the genome-wide transcriptional and physiological...

[1]

The Genome-Wide Transcriptional and Physiological Responses of 1

Bradyrhizobium japonicum to Paraquat-Mediated Oxidative Stress 2

3

4

Andrew J. Donati1, Jeong-Min Jeon1,2, Dipen Sangurdekar3, Jae-Seong So2 and Woo-Suk 5

Chang1* 6

7

1 Department of Biology, University of Texas, Arlington, Texas 76019; 2 Department of Marine 8

Science and Biotechnology BK21 Program, Inha University, Incheon 402-751, South Korea 9

3 Lewis-Sigler Institute for Integrative Genomics, Princeton University, Princeton, New Jersey 10

08544 11

12

13

14

Running title: Paraquat-mediated oxidative stress in B. japonicum 15

16

17

*Corresponding author. 18

Mailing address: Department of Biology, University of Texas at Arlington, Life Science 19

Building 216, Arlington, TX 76019. 20

Phone: (817) 272-3280 21

Fax: (817) 272-2855 22

E-mail address: [email protected] 23

Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.00047-11 AEM Accepts, published online ahead of print on 15 April 2011

on Septem

ber 6, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

http://aem.asm.org/

[2]

ABSTRACT 24

The rhizobial bacterium Bradyrhizobium japonicum functions as a nitrogen-fixing symbiont 25

of the soybean plant (Glycine max). Plants are capable of producing an oxidative burst, a rapid 26

proliferation of reactive oxygen species (ROS), as a defense mechanism against pathogenic and 27

symbiotic bacteria. Therefore, B. japonicum must be able to resist such a defense mechanism to 28

initiate nodulation. In this study, paraquat, a known superoxide radical-inducing agent, was used 29

to investigate this response. Genome wide transcriptional profiles were created for both 30

prolonged exposure (PE) and fulminant shock (FS) conditions. These profiles revealed that 190 31

and 86 genes were up and down-regulated for the former condition, and that 299 and 105 genes 32

were up and down-regulated for the latter condition, respectively (> 2.0-fold, P < 0.05). Many 33

genes within putative operons for F0F1-ATP synthase, chemotaxis, transport, and ribosomal 34

proteins were up-regulated during PE. The transcriptional profile for the FS condition strangely 35

resembled that of a bacteroid condition, including the FixK2 transcription factor and most of its 36

response elements. However, genes encoding canonical ROS scavenging enzymes such as 37

superoxide dismutase and catalase were not detected, suggesting constitutive expression of those 38

genes by endogenous ROS. Various physiological tests including exopolysaccharide (EPS), 39

cellular protein, and motility characterization were performed to corroborate the gene expression 40

data. The results suggest that B. japonicum responds to tolerable oxidative stress during PE 41

through enhanced motility, increased translational activity, and EPS production in addition to the 42

expression of genes involved in global stress responses such as chaperones and sigma factors. 43

44

45

46

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[3]

INTRODUCTION 47

Bradyrhizobium japonicum, which belongs to the family Bradyrhizobiaceae of the order 48

Rhizobiales, is an inhabitant of the soil which can exist in either a free-living state or an 49

endosymbiont state in association with host plants. In the latter state, the host specificity of B. 50

japonicum allows it to establish a symbiotic relationship with the soybean plant (Glycine max) by 51

engaging in specific signaling and communication which involves plant-borne flavonoids and 52

bacterial lipo-chito-oligosaccharide Nod factors (11, 40). In addition, B. japonicum is capable 53

of diversity in its metabolism and energy production in response to environmental cues (24). 54

One variable that changes as B. japonicum transforms from a free-living state to a symbiotic state 55

is the concentration of oxygen. It has been demonstrated that a concentration difference on the 56

magnitude of five orders of ten (34) exists between the two states. Reactive oxygen species 57

(ROS) are created within cellular systems as a by-product of aerobic respiration because of the 58

incomplete reduction of molecular oxygen at the terminus of the electron transport chain. These 59

reactive oxygen molecules are capable of modifying cellular components such as lipids, proteins 60

and nucleic acids due to their contribution to the propagation of free radicals within a cell. 61

A key aspect of a plant-microbe interaction involving either pathogenic or non-pathogenic 62

but invasive bacteria is an induction of the plant’s innate defense mechanism which has been 63

termed the hypersensitive disease resistance response (35). This non-specific localized response 64

is mediated by ROS such as hydrogen peroxide and the superoxide anion radical (3, 4, 31, 36, 65

51, 53). Symbiotic bacteria of necessity must possess compensatory mechanisms for the plant 66

innate defense mechanisms to initiate symbiosis. These mechanisms include activation of 67

detoxification enzymes, exopolysaccharide (EPS) production, and biofilm formation, all of 68

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[4]

which have been suggested to play a role in tolerance to a variety of stresses such as ROS (33), 69

desiccation (16), and cytotoxic host immune responses (18, 19). 70

Paraquat (1,1’-dimethyl-4,4’-dipyridylium dichloride or methyl viologen) is the 71

ROS-inducing agent and indirectly contributes to oxidative stress in the cytosol by its interaction 72

with membrane-bound cytochrome c. The paraquat radical is capable of diffusion across the 73

cellular membrane of bacteria (27). The overall mechanism for its toxicity involves a net 74

production of superoxide anion radicals in the intracellular compartment and a moderate degree 75

of extracellular production of superoxide anion radicals and hydrogen peroxide (13). The toxic 76

effects of paraquat on a prokaryotic system have been demonstrated to be augmented by the 77

presence of oxygen, and also depend on nutritional factors such as substrate availability and 78

medium composition (27, 29). The transcriptional response to paraquat in prokaryotic systems, 79

namely Escherichia coli (28, 29), has been shown to involve the canonical mechanism of 80

detoxification by manganese-superoxide dismutase and downstream enzymes such as catalases 81

and peroxidases. 82

Many studies on oxidative stress have been performed using shock experiments in which the 83

bacteria are exposed to a high concentration of the ROS for a short time period (5, 39, 50). 84

However, little is known about how bacteria respond to tolerable, low concentrations of ROS for 85

a long time. It is not difficult to conceive of the notion that bacteria inhabiting the soil and the 86

rhizosphere experience low concentrations of ROS in addition to the high concentrations that 87

have been conventionally used in most transcriptional analyses. It can also be reasonably 88

hypothesized that cells subjected to a high concentration rarely experienced in nature may not 89

respond in a coherent and realistic manner because of the excessive levels of stress. A state of 90

prolonged exposure to a moderate concentration allows a cell to gradually acclimatize to the 91

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[5]

experimental variable and may provide a more comprehensive overview of its metabolic 92

adjustment to ROS. Moreover, the concentration of ROS within the rhizosphere is not static, but 93

is characterized by a fluctuation of the relative concentration. Therefore, the proceeding 94

experimentation has been designed to consist of two categories. The first method is referred to 95

as the fulminant shock (FS) treatment of cells which uses a high, sub-lethal concentration of 96

paraquat. The other method has been termed the prolonged exposure (PE) condition in which 97

low concentrations are used to provide a balanced approach to the transcriptional profile of B. 98

japonicum. 99

In this study, we demonstrate the transcriptional and physiological responses of B. 100

japonicum to oxidative stress induced by paraquat. The elucidation of possible stress tolerance 101

mechanisms will provide insight into the plant-microbe interaction between B. japonicum and 102

Glycine max as well as other rhizobia and their respective symbiotic partners. 103

104

MATERIALS AND METHODS 105

Bacterial strain and growth conditions. The wild-type strain, B. japonicum USDA 110, 106

was routinely cultured in arabinose-gluconate medium (AG) (48) which contained 125 mg 107

NaHPO4, 250 mg Na2SO4, 320 mg NH4Cl, 180 mg MgSO4 x 7H2O, 10 mg CaCl2, 4 mg FeCl3, 108

1.3 g HEPES, 1.1 g MES, 1.0 g yeast extract, 1.0g L-arabinose, and 1.0 g D-gluconic acid sodium 109

salt per liter with pH adjusted to 6.8. All cultures were maintained aerobically at 30 °C with 110

shaking (200 rpm). 111

Prolonged exposure (PE) experimental conditions. Growth curves were produced for B. 112

japonicum during PE to paraquat (Aldrich) at various concentrations (10, 50, 100 μM, and 113

1 mM) in order to ascertain which concentration had an intermediate effect on generation time 114

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[6]

and the final optical density. Measurements of turbidity (O.D.600) were taken every 8-12 hours 115

with a UV-Vis spectrophotometer (Genesys 5, Spectronic Instruments) and plotted against time 116

on the abscissa. Paraquat was added to AG medium at the time of inoculation to create final 117

concentrations of 10, 50, 100 μM and 1 mM. 118

Fulminant shock (FS) experimental conditions. For induction of a FS stress condition, 119

paraquat was added after cell cultures had achieved O.D.600 of 0.8. Cells were treated with 120

various concentrations of paraquat (100, 250, 500, 750 μM, and 1, 5, 10, and 20 mM) for 10, 20, 121

and 30 min. After being subjected to paraquat, cells were plated on AG medium plates. Then, 122

colony forming units (CFUs) were counted after 4 days of incubation at 30 °C. The 123

experimental condition was chosen from the concentration and time variables which had 124

intermediate and sub-lethal effects on the viable cell counts. 125

Isolation of total RNA. Cells were harvested from 250-ml cultures during mid-log phase 126

(O.D.600 ~0.6-0.8) after PE to paraquat and after FS treatment with paraquat by 10% stop solution 127

(5% H2O-phenol, pH 4.3, in 100% ethanol). Cells were recovered by centrifugation at 8,000 x g 128

for 20 min, flash frozen in liquid N2, and stored at -80 °C until use. Total RNA was isolated 129

from cell pellets using a modified hot-phenol method as previously described (7). DNase 130

treatment and purification of total RNA were performed by using RNase-free DNase set 131

(Qiagen) and the RNeasy® mini kit (Qiagen) according to the manufacturer’s protocols. RNA 132

quality was analyzed on 0.8% agarose gels and RNA quantity was measured by the NanoDrop 133

ND-1000 spectrophotometer (Thermo Scientific). 134

Global gene expression analysis by microarray hybridization. Genome-wide 135

transcriptional profiles were created from the hybridization of cDNA samples labeled with 136

Amersham Cy3 and Cy5 monoreactive dyes (GE Healthcare) to microarray chips containing 137

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[7]

70-mer oligonucleotides which were complementary to each of the 8,453 annotated open reading 138

frames (ORFs) of B. japonicum (15). Thirty micrograms of total RNA were used for cDNA 139

synthesis and 5 μg of cDNA from both control and experimental conditions were used for 140

labeling and hybridization. The detailed protocols for cDNA synthesis, cDNA labeling, 141

hybridization, and washing have been described previously (15). A total of three independent 142

biological replicates were prepared for each condition, which included a dye-swap for each 143

replicate, resulting in a total of 6 slides for each experimental condition. 144

Statistical analysis of microarray data. The slides were scanned with the Axon GenePix 145

4200 scanner and GenePix Pro 6.0 software was used to measure intensity values at each spot. 146

The signal intensities were normalized for slide and spot abnormalities using the Lowess 147

algorithm and subsequently analyzed by mixed-effect microarray ANOVA (MAANOVA) (32). 148

Values obtained from this round of analysis were input into a significance analysis of microarray 149

(SAM) statistical package (57) to create a list of differentially expressed genes with a fold-150

induction threshold of 1.5 or 2.0, and a false-discovery rate (FDR) of 5% or less (q value ≤ 0.05). 151

Quantitative reverse transcription-PCR (qRT-PCR) analysis. Representative genes 152

which were differentially expressed from the microarray data were chosen for qRT-PCR analysis 153

to confirm the microarray data. Primers were designed with Primer 3 software, available at 154

http://frodo.wi.mit.edu/primer3/, to amplify 80-250 bp regions of the chosen genes (Table 1). 155

Two micrograms of the same RNA which was used in the microarray experiment was employed 156

to synthesize cDNA. The process was performed according to a previously described protocol 157

(20). Relative expression values for 3 biological replicates were normalized to the expression 158

values of a housekeeping gene (bll0631, parA), which encodes a chromosome partitioning 159

protein. Fold-induction values were calculated in accordance with the method of Pfaffl (42). 160

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[8]

Construction of ΔcheA mutant. The locus blr2343 (cheA) was chosen for mutagenesis 161

based on the transcriptomics data. The mutant strain (ΔcheA) was created by amplification of a 162

3,663 bp fragment containing the 1,911-bp cheA gene and additional 892-bp 5’ upstream and 163

860-bp 3’ downstream portions with the primers TGATTCGCGTCAAACG TGTATCGG and 164

TCATCTTGGCGTATGTCACAGCGA, forward and reverse respectively. The 3,663 bp 165

fragment was cloned into the pKnockout Ω suicide vector (59). A kanamycin cassette from 166

pHP45Ω-Km (22) was inserted inside the cloned gene to disrupt it. The resulting construct was 167

transferred from E. coli DH5α to B. japonicum USDA110 by triparental mating with the helper 168

strain containing pRK2073. Transconjugants were selected based on double homologous 169

recombination, which confers kanamycin resistance and streptomycin sensitivity. The mutant 170

strain was confirmed by Southern blot analysis and colony PCR (data not shown). 171

Measurement of ROS in vitro. Fifty micro-liters of a 20 μM stock solution of 172

dihydroethidium (Molecular Probes) in dimethyl sulfoxide was combined with 50 μL of the 173

samples to create a final concentration of 10 μM and incubated for 1 h at 37 °C in the dark. 174

Absorbance was measured at the λmax for fluorescence excitation (300 nm) of dihydroethidium 175

using a 96-well microtiter plate reader (Synergy 2, BioTek). Nine replicates were performed at 176

the harvesting time for the growth of B. japonicum when subjected to 100 μM paraquat (for the 177

PE condition) and at 10 min following treatment with 5 mM paraquat (for the FS treatment). 178

The medium itself and medium with paraquat were also used as internal controls. 179

Capillary assay for chemotaxis. The effect of paraquat on chemotaxis was investigated 180

using a previously described capillary assay (1). Briefly, a mid-log phase culture was harvested 181

by centrifugation at 8,000 x g and resuspended into AG media to adjust cell numbers to ca. 109 182

cells per milliliter. The sample was divided into three and media was added to reconstitute ca. 183

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[9]

3.3 x 108 cells for each sample in 1 milliliter. The capillary test was performed using the capillary 184

tube apparatus as described previously (1). CFUs were counted after incubation for 3 to 4 days. 185

Therefore the approximate influx of motile cells into the capillary tube was measured. A ratio of 186

the treated cells over the control cells was calculated to infer the effects of 100 μM paraquat on 187

chemotaxis. A ratio greater than one indicates that the test substance is an attractant and a ratio 188

less than 1 indicates that the substance is a repellant. A ratio close to one is indicative of no net 189

effect on chemotaxis. The chemotaxis of the mutant strain (ΔcheA) was also assayed to compare 190

it with that of the wild type. 191

EPS isolation and quantification. B. japonicum cultures treated with 0, 100, 250, and 500 192

µM paraquat were grown for the late log phase and the extracellular materials were recovered by 193

centrifugation at 16,000 x g for 30 min at 4 °C. The supernatant was filtered with sterilized 0.45-194

µm filters and treated with DNase I and proteinase K as described previously (6, 46). The EPSs 195

were precipitated with three volumes of 100% ethanol at -20 °C overnight. The ethanolic 196

supernatant was subject to the second ethanol precipitation to ensure adequate EPS recovery (10, 197

16). The EPSs were dried at room temperature before being resuspended in deionized water. 198

Total carbohydrate content was measured with the phenol-sulfuric acid method (21) in which 199

glucose was the standard, and the acidic carbohydrate content was determined by the m-200

phenylphenol method (8) with D-glucuronic acid as the standard. The carbohydrate content was 201

normalized to the total protein. 202

Isolation and quantification of cellular protein. Cellular protein was isolated from the 203

same cell pellets from the cultures used for EPS quantification. The cell pellets were 204

resuspended in 20 ml 1N NaOH and incubated at 80 °C for 30 min to lyse the cells and recover 205

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[10]

the cellular proteins in the supernatant. The cellular protein content was determined by the 206

method of Bradford (9) in which bovine serum albumin served as a reference. 207

Microarray data accession numbers. The microarray data from this study are compiled in 208

the NCBI Gene Expression Omnibus (GEO) database (http://www.ncbi.nlm.nih.gov/geo/) and 209

are accessible through the GEO series accession numbers GSE26252 and GSE26236 for PE and 210

FS treatments, respectively. 211

212

RESULTS 213

Bacterial growth characteristics during prolonged exposure (PE) to paraquat. The 214

growth characteristics of B. japonicum when subjected to various concentrations of paraquat 215

from the time of inoculation were examined and an optimal concentration for the PE experiment 216

was determined to create a genome-wide transcriptional profile. As shown in Fig. 1, the high 217

concentration (1 mM) of paraquat affected both the lag phase and the generation time. B. 218

japonicum cultures supplemented with 10, 50, and 100 μM paraquat also experienced a 219

lengthened acclimation period, but had a growth rate comparable to that of the control, although 220

the maximum density of cells treated with 100 μM paraquat is lower than that of the control 221

(Fig. 1). Given that the oxidative stress condition of 100 μM paraquat had intermediate effects on 222

cellular processes and physiology without excessive lethality, this condition was chosen for PE 223

experiments and the transcriptomics study. 224

Bacterial survival after fulminant shock (FS) treatment with paraquat. The effects of a 225

concentration spectrum of paraquat on the survival of B. japonicum were investigated to 226

determine an optimal condition for FS experiments. After a 10 min treatment period, 5, 10, and 227

20 mM paraquat caused a diminution of the viable cell count by 22%, 24 %, and 32% 228

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[11]

respectively (Fig. 2). However, by 30 min there was a steady-state in CFUs with a little decline, 229

approximately 40% for the three concentrations. Due to the intermediate consequences on cell 230

viability, we chose the treatment parameters of a 5 mM concentration and 10 min for the creation 231

of genome-wide transcriptional profiles. 232

Genome-wide transcriptional analyses of cells exposed to paraquat-mediated oxidative 233

stress. Genome-wide transcriptional profiles were generated from both cells subjected to the low 234

concentration (100 μM) of paraquat throughout their entire growth phase and cultures treated 235

with the high concentration (5 mM) of paraquat for a short time period (10 min). Both 236

transcriptional profiles reveal that the distribution of affected cellular functional categories 237

between the two conditions is different but does contain some overlap (Fig. 3). At the time of 238

cell harvest, we also checked the ROS level since the concentration of paraquat used, specifically 239

in the PE treatment, may have been detoxified earlier. To insure that superoxide was still present 240

at the time of the transcriptional analysis, we conducted an assay for superoxide radicals. 241

Relative superoxide levels were inferred from the intercalation of DNA with 2-hydroxyethidium 242

which is a product of the oxidation of dihydroethidium by the superoxide anion radical. 243

Endogenous superoxide has been shown to selectively oxidize dihydroethidium (47, 60, 61). As 244

shown in Fig. 4, the difference in superoxide levels is displayed at the time of cell harvest for 245

transcriptional profiling for both conditions. A statistically significant amount of intracellular 246

superoxide is still present in the experimental cultures. This result eliminates the possibility of 247

the paraquat-mediated production of superoxide radicals having been quenched before the 248

transcriptional analysis was performed. 249

A total of 190 genes were up-regulated and 86 genes were down-regulated (2.0-fold cutoff 250

with P < 0.05) during PE to paraquat with diversity in the functional classification of the 251

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[12]

differentially-expressed genes (Table S1). A substantial difference was observed within the 252

functional classifications of cellular processes, cell envelope, energy metabolism, translation, and 253

transport and binding proteins (Fig. 5A). Most differentially-expressed genes within these 254

categories were up-regulated. However, many of the genes within the regulation category were 255

down-regulated by PE to paraquat. The most interesting results from this experiment were the 256

comprehensive induction of genes involved in chemotaxis, translation factors, and the two 257

putative ATP synthase operons within the B. japonicum genome (Table 2). Specifically, out of a 258

total of 31/44 (2.0/1.5 fold-induction) differentially-expressed chemotaxis genes, all of them 259

were up regulated (Table S1). In addition, genes belonging to the sub-classifications of 260

molecular chaperones, nucleic acid modification and repair proteins, and oxidative stress 261

mechanisms were expected to be augmented in their relative expression levels, and such was the 262

case. The most unexpected result was the failure to detect the induction of canonical 263

detoxification enzymes such as superoxide dismutase and catalase. The two superoxide-264

dismutase enzymes (bll7559 and bll8073) which depend on a manganese co-factor were not 265

detected in B. japonicum, although the manganese co-factor enzyme has been demonstrated to be 266

the primary detoxification response to superoxide in E. coli (25, 26, 28). 267

A total of 299 genes were up-regulated and 105 were down regulated (2.0-fold cutoff with 268

P < 0.05) for the FS condition (Table S2). A majority of the differentially expressed genes are 269

listed under the classification of hypothetical or other categories. Most genes within the 270

categories of central intermediary metabolism, of which most function in nitrogen fixation or 271

nitrogen metabolism, and regulatory functions had augmented expression levels relative to 272

control. The FS treatment also induced the expression of the FixK2 transcription factor and most 273

of its target genes (Table 3) which are necessary for microaerobic, anaerobic, and symbiotic 274

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[13]

growth conditions (38). These targets include the fixNOQP operon which encodes proteins 275

related to an alternative, high-affinity cytochrome c oxidase complex (44, 45). Other targets 276

include the fixGHIS operon, rpoN1 sigma factor, heme biosynthesis genes, and possibly genes for 277

nitrate respiration all of which are induced when oxygen availability is limited (23, 37, 38, 45). 278

In a comparison of the transcriptional profiles of bacteroids isolated from soybean root 279

nodules and aerobically grown free-living cells, Pessi et al. report two statistically significant 280

overrepresented functional categories in the bacteroid cells which are central intermediary 281

metabolism and transport and binding proteins (41). A similar pattern was observed in cells 282

exposed to a FS treatment of paraquat (Fig. 5B and Table 3). In general, the results of the 283

transcriptional profiles of B. japonicum when subjected to paraquat-mediated oxidative stress are 284

strangely similar to a transcriptional profile of a bacteroid state. Genes within the sub-categories 285

of molecular chaperones, respiration, and transport and binding function were also up-regulated 286

(Table 3). Within the context of this experimental condition, the transcript levels for superoxide 287

dismutase and catalase were not changed as in the case of the PE condition. A complete list of 288

all genes for both conditions can be found in Tables S1 and S2 in the supplementary material. 289

Validation of microarray expression by qRT-PCR. In order to confirm the microarray 290

expression data, fold-induction values for representative genes from each experimental condition 291

were determined by qRT-PCR. The genes for qRT-PCR analysis were chosen based on a range 292

of fold-induction values and by their diversity in function. All of the chosen genes from both PE 293

and FS conditions yielded consistent results with little deviation (R2 = 0.92), indicating that the 294

microarray data have been validated by the qRT-PCR method (Fig. 6). 295

Differential activation of oxidative stress response mechanisms between PE and FS. PE 296

to paraquat induced 17 oxidative stress-responsive genes of which most were only moderately 297

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[14]

up-regulated, while the FS treatment induced 5 oxidative stress-responsive genes (Table 4). 298

Organic hydroperoxide resistance protein (bll0735) was the only common gene induced in both 299

PE and FS conditions. In addition, 4 sigma factor related genes were up-regulated in the FS 300

treatment (Table 3), indicating that these sigma factors function in the amelioration of fulminant 301

shock. Interestingly, the failure to detect the induction of catalase (kat) and superoxide dismutase 302

(sod) genes commonly known to be induced by oxidative stresses led us to employ qRT-PCR to 303

confirm the negative result. Genes encoding a Fe/Mn superoxide dismutase (bll7559), alkyl 304

hydroperoxide reductase (bll1777), and catalase (blr0778) also failed to meet 2.0 threshold 305

values by qRT-PCR analysis (data not shown), which suggests constitutive expression of these 306

proteins and dependence upon alternative methods for oxidative stress tolerance. 307

Translational activity is increased during PE, but decreased by FS. One interesting 308

finding in the gene expression data is related to translational machinery. Twenty one/fifty six 309

(2.0/1.5-fold cutoff) translation-related genes were expressed higher in the PE condition (Table 310

S1), while no genes encoding ribosomal proteins were expressed in the FS treatment (Tables 3 311

and S2). In general, there is an increased demand for translational machinery for metabolically 312

active cells. For example, more translation related genes were up-regulated in the faster growing 313

cells (15, 56). However, our growth data do not support an increased demand for translational 314

machinery due to higher metabolic activity, since the growth rate in 100 µM paraquat is 315

comparable to that of the control (Fig. 1). This discrepancy led us to measure total protein 316

content in response to paraquat-mediated oxidative stress during PE. The total cellular protein for 317

cultures supplemented with 100 μM paraquat was 15.61 ± 0.63 mg/ml while the protein content 318

of control cultures was 9.50 ± 0.47 mg/ml, which means a 61% increase in total cellular protein 319

was evident for treatment with paraquat. Given that all cells were harvested at the same O.D. 320

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[15]

(approximately 0.6 at 600 nm), our protein data are consistent with the transcriptomic data. In the 321

FS condition, there was no difference of total protein content between the control and 5 mM 322

paraquat for 10 min (data not shown), which is also in agreement with gene expression data. 323

However, we prefer to interpret the latter result in that 10 min was not sufficient enough to 324

compare levels of total proteins between before and after the treatment. 325

Paraquat-mediated oxidative stress modulates motility characteristics. Another 326

interesting finding was induction of motility related gene clusters in the PE treatment. Thirty 327

one/forty four (2.0/1.5-fold cutoff) chemotaxis genes were up-regulated (Table S1). The FS 328

treatment, to the contrary, caused a repression of most chemotaxis genes that were differentially 329

expressed at 2-fold cutoff (Table S2). The high expression of chemotaxis genes may indicate that 330

the chemical added to the culture is an attractant, and therefore bacteria move towards it. 331

However, our capillary assay has determined that paraquat has a negative chemotactic effect, 332

indicating that it is a repellent (Fig. 7). The ∆cheA (blr2343) mutant strain was constructed and 333

used as a negative control in the assay (Fig. 7). This gene was chosen because it encodes a key 334

two-component sensor histidine kinase and is part of a more complete gene cluster. Moreover, 335

the contiguous genes within the same putative operon were concomitantly induced during PE. 336

The result suggests that B. japonicum activates chemotaxis functions to stay away from a 337

potential toxicity caused by paraquat. This finding is of particular importance because expression 338

of chemotaxis genes can be induced by either an attractant or a repellant. The latter case is often 339

neglected in bacterial chemotaxis studies. Alternatively, we cannot rule out the possibility that 340

apparent gene expression may be modified at the post-transcriptional level. 341

Exopolysaccharide (EPS) production is enhanced in the presence of ROS. In this 342

transcriptional profiling, we expected that more EPS related genes would be expressed because 343

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[16]

of the protective nature of EPS against ROS (33). In a pre-determined hypothesis, one of the 344

physiological responses of B. japonicum to oxidative stress was an increase in the net production 345

of EPS as a possible compensatory mechanism for the innate host defense mechanisms (12, 33). 346

Nonetheless, there was no transcriptomic evidence for enhanced EPS production except for 347

blr7573 (exoU), which does not exclude the possibility of post-transcriptional regulation as the 348

cause of excessive EPS. Thus, we measured the total amount of EPSs during PE to paraquat. It is 349

nearly two-fold more than in the case of the control, although there is approximately 50% 350

increase in the 500 µM paraquat treatment (Fig. 8A), suggesting that EPS production is induced 351

by paraquat-mediated oxidative stress. However, there is no direct correlation between 352

increasing concentration and EPS production, which may suggest a refractory effect upon 353

achieving a threshold concentration. We also quantified the sub-class of acidic carbohydrate 354

content as expressed in glucuronic acid equivalents (Fig. 8B). Uronic acids such as alginate, 355

composed of mannuronic and guluronic acids, have been known to be involved in tolerance to 356

desiccation and associated oxidative stresses in Pseudomonas putida, a typical soil bacterium (16, 357

17). Acidic sugars were not detected in control cultures, while relatively similar amounts of 358

uronic acids were present across various concentrations of paraquat (Fig. 8B). EPS 359

quantification analysis for both the total and acidic sugars indicates that more EPS production is 360

one of the ROS-responsive mechanisms in B. japonicum. Regulation of EPS production in 361

response to paraquat-mediated oxidative stress may also be controlled at the post-transcriptional 362

level. 363

364

DISCUSSION 365

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[17]

In prolonged exposure (PE), B. japonicum requires longer acclimation time, compared with 366

the control (no paraquat), to adapt to superoxide-mediated oxidative stress presumably through 367

detoxification mechanisms as well as through other indirect mechanisms before exponential 368

growth is achieved. In fulminant shock (FS), the net effect of adding 5 mM paraquat to a 369

proliferating culture was a swift reduction in viable cell counts within a short time period (10 370

min) as was expected. A shock experimental condition within a short time period exceeds a 371

capacity of cells to respond and return to homeostasis which is evidenced by a rapid decrease in 372

viable cells or cell survival. This high concentration was chosen to generate a gene expression 373

profile of B. japonicum during a systemic and desperate response to oxidative stress whose 374

magnitude is rarely experienced for a lengthy period under normal environmental conditions. 375

A more consummate picture of the transcriptional activities of B. japonicum during oxidative 376

stress is made possible by comparing these two distinct parameters of PE and FS. Chemotaxis, 377

chaperones, respiration, translation, and transport are the primary functional categories affected 378

during PE to paraquat. Chemotaxis is worth addressing because most of the differentially 379

expressed genes in this category are up-regulated. However, in the FS treatment most of the 380

chemotaxis genes did not change or some were even down-regulated, which is consistent with 381

other genome-wide transcriptional studies of Staphylococcus aureus (14), Pseudomonas 382

aeruginosa (50), and E. coli (58) where shock concentrations of hydrogen peroxide were applied 383

to the cultures. Another study on E. coli which used paraquat for treatment of early-log phase 384

cultures did not show induction of chemotaxis related genes (43). The observed increase in 385

chemotaxis can be explained as an evasive mechanism. When exposed to low levels of ROS, 386

bacteria can respond by increasing motility to limit the damage of the superoxide radicals. 387

However, in the high level of ROS they may not have enough time to adjust and activate their 388

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[18]

motility machinery. Instead, cells may utilize much quicker mechanisms such as chaperones and 389

sigma factors to ameliorate the toxicity of ROS. 390

Aerobic respiration also appears to be regulated in both PE and FS conditions. The putative 391

ATP synthase operons and some proteins associated with electron transport immediately 392

upstream in the aerobic respiratory chain to ATP synthase, such as the Rieske Fe-S 393

protein/cytochrome bc1 complex (blr2485) and the cytochrome aa3 terminal oxidase (blr1171), 394

were moderately up-regulated during PE to paraquat. Tamarit et al. (54) report that the β-subunit 395

of the F0F1-ATPase is a specific protein damaged by superoxide stress. The induction of 396

cytochrome c oxidase genes has also been observed in global transcriptome analysis of E. coli 397

exposed to paraquat-mediated oxidative stress (43). Hassan et al. have demonstrated that toxicity 398

of paraquat is oxygen- and nutrient-dependent, and also augments what they have termed as a 399

cyanide-insensitive respiration which applies to the terminal cytochrome c oxidase complex (28, 400

29). They also postulate that paraquat is able to subvert electron flow through the cytochrome c 401

oxidase complex directly to molecular oxygen, thereby increasing endogenous superoxide. The 402

transcriptional profiles of B. japonicum appear to be consistent with these conjectures. This 403

phenomenon could confer a metabolic advantage to the bacteria as they adapt from a free-living 404

state into a symbiotic state which invariably involves the plant’s hypersensitive disease 405

resistance response. Further experiments would be required to corroborate this hypothesis. 406

Various genes encoding proteins from the tricarboxylic acid (TCA) cycle were up-regulated 407

in both conditions such as aconitase (bll0466), enolase (bll4794), succinate dehydrogenase 408

(blr0513), and most notably the pyruvate dehydrogenase complex (blr6333 and blr6334) which 409

links the TCA cycle and the glycolytic pathway. Genome-wide transcriptional profiles of P. 410

aeruginosa and Sinorhizobium meliloti indicate a moderate increase in expression levels for 411

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[19]

proteins within the pyruvate dehydrogenase complex in response to oxidative stress (5, 49). In 412

the case of P. aeruginosa, genes encoding proteins that function in the TCA cycle and the 413

terminal aerobic respiratory chain complex are up-regulated, which is in agreement with B. 414

japonicum gene expression. 415

The transcriptional profile for B. japonicum during FS oxidative stress was strangely 416

identical to a symbiotic state which included activation of the FixLJ-FixK2 regulatory pathway. 417

However, Mesa et al. reported a repression of these target genes of the FixLJ-FixK2 pathway in 418

response to oxidative stress (37), which is incongruous with our findings. The rationale for the 419

contradictory results would be the differing background conditions. In this study, all 420

transcriptional analyses were performed in aerobic conditions, while a micro-oxic condition was 421

used in the previous study, which may not allow for a direct comparison. Furthermore, Western 422

blot analysis conducted in vivo across a variety of conditions (i.e., oxic, micro-oxic, and anoxic) 423

reveals a somewhat constitutive expression of FixK2 transcripts, which hints at a possible control 424

mechanism at the post-translational level. Alternatively, it can be explained by the toxicity 425

mechanism of the paraquat radical which reacts with molecular oxygen, resulting in a superoxide 426

anion radical. A fulminant increase in the concentration of paraquat would cause a rapid 427

conversion of free oxygen into superoxide, thereby creating a transient micro-oxic condition in 428

which the induced FixK2 positively regulates the fixNOQP and fixGHIS operons (38). Hence, the 429

bacteria would adjust their transcriptional profiles as if they were in a bacteroid state whose 430

environment is typically micro-oxic. 431

Only one gene (blr7573, exoU) encoding UDP-hexose transferase associated with EPS 432

production was moderately up-regulated. Nevertheless, we performed EPS quantification 433

because an a priori hypothesis was that B. japonicum would produce more EPS as a defense 434

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[20]

mechanism against oxidative stress. In addition, a number of previous studies investigating 435

various stresses such as desiccation (16, 20, 55) and cytotoxic immune responses (12, 18, 19) 436

have reported elevated EPS production against those stresses. Indeed, our EPS quantification 437

results are consistent with that of previous findings, and therefore support our original hypothesis 438

regardless of the transcriptomic profiles, suggesting possible regulation of EPS production at the 439

post-transcriptional level. In a study on the virulence of Streptococcus mutans in response to 440

oxygen availability, the authors demonstrate that the EPS machinery is modulated post-441

transcriptionally in the regulation of the biofilm microhabitat (2). The subset of acidic, anionic 442

carbohydrate content of the EPS was also included in addition to total EPS content because the 443

acidic sugars have been demonstrated to play a crucial role in biofilm and EPS integrity in 444

bacteria within the Pseudomonas genus (30, 50). 445

Only a few genes encoding proteins involved in oxidative stress were highly expressed in 446

both PE and FS. The expression of the canonical detoxification enzymes superoxide dismutase 447

and catalase was not detected in either condition. However, moderate induction (between 1.5- 448

and 2.0-fold) was evident of organic hydroperoxide resistance proteins, glutathione related 449

genes, and some oxidoreductases (Table 4). Similarly, Salunke et al. did not detect up-regulation 450

of catalase (katA), superoxide dismutase (sodB) or alkyl hydroperoxide reductases (ahpB and 451

ahpC) in their expression analysis of three strains of P. aeruginosa in response to superoxide 452

stress (49). Moreover, evidence has been provided that these genes are already constitutively 453

expressed at such a high level, and thus any exposure to oxidative stress would not be effective 454

in further induction of these genes. This certainly appears to be the case for B. japonicum. The 455

superoxide assay in this study not only revealed that excessive superoxide was present at the 456

time of cell harvest, but that a basal level, presumably from endogenous ROS, was present in 457

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[21]

control cultures (data not shown) which would induce transcription of these detoxification 458

enzymes. In addition, FS caused significant up-regulation of a gene (hemN2) involved in heme 459

biosynthesis which has been demonstrated to be functional during anaerobic and symbiotic 460

growth (23). This is also evidence for a transcriptional profile that resembles that of a symbiotic 461

condition. The most pertinent conclusion from these enumerated findings is that B. japonicum is 462

capable of diverse physiological responses to tolerable oxidative stress levels which include 463

enhanced motility, translational activity, respiration, and EPS production. 464

465

ACKNOWLEDGEMENTS 466

We thank Raymond Jones in the Genomics Core Facility at the University of Texas-467

Arlington for providing technical support for the qRT-PCR analysis and Hae-In Lee for his 468

assistance in the chemotaxis mutant strain construction. This research was supported in part by 469

Basic Science Research Program through the National Research Foundation of Korea (NRF) 470

funded by the Ministry of Education, Science and Technology (2010-0016797), Inha University 471

Research grant, and a Research Enhancement Program (REP) grant from the University of 472

Texas-Arlington. 473

474

REFERENCES 475

1. Adler, J. 1973. A method for measuring chemotaxis and use of the method to determine 476 optimum conditions for chemotaxis by Escherichia coli. J. Gen. Microbiol. 74:77-91. 477 2. Ahn, S.J., Z. T. Wen, and R. A. Burne. 2007. Effects of oxygen on virulence traits of 478 Streptococcus mutans. J. Bacteriol. 189:8519-8527. 479 3. Baker, C. J, E. W. Orlandi. 1995. Active oxygen in plant pathogenesis. Annu. Rev. 480 Phytopathol. 33:299-321. 481 4. Baker, C. J., N. Mock, J. Glazener, and E. Orlandi. 1993. Recognition responses in 482 pathogen/non-host and race/cultivar interactions involving soybean (Glycine max) and 483 Pseudomonas syringae pathovars. Physiol. Mol. Plant Pathol. 43:81-94. 484

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[22]

5. Barloy-Hubler, F., A. Cheron, A. Hellegouarch, and F. Galibert. 2004. Smc01944, a 485 secreted peroxidase induced by oxidative stresses in Sinorhizobium meliloti 1021. 486 Microbiology. 150:657-664. 487 6. Bergmaier, D., C. Lacroix, M. G. Macedo, and C.P. Champagne. 2001. New method 488 for exopolysaccharide determination in culture broth using stirred ultrafiltration cells. 489 Appl. Microbiol. Biotechnol. 57:401-406. 490 7. Bittner, M., R. Butow, J. DeRisi, M. Diehn, J. Eberwine, C. B. Epstein, R. Glynne, 491 S. Grimmond, T. Ideker, J. E. Kacharmina, S. Katsabanis, J. Khan, J. Lee, C. L. 492 Liu, P. Marciano, F. M. Marincola, T. McIntosh, D. Monte, J. R. Pollack, V. 493 Rhodius, S. Somerville, E. Tom, E. Wang, J. S. Wei, D. Willhite, and S. Ybarra. 494 2003. Expression analysis of RNA, p. 101–288. In D. Bowtell and J. Sambrook (ed.), 495 DNA microarrays: a molecular cloning manual. Cold Spring Harbor Laboratory Press,496 Cold Spring Harbor, NY. 497 8. Blumenkrantz, N., and G. Asboe-Hansen. 1973. New method for quantitative 498 determination of uronic acids. Anal. Biochem. 54:484-489. 499 9. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram 500 quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 501 72:248-254. 502 10. Breedveld, M. W., L. P. T. M. Zevenhuizen, and A. J. B. Zehnder. 1991.Osmotically- 503 regulated trehalose accumulation and cyclic -(1,2)-glucan excretion by Rhizobium 504 leguminosarum biovar trifolii TA-1. Arch. Microbiol. 156:501-506. 505 11. Broughton, W. J., S. Jabbouri, and X. Perret. 2000. Keys to symbiotic harmony. 506 J. Bacteriol. 182:5641-5652. 507 12. Bylund, J., L. A. Burgess, P. Cescutti, R. K. Ernst, and D. P. Speert. 2006. 508 Exopolysaccharides from Burkholderia cenocepacia inhibit neutrophil chemotaxis and 509 scavenge reactive oxygen species. J. Biol. Chem. 281:2526-2532. 510 13. Carr, R. J. G., R. F. Bilton, and T. Atkinson. 1986. Toxicity of paraquat to 511 microorganisms. Appl. Environ. Microbiol. 52:1112-1116. 512 14. Chang, W., D. A. Small, F. Toghrol, and W. E. Bentley. 2006. Global transcriptome 513 analysis of Staphylococcus aureus response to hydrogen peroxide. J. Bacteriol. 514 188:1648-1659. 515 15. Chang, W.-S., W. L. Franck, E. Cytryn, S. Jeong, T. Joshi, D.W. Emerich, M. 516 Sadowsky, D. Xu, and G. Stacey. 2007. An oligonucleotide microarray resource for 517 transcriptional profiling of Bradyrhizobium japonicum. Mol. Plant-Microbe Interact. 518 20:1298-1307. 519 16. Chang, W.-S., M. van de Mortel, L. Nielson, G. N. de Guzman, X. Li, and L. J. 520 Halverson. 2007. Alginate production by Pseuodomonas putida creates a hydrated 521 microenvironment and contributes to biofilm architecture and stress tolerance under 522 water-limiting conditions. J. Bacteriol. 189:8290-8299. 523 17. Chang, W.-S., X. Li, and L. J. Halverson. 2009 Reduced water availability 524 influences endogenous oxidative stress and cell death within unsaturated Pseudomonas 525 putida biofilms. Environ. Microbiol. 11: 1482-1492. 526 18. Costerton, J. W., K. J. Cheng, G. G. Geesy, T. I. Ladd, J. C. Nickel, M. Dasgupta, 527 and T. J. Marrie. 1987. Bacterial biofilms in nature and disease. Annu. Rev. Microbiol. 528 41:435-464. 529

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[23]

19. Costerton, J. W., P. S. Stewart, and E. P. Greenberg. 1999. Bacterial biofilms: a 530 common cause of persistent infections. Science. 284:1318-1322. 531 20. Cytryn, E. J., D. P. Sangurdekar, J. G. Streeter, W. L. Franck, W.-S. Chang, G. 532 Stacey, D. W. Emerich, T. Joshi, D. Xu, and M. J. Sadowsky. 2007. Transcriptional 533 and physiological responses of Bradyrhizobium japonicum to desiccation-induced stress. 534 J. Bacteriol. 189:6751-6762. 535 21. Dubois, M., K. A. Giles, J. K. Hamilton, P. A. Rebers, and F. Smith. 1956. 536 Colorimetric method for determination of sugars and related substances. Anal. Chem. 537 28:350-356. 538 22. Fellay, R., J. Frey, and H. Krisch. 1987. Interposon mutagenesis of soil and 539 water bacteria: a family of DNA fragments designed for in vitro insertional mutagenesis 540 of gram-negative bacteria. Gene 52:147-154. 541 23. Fischer, H. M., L. Velasco, M. J. Delgado, E. J. Bedmar, S. Scharen, D. Zingg, M. 542 Gottfert, and H. Hennecke. 2001. One of two hemN genes in Bradyrhizobium 543 japonicum is functional during anaerobic growth and in symbiosis. J. Bacteriol. 544 183:1300-1311. 545 24. Franck, W. L., W.-S. Chang, J. Qiu, M. Sugawara, M. J. Sadowsky, S. A. Smith, 546 and G. Stacey. 2008. Whole-genome transcriptional profiling of Bradyrhizobium 547 japonicum during chemoautotrophic growth. J. Bacteriol. 190:6697-6705. 548 25. Gregory, E. M., F. J. Yost, Jr., and I. Fridovich. 1973. Superoxide dismutases of 549 Escherichia coli: intacellular localization and functions. J. Bacteriol. 115:987-991. 550 26. Hassan, H. M., and I. Fridovich. 1977. Enzymatic defenses against the toxicity of 551 oxygen and of streptonigrin in Escherichia coli. J. Bacteriol. 129:1574-1583. 552 27. Hassan, H. M., and I. Fridovich. 1979. Paraquat and Escherichia coli: mechanism and 553 production of extracellular superoxide radical. J. Biol. Chem. 254:10846-10852. 554 28. Hassan, H. M., and I. Fridovich. 1977. Regulation of the synthesis of superoxide 555 dismutase in Escherichia coli. J. Biol. Chem. 252:7667-7672. 556 29. Hassan, H. M., and I. Fridovich. 1978. Superoxide radical and oxygen enhancement of 557 the toxicity of paraquat to Escherichia coli. J. Biol. Chem. 253:8143-8148. 558 30. Kachlany, S.C., S. B. Levery, J. S. Kim, B. L. Reuhs, L. W. Lion, and W. C. 559 Ghiorse.2001. Structure and carbohydrate analysis of the exopolysaccharide capsule of 560 Pseudomonas putida G7. Environ. Microbiol. 3:774-784. 561 31. Keppler, L. D., C. J. Baker, and M. M. Atkinson. 1989. Active oxygen production 562 during a bacteria-induced hypersensitive reaction in tobacco suspension cells. 563 Phytopathology. 79:974-978. 564 32. Kerr, M. K., M. Martin, and G. A. Churchill. 2000. Analysis of variance for gene 565 expression microarray data. J. Comput. Biol. 7:819-837. 566 33. Kiraly, Z., H. M. El-Zahaby, and Z. Klement. 1997. Role of extracellular 567 polysaccharide (EPS) slime of plant pathogenic bacteria in protecting cells to reactive 568 oxygen species. J. Phytopathol. 145:59-68. 569 34. Kuzma M. M., S. Hunt, and D. B. Layzell. 1993. Role of oxygen in the limitation and 570 inhibition of nitrogenase activity and respiration rate in individual soybean nodules. Plant 571 Physiol. 101:161-169. 572 35. Levine, A., R. Tenhaken, R. Dixon, and C. Lamb. 1994. H2O2 from the oxidative burst 573 orchestrates the plant hypersensitive disease resistance response. Cell. 79:583-593. 574

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[24]

36. Mehdy, M. C. 1994. Active oxygen species in plant defense against pathogens. Plant 575 Physiol. 105:467-472. 576 37. Mesa, S., Z. Ucurum, H. Hennecke, and H. M. Fischer. 2005. Transcription activation 577 in vitro by the Bradyrhizobium japonicum regulatory protein FixK2. J. Bacteriol. 578 187:3329-3338. 579 38. Nellen-Anthamatten, D., P. Rossi, O. Preisig, I. Kullik, M. Babst, H. M. Fischer, and 580 H. Henneke. 1998. Bradyrhizobium japonicum FixK2, a crucial distributor in the FixLJ-581 dependent regulatory cascade for control of genes inducible by low oxygen levels. J. 582 Bacteriol. 180:5251-5255. 583 39. Panek, H. R., and M. R. O’Brian. 2004. KatG is the primary detoxifier of hydrogen 584 peroxide produced by aerobic metabolism in Bradyrhizobium japonicum. J. Bacteriol. 585 186:7874-7880. 586 40. Parniske, M., and J. A. Downie. 2003. Locks, keys, and symbioses. Nature. 425:569-587 570. 588 41. Pessi, G., C. H. Ahrens, H. Rehrauer, A. Lindemann, F. Hauser, H. M. Fischer, and 589 H. Henneke. 2007. Genome-wide transcript analysis of Bradyrhizobium japonicum 590 bacteroids in soybean root nodules. Mol. Plant-Microbe Interact. 20:1353-1363. 591 42. Pfaffl, M. W. 2001. A new mathematical model for relative quantification in real-time 592 RT-PCR. Nucleic Acids Res. 29:2002-2007. 593 43. Pomposiello, P. J., M. H. J. Bennik, and B. Demple. 2001. Genome-wide 594 transcriptional profiling of the Escherichia coli responses to superoxide stress and 595 sodium salicylate. J. Bacteriol. 183:3890-3902. 596 44. Preisig, O., D. Anthamatten, and H. Hennecke. 1993. Genes for a microaerobically 597 induced oxidase complex in Bradyrhizobium japonicum are essential for a nitrogen-fixing 598 endosymbiosis. Proc. Natl. Acad. Sci. USA. 90:3309-3313. 599 45. Preisig, O., R. Zufferey, L. Thony-Meyer, C. A. Appleby, and H. Hennecke. 1996. A 600 high-affinity cbb3-type cytochrome oxidase terminates the symbiosis-specific respiratory 601 chain of Bradyrhizobium japonicum. J. Bacteriol. 178:1532-1538. 602 46. Read, R. R., and J. W. Costerton. 1987. Purification and characterization of adhesive 603 exopolysaccharides from Pseudomonas putida and Pseudomonas fluorescens. Can. J. 604 Microbiol. 33:1080-1090. 605 47. Robinson, K. M., M. S. James, M. Pehar, J. S. Monette, M. F. Ross, T. M. Hagen, 606 M. P. Murphy, and J. S. Beckman. 2006. Selective fluorescent imaging of superoxide 607 in vivo using ethidium-based probes. Proc. Natl. Acad. Sci. USA. 103:15038-15043. 608 48. Sadowski, M. J., R. E. Tully, P. B. Cregan, and H. H. Keyser. 1987. Genetic diversity 609 in Bradyrhizobium japonicum serogroup 123 and its relation to genotype-specific 610 nodulation of soybean. Appl. Environ. Microbiol. 53:2624-2630. 611 49. Salunkhe, P., F. von Gotz, L. Wiehlmann, J. Lauber, J. Buer, and B. Tummler. 612 2002. Genechip expression analysis of the response of Pseudomonas aeruginosa to 613 paraquat-induced superoxide stress. Genome Lett. 4:165-174. 614 50. Salunkhe, P., T. Topfer, J. Buer, and B. Tummler. 2005. Genome-wide transcriptional 615 profiling of the steady-state response of Pseudomonas aeruginosa to hydrogen peroxide. 616 J. Bacteriol. 187:2565-2572. 617 51. Santos R., D. Herouart, S. Siguad, D. Touati, and A. Puppo. 2001. Oxidative burst in 618 alfalfa-Sinorhizobium meliloti symbiotic interaction. Mol. Plant-Microbe Interact. 14:86-619 89. 620

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[25]

52. Sutherland, I. 2001. Biofilm exopolysaccharides: a strong and sticky framework. 621 Microbiology. 147:3-9. 622 53. Sutherland, M. W. 1991. The generation of oxygen radicals during host plant responses 623 to infection. Physiol. Mol. Plant Pathol. 39:79-94. 624 54. Tamarit, J., E. Cabiscol, and J. Ros. 1998. Identification of the major oxidatively 625 damaged proteins in Escherichia coli cells exposed to oxidative stress. J. Biol. Chem. 626 273:3027-3032. 627 55. Tamaru, Y., Y. Takani, T. Yoshida, and T. Sakamoto. 2005. Crucial role of 628 extracellular polysaccharides in desiccation and freezing tolerance in the terrestrial 629 cyanobacterium Nostoc commune. Appl. Environ. Microbiol. 71:7327-7333. 630 56. Tao, H., C. Bausch., C. Richmond, F. R. Blattner, and T. Conway. 1999. Functional 631 Genomics: expression analysis of Escherichia coli growing on minimal and rich media. 632 J. Bacteriol. 181:6425-6440. 633 57. Tusher, V. G., R. Tibshirani, and G. Chu. 2001. Significance analysis of microarrays 634 applied to the ionizing radiation response. Proc. Natl. Acad. Sci. USA. 98:5116-5121. 635 58. Wang, S., K. Deng, S. Zaremba, X. Deng, C. Lin, Q. Wang, M. L., Tortorello, and 636 W. Zhang. 2009. Transcriptomic response of Escherichia coli O157:H7 to oxidative 637 stress. Appl. Environ. Microbiol. 75:6110-6123. 638 59. Windgassen, M., A. Urban, and K. E. Jaeger. 2000. Rapid gene inactivation in 639 Pseudomonas aeruginosa. FEMS Microbiol. Lett. 193:201-205. 640 60. Zhao, H., J. Joseph, H. M. Fales, E A. Sokoloski, R. L. Levine, J. Vasquez-Vivar, 641 and B. Kalyanaraman. 2005. Detection and characterization of the product of 642 hydroethidine and intracellular superoxide by HPLC and limitations of fluorescence. 643 Proc. Natl. Acad. Sci. USA. 102:5727-5732. 644 61. Zhao, H., S. Kalivendi, H. Zhang, J. Joseph, K. Nithipatikom, J. Vasquez-Vivar, and 645 B. Kalyanaraman. 2003. Superoxide reacts with hydroethidine but forms a fluorescent 646 product that is distinctly different from ethidium: potential implications in intracellular 647 fluorescence detection of superoxide. Free Radic. Biol. Med. 34:1359-1368. 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[26]

Table 1. Gene-specific primers used for qRT-PCR. 667 Primer Sequence Gene Description

bll6866F GGTATCGATCGCTCCAAGATCCA flagellin bll6866R TCAGCCAGTTGATGCCGTTGAT

blr6333F ATCAATCATCCCGAGGTCGCCA pyruvate dehydrogenase complex E2 blr6333R AGCTGCAGGAGAGGTTCATCAT

blr1602F AGCTTCGCTTGTTTCCTGTCGT ABC transporter permease protein blr1602R TGAATCCGCTCAAGACCGCTT

bll5412F AAAGAAGCGGTCGAACAGCTCA 50S ribosomal Protein L10 blr5412R GACGGTGAGGCCGGAATATTGA

bll6879F AGTCTGCATCTGCATCGGAAGAG probable flagellar motor switch protein bll6879R TCGCATCGACATTGGCGAACTT

bsr4258F TGAAGTGGACGCGGTAAACCT hypothetical protein bsr4258 bsr4258R GGCCGAACTTGAACGTGGATGAA

bll0256F GACATTGCCGATGCGAAATGGA transcriptional regulatory protein bll0256R GCGACATGGTCCTTGGCATTT

blr2581F TCGAATCGCCGGCATTGGGAT putative D-fructose-1,6-bisphosphatase protein blr2581R ACCCAGCGCATGTTGAAATCGT

bll1028F AGGCGACTTCGGACGATATGCTT RNA polymerase sigma factor (carQ) bll1028R TTGTGCCGGCAATAGAGGATGT

blr2764F ATCGTCGGCATCCTCTTGGTGAT cytochrome-c oxidase (fixO) blr2764R TCTCGATCGTGCTCTTGAGGTAGA

blr4635F TCGAGGGAATGAAATTCGAC chaperonin GroEL (groEL5) blr4635R CGCAATTGATTGACGATGAG

blr3815F GATGTTGCCGGAAGAATTTG putative cation-transporting ATPase blr3815R TCTGGTTCTGCGTCAGTGTC

bll4012F TGCCAAGCTTCTCTTTACCG organic hydroperoxide resistance protein bll4012R TCGGATTGTTGAGGTCGAT

bsl2574F AACGCGTTTGGAAAGTGAAC hypothetical protein bsl2574 bsl2574R CTACTTCCGCAGCAATTCG

blr4701F TGGAACAACGTGCTCTGGTA putative outer-membrane immunogenic protein blr4701R CCGAGGAAGGTGAAAGTGTC precursor bll5813F TCTCAGAGAACATCGCGAAC flagellar basal-body rod protein (flgC) bll5813R CGGATTGTTCGGTTCGTATT

blr2221F CTGCTGATCTTCGACGAGGT adenosylmethionine-8-amino-7-oxononanoate blr2221R ACAGCTCCATCTGGTTCTCG aminotransferase (bioA) blr5517F TGGAAATGTACAGCCACTACGTGC two-component response regulator blr5517R TGATGATCGGCGCGTAAGGATT

bll0631F TCAACCTTCTGACGGTGAACGC chromosome partitioning protein A (parA) bll0631R TGCAGCAATTGCGACAGACCTT for normalization

668 669

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[27]

Table 2. A subset of B. japonicum genes and their clusters significantly induced during prolonged 670 exposure (PE) to paraquat a. 671 Locus (gene ID) Gene descriptionb Fold induction Chemotaxis

bll1439 (ctpD) pilus assembly protein 2.3 bll1440 (ctpC) pilus assembly protein 2.1 bll6851 (flhA) flagellar biosynthesis protein 2.1 bll6853 (flgD) hook formation protein 7.4 bll6854 (flbT) flagellin synthesis repressor protein 3.2 bll6855 (fliC) probable flagellar protein 2.9 bll6856 (flgL) probable flagellar hook-associated protein 5.9 bll6857 (flgK) hook associated protein I homolog 7.5 bll6858 (flgE) flagellar hook protein 7.8 bll6861 (motC) probable chemotaxis protein precursor 2.7 bll6862 (motB) probable flagellar motor protein 5.3 bll6865 (fla) flagellin 18.8 bll6866 (fla) flagellin 19.5 bll6869 (flgH) flagellar L-ring protein precursor 2.9 bll6871 (flgI) flagellar P-ring protein precursor 4.1 bll6873 (flgG) flagellar basal-body rod protein 4.5 bll6874 (fliE) flagellar hook-basal body complex protein 3.7 bll6875 (flgC) flagellar basal-body rod protein 4.6 bll6876 (flgB) flagellar basal-body rod protein 6.0 bll6877 (flhB) flagellar biosynthetic protein 2.9 bll6878 (fliG) probable flagellar motor switch protein 2.9 bll6879 (fliN) probable flagellar motor switch protein 2.6

Chaperones bll2059 (groEL3) GroEL3 chaperonin 2.0

bll5834 (dksA) dnaK deletion suppressor protein 2.2 blr5625 (groES) 10 KD chaperonin 8.4 blr5626 (groEL) 60 KDA chaperonin 8.3 blr6978 (groES2) chaperonin 3.7 blr7533 (groEL) 60 KDA chaperonin 3.9 bsr7532 (groES) 10 KD chaperonin (protein CPN10) 5.1

Respiration bll0439 (atpC) ATP synthase epsilon chain 2.0

bll0441 (atpG) ATP synthase gamma chain 2.0 bll0442 (atpA) ATP synthase alpha chain 2.3 bll0443 (atpH) ATP synthase delta chain 2.1 bll1185 (atpB) FoF1 ATP synthase B chain 3.7 bll1186 (atpB) FoF1 ATP synthase B' chain 2.8

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[28]

bsl1187 (atpC) FoF1 ATP synthase C chain 2.3 bll1188 (atpA) FoF1 ATP synthase A chain 2.7 blr6333 (bkdB) dehydrogenase complex E2 7.0 blr6334 (lpdA) dihydrolipoamide dehydrogenase 6.0

Transcription and Translation bll4076 50S ribosomal protein L9 2.0

bll4079 30S ribosomal protein S6 2.1 bll5399 50S ribosomal protein L4 2.0 bll5401 30S ribosomal protein S10 2.2 bll5402 elongation factor TU 2.3 bll5403 translation elongation factor G 2.2 bll5404 30S ribosomal protein S7 2.4 bll5405 30S ribosomal protein S12 2.1 bll5411 50S ribosomal protein L7/L12 2.3 bll5412 50S ribosomal Protein L10 3.2 bll5414 50S ribosomal protein L1 2.1 bll7440 peptidyl-tRNA hydrolase 2.0 bll7441 50S ribosomal protein L25 2.4

Transport bll6453 ABC transporter ATP-binding protein 2.2

bll6455 ABC transporter substrate-binding protein 3.0 bll6832 probable ABC transporter permease protein 2.4 bll6833 probable ABC transporter permease protein 3.6 bll6834 probable ABC transporter substrate-binding protein 5.6 blr1601 ABC transporter substrate-binding protein 4.4 blr1602 ABC transporter permease protein 5.3 blr1604 ABC transporter ATP-binding protein 2.4 blr3917 ABC transporter ATP-binding protein 2.1 blr3920 ABC transporter permease protein 2.6

a Differentially expressed genes from each functional category were selected based on a 2-fold 672 cut-off with q value ≤ 0.05. 673 b Gene description (annotations) represents the third level from the three-tiered functional level 674 system of B. japonicum (www.kazusa.or.jp/rhizobase/Bradyrhizobium/cgi-675 bin/category_brady.cgi). 676 677 678 679 680 681 682

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[29]

Table 3. A subset of B. japonicum genes and their clusters significantly induced during paraquat 683 fulminant shock (FS) treatmenta. 684

Locus (Gene ID) Descriptionb Fold induction Chaperones bll0729 small heat shock protein 2.0 blr4635 (groEL) chaperonin GroEL 6.4 blr4637 probable HspC2 heat shock protein 3.4 blr4653 molecular chaperone DnaJ family 7.5 blr7740 small heat shock protein 2.1 blr7961 probable HspC2 heat shock protein 2.5

Respiration bll3998 probable succinate-semialdehyde dehydrogenase 8.1 blr1309 acetyl-coenzyme A synthetase 2.7 blr2584 (cbbA) putative fructose-1,6-bisphosphate aldolase protein 2.0 blr4655 Phosphoenolpyruvate synthase 2.8 blr4657 beta-glucosidase 4.4 blr4658 probable Glucokinase (EC 2.7.1.2) 3.1 blr4955 putative cytochrome B561 2.0 blr6062 putative cytochrome C6 precursor 2.0 blr6128 cytochrome c552 5.6 blr6333 (bkdB) dehydrogenase complex E2 2.2 blr6636 ATP synthase subunit 2.2 blr7040 (napC) cytochrome C-type protein 5.1

Nitrogen fixation and metabolism bll2757 (fixK2) transcriptional regulatory protein 3.4 blr2763 (fixN) cytochrome-c oxidase 6.7 blr2764 (fixO) cytochrome-c oxidase 8.0 blr2766 (fixP) cbb3 oxidase subunit III 4.5 blr2767 (fixG) iron-sulfur cluster-binding protein 5.9 blr2768 (fixH) FixH protein 3.0 blr3125 (cycH) cytochrome C-type biogenesis protein 2.0 blr3126 (cycJ) cytochrome C-type biogenesis protein 2.0 blr3127 (cycK) cytochrome C-type biogenesis protein 2.2 blr3128 (cycL) cytochrome C-type biogenesis protein 2.3 blr5778 (fixG) nitrogen fixation protein 2.0 blr7089 respiratory nitrite reductase 3.2

Lipid metabolism bll1200 (hemA) 5-aminolevulinic acid synthase 5.0 blr1288 probable long-chain-fatty-acid-CoA ligase 2.6

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[30]

blr2989 putative acyl-CoA dehydrogenase 2.0

Transcription and Translation bll1028 (carQ) RNA polymerase sigma factor 16.4 bll1447 (rhlE) dead-box ATP-dependent RNA helicase 2.2 blr1883 (rpoN1) RNA polymerase sigma-54 subunit 2.0 blr3042 putative RNA polymerase sigma factor 3.9 blr7337 (rpoH2) sigma32-like transcription factor 2.3 blr1404 (clpB) ATP-dependent protease ATP-binding subunit 2.5

Transport bll6063 ABC transporter substrate-binding protein 3.3 bll6064 ABC transporter ATP-binding protein 3.3 bll7988 probable ATP-binding protein 4.4 blr0316 (nosD) periplasmic copper-binding precursor 3.0 blr1093 (pstA) phosphate ABC transporter permease protein 2.0 blr1094 (pstB) phosphate ABC transporter ATP-binding protein 2.3 blr1233 putative sulfonate binding protein 3.6 blr3815 putative cation-transporting ATPase 4.9 blr4112 Probale cation efflux system protein 4.5 blr4932 putative cation efflux system protein 2.0 blr6523 putative iron transport protein 3.0 blr7037 (napD) periplasmic nitrate reductase 9.2 blr7038 (napA) periplasmic nitrate reductase large subunit precursor 5.9

blr7039 (napB) periplasmic nitrate reductase small subunit precursor 4.4

blr7090 probable periplasmic nitrate reductase 4.0 blr7873 ABC transporter ATP-binding protein 3.2 blr7874 ABC transporter permease protein 2.0 bsr4636 putative cation transport regulator 5.6 bsr7036 (napE) periplasmic nitrate reductase protein 3.3

Amino acid biosynthesis blr0314 (nosR) nitrous oxide reductase expression regulator 3.1 blr0315 (nosZ) nitrous oxide reductase 4.1 blr3212 (norE) nitric oxide reductase subunit E 2.3 blr3214 (norC) nitric oxide reductase subunit C 3.2 blr3215 (norB) nitric oxide reductase subunit B 2.7 blr3216 (norA) NorQ protein 2.7 blr5774 probable sulfide-quinone reductase 3.1

685

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[31]

a Differentially expressed genes from each functional category were selected based on a 2-fold 686 cut-off with q value ≤ 0.05. 687 b Gene description (annotations) represents the third level from the three-tiered functional level 688 system of B. japonicum (www.kazusa.or.jp/rhizobase/Bradyrhizobium/cgi-689 bin/category_brady.cgi). 690 691 692

693

694

695

696

697

698

699

700

701

702

703

704

705

706

707

708

709

710

711

712

713

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[32]

Table 4. Oxidative stress-responsive genes differentially expressed during paraquat-mediated oxidative 714 stressa. 715

Locus (Gene ID) Descriptionb Fold inductionc

Prolonged Exposure (PE) blr0528 probable oxidoreductase 1.5 blr0594 thioredoxin 1.5 bll0668 glutathione synthetase 1.7 bll0735 organic hydroperoxide resistance protein 1.8 bll0773 hypothetical glutathione S-transferase like protein 1.7 bll1162 glutathione S-transferase 1.6 bll2508 hypothetical glutathione S-transferase like protein 1.9 blr2609 oxidoreductase -2.8 bll2737 oxidoreductase with iron-sulfur subunit -2.0 bll2856 probable cytochrome P450 1.6 blr2939 glutathione S-transferase 1.7 bll3914 oxidoreductase 2.8 bll4059 NAD/NADP dependent oxidoreductase 1.7 bll5338 probable oxidoreductase 1.9 blr5618 putative oxidoreductase protein 1.7 blr6218 putative oxidoreductase protein -1.7 bll7007 putative oxidoreductase 1.9 bll7404 hypothetical glutathione S-transferase like protein 1.6 blr7566 oxidoreductase 1.7 bll7606 oxidoreductase 1.5

Fulmimant Shock (FS) bll0088 oxidoreductase -2.0 bll0735 organic hydroperoxide resistance protein 1.5 bll1244 flavin dependant oxidoreductase 1.8 bll4012 organic hydroperoxide resistance protein 1.8 bll5081 putative multidrug resistance protein 3.6 bll7086 (hemN) anaerobic coproporphyrinogen III oxidase 8.2

a Differentially expressed genes were selected based on a 1.5-fold cut-off with q value ≤ 0.05. 716 b Gene description (annotations) represents the third level from the three-tiered functional level 717 system of B. japonicum (www.kazusa.or.jp/rhizobase/Bradyrhizobium/cgi-718 bin/category_brady.cgi). 719 c Positive and negative values indicate up and down regulation in response to paraquat compared 720 to the control without paraquat. 721

722

723

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[33]

Figure legends 724

725

Figure 1. The effect of paraquat on the growth of B. japonicum USDA 110 in AG media. The 726

raw absorbance data have been log10 transformed and plotted as a function of time in hours. 727

Control cultures were treated with sterilized ddH2O. Symbols are as follows: control (); 10 μM 728

(); 50 μM (); 100 μM (∆); and 1 mM (). Each point is the mean of three replicates and the 729

error bars represent the standard error of the mean. 730

731

Figure 2. The effect of fulminant shock (FS) treatment with paraquat on the survival of B. 732

japonicum USDA 110. Control cultures were treated with ddH2O. Symbols are as follows: 733

control (); 100 μM (); 250 μM (); 500 μM (∆); 750 μM (); 1 mM (); 5 mM (♦); 10 mM 734

(◊); and 20 mM (). Values are means ± standard error of the mean for three replications. 735

736

Figure 3. A comparison of the total number of differentially expressed genes between prolonged 737

exposure (PE) and fulminant shock (FS) conditions. Values shown represent more than 2-fold 738

(in bold) and 1.5-fold (in parentheses) differential expression with P < 0.05. 739

740

Figure 4. Measurement of ROS in B. japonicum cultures. Absorbance at 300 nm of 2-741

hydroxyethidium was calculated for each condition at time of cell harvest. The contribution of 742

paraquat and the media to the absorbance values were accounted for by including them as 743

controls and subtracting those values from the measured absorbance values, resulting in relative 744

absorbance. Black bars represent control without treatments and grey bars represent paraquat 745

treatment conditions (100 μM for prolonged exposure (PE), and 5 mM for fulminant shock (FS)). 746

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[34]

The differences between control and treatment for both treatments are statistically significant (P 747

< 0.05). Error bars represent the standard error of the mean for nine replicates. 748

749

Figure 5. Functional classification of differentially expressed genes with > 2.0 fold changes. (A) 750

Comparison of differential expression in the prolonged exposure (PE) condition. (B) Comparison 751

of differential expression in the fulminant shock (FS) condition. Black bars represent positive 752

fold-induction values and grey bars represent negative fold-induction values. Functional 753

classifications were derived from B. japonicum genome annotations available through Rhizobase 754

(http://bacteria.kazusa.or.jp/rhizobase/). 755

756

Figure 6. Comparison of log2 transformed qRT-PCR data and microarray data of 18 757

representative genes from both conditions. These genes were selected based on fold-induction 758

and functional categories. The corresponding gene names for the locus IDs are as follows: 759

bll1028 (carQ), blr2764 (fixO), blr4635 (groEL), bll5813 (flgC), blr2221 (bioA), bll6866 (fla), 760

blr6333 (bkdB), bll5412 (rplJ), bll6879 (fliN), and blr2581 (cbbF). blr1602, blr4258, bll0256, 761

blr3815, bll4012, bsl2574, blr4701, blr5517, and bll0631 lack assigned names. Open triangles, 762

prolonged exposure (PE); closed triangles, fulminant shock (FS). 763

764

Figure 7. The ratio of treatment (100 µM paraquat) to control of relative CFUs in capillaries 765

plotted against time. Error bars are the standard error of the mean for three replicates. If the ratio 766

> 1, chemotaxis is positive and the test substance is an attractant. If the ratio < 1, chemotaxis is 767

negative and the test substance is a repellant. A ratio close to 1 is indicative of no net effect on 768

chemotaxis. Symbols are as follows: , wild-type; ∇, ∆cheA mutant. 769

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[35]

770

Figure 8. Quantification of the total EPS (A) and acidic sugar content (B) isolated from the 771

supernatant of B. japonicum cultures treated with 0, 100, 250, and 500 µM of paraquat. All 772

values in the paraquat treatments are statistically significant from control (P < 0.05). Error bars 773

represent the standard error of the mean for three replicates. 774

775

776

777

778

779

780

781

782

783

784

785

786

787

788

789

790

791

792

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[36]

Figure 1: 793

Time (hours)

0 20 40 60 80

Abso

rban

ce (6

00nm

)

0.001

0.01

0.1

1

10

794

795

796

797

798

799

800

801

802

803

804

805

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[37]

Figure 2: 806

Time (min)

0 10 20 30

Surv

ival

(%)

0

20

40

60

80

100

120

807

808

809

810

811

812

813

814

815

816

817

818

819

820

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[38]

Figure 3: 821

822 823

Up Up 824 PE FS 825 826 827 828 178 5 287 829 (443) (35) (475) 830 831 832 7 7 833 (40) (13) 834 835 836 98 0 79 837 (271) (5) (107) 838 839 840 841 842 Down Down 843 FS PE 844 845

846

847

848

849

850

851

852

853

854

855

856

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[39]

Figure 4: 857

Rel

ativ

e Ab

sorb

ance

(300

nm

)

0.0

0.5

1.0

1.5

2.0

2.5

3.0

PE FS 858

859

860

861

862

863

864

865

866

867

868

869

870

871

872

873

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[40]

Figure 5: 874

Number of genes

0 10 20 30 40 50 60 70

Func

tiona

l cat

egor

ies

Amino acid biosynthesis

Biosynthesis of cofactors, prosthetic groups, and carriers

Cell envelope

Cellular processes

Central intermediary metabolism

DNA replication, recombination, and repair

Energy metabolism

Fatty acid, phospholipid and sterol metabolism

Purines, pyrimidines, nucleosides, and nucleotides

Regulatory functions

Transcription

Translation

Transport and binding proteins

Other categories

Hypothetical protein

0 50 150

A B

PE FS

200

875

876

877

878

879

880

881

882

883

884

885

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[41]

Fig. 6: 886

Microarray data (log2 fold change)

qRT-

PCR

dat

a (lo

g 2 fo

ld c

hang

e)

-4 -2 0 2 4

-4

-2

0

2

4

y = 0.93x - 0.30

R2 = 0.92bll5813blr4701

blr2221bsl2574

blr5517

bsr4258

bll0256blr2581

bll5412bll6879

bll4012blr1602

blr6333blr2764

bll1028bll6866

blr3815blr4635

887

888

889

890

891

892

893

894

895

896

897

898

899

900

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[42]

Figure 7: 901

Time (min)

Rel

ativ

e ra

tios

of C

FUs

in c

apill

ary

(Tre

atm

ent/C

ontro

l)

0.4

0.6

0.8

1.0

1.2

20 30 40

902

903

904

905

906

907

908

909

910

911

912

913

914

915

916

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

[43]

Figure 8: 917

µ g G

lc e

q's

/ mg

prot

ein

0

20

40

60

80

100

120

A

Paraquat (µM)

µ g G

lcU

A eq

's /

mg

prot

ein

0

2

4

6

8

10

0 100 250 500

B

918

on Septem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

the genome-wide transcriptional and physiological...

Documents