kinds of mutations–Chromosomal: easily visible, major
mutations
–Gene mutations: checking for mutated gene; must know what you are looking for!
![Page 24: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/24.jpg)
Amniocentesis
![Page 25: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/25.jpg)
Amniocentesis
Extracting amniotic fluid from womb
Contains cells from fetus
DNA or protein can be isolated and examined
![Page 26: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/26.jpg)
Can check for:
1.Mutations in certain genes (must be looking for something specific)
2.Chromosome abnormalities
3.Abnormal protein levels
![Page 27: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/27.jpg)
DNA finger printing
• Used to compare two people’s DNA
• Used in paternity cases
• Used for crime scene analysis
![Page 28: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/28.jpg)
DNA finger printing
![Page 29: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/29.jpg)
DNA finger printing
• Based on the idea that EVERYONE’s DNA is unique, like a fingerprint
• BUT related individuals will have more similarities
![Page 30: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/30.jpg)
How to do a DNA fingerprint
• Get a sample of DNA and digest it with restriction enzymes– restriction enzymes cut DNA at
specific sequences.
–For example: EcoRI cuts DNA every time it sees the sequence GAATTC
![Page 31: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/31.jpg)
How to do a DNA fingerprint
• If everyone’s DNA is unique, the enzyme will cut each persons DNA differently
• Example: • TCATGAATTCATTGCCGAATTCCGTGAATCCAGAATTCGGACTA
• TCATGAAGTCATTGCCGAATTCCGTGAATCCAGACTTCGGACTA
![Page 32: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/32.jpg)
How to do a DNA fingerprint
• Run cut up DNA on through electrophoresis
• Click here for animation
![Page 33: The Good, the bad and the ugly of Genetic Engineering](https://reader036.vdocuments.us/reader036/viewer/2022081603/56649f295503460f94c41b46/html5/thumbnails/33.jpg)
How to do a DNA fingerprint
• Small pieces travel fast and move further down the gel slab.
• Large pieces move slower and stay closer to the injection point.