the function of barren inflorescence1 and sparse
TRANSCRIPT
The Pennsylvania State University
The Graduate School
The Huck Institutes of Life Sciences
THE FUNCTION OF BARREN INFLORESCENCE1 AND SPARSE
INFLORESCENCE1 IN MAIZE INFLORESCENCE DEVELOPMENT
A Dissertation in
Integrative Biosciences
by
Solmaz Barazesh
© 2008 Solmaz Barazesh
Submitted in Partial Fulfillment
of the Requirements
for the Degree of
Doctor of Philosophy
December 2008
The dissertation of Solmaz Barazesh was reviewed and approved* by the following:
Paula McSteen
Assistant Professor of Biology
Dissertation Advisor, Chair of Committee
David Braun
Assistant Professor of Biology
Hong Ma
Professor of Biology
Teh-Hui Kao
Professor of Biochemistry and Molecular Biology
Chair, Intercollege Graduate Degree Program in Plant Biology
Peter Hudson
Chair, The Huck Institutes of the Life Sciences
*Signatures are on file in the Graduate School
iii
ABSTRACT
The production of inflorescence structures allows flowering plants to reproduce, and is
therefore an essential stage of plant development. The branches, florets and floral organs
of the inflorescence are produced by a series of axillary meristems. In this thesis, maize
mutants with defects in inflorescence development are characterized to gain insight into
the pathways regulating the initiation of the axillary meristems controlling inflorescence
development.
Previous work revealed that the plant hormone auxin plays a central role in the
initiation of lateral organs and meristems. Mutants with defects in polar auxin transport,
such as pinformed1 (pin1) and pinoid (pid) of Arabidopsis, fail to initiate axillary
meristems during inflorescence development and as a consequence produce sterile, pin-
like inflorescences. Similarly, in maize, mutants in barren inflorescence2, the co-
ortholog of PID, are also defective in axillary meristem initiation, resulting in a barren
inflorescence with reduced branches, spikelets and florets.
In Chapter 2, we describe the classical maize mutant Barren inflorescence1
(Bif1). Similar to bif2, Bif1 mutants produced fewer branches, spikelets, florets and floral
organs than normal, the result of a failure in axillary meristem initiation. Double mutants
between Bif1 and bif2 displayed a synergistic phenotype, indicating that Bif1 overlaps in
function with bif2, possibly encoding a regulator of auxin transport in maize. Positional
cloning of Bif1 is presented in the Appendix.
In Chapters 3 and 4, the characterization of a novel maize mutant, sparse
inflorescence1 (spi1) is described. spi1 mutants have defects in the initiation of axillary
iv
meristems and lateral organs during vegetative and inflorescence development. spi1 has
been found to encode a flavin mono-oxygenase similar to the YUCCA (YUC) enzymes
of Arabidopsis, which function in local auxin biosynthesis. Analysis of the interaction
between spi1 and genes regulating auxin transport indicates auxin biosynthesis and auxin
transport function synergistically to regulate axillary meristem initiation. In Chapter 4,
the non-autonomous effects of the spi1 mutation are described.
v
TABLE OF CONTENTS
LIST OF FIGURES ..................................................................................................... ix
LIST OF TABLES.......................................................................................................xi
NOMENCLATURE ....................................................................................................xii
ACKNOWLEDGEMENTS.........................................................................................xiii
CHAPTER 1 Hormonal control of grass inflorescence development ........................1
1.1 Introduction.....................................................................................................2
1.2 The role of auxin in axillary meristem initiation ............................................4
1.3 Cytokinin and apical meristem size................................................................9
1.4 Meristem determinacy ....................................................................................12
1.5 Conclusions.....................................................................................................17
1.6 References.......................................................................................................23
CHAPTER 2 barren inflorescence1 functions in organogenesis during vegetative
and inflorescence development in maize..............................................................34
2.1 Introduction.....................................................................................................35
2.2 Materials and methods....................................................................................38
2.2.1 Analysis of the mature inflorescence phenotype of Bif1......................38
2.2.2 Double mutant analyses........................................................................39
2.2.3 Statistical analysis ................................................................................41
2.2.4 SEM, RNA in situ hybridization, histology....................................41
2.2.5 Expression analysis .........................................................................42
2.2.6 Auxin transport assays..........................................................................44
2.3 Results.............................................................................................................45
2.3.1 Bif1 mutants produce fewer branches and spikelets.............................45
2.3.2 Bif1 mutants fail to initiate SPMs.........................................................46
vi
2.3.3 Bif1 mutants have defects in SM initiation rather than SPM
determinacy ............................................................................................48
2.3.4 Spikelet and floral meristems are defective in Bif1 mutants ................49
2.3.5 Expression studies show that bif2 and ba1 are expressed at a lower
level in Bif1 mutants...............................................................................51
2.3.6 Double mutant analysis indicates that bif1 and bif2 play a role in
vegetative development..........................................................................52
2.3.7 Double mutant analysis indicates that Bif1 is epistatic to ba1 in the
tassel .......................................................................................................53
2.3.8 Bif1 mutants have a reduced level of auxin transport...........................54
2.4 Discussion.......................................................................................................55
2.4.1 bif1 plays a role in axillary meristem initiation....................................56
2.4.2 Role of bif1 in auxin transport..............................................................57
2.4.3 Genetic interaction between Bif1 and other barren inflorescence
mutations ................................................................................................58
2.5 References.......................................................................................................72
CHAPTER 3 sparse inflorescence1 encodes a monocot specific YUCCA-like gene
required for vegetative and reproductive development in maize..........................80
3.1 Introduction.....................................................................................................81
3.2 Results and Discussion ...................................................................................84
3.2.1 spi1 mutants have defects during vegetative and reproductive
development ...........................................................................................84
3.2.2 spi1 encodes a YUCCA-like flavin monooxygenase ............................85
3.2.3 spi1 expression is localized in proximity to newly emerging
primordia and axillary meristems...........................................................86
3.2.4 Phylogenetic analysis shows that spi1 is a member of a monocot
specific clade of YUC-like genes ...........................................................87
3.2.5 Interactions between spi1 and genes regulating auxin transport ..........90
3.3 Conclusions.....................................................................................................92
vii
3.4 Materials and Methods ...................................................................................93
3.4.1 spi1 alleles ............................................................................................93
3.4.2 SEM and histology ...............................................................................94
3.4.3 spi1 cloning ..........................................................................................94
3.4.4 Expression analysis ..............................................................................94
3.4.5 spi1 phylogeny......................................................................................95
3.4.6 spi1 double mutant analysis..................................................................96
3.4.7 Confocal microscopy............................................................................97
3.5 References.......................................................................................................110
CHAPTER 4 Non-autonomous effects of the spi1 mutation.......................................116
4.1 Introduction.....................................................................................................116
4.2 Materials and Methods ...................................................................................120
4.2.1 Origin of spi1-ref allele ........................................................................120
4.2.2 Double mutant analyses........................................................................120
4.2.3 Histology ..............................................................................................121
4.2.4 Cell size measurements ........................................................................122
4.2.5 RT-PCR ................................................................................................122
4.3 Results.............................................................................................................123
4.3.1 Abnormal initiation of SPMs at the tassel apex is not the cause of
reduced tassel length in spi1 mutants .....................................................123
4.3.2 spi1 does not have defects in apical meristem maintenance ................124
4.3.3 spi1 functions in cell elongation in the developing tassel ....................126
4.3.4 Bif1 and ba1 mutants have defects in cell elongation in the
developing tassel ....................................................................................127
4.3.5 spi1 interaction with Bif1......................................................................127
4.3.6 spi1 interaction with ba1 ......................................................................128
4.3.7 The molecular interaction of auxin biosynthesis and transport............130
4.4 Discussion.......................................................................................................131
4.4.1 spi1 has a short inflorescence linked to a defect in cell elongation......131
viii
4.4.2 spi1 functions in cell expansion ...........................................................133
4.4.3 spi1 functions in a non cell autonomous manner ................................134
4.4.4 Synergism between auxin biosynthesis and transport ..........................135
4.4.5 A model for the interaction between spi1 and auxin transport.............136
4.5 References.......................................................................................................148
CHAPTER 5 Summary and Conclusions ...................................................................156
5.1 Summary.........................................................................................................156
5.2 Conclusions.....................................................................................................156
5.2.1 Identification of a potential regulator of auxin transport......................156
5.2.2 Map-based cloning of bif1....................................................................157
5.2.3 The interaction between localized auxin biosynthesis and auxin
transport..................................................................................................158
5.2.4 Future experimentation.........................................................................159
5.3 Future Perspectives........................................................................................160
5.3.1 The role of other hormones in inflorescence development ..................160
5.4 References.......................................................................................................161
APPENDIX Positional cloning of barren inflorescence1 ..........................................162
A.1 Introduction....................................................................................................162
A.2 Results............................................................................................................162
A.2.1 Construction of mapping population ...................................................162
A.2.3 Fine Mapping of recombinants............................................................163
A.3 Discussion and future work ...........................................................................164
ix
LIST OF FIGURES
Figure 1.1: Inflorescence structure of Maize, Arabidopsis and rice ............................18
Figure 1.2: Proposed model of the role of cytokinin and auxin during maize
inflorescence development. ..................................................................................19
Figure 2.1: Mature inflorescence phenotype of the Bif1 mutant. ................................61
Figure 2.2: Scanning Electron Microscopy (SEM) images of developing Bif1
inflorescences. ......................................................................................................62
Figure 2.4: Analysis of Bif1; ra1 double mutants. ......................................................64
Figure 2.5: Quantification of floret and floral organ numbers in Bif1 mutants. ..........65
Figure 2.6: Real time RT-PCR analysis of the expression of bif2 and ba1 in Bif1
mutants..................................................................................................................66
Figure 2.7: Analysis of Bif1; bif2 double mutants.......................................................67
Figure 2.8: Analysis of Bif1; ba1 double mutants. ....................................................68
Figure 2.9: Measurement of auxin transport in normal and Bif1 inflorescences. .......69
Figure 3.1: Characterization of the spi1 inflorescence. ..............................................98
Figure 3.2: Cloning of spi1. ........................................................................................99
Figure 3.6: Analysis of spi1;tb1 double mutants. .......................................................103
Figure 3.7: Partial amino acid alignment of SPI1 and other previously
characterized YUCCA-like proteins.....................................................................104
Figure 4.1: spi1;bif2 double mutant analysis...............................................................138
Figure 4.2: Histology of developing spi1 tassels and ears...........................................139
Figure 4.3: Analysis of spi1; kn1 double mutants. ......................................................140
Figure 4.5: Analysis of cell size in immature and mature spi1 mutants. .....................142
x
Figure 4.6: spi1; Bif1 double mutant inflorescence analysis. .....................................143
Figure 4.7: spi1; Bif1 double mutant vegetative analysis. ...........................................144
Figure 4.8: spi1; ba1 double mutant analysis .............................................................145
Figure 4.9: Real time RT-PCR analysis of bif2 expression in spi1 mutants. ..............146
Figure A.1: The bif1 region ........................................................................................165
Figure A.2: Map location of bif1 .................................................................................166
xi
LIST OF TABLES
Table 2.1: Chi-square analysis of double mutant segregation .....................................71
Table 3.3: List of markers developed for map based cloning of spi1.........................107
Table 3.4: Chi-square analysis of double mutant segregation. ...................................108
Table 3.5: Table of primers..........................................................................................109
Table 4.1: Chi-square analysis of double mutant segregation. ....................................147
xii
NOMENCLATURE
Maize Example
Gene: Lower case italic bif2
Mutant: Lower case italic
First letter will be capitalized if Bif1
mutation is dominant or semi dominant
Protein: Upper case BIF2
Arabidopsis Example
Gene: Upper case italic PID
Mutant: Lower case italic pid
Protein: Upper case PID
ACKNOWLEDGEMENTS
I would like to express my gratitude to my thesis advisor, Paula McSteen, for giving me
the opportunity to work on this project, and for her guidance and enthusiasm. I would
also like to thank my committee members Hong Ma, David Braun and Teh-Hui Kao, for
sharing their considerable knowledge and expertise. I am especially grateful to Teh-Hui
Kao, who as chair of the Plant Biology program has provided support throughout my
graduate studies.
My lab mates, Xianting Wu, Andrea Skirpan and Kim Phillips, provided
instruction in lab techniques, assistance with field experiments and helped with the
prepartation of manuscripts. I wish to thank David Braun and the members of his lab,
Frank Baker, Tom Slewinski, Yi Ma and Mingshu Huang, for their invaluable
discussions during lab meetings.
I appreciate the work of Tony Omeis, who ensured our plants thrived in the
greenhouse; and that of Missy Hazen and Ruth Haldeman, who instructed me on the
microtome and the scanning electron microscope. I must also acknowledge Deb Grove,
who made the real time RT-PCR experiments possible.
I would like to give heartfelt thanks to my parents, Bahram and Caroline, and my
brother Ellyar, whose constant love and encouragement made it possible for me to
complete this work. Finally, I would like to thank Tom for his support and
companionship over the past several years. I dedicate this thesis to my family.
CHAPTER 1
Hormonal control of grass inflorescence development
This chapter was revised to produce a review article published in Trends in Plant Science
in December 2008.
Barazesh, S. and McSteen, P. (2008) Trends in Plant Science,
doi:10.1016/j.tplants.2008.09.007.
2
1.1 Introduction
During vegetative growth, the shoot apical meristem (SAM) produces the aerial
structures of the plant in units called phytomers, each of which consists of a leaf, a node,
an internode, and an axillary meristem (Steeves and Sussex 1989). During reproductive
growth, the apical inflorescence meristem initiates bract leaves, which are usually
suppressed from further development. Axillary meristems, which form in the axils of the
bract leaves, produce flowering branches called inflorescences.
The maize inflorescence is an excellent model system for studying the regulation
of meristem function, because the complex architecture of the inflorescence is regulated
by several types of axillary meristem (Irish 1997; McSteen et al. 2000). Maize has
separate male and female inflorescences: the male inflorescence (the tassel) at the shoot
apex, and the female inflorescence (the ear), which grows in the axil of a leaf several
nodes below the tassel (McSteen et al. 2000). The tassel consists of a central rachis with
several long branches at the base (Figure 1.1a). Short branches bearing pairs of spikelets
cover both the rachis and branches, and each spikelet contains a pair of staminate florets.
The ear is unbranched, consisting of a central rachis bearing pairs of spikelets, which in
turn produce pistillate florets (Irish 1997).
Four different types of axillary meristem produce the maize inflorescence
(Table 1.1). Branch meristems (BMs) give rise to the long branches at the base of the
tassel, before the spikelet pair meristems (SPMs) elaborate the short spikelet pair
branches. Spikelet meristems (SMs) produce the spikelets, and lastly floral meristems
(FMs) produce florets and floral organs (Irish 1997). The early development of the ear
3
follows a similar pathway as the tassel, except BMs are not produced. Selective organ
abortion gives rise to unpaired, female florets in the ear and paired, male florets in the
tassel (Irish 1996).
Our understanding of maize inflorescence development can be aided by
comparison with the two other widely studied model species, Arabidopsis and rice. The
Arabidopsis inflorescence consists of a central inflorescence stem with several branches
(McSteen and Leyser 2005). Both the inflorescence stem and the branches bear flowers
singly (Figure 1.1b). Two types of axillary meristem are involved in making the
Arabidopsis inflorescence; the BMs, which produce the long branches, and the FMs
which produce the flowers (Table 1.1). The rice inflorescence consists of a determinate
central inflorescence stem bearing long branches that often have secondary branches
(Figure 1.1c), (Shimamoto and Kyouzuka 2002). Both branch types bear spikelets, and
each spikelet contains a single floret (Kyozuka 2007). The rice inflorescence is
elaborated by three types of axillary meristem: BMs produce both the primary and
secondary branches, spikelet meristems (SMs) give rise to spikelets, and lastly FMs
produce the florets and floral organs (Table 1.1), (Kellogg 2007).
For decades, maize geneticists have collected maize plants with developmental
defects, amassing a wide array of well-characterized mutants available to the community
of maize cooperators (Table 1.2). Due to recent advances in the sequencing of grass
genomes, chromosome walking has become feasible in maize, leading to rapid progress
in the identification of the corresponding genes (Vollbrecht and Sigmon 2005; Bortiri et
al. 2006; McSteen 2006; Bortiri and Hake 2007). These resources, as well as those
available for Arabidopsis and rice, has allowed the identification of hormones as
4
important regulators of inflorescence development. In particular, auxin has been found to
play a critical role in axillary meristem initiation, cytokinin in regulation of meristem
size, and multiple hormones are implicated in meristem determinacy and sex
determination.
1.2 The role of auxin in axillary meristem initiation
Auxin at the shoot apex is an important signal functioning in the initiation of lateral
organs and axillary meristems (Benjamins and Scheres 2008). Localized accumulations
of auxin denote the site of primordia initiation (Smith et al. 2006). Distribution of auxin
at the shoot apex is controlled by a combination of directed auxin transport (Polar Auxin
Transport, PAT) and localized auxin biosynthesis (Delker et al. 2008).
PAT is central to auxin function, and the components of the PAT pathway have
been researched extensively in Arabidopsis. Recent work has established that at least
some components are conserved in monocots. The auxin influx carriers, such as AUX1,
facilitate the movement of auxin into the cell, and members of the PINFORMED family
of efflux carriers allow movement of auxin out of the cell (Zazimalova et al. 2007). For
auxin transport to occur in a unidirectional manner, the PIN1 auxin efflux carrier must be
localized only at one end of the cell. The serine/threonine kinase PINOID (PID) has been
shown to regulate the localization of the PIN proteins (Friml et al. 2004; Michniewicz et
al. 2007). Disruption of polar auxin transport yields defects in floral meristem initiation
resulting in a pin-like inflorescence structure in both pin and pid mutants, and
5
demonstrates that PAT is required for floral meristem development in Arabidopsis
(Bennett et al. 1995; Benjamins et al. 2001).
It has been suggested that PIN1 localization may not be conserved in maize
(Carraro et al. 2006). Immunolocalization using an Arabidopsis anti-PIN1 antibody
showed that PIN1 proteins in maize localized to a subepidermal group of cells in the apex
of developing inflorescences, a pattern different from that of Arabidopsis, where PIN1
localized to epidermal cells. Contrary to this, in a recent paper, maize PIN1a tagged with
fluorescent protein showed localization to the epidermal cell layer of apical and axillary
meristems in maize, similar to Arabidopsis (Gallavotti et al. 2008). Furthermore, the
auxin-responsive promoter DR5 fused to a fluorescent reporter protein showed that auxin
maxima formed in the outer two cell layers of the inflorescence, supporting the epidermal
localization of PIN1 protein in maize (Gallavotti et al. 2008). The contradiction between
the two sets of results could be due to differences in the methods used.
The role of auxin transport in axillary meristem initiation in maize was further
investigated in a series of experiments that used the auxin transport inhibitor N-1-
napthylphthalamic acid (NPA) to block PAT in maize plants during inflorescence
development (Wu and McSteen 2007). NPA-treated plants failed to initiate axillary
meristems, producing a barren inflorescence that phenocopied the pin1 and pid mutants
of Arabidopsis. Therefore, although inflorescence development in maize is more
complex and requires several more types of axillary meristem than inflorescence
development in Arabidopsis, the role of PAT in axillary meristem initiation appears to be
conserved between the two species.
6
The identification and characterization of classical maize mutants with barren
inflorescence phenotypes has helped to further elucidate the mechanism of axillary
meristem initiation in maize. Recent work has shown that various members of the group
encode components of the auxin biosynthesis, transport and response pathway, further
evidence of the important role of auxin in this process (Table 1.2). One of the first
characterized members of this group was barren inflorescence2 (bif2). bif2 mutants have
defects in the production of all types of axillary meristems, resulting in a plant with
reduced numbers of branches, spikelets, florets and floral organs in the tassel, and
reduced kernel number in the ear (McSteen and Hake 2001). Detailed phenotypic and
histological analysis determined that these phenotypes result from a failure to initiate all
types of axillary meristem. bif2 encodes a serine/threonine kinase co-orthologous to the
Arabidopsis auxin transport regulator PID (McSteen et al. 2007).
The barren inflorescence1 (bif1) gene is another possible regulator of PAT
(Chapter 2). Barren inflorescence1 (Bif1) mutants are semi dominant, and are very
similar in phenotype to bif2. Double mutants between Bif1 and bif2 have severe defects
in both vegetative and inflorescence development; this synergistic phenotype suggests the
two genes function in distinct pathways with redundant function, possibly identifying
another component of the auxin transport pathway in maize. Support for this hypothesis
comes from recent evidence that PIN1 proteins are mis-localized in Bif1 mutants
(Gallavotti et al. 2008).
The barren stalk1 (ba1) gene is required for axillary meristem initiation, and
consequently ba1 mutants are defective in the initiation of all types of axillary meristems,
producing a plant with no ears, and a tassel with no branches or spikelets (Ritter et al.
7
2002). ba1 encodes a basic helix-loop-helix transcription factor with similarity to the
LAX PANICLE (lax) gene of rice, and has no orthologs in Arabidopsis (Kyozuka et al.
2002; Gallavotti et al. 2004). Recent papers have proposed two alternative models that
ba1 functions either upstream or downstream of auxin transport. In support of the first
model, the presence and normal phyllotaxy of bract leaf primordia in ba1 mutants
indicates that PAT is normal in the inflorescence (Ritter et al. 2002; Skirpan et al. 2008).
Furthermore, ZmPIN1a protein is localized normally in ba1 mutants (Gallavotti et al.
2008). ba1 is not expressed in NPA treated plants, suggesting that PAT is required for
ba1 expression (Wu and McSteen 2007). In addition, ba1;bif2 double mutants display a
bif2-like phenotype, interpreted as meaning that auxin transport and bif2 are upstream of
ba1 (Skirpan et al. 2008). Identification of proteins interacting with ba1 has revealed a
direct interaction between BA1 and BIF2 in vitro (Skirpan et al. 2008). BA1 and BIF2
co-localize to the nucleus, where BIF2 phosphorylates BA1, directly linking BA1 to a
known regulator of PAT.
However, there is also evidence suggesting that ba1 functions upstream of auxin
transport. ba1 is expressed at the base of SPM, implying it functions non cell
autonomously (Gallavotti et al. 2004). Localization of red fluorescent protein (RFP)
fused to the auxin-responsive promoter DR5 revealed an absence of RFP expression on
the flanks of the ba1 inflorescence meristem. Interpreted as showing that auxin maxima
were not created, this result suggested that ba1 is required for PAT during axillary
meristem initiation (Gallavotti et al. 2008). Alternatively, it is possible that the absence
of DR5:RFP expression was caused by a disruption in auxin signaling required for
axillary meristem initiation. As many feedback loops are involved in auxin signaling, it
8
is also possible that ba1 acts both up- and downstream of PAT. The localization of bif2
to two different cellular compartments – the cell periphery, consistent with its role in
PAT; and the nucleus, where it phosphorylates ba1- opens up the possibility that bif2
fulfills two different roles (Skirpan et al. 2008). Perhaps ba1 functions both up and
downstream of auxin transport, allowing the two proposed models of ba1 function to
coexist, at least at present.
In addition to the transport of auxin, localized auxin biosynthesis contributes to
gradients of auxin at the shoot apex (Zhao 2008). The idea that localized auxin
biosynthesis could contribute to auxin dynamics was at first controversial, but is gaining
acceptance as more reports establish this hypothesis in multiple species. First isolated in
Arabidopsis, the YUCCA (YUC) gene family encodes flavin monooxygenases (FMOs)
which catalyze a rate-limiting step during tryptophan-dependent auxin biosynthesis (Zhao
et al. 2001). yuc mutants display defects in seedling development, vascular patterning
and floral development. YUC genes are expressed in a limited region of cells adjacent to
the site of axillary meristem and lateral organ initiation, implying that localized
biosynthesis of auxin is critical during plant development.
In maize, sparse inflorescence1 (spi1) encodes a FMO with similarity to the YUC
genes. spi1 mutants have defects in axillary meristem initiation resulting in a similar
phenotype to the bif2 and Bif1 mutants (Chapter 3). However, there are differences
between the spi1 mutant phenotype and that of the Arabidopsis and rice YUCCA mutants.
Mutation at the single spi1 locus produces plants with severe defects, but extensive
redundancy within the Arabidopsis YUC family means that an equivalent phenotype is
not observed until the quadruple yuc1; yuc2; yuc4; yuc6 mutant is created (Cheng et al.
9
2006). The rice ortholog of spi1 is Osyuc1, yet it has a very different phenotype, with no
floral defects reported (Yamamoto et al. 2007). Therefore the YUC gene family has
experienced extensive divergence during the evolution of plants.
There is extensive feedback regulation of auxin function, for example, auxin
promotes its own efflux from cells (Paciorek et al. 2005). spi1;bif2 double mutants
display a synergistic phenotype suggesting a link between auxin biosynthesis and
transport (Gallavotti et al. 2008). Synergism between auxin biosynthesis and transport
has been previously reported but the molecular basis for synergism is not well understood
(Cheng et al. 2007; Cheng et al. 2007). It is possible that spi1-regulated auxin
biosynthesis functions in inducing or regulating auxin transport, as PIN protein is mis
localized in spi1 mutants (Chapter 3). Continued research into genes such as Bif1, bif2,
ba1 and spi1, and the other barren inflorescence mutants, their protein function and
interacting partners will yield valuable insights.
1.3 Cytokinin and apical meristem size
Plants are able to produce organs throughout their lifetime because a portion of the
meristem is maintained as lateral organ primordia are produced. The SAM is divided into
three functional zones: the peripheral zone (PZ), where lateral organ primordia are
produced; the rib zone (RZ), which gives rise to stem tissue; and the central zone (CZ),
the reservoir of stem cells (Carles and Fletcher 2003). The plant hormone cytokinin has
been implicated in maintaining the meristem, as decreases in cytokinin biosynthesis or
signaling result in a reduction in meristem size (Shani et al. 2006; Kyozuka 2007).
10
The LONELY GUY (LOG) gene of rice encodes a phosphoribohydrolase
functioning to activate cytokinin in the final step of cytokinin biosynthesis (Kurakawa et
al. 2007). log mutants fail to maintain meristematic cells in the SAM, resulting in smaller
meristems. In addition, log mutants have floral defects, often producing flowers with
only one stamen and no pistil due to premature floral meristem termination. LOG
mRNA is expressed at the shoot meristem tip indicating that LOG provides a localized,
meristem specific influx of active cytokinin required for meristem maintenance (Zhao
2008). The role of cytokinin in meristem maintenance is therefore conserved in
monocots and dicots, and furthermore cytokinin functions at the SAM and at the
inflorescence apical and axillary meristems (Figure 1.1).
In Arabidopsis and rice, the KNOTTED1 homeobox-like (KNOX) family of genes
are required for meristem maintenance and promote cytokinin biosynthesis by activation
of ATP/ADP-ISOPENTYLTRANSFERASE (IPT) genes, which catalyze the rate-limiting
step of cytokinin biosynthesis (Sakakibara 2006 ; Shani et al. 2006). In maize, knotted1
(kn1) loss of function mutants have a sparse inflorescence due to a failure to maintain
apical meristem during inflorescence development, which results in a smaller apical
meristem (Kerstetter et al. 1997). Although a direct link between kn1 in maize and
cytokinin biosynthesis has not yet been shown, it is likely that kn1 promotes cytokinin
biosynthesis in a similar manner to the KNOX genes of Arabidopsis and rice. The
smaller apical meristem of kn1 mutants could, therefore, be the result of a reduction in
cytokinin levels.
The cytokinin signal is transduced via a two-component system, which has been
characterized in Arabidopsis (Ferreira and Kieber 2005). Cytokinin is bound by
11
transmembrane receptors of the Arabidopsis sensor histidine kinase (AHK) family,
triggering a phosphorelay through the Arabidopsis histidine-phosphotransfer proteins
(AHPs) (Zhao 2008). AHPs transfer the signal to the nucleus where type B-Arabidopsis
Response Regulators (ARRs) are activated, inducing the transcription of cytokinin-
responsive genes. In addition, the type B ARRs activate transcription of type A ARRs,
which negatively regulate the cytokinin signal to allow cells to differentiate (To et al.
2007). Failure to down regulate cytokinin in the SAM results in the abnormal phyllotaxy
(abph1) mutant of maize (Jackson and Hake 1999). abph1 encodes a type-A response
regulator, which functions to restrict cytokinin-induced SAM proliferation; abph1
mutants have enlarged SAMs and defects in phyllotaxis (Giulini et al. 2004).
The WUSCHEL (WUS) gene and the CLAVATA (CLV) genes of Arabidopsis
function in the regulation of meristem size, with WUS positively regulating stem cell
identity, and the CLV genes promoting organ initiation (Carles and Fletcher 2003). WUS
functions to maintain meristems by directly repressing type-A ARRs, so restricting
negative cytokinin signaling (Leibfried et al. 2005). The CLV proteins encode
components of a receptor kinase pathway: CLV1 and CLV2 encode components of a
receptor protein, and CLV3 encodes a secreted polypeptide this is the ligand of this
receptor. The function of the CLV pathway is to repress transcription of WUS, so
allowing stem cells to differentiate (Schoof et al. 2000).
The thick tassel dwarf1 (td1) gene of maize and FLORAL ORGAN NUMBER1
(FON1) gene of rice encode orthologs of CLV1, and the maize gene fasciated ear2 (fea2)
encodes a CLV2 ortholog (Taguchi-Shiobara et al. 2001; Bommert et al. 2005). In td1
and fea2 mutants, an over proliferation of the ear inflorescence meristem results in a
12
severely fasciated ear. In addition, td1 and fea2 mutants have enlarged floral meristems
and increased numbers of floral organs, phenotypes also observed in fon1 mutants.
FLORAL ORGAN NUMBER4 (FON4) encodes a rice ortholog of CLV3 (Chu et al. 2006;
Suzaki et al. 2006). FON4 mutants have enlarged SAMs and increased inflorescence
branching and floral organ number. The function of td1, fea2, fon1 and fon4 in floral
meristems indicates that the wus-clv pathway functions in axillary meristems as well as in
the apical meristem during both vegetative and inflorescence development.
Cytokinin homeostasis in plants is maintained by degradation catalyzed by
CYTOKININ OXIDASE (CKX) (Brugiere et al. 2003). An analysis of QTLs for grain
yield in rice identified CKX as an important regulator of this trait (Ashikari et al. 2005).
Reduced expression of CKX allows cytokinin to accumulate, enlarging inflorescence
meristems, increasing spikelet number, and therefore increasing yield (Houba-Herin et al.
1999; Morris et al. 1999). This mimics the phenotype of the maize fea2 and td1 mutants,
which also have enlarged meristems and increased kernel number (Taguchi-Shiobara et
al. 2001). Future work will show if increased cytokinin levels produce the meristem
enlargement of the fea2 and td1 mutants.
1.4 Meristem determinacy
Indeterminate meristems can produce an indefinite number of organs. For example, the
shoot apical meristem produces an indefinite number of leaves, stem tissues and axillary
meristems by balancing organogenesis with self-renewal. Determinate meristems
produce a specific number of organs. An example of this is the floral meristem, which
13
produces a specific number of floral organs before termination. The determinacy of
axillary meristems during inflorescence development affects the numbers of branches,
spikelets, florets and floral organs produced in the inflorescence, and is therefore an
important factor in inflorescence architecture (Kellogg 2007). By analyzing mutants with
defects in meristem determinacy, genes specifying meristem determinacy have been
identified (Table 1.2).
The reversed germ orientation (rgo) mutant produces an extra floret in each
spikelet. In the ear, this alters the arrangement of seed rows and produces the phenotype
for which the mutant is named (Kaplinsky and Freeling 2003). rgo functions in
specifying spikelet meristem identity and is required for the spikelet to floral meristem
conversion. rgo overlaps in function with indeterminate spikelet1 (ids1), demonstrated by
the synergistic phenotype of rgo; ids1 double mutants. ids1 mutants lack SM
determinacy and produce extra florets as a result of a loss of spikelet meristem identity
(Chuck et al. 1998). Additional analysis indicates that rgo and ids1 function in a dosage-
dependent manner, with a threshold level of both proteins required to specify meristem
identity. In this way, variations in dosage could produce the differences in inflorescence
architecture between species.
The indeterminate floral apex1 (ifa1) mutant of maize displays defects in
determinacy in SPMs, SMs and FMs (Laudencia-Chingcuanco and Hake 2002). As a
result, ifa1 mutants produce increased numbers of spikelets and florets, and in addition,
the floral meristem does not terminate after production of all the floral organs but instead
continues to proliferate, a phenotype observed in both male and female flowers. These
14
phenotypes indicate that ifa1 is required to specify the identity of the SM and FM, and
functions to maintain FM determinacy.
branched silkless1 (bd1) mutants lack determinacy in SMs producing ears with
branches in place of spikelets (Chuck et al. 2002). A less severe phenotype is observed in
the tassel. bd1 encodes an ethylene-responsive element-binding factor (ERF)
transcription factor that is expressed only in tassels and ears, specifically at the base of
the SM. The presumed function of bd1 is to specify SM identity and repress
indeterminacy. ERF proteins have been shown to act as transcriptional repressors, it is
possible that bd1 also functions in this way.
Three genes in the ramosa (ra) pathway have recently been identified, ramosa1,2
and 3, which are regulators of SPM determinacy (Vollbrecht et al. 2005; Bortiri et al.
2006; Satoh-Nagasawa et al. 2006). In ra mutant tassels and ears, the SPMs produce
long branches instead of short spikelet branches. ramosa1 (ra1) encodes an EPF-type
transcription factor expressed in SPMs (Vollbrecht et al. 2005). In ra1 mutants, the short
spikelet branches are converted to long branches. Spikelets are produced on the
branches, indicating that ra1 is not required for SM identity, but rather for SPM
determinacy. In normal plants, ra1 is not expressed at the base of BMs, which allows
them to become indeterminate.
Similar to ra1, ra2 mutants have highly branched tassels and ears, however, an
interesting difference is that the branches of the ra2 tassel are held at a more acute angle,
and the spikelets are borne on elongated pedicels (Bortiri et al. 2006). ra2 encodes a
LOB-domain transcription factor and is expressed in BMs, SPMs and SMs. ra2 is
thought to act upstream of ra1, and is proposed to regulate ra1, possibly through
15
transcriptional activation. Similar to the other ramosa mutants, ra3 produces extra long
branches in the tassel and ear (Satoh-Nagasawa et al. 2006). This indicates that ra3
functions in axillary meristem determinacy, and consistent with this role, ra3 is expressed
in cells subtending spikelet pair meristems Because the ramosa genes are expressed in
similar patterns at the base of the SPMs, it is thought that the ramose pathway regulates
an non autonomous signal that functions in conferring meristem determinacy. As ra3
encodes a trehalose-6-phosphate phophatase (TPP), it is proposed that trehalose-6-
phosphate (T6P) levels act as a signal during inflorescence development, and that ra3
functions to modulate trehalose level. Other possible meristem determinacy signaling
molecules include auxin, suggested because RA1 contains an EAR repression domain
also found in Aux/IAA transcription factors.
Meristem determinacy also impacts the sex determination process in maize
flowers. Maize flowers are produced with both male and female organs; later on in
development, stamens are aborted in ear florets and carpels are aborted in tassel florets to
form separate male and female flowers in the tassel and ear. In mutants such as
antherear1 (an1) and Dwarf8 (D8), the stamens and lower floret in the ear do not abort,
creating masculinized ears (Bensen et al. 1995; Peng et al. 1999). The tasselseed (ts)
family of maize mutants have feminized tassels due to a failure in carpel abortion (Irish
and Nelson 1993; Irish et al. 1994; Irish 1997). In class I ts mutants (ts1, ts2, and ts5)
male florets are converted to female florets, resulting in feminized tassels. The class II ts
mutants (ts4 and Ts6) also have this phenotype, and in addition produce extra branches
on both tassels and ears, suggesting that the pathways regulating meristem branching and
sex determination could be interconnected. tasselseed4 (ts4) encodes a member of the
16
mir172 microRNA family found to regulate the APETALA2 (AP2)-like transcription
factor ids1/Ts6 (Chuck et al. 2007).
The plant hormone gibberelic acid (GA) functions in several developmental
processes including seed germination, shoot elongation and floral development, and is
also implicated in inflorescence architecture and sex determination (Chuck et al. 2007).
Mutants deficient in GA biosynthesis or signaling have dwarfed phenotypes and floral
defects (Schwechheimer 2008). Application of endogenous GA reduces branch number
in normal tassels and suppresses the phenotype of ra mutants, identifying GA as a
possible hormonal regulator of meristem determinacy (McSteen 2006).
A further link between GA and floral development comes with the discovery that
the KNOX proteins negatively regulate gibberellin (GA) levels by repressing the
transcription of GA biosynthesis gene GA-20-oxidase (Hay et al. 2002). Furthermore,
the KNOX gene STM also positively regulates the expression of GA-2-oxidases, which
deactivate bioactive GAs, suggesting a mechanism where KNOX proteins maintain
meristems by simultaneously activating cytokinin and repressing GA biosynthesis
(Jasinski et al, 2005).
In summary, recent research has implicated T6P, auxin, GA and microRNAs in
the regulation of meristem determinacy. The cloning of additional genes, and
identification of genes interacting with members of the ts and ra families will help to
elucidate the pathways regulating meristem determinacy.
17
1.5 Conclusions
In this thesis, research characterizing maize mutants with defects in inflorescence
development will be presented. This work has contributed to our understanding of the
role that auxin plays in regulating axillary meristem initiation during maize inflorescence
development. Barren inflorescence1 has been identified as a possible regulator of auxin
transport, and sparse inflorescence1 functions in localized auxin biosynthesis. An
emerging theme of this work is the synergistic interaction between auxin biosynthesis and
transport.
18
Figure 1.1: Inflorescence structure of Maize, Arabidopsis and rice
19
(a) Inflorescence meristem (IM). Cytokinin (CK) maintains the inflorescence meristem. kn1,
fea2 and td1 also regulate meristem size possibly through regulation of cytokinin levels. (b)
Axillary meristem (AXM). Localized accumulation of auxin (AUX) indicates the site of axillary
meristem initiation. spi1, bif2 and Bif1 regulate the accumulation of auxin by regulating both
biosynthesis and transport. (c) Axillary meristem (AXM) later in development. Cytokinin also
maintains the size of axillary meristems. In addition, auxin is also required to initiate lateral
organ primordia. ba1 is expressed in an adaxial domain at the base of SPMs where it functions
either up- or down-stream of auxin transport. ra1 is expressed adaxial to SPMs and functions to
confer determinacy on the meristem.
Figure 1.2: Proposed model of the role of cytokinin and auxin during maize inflorescencedevelopment.
20
* Rice branches terminate in a spikelet, but because they produce an indefinite number of
spikelets before terminating, we define them as indeterminate.
Table 1.1: Axillary meristems during inflorescence development in Maize, Arabidopsis, and rice.
Meristem Abbreviation Determinacy Product Maize Branch meristem BM indeterminate Long branch with spikelet pairs Spikelet pair meristem SPM determinate Short spikelet pair branch Spikelet meristem SM determinate Spikelet Floral meristem FM determinate Floret Arabidopsis Branch meristem BM indeterminate Long branch with flowers Floral meristem FM determinate Flower Rice Branch meristem BM indeterminate* Long branch Spikelet meristem SM determinate Spikelet Floral meristem FM determinate Floret
21
Maize Gene Protein Function Arabidopsis Rice Reference
Meristem size thick tassel dwarf1 (td1)
Receptor-like kinase
Restricts meristem size
CLAVATA1 FLORAL ORGAN NUMBER1
(Bommert et al. 2005)
fasciated ear2 (fea2)
Receptor-like protein
Restricts meristem size
CLAVATA3 FLORAL ORGAN NUMBER2/4
(Taguchi-Shiobara et al. 2001)
knotted1 (kn1) KNOX TF Meristem maintenance
SHOOT MERISTEM LESS
OSH1 (Jackson et al. 1994)
abphyl1 (abph1) Type-A Response Regulator
Negative cytokinin signaling
ARR OsARR (Giulini et al. 2004)
cytokinin oxidase (ckx1)
Cytokinin oxidase
Meristem size CYTOKININ OXIDASE (CKX)
OsCKX1 (Houba-Herin et al. 1999), (Morris et al. 1999)
Axillary meristem initiation Barren inflorescence1 (Bif1)
- Regulates auxin transport
- - (Barazesh and McSteen 2008)
barren inflorescence2 (bif2)
Serine/threonine kinase
Regulates auxin transport
PINOID OsPINOID (McSteen et al. 2007)
sparse inflorescence1 (spi1)
Flavin mono-oxygenase
Localized auxin biosynthesis
YUCCA4/1 OsYUCCA1 (Gallavotti et al. 2008)
barren stalk1 (ba1) Basic helix-
loop-helix TF
AXM initiation
HECATE LAX PANICLE (Gallavotti et al. 2004)
Meristem determinacy/identity Suppressor of sessile spikelets (Sos)
- Regulates SPM determinacy
- - (Wu and McSteen 2008)
ramosa1 (ra1) EPF-type TF
Confers SPM determinacy
- - (Vollbrecht et al. 2005)
Table 1.2: Maize inflorescence development mutants, with similar genes from Arabidopsis and
rice.
22
ramosa2 (ra2) LOB-domain TF
Confers SPM determinacy
ASYMMETRIC LEAVES2-LIKE4
OsRA2 (Bortiri et al. 2006)
ramosa3 (ra3) Trehalose-6-phosphate phosphatase (TPP)
AXM determinacy
TPP SISTER OF RA2
(Satoh-Nagasawa et al. 2006)
branched silkless (bd1)
ERF TF Specifies SM identity
LEAFY PETIOLE
FRIZZY PANICLE1
(Chuck et al. 2002)
indeterminate spikelet (ids1)/ Tasselseed6 (Ts6)
AP2-like TF Confers SM determinacy
APETALA2 OsIDS1 (Chuck et al. 1998)
tasselseed4 (ts4) mir172 microRNA
Confers SM determinacy
miR172 (Chuck et al. 2007)
teosinte branched1(tb1)
TCP TF Suppresses tiller outgrowth
TEOSINTE BRANCHED1-LIKE1 (TBL1)
FINE CULM1 (Doebley et al. 1997)
Miscellaneous
Corngrass (Cg1) miR156 microRNA
Juvenile-adult transition
miR156 (Chuck et al. 2007)
tasselseed2 (ts2) Alcohol dehydrogenase
Floral organ abortion
AtATA1(Ts2-like)
OsTS2 (Delong et al. 1993)
anther ear1 (an1) Ent-kaurene synthase
GA biosynthesis
(Bensen et al. 1995)
Dwarf8 (D8) SH2 TF Negative regulator of GA response
GIBBERELLIC ACID INSENSITIVE (GAI)
SLENDER1 (SLN1)
(Peng et al. 1999)
Teosinte glume architecture1 (tga1)
SBP TF Reduces cupule size
- OsTGA1 (Wang et al. 2005)
iKNOX = KNOTTED1 HOMEOBOX-like; TF = Transcription factor; LOB= lateral organ
boundary; TPP = Trehalose-6-phosphate phosphatase; ERF = ethylene responsive binding factor;
SH2 = Src homology 2 domain, SBP= squamosa binding protein
23
1.6 References
Ashikari, M., H. Sakakibara, S. Lin, T. Yamamoto, T. Takashi, A. Nishimura, E. R.
Angeles, Q. Qian, H. Kitano and M. Matsuoka (2005). "Cytokinin oxidase
regulates rice grain production." Science 209: 741-745.
Barazesh, S. and P. McSteen (2008). "Barren inflorescence1 functions in organogenesis
during vegetative and inflorescence development in maize." Genetics 179: 389–
401.
Benjamins, R., A. Quint, D. Weijers, P. Hooykaas and R. Offringa (2001). "The PINOID
protein kinase regulates organ development in Arabidopsis by enhancing polar
auxin transport." Development 128(20): 4057-4067.
Benjamins, R. and B. Scheres (2008). "Auxin: the looping star in plant development."
Annual Review of Plant Biology 59: 443-465.
Bennett, S. R. M., J. Alvarez, G. Bossinger and D. R. Smyth (1995). "Morphogenesis in
pinoid mutants of Arabidopsis thaliana." Plant Journal 8(4): 505-520.
Bensen, R. J., G. S. Johal, V. C. Crane, J. T. Tossberg, P. S. Schnable, R. B. Meeley and
S. P. Briggs (1995). "Cloning and characterization of the maize an1 Gene." Plant
Cell 7(1): 75-84.
Bommert, P., C. Lunde, J. Nardmann, E. Vollbrecht, M. Running, D. Jackson, S. Hake
and W. Werr (2005). "thick tassel dwarf1 encodes a putative maize ortholog of
the Arabidopsis CLAVATA1 leucine-rich repeat-like kinase." Development
132(6): 1235-1245.
24
Bortiri, E., G. Chuck, E. Vollbrecht, T. Rocheford, R. Martienssen and S. Hake (2006).
"The ramosa2 LATERAL ORGAN BOUNDARY protein that determines the fate
of stem cells in branch meristems of maize." Plant Cell 18(574-585).
Bortiri, E. and S. Hake (2007). "Flowering and determinacy in maize." Journal of
Experimental Botany 58: 909-916.
Bortiri, E., D. Jackson and S. Hake (2006). "Advances in maize genomics: the emergence
of positional cloning." Current Opinion in Plant Biology 9: 164-171.
Brugiere, N., S. Jiao, S. Hantke, C. Zinselmeier, J. A. Roessler, X. Niu, R. J. Jones and J.
E. Habben (2003). "cytokinin oxidase gene expression in maize is localized to the
vasculature, and is induced by cytokinins, abscisic acid, and abiotic stress." Plant
Physiology 132: 1228-1240.
Carles, C. and J. C. Fletcher (2003). "Shoot apical meristem maintenance: the art of
dynamic balance." Trends in Plant Science 8(8): 394-401.
Carraro, N., C. Forestan, S. Canova, J. Traas and S. Varotto (2006). "ZmPIN1a and
ZmPIN1b encode two novel putative candidates for polar auxin transport and
plant architecture determination of maize." Plant Physiology 142(1): 254-264.
Cheng, Y. F., X. H. Dai and Y. Zhao (2007). "Auxin synthesized by the YUCCA flavin
monooxygenases is essential for embryogenesis and leaf formation in
Arabidopsis." Plant Cell 19(8): 2430-2439.
Cheng, Y. F., X. H. Dai and Y. D. Zhao (2006). "Auxin biosynthesis by the YUCCA
flavin monooxygenases controls the formation of floral organs and vascular
tissues in Arabidopsis." Genes & Development 20(13): 1790-1799.
25
Cheng, Y. F., G. J. Qin, X. H. Dai and Y. D. Zhao (2007). "NPY1 a BTB-NPH3-like
protein, plays a critical role in auxin-regulated organogenesis in Arabidopsis."
Proceedings of the National Academy of Sciences of the United States of America
104(47): 18825-18829.
Christian, M., B. Steffens, D. Schenck, S. Burmester, M. Bottger and H. Luthen (2006).
"How does auxin enhance cell elongation? Roles of auxin-binding proteins and
potassium channels in growth control." Plant Biology 8(3): 346-352.
Chu, H., Q. Qian, W. Liang, C. Yin, H. Tan, X. Yao, Z. Yuan, J. Yang, H. Huang, D.
Luo, H. Ma and D. Zhang (2006). "The FLORAL ORGAN NUMBER4 gene
encoding a putative ortholog of Arabidopsis CLAVATA3 regulates apical
meristem size in rice." Plant Physiology 142: 1039-1052.
Chuck, G., A. M. Cigan, K. Saeteurn and S. Hake (2007). "The heterochronic maize
mutant Corngrass1 results from overexpression of a tandem microRNA." Nature
Genetics 39(4): 544-549.
Chuck, G., R. B. Meeley and S. Hake (1998). "The control of maize spikelet meristem
fate by the APETALA2- like gene indeterminate spikelet1." Genes &
Development 12(8): 1145-1154.
Chuck, G., R. B. Meeley, E. E. Irish, H. Sakai and S. Hake (2007). "The maize
tasselseed4 microRNA controls sex determination and meristem cell fate by
targeting Tasselseed6/indetermintate spikelet1." Nature Genetics 39(12): 1517-
1521.
Chuck, G., M. Muszynski, E. Kellogg, S. Hake and R. J. Schmidt (2002). "The control of
spikelet meristem identity by the branched silkless1 gene in maize." Science
298(5596): 1238-1241.
26
Delker, C., A. Raschke and M. Quint (2008). "Auxin dynamics: the dazzling complexity
of a small molecule's message." Planta 227(5): 929-941.
Delong, A., A. Calderonurrea and S. L. Dellaporta (1993). "Sex Determination Gene
Tasselseed2 of maize encodes a short-chain alcohol-dehydrogenase required for
stage-specific floral organ abortion." Cell 74(4): 757-768.
Doebley, J., A. Stec and L. Hubbard (1997). "The evolution of apical dominance in
maize." Nature 386(6624): 485-488.
Doonan, J. (2000). "Social controls on cell proliferation in plants." Current Opinion in
Plant Biology 3(6): 482-487.
Ferreira, F. J. and J. J. Kieber (2005). "Cytokinin signaling." Current Opinion in Plant
Biology 8(5): 518-525.
Friml, J., Y. Xiong, M. Michniewicz, D. Weijers, A. Quint, O. Tietz, R. Benjamins, P. B.
F. Ouwerkerk, K. Ljung, G. Sandberg, P. J. J. Hooykaas, K. Palme and R.
Offringa (2004). "A PINOID-Dependent Binary Swithch in Apical-Basal PIN
Polar Targeting Directs Auxin Efflux." Science 306: 862-865.
Gallavotti, A., S. Barazesh, S. Malcomber, D. Hall, D. Jackson, R. J. Schmidt and P.
McSteen (2008). "sparse inflorescence1 encodes a monocot specific YUCCA-like
flavin monooxygenase required for vegetative and reproductive development in
maize." Proceedings of the National Academy of Sciences of the United States of
America 105: 15196-15201.
Gallavotti, A., Y. Yang, R. J. Schmidt and D. Jackson (2008). "The relationship between
auxin transport and maize branching." Plant Physiology 142: 1913-1923.
27
Gallavotti, A., Q. Zhao, J. Kyozuka, R. B. Meeley, M. K. Ritter, J. F. Doebley, M. E. Pe
and R. J. Schmidt (2004). "The role of barren stalk1 in the architecture of maize."
Nature 432: 630-635.
Giulini, A., J. Wang and D. Jackson (2004). "Control of phyllotaxy by the cytokinin-
inducible response regulator homologue ABPHYL1." Nature 430: 1031-1034.
Hay, A., H. Kaur, A. Phillips, P. Hedden, S. Hake and M. Tsiantis (2002). "The
gibberellin pathway mediates KNOTTED1-Type homeobox function in plants
with different body plans." Current Biology 12: 1557-1565.
Heisler, M. G., C. Ohno, P. Das, P. Sieber, G. V. Reddy, J. Long and E. M. Meyerowitz
(2005). "Patterns of Auxin Transport and Gene Expression during Primordium
Development Revealed by Live Imaging of the Arabidopsis Inflorescence
Meristem." Current Biology 15: 1899-1911.
Houba-Herin, N., C. Pethe, J. d'Alayer and M. Laloue (1999). "Cytokinin oxidase from
Zea Mays: purification, cDNA cloning and expression in moss protoplasts." The
Plant Journal 17: 615-626.
Irish, E. E. (1996). "Regulation of sex determination in maize." Bioessays 18(5): 363-
369.
Irish, E. E. (1997). "Class II tassel seed mutations provide evidence for multiple types of
inflorescence meristems in maize (Poaceae)." American Journal of Botany
84(11): 1502-1515.
Irish, E. E., J. A. Langdale and T. M. Nelson (1994). "Interactions Between tasselseed
genes and other sex-determining genes in maize." Developmental Genetics 15(2):
155-171.
28
Irish, E. E. and T. M. Nelson (1993). "Development of tassel seed-2 inflorescences in
maize." American Journal of Botany 80: 292-299.
Jackson, D. and S. Hake (1999). "Control of phyllotaxy in maize by the abphyl1 gene."
Development 126(2): 315-323.
Jackson, D., B. Veit and S. Hake (1994). "Expression of maize knotted1 related
homeobox genes in the shoot apical meristem predicts patterns of morphogenesis
in the vegetative shoot." Development 120(2): 405-413.
Kaplinsky, N. J. and M. Freeling (2003). "Combinatorial control of meristem identity in
maize inflorescences." Development 130(6): 1149-1158.
Kellogg, E. (2007). "Floral displays: genetic control of grass inflorescences." Current
Opinion in Plant Biology 10: 26-31.
Kerstetter, R. A., D. LaudenciaChingcuanco, L. G. Smith and S. Hake (1997). "Loss-of-
function mutations in the maize homeobox gene, knotted1, are defective in shoot
meristem maintenance." Development 124(16): 3045-3054.
Kurakawa, T., N. Ueda, M. Maekawa, M. Kobayashi, M. Kojima, Y. Nagato, H.
Sakakibara and J. Kyouzuka (2007). "Direct control of shoot meristem activity by
a cytokinin-activating enzyme." Nature 445: 652-655.
Kyozuka, J. (2007). "Control of shoot and root meristem function by cytokinin." Current
Opinion in Plant Biology 10(5): 442-446.
Kyozuka, J., K. Komatsu, N. Okamoto, M. Maekawa and K. Shimamoto (2002). "The
LAX PANICLE (LAX) gene of rice is required for axillary meristem initiation in
the inflorescence." Plant and Cell Physiology 43: S8-S8.
29
Laudencia-Chingcuanco, D. and S. Hake (2002). "The indeterminate floral apex1 gene
regulates meristem determinacy and identity in the maize inflorescence."
Development 129(11): 2629-2638.
Leibfried, A., J. P. C. To, W. Busch, S. Stehling, A. Kehle, M. Demar, J. J. Kieber and J.
U. Lohmann (2005). "WUSCHEL controls meristem function by direct regulation
of cytokinin-inducible response regulators." Nature 438(7071): 1172-1175.
Livak, K. J. and T. D. Schmittgen (2001). "Analysis of relative gene expression data
using real-time quantitative PCR and the 2T-ΔΔC method." Methods 35: 402-408.
McSteen, P. (2006). "Branching out: The ramosa pathway and the evolution of grass
inflorescence morphology." Plant Cell 18(3): 518-522.
McSteen, P. and S. Hake (1998). "Genetic control of plant development." Current
Opinion in Biotechnology 9(2): 189-195.
McSteen, P. and S. Hake (2001). "barren inflorescence2 regulates axillary meristem
development in the maize inflorescence." Development 128(15): 2881-2891.
McSteen, P., D. Laudencia-Chingcuanco and J. Colasanti (2000). "A floret by any other
name: control of meristem identity in maize." Trends in Plant Science 5(2): 61-66.
McSteen, P. and O. Leyser (2005). "Shoot branching." Annual Review of Plant Biology
56: 353-374.
McSteen, P., S. Malcomber, A. Skirpan, C. Lunde, X. Wu, E. Kellogg and S. Hake
(2007). "barren inflorescence2 encodes a co-ortholog of the PINOID
serine/threonine kinase and is required for organogenesis during inflorescence and
vegetative development in maize." Plant Physiology 144: 1000-1011.
30
Michniewicz, M., M. K. Zago, L. Abas, D. Weijers, A. Schweighofer, I. Meskiene, M. G.
Heisler, C. Ohno, J. Zhang, F. Huang, R. Schwab, D. Weigel, E. M. Meyerowitz,
C. Luschnig, R. Offringa and J. Friml (2007). "Antagonistic regulation of PIN
phosphorylation by PP2A and PINOID directs auxin flux." Cell 130(6): 1044-
1056.
Morris, R. O., K. D. Bilyeu, J. G. Laskey and N. Cheikh (1999). "Isolation of a gene
encoding a glycosylated cytokinin oxidase from maize." Biochemical and
Biophysical Research Communications 255: 328-333.
Paciorek, T., E. Zazimalova, N. Ruthardt, J. Petrasek, Y. D. Stierhof, J. Kleine-Vehn, D.
A. Morris, N. Emans, G. Jurgens, N. Geldner and J. Friml (2005). "Auxin inhibits
endocytosis and promotes its own efflux from cells." Nature 435(30): 1251-1256.
Peng, J. R., D. E. Richards, N. M. Hartley, G. P. Murphy, K. M. Devos, J. E. Flintham, J.
Beales, L. J. Fish, A. J. Worland, F. Pelica, D. Sudhakar, P. Christou, J. W.
Snape, M. D. Gale and N. P. Harberd (1999). "'Green revolution' genes encode
mutant gibberellin response modulators." Nature 400(6741): 256-261.
Ritter, M. K., C. M. Padilla and R. J. Schmidt (2002). "The maize mutant barren stalk1 is
defective in axillary meristem development." American Journal of Botany 89(2):
203-210.
Sakakibara, H. (2006). "Cytokinins: activity, biosynthesis, and translocation." Annual
Review of Plant Biology 57: 431-449.
Satoh-Nagasawa, N., N. Nagasawa, S. Malcomber, H. Sakai and D. Jackson (2006). "A
trehalose metabolic enzyme controls inflorescence architecture in maize." Nature
441(7090): 227-230.
31
Schoof, H., M. Lenhard, A. Haecker, K. F. X. Mayer, G. Jurgens and T. Laux (2000).
"The stem cell population of Arabidopsis shoot meristems is maintained by a
regulatory loop between the CLAVATA and WUSCHEL genes." Cell 100(6): 635-
644.
Schwechheimer, C. (2008). "Understanding gibberellic acid signaling - are we there yet?"
Current Opinion in Plant Biology 11: 9-15.
Shani, E., O. Yanai and N. Ori (2006). "The role of hormones in shoot apical meristem
function." Current Opinion in Plant Biology 9: 484-489.
Shimamoto, K. and J. Kyouzuka (2002). "Rice as a model for comparative genomics of
plants." Annual Review of Plant Biology 53: 399-419.
Skirpan, A., X. Wu and P. McSteen (2008). "Genetic and physical interaction suggest
that BARREN STALK1 is a target of BARREN INFLORESCENCE2 in maize
inflorescence development." The Plant Journal 55: 787-797.
Smith, R. S., S. Guyomarc'h, T. Mandel, D. Reinhardt, C. Kuhlemeier and P.
Prusinkiewicz (2006). "A plausible model of phyllotaxis." Proceedings of the
National Academy of Sciences of the United States of America 103(5): 1301-
1306.
Steeves, T. and I. Sussex (1989). Patterns in plant development. Cambridge, UK,
Cambridge University Press.
Suzaki, T., T. Toriba, M. Fujimoto, N. Tsutsumi, H. Kitano and H. Hirano (2006).
"Conservation and diversification of meristem maintenance mechanism in Oryza
Sativa: Function of the FLORAL ORGAN NUMBER2 gene." Plant and Cell
Physiology 47(12): 1591-1602.
32
Taguchi-Shiobara, F., Z. Yuan, S. Hake and D. Jackson (2001). "The fasciated ear2 gene
encodes a leucine-rich repeat receptor-like protein that regulates shoot meristem
proliferation in maize." Genes & Development 15(20): 2755-2766.
To, J. P. C., J. Deruere, B. B. Maxwell, V. F. Morris, C. E. Hutchison, F. J. Ferreira, G.
E. Schaller and J. J. Kieber (2007). "Cytokinin regulates type-A Arabidopsis
response regulator activity and protein stability via two-component
phosphorelay." Plant Cell 19: 3901-3914.
Tobena-Santamaria, R., M. Bliek, K. Ljung, G. Sandberg, J. N. M. Mol, E. Souer and R.
Koes (2002). "FLOOZY of petunia is a flavin mono-oxygenase-like protein
required for the specification of leaf and flower architecture." Genes &
Development 16(6): 753-763.
Vollbrecht, E. and B. Sigmon (2005). "Amazing grass: developmental genetics of maize
domestication." Biochemical Society Transactions 33: 1502-1506.
Vollbrecht, E., P. S. Springer, L. Goh, E. S. Buckler and R. Martienssen (2005).
"Architecture of floral branch systems in maize and related species." Nature 436:
1119-1126.
Wang, H., T. Nussbaum-Wagler, B. L. Li, Q. Zhao, Y. Vigouroux, M. Faller, K.
Bomblies, L. Lukens and J. F. Doebley (2005). "The origin of the naked grains of
maize." Nature 436(7051): 714-719.
Wisniewska, J., J. Xu, D. Seifertova, P. B. Brewer, K. Ruzicka, I. Blilou, D. Rosque, E.
Benkova, B. Scheres and J. Friml (2006). "Polar PIN Localization Directs Auxin
Flow in Plants." Sciencexpress.
33
Woodward, C., S. M. Bemis, E. J. Hill, S. Sawa, T. Koshiba and K. U. Torii (2005).
"Interaction of auxin and ERECTA in elaborating Arabidopsis inflorescence
architecture revealed by the activation tagging of a new member of the YUCCA
family putative flavin monooxygenases." Plant Physiology 139(1): 192-203.
Wu, X. and P. McSteen (2007). "The role of auxin transport during inflorescence
development in Maize (Zea Mays, Poaceae)." American Journal of Botany
94(11): 1745-1755.
Wu, X. and P. McSteen (2008). "Characterization of Suppressor of sessile spikelets." in
press.
Yamamoto, Y., N. Kamiya, Y. Morinaka, M. Matsuoka and T. Sazuka (2007). "Auxin
biosynthesis by the YUCCA genes in rice." Plant Physiology 143(3): 1362-1371.
Zazimalova, E., P. Krecek, P. Skupa, K. Hoyerova and J. Petrasek (2007). "Polar
transport of the plant hormone auxin - he role of PIN-FORMED (PIN) proteins."
Cellular and Molecular Life Sciences 64: 1621-1637.
Zhao, Y. (2008). "The role of local biosynthesis of auxin and cytokinin in plant
development." Current Opinion in Plant Biology 11: 16-22.
Zhao, Y. D., S. K. Christensen, C. Fankhauser, J. R. Cashman, J. D. Cohen, D. Weigel
and J. Chory (2001). "A role for flavin monooxygenase-like enzymes in auxin
biosynthesis." Science 291 (5502): 306-309.
CHAPTER 2
barren inflorescence1 functions in organogenesis during vegetative and inflorescence development in maize
This chapter was published in Genetics in May 2008
Barazesh, S., and McSteen, P. (2008), Genetics 179: 389-401
35
2.1 Introduction
Organogenesis in plants is controlled by meristems (Steeves and Sussex 1989). The
peripheral zone of the meristem initiates organ primordia while the central zone remains
undifferentiated to allow organogenesis to continue indefinitely (McSteen and Hake
1998; Veit 2006). Auxin plays a fundamental role in organogenesis in the peripheral
zone of the meristem (Reinhardt et al. 2000; Vernoux et al. 2000; Reinhardt et al. 2003).
Plants with mutations in genes required for auxin biosynthesis, transport or response,
have defects in organogenesis (Okada et al. 1991; Bennett et al. 1995; Przemeck et al.
1996; Vernoux et al. 2000; Cheng et al. 2006; Cheng et al. 2007). These and other
studies have shown that auxin is required for leaf initiation during vegetative
development and flower initiation during reproductive development (Okada et al. 1991;
Reinhardt et al. 2000; Benkova et al. 2003; Reinhardt et al. 2003; Scanlon 2003; Heisler
et al. 2005; Cheng et al. 2007; Wu and McSteen 2007).
During the vegetative phase of growth, the shoot apical meristem (SAM) at the tip
of the developing shoot, reiteratively produces phytomers, consisting of node, internode,
leaf and axillary meristem located in the axil of the leaf (Steeves and Sussex 1989;
McSteen and Leyser 2005). Axillary meristems can grow out to become a lateral branch,
known as a tiller in maize, which reiterates the growth of the main shoot. During the
reproductive phase of growth, the shoot apical meristem converts to an inflorescence
meristem which produces modified phytomers. In many plants, the leaves are reduced to
form bract leaves and the axillary meristems are enlarged to produce the flowers (Steeves
and Sussex 1989). In maize, highly branched inflorescences are produced (McSteen et al.
36
2000; Bommert et al. 2005; Bortiri and Hake 2007). The male inflorescence, the tassel,
grows at the apex of the plant and is composed of a main spike with several long
branches at the base (Fig. 1A). The main spike and branches produce short branches
called spikelet pairs. The spikelet is the building block of all grass inflorescences
(Clifford 1987; Kellogg 2000). In maize, the spikelet is composed of two leaf-like
glumes enclosing two florets. The female inflorescence, the ear, is produced from an
axillary meristem located several nodes below the tassel. In both tassel and ear, the
florets are enclosed by leaf-like structures called lemma and palea surrounding a pair of
petal-like structures called lodicules, and the reproductive organs, the stamens and
carpels. The carpels abort in the tassel and the stamens abort in the ear to produce
separate male and female inflorescences (Irish 1996).
To produce this highly branched inflorescence, the inflorescence meristem
produces four types of axillary meristems (Table 2.1), which give rise to the various
structures of the mature inflorescence (Cheng et al. 1983; Irish 1997; McSteen et al.
2000; Bommert et al. 2005). The primary axillary meristems have two alternative fates.
The first primary axillary meristems that arise are the branch meristems (BM). BMs are
indeterminate and grow out to become long branches at the base of the tassel, which
reiterate the growth of the main spike (Table 1.1, Table 1.1A). The next primary axillary
meristems that arise are the spikelet pair meristems (SPMs). SPMs are determinate and
give rise to short branches bearing a pair of spikelets (Table 1.1). The SPMs produce the
secondary axillary meristems called spikelet meristems (SMs), which then produce the
tertiary axillary meristems called floral meristems (FMs), which finally produce the floral
organs. The fate of the primary axillary meristems as indeterminate (branch) versus
37
determinate (spikelet pair) is regulated by the ramosa (ra) pathway (Vollbrecht et al.
2005; Bortiri et al. 2006; McSteen 2006; Satoh-Nagasawa et al. 2006; Kellogg 2007).
The ra1 and ra2 genes encode transcription factors which are required to impose
determinacy on the SPM (Vollbrecht et al. 2005; Bortiri et al. 2006). In the ra1 mutant,
there are additional long branches in the tassel and ear (Gernart 1912; Vollbrecht et al.
2005).
The barren inflorescence loci in maize identify genes required for axillary
meristem initiation. barrenstalk1 (ba1) encodes a basic helix-loop-helix transcription
factor required for axillary meristem initiation during both vegetative and reproductive
development (Gallavotti et al. 2004). ba1 mutants do not produce tillers, ears, branches,
spikelets and florets (Ritter et al. 2002). barren inflorescence2 (bif2) mutants also have
fewer ears and fewer branches, spikelets, florets and floral organs due to defects in the
initiation of axillary meristems in the inflorescence (McSteen and Hake 2001). bif2
mutants also have defects in axillary meristem initiation during vegetative development
(McSteen et al. 2007). The bif2 gene encodes a serine/threonine protein kinase co-
orthologous to PINOID, which regulates auxin transport in Arabidopsis (Christensen et
al. 2000; Benjamins et al. 2001; Lee and Cho 2006; McSteen et al. 2007).
Here, we characterize another barren inflorescence mutation, Barren
inflorescence1 (Bif1). Bif1 is a semi-dominant mutation that confers the phenotype of
fewer branches, spikelets, florets and floral organs in the inflorescence. Although Bif1 is
a classical mutation of maize first isolated more than 30 years ago (Neuffer et al. 1997),
the phenotype had not previously been analyzed in detail. Here, we report that the
defects in Bif1 mutants are due to defects in the initiation of axillary meristems in the
38
inflorescence. We tested the interaction between Bif1 and bif2 or ba1 using expression
and double mutant analyses. We show that Bif1 is epistatic to ba1 and that ba1
expression is greatly reduced in Bif1 mutants. We show that Bif1 mutants share many
phenotypic similarities with bif2 mutants and that bif2 expression is also reduced in Bif1
mutants. The dramatic enhancement of phenotype seen in Bif1; bif2 double mutant plants
indicates that bif1 plays a redundant role with bif2 in the initiation of leaves during
vegetative development. Bif1 mutants have reduced levels of auxin transport implying
that the function of bif1 is in the regulation of auxin transport.
2.2 Materials and methods
2.2.1 Analysis of the mature inflorescence phenotype of Bif1
The Bif1-1440 allele was obtained from the Maize Genetics Coop Stock Center (stock #
827C) and backcrossed eight times into the B73 genetic background. Quantitative
analysis was performed on plants grown until maturity (9-10 weeks) in the field during
the summer in Rock Springs, PA. Data representative of one field season are presented.
For analysis of branch and spikelet number, 8-10 plants of each genetic class were
analyzed. For floret and floral organ number, 100 spikelets of each genetic class were
analyzed.
39
2.2.2 Double mutant analyses
All mutant stocks were backcrossed a minimum of five times to B73 before being used to
generate double mutants with Bif1. All double mutant families were grown in the field
during the summer in Rock Springs, PA. To reduce environmental effects, all families
were planted twice in different field locations and in two separate field seasons. Two to
three F2 families of 120 kernels were planted in each location. Data presented here are a
representative subset of the data collected during the 2007 field season. Chi squared
analysis failed to reject the null hypothesis for the expected number of plants in each
genotypic class (Table 2.1).
Bif1; ra1: The ra1-R allele was used to generate Bif1; ra1 double mutant
segregating families (Vollbrecht et al. 2005). At maturity Bif1; ra1 double mutants were
scored by tassel and ear phenotype. Inflorescence architecture of at least 10 plants of
each genetic class was analyzed. The number of primary and secondary tassel branches
and the total number of spikelets was counted. The spikelet number per branch at the
base of the tassel was also counted, as well as the number of spikelets in the top two cm
of the main spike.
Bif1; bif2: Families segregating Bif1; bif2 double mutants were generated using
the bif2-77 allele (McSteen et al. 2007). For genotyping, leaf tissue was collected from
two-week old plants into 96 well plates and ground using a Tissue Lyzer (Qiagen,
Valencia, CA). DNA was extracted according to a protocol modified for 96 well plate
format from (Chen and Dellaporta 1994) with the phenol chloroform extraction step
omitted. PCR was carried out to genotype the plants for the bif2-77 mutation using
40
primers bif2-57 (5’ CAG CCT GCC GCG CTG CTC CAG 3’) and bif2-250 (5’ CGG
CGC AGC AGC CTG AAG TCC 3’), which are designed to cross the site of the
insertion in this bif2 allele (McSteen et al. 2007). A second set of PCR reactions, using
primer bif2-57 with a primer located in the insertion (bif2-77, 5’ CAG TGG CGG TAG
AAA TTT G 3’) was used to confirm this result. Bif1/Bif1; bif2/bif2 plants were easily
identified as plants genotyped as homozygous for the bif2 mutation but which also had
extremely short stature and a severe tassel phenotype. Initial phenotype analysis revealed
an excess of plants with a Bif1/Bif1 homozygous phenotype. This excess was attributed
to Bif1/+; bif2/bif2 double mutants which resembled severe Bif1 homozygotes in
phenotype but were genotyped as homozygous for the bif2 mutation. Further
confirmation of this result was obtained by crossing Bif1/+; bif2/+ plants to +/+; bif2/+
plants and determining that 1/8 of the progeny resembled Bif1 homozygotes. At
maturity, plant height was measured on every plant from the ground to the tip of the
tassel. To count leaf number, every fifth leaf of each plant was clipped with pinking
shears, beginning at three weeks after emergence and at regular intervals throughout the
field season. This enabled us to obtain an accurate measure of total leaf number at the
end of the field season because if we had only counted at the end of the field season, we
would have missed the leaves that had senesced. Ten plants of each genetic class were
used for analysis of tassel branch number and spikelet number.
Bif1; ba1: The ba1-ref allele was used to generate Bif1; ba1 double mutant
segregating families (Gallavotti et al. 2004). Tissue was collected and DNA extracted as
described for the Bif1; bif2 plants. Plants were genotyped using primer ba04 (5’ TGG
CAT TGC ATG GAA GCG TGT ATG AGC 3’) located in the ba1 promoter and primer
41
ba05 (5’ TCC TAG ACA TGC ATA TCT GAA CCA GAG CT 3’) located in the helitron
in the ba1-ref allele, which amplified a product in ba1 heterozygous and homozygous
plants. A second PCR reaction with primer ba04 and ba07 (5’ GCT AAG CTA CTG
TAA GCG GGA TGG ACA 3’), amplified a product in wild type and heterozygous
plants. Bif1/Bif1; ba1/ba1 double mutants were classified as plants genotyped as
homozygous for ba1, but with a smooth, thin tassel rachis similar to Bif1 homozygotes.
Bif1/+; ba1/ba1 double mutants were classified as plants genotyped as homozygous for
ba1, which looked like ba1 but with a slightly smoother tassel rachis.
2.2.3 Statistical analysis
The computer program Minitab v.15 (State College, PA) was used to perform all
statistical analysis. Data sets were compared with two-sample two-tailed T-tests. Data
presented in bar charts are the mean value of the data, and all error bars show standard
error of the mean.
2.2.4 SEM, RNA in situ hybridization, histology
Tassels were obtained from families segregating for Bif1 grown in the greenhouse for
five weeks. The tassels were dissected and fixed on ice overnight in FAA (3.7%
formalin, 50% ethanol, 10% acetic acid) then dehydrated through an ethanol series. Ears
were obtained from Bif1 plants grown in the field for eight weeks. Ears were dissected
and fixed on ice overnight in 4% formaldehyde in phosphate-buffered saline. For
42
scanning electron microscopy (SEM), meristems were critical point dried (BAL-TEC
CPD 030, Techno Trade, Manchester, NH) and then mounted onto carbon stubs. The
samples were sputter coated with a 0.7 Ao layer of gold palladium (BAL-TEC SCD 050,
Techno Trade, Manchester, NH), and viewed by SEM (JSM 5400, JEOL, Peabody, MA)
using a 10 kv accelerating voltage.
For sectioning, samples were embedded in paraffin wax (Paraplast Plus,
McCormick Scientific LLC, St. Louis, MO). Sections 8 µm thick were cut using a
Finnesse paraffin microtome (Thermo Fisher, Waltham, MA), and mounted onto coated
slides (Probe-On Plus, Fisher Scientific, Waltham, MA).
For RNA in situ hybridization, the slides were probed with DIG-labeled RNA
antisense probe of kn1 according to (Jackson et al. 1994). For histology, the slides were
dewaxed using histoclear (National Diagnostics, Atlanta, GA), hydrated through an
ethanol series, stained in 0.05 % Toluidine Blue O (TBO) for 30 seconds, dehydrated,
and mounted with a coverslip using Histomount (Thermo-Shandon, Pittsburgh, PA). All
slides were viewed under bright field with an Eclipse 80i upright microscope (Nikon,
Melvill, NY) and photographed with a DXM1200F digital camera (Nikon, Melvill, NY).
2.2.5 Expression analysis
Total RNA was isolated from 5-6 week old tassels (5-7 mm) and 8 week old ears (20-22
mm) from Bif1 homozygotes and normal siblings, using the Nucleospin RNA Plant kit
following the manufacturer’s protocol (Macherey-Nagel, Durel, Germany). One tassel or
ear (approximately 8-12 milligrams fresh weight) was used per RNA extraction, with
43
three biological replicates of each sample type. 200 ng of RNA from each sample was
DNase treated using the DNase I kit (Ambion, Austin, TX) to remove genomic DNA
contamination.
Reverse transcription was carried out using the ABI High Capacity RT kit
(Applied Biosystems, Foster City, CA), with incubation at 25° C for 10 minutes and then
37° C for 2 hours. Real-time RT-PCR primers and 5' FAM (Carboxyfluorescein) and 3'
BHQ1 (Black Hole Quencher) labeled Taqman® probes (Biosearch Technologies,
Novato, CA) were designed using Primer Express version 2.0 software (Applied
Biosystems, Foster City, CA). 5ul of cDNA was used as template for real-time RT-PCR
reactions using TaqMan 2X Universal Mix (Applied Biosystems, Foster City, CA) except
that Betaine (Sigma, St Louis, MO) was added to a final concentration of 0.5M in the bif2
reactions. RT-PCR reactions were carried out in 96 well plates using an ABI 7300 real-
time PCR machine (Applied Biosytems, Foster City, CA).
For detection of bif2 expression, the Taqman® probe was (FAM-5’ CTC CGC
CAC CGC ATG CCC 3’-BHQ) and the RT-PCR primers were bif2F (5’ CTG CGT CGT
CAC GGA GTT C 3’) and bif2R (5’ TGC CCA TCA TGT GCA GGT ACT 3’).
For detection of ba1 expression, the Taqman® probe was (FAM-5’ ACG CGG
CTT CCC CAT CAT CCA 3’-BHQ) and the RT-PCR primers were ba1F (5’ TGG ATC
CAT ATC ACT ACC AAA CCA 3’) and ba1R (5’ ACC GGG TGC TGG AGG TAA G
3’).
The control for normalization was ubiquitin: Taqman® probe was (5' FAM-AAA
TCC ACC CGT CGG CAC CTC C-3' BHQ) and RT-PCR primers were ubqF (5’ CTC
TTT CCC CAA CCT CGT GTT 3’) and ubqR (5’ACG AGC GGC GTA CCT TGA 3’).
44
Three technical replicates of each real-time PCR reaction were performed on three
biological replicates for each experiment and the entire experiment was repeated twice.
Normalized relative expression levels were determined using the comparative threshold
method (Livak and Schmittgen 2001).
2.2.6 Auxin transport assays
Auxin transport assays were performed using a method modified from (Okada et al.
1991) and (McSteen et al. 2007). Immature ear inflorescences were dissected from plants
grown in the field for eight weeks. The immature ears ranged from two to three cm in
size. At this stage of development, the inflorescence meristem was still initiating SPMs
at the tip and floral organs were being produced at the base. Two cm of the tip of the ear
was placed in either orientation into 2 ml tubes containing 100 µl 1.5 µM 3-[5(n)-3H]
indole acetic acid (specific activity 25Ci/mmol, GE Healthcare, Piscataway, NJ) in 0.5 X
Murashige and Skoog medium (Sigma, St. Louis, MO). Some tubes also contained 20
µM N-1-naphthylphthalamic acid (Chemservice, West Chester, PA). After 24 hours
incubation in the dark, the immature ear pieces were blotted and 5 mm from the end that
was not immersed in solution was placed in scintillation fluid (Ready safe, Beckman
Coulter, Fullerton, CA) and counted in a liquid scintillation counter (LSC6000, Beckman
Coulter, Fullerton, CA). For the initial experiment on normal ears, three ears were used
for each treatment and the experiment was repeated three times. For the experiment on
Bif1 mutants, three ears from each genotypic class were used and the experiment was
repeated four times. Data that are representative of one experiment are presented.
45
2.3 Results
The Bif1 mutation was recovered from an EMS mutagenesis experiment (Neuffer and
Sheridan 1977) and was mapped to chromosome eight using genetic and cytogenetic
tools (www.maizegdb.org). Using SSR markers, we fine mapped Bif1 to between idp98
and umc1360 in bin 8.02. Bif1 is a semi-dominant mutation with the homozygote having
a more severe phenotype than the heterozygote. The Bif1 mutation confers the phenotype
of fewer branches and spikelets in the tassel and fewer kernels in the ear but the
phenotype had not previously been analyzed in detail (Coe et al. 1988; Sheridan 1988;
Veit et al. 1993; Neuffer et al. 1997; McSteen et al. 2000).
2.3.1 Bif1 mutants produce fewer branches and spikelets
Bif1 mutant tassels had a sparse appearance with fewer branches and spikelets compared
to normal siblings (Figure 2.1 A). The tassels of plants that were homozygous for Bif1
were more strongly affected than heterozygotes (Figure 2.1 A). Plants heterozygous for
Bif1 produced ears with irregular rowing due to the reduced number of kernels and the tip
was barren (Figure 2.1 B). Plants homozygous for Bif1 produced ears with very few
kernels, such that bare rachis was visible (Figure 2.1 B).
Quantitative analysis of the mature Bif1 tassel showed that Bif1 mutants fail to
produce the full complement of tassel branches (Figure 2.1 C). Analysis of spikelet
number showed a statistically significant reduction in spikelet number in plants
heterozygous and homozygous for Bif1 (Figure 2.1 D). In plants homozygous for Bif1,
spikelets that formed were sometimes produced singly instead of in pairs (Figure 2.1 E).
46
The reduced number of branches and spikelets produced suggests that the initiation or
maintenance of primary axillary meristems, the BM and SPM, are defective in Bif1
inflorescences.
2.3.2 Bif1 mutants fail to initiate SPMs
The phenotype of the mature Bif1 inflorescence suggested that there were defects in the
early stages of inflorescence development. To test this, scanning electron microscopy
(SEM) was used to visualize the developing inflorescence. By five weeks of growth,
normal inflorescences had initiated several lateral branches, with SPMs visible as regular
bumps on the flanks of both the main spike and the branches (Figure 2.2 A). At the same
stage of development, plants heterozygous for Bif1 had a reduced number of SPMs
(Figure 2.2 B). Plants homozygous for Bif1 had a more severe phenotype with very few,
or in some cases, no SPMs (Figure 2.2 C). The barren surface of the rachis was very
slightly ridged (Figure 2.2 C). The Bif1 homozygous ear had a similar phenotype as the
tassel with few SPM initiated (Figure 2.2 E). Unlike the tassel, the ear inflorescence
meristem was fasciated (Figure 2.2 E).
To determine if there was any histological evidence of SPM formation, we used
Toluidine Blue O (TBO) to stain sections of developing Bif1 inflorescences. As
meristematic cells have smaller vacuoles than differentiated cells, SPMs stain more
intensely with TBO than surrounding tissue. In normal inflorescences, developing SPMs
were visible as regular groups of densely staining cells on the flanks of the inflorescence
(Figure 2.3 A). In Bif/+ plants, SPMs visible on the flanks of the inflorescence looked
47
similar to normal except there were fewer of them (Figure 2.3 B). Bif1 homozygotes
mostly did not produce SPMs (Figure 2.3 C). Instead, the surface of barren regions of the
inflorescence occasionally had very slightly raised protrusions which were less intensely
stained than SPMs, indicating that the slight ridges visible by SEM consist of
differentiated tissue (Figure 2.3 C).
To determine if there was any molecular evidence of SPM formation, RNA in situ
hybridization with kn1 was used as a marker to identify meristematic tissues. kn1 is
expressed in meristems, where it is required for meristem maintenance, and is not
expressed as organ primordia differentiate (Jackson et al. 1994; Kerstetter et al. 1997;
Vollbrecht et al. 2000). In normal plants, kn1 expression was clearly visible in the
inflorescence meristem and in the vasculature and stem (Figure 2.3 D). kn1 was not
expressed on the flanks of the inflorescence meristem, as bract primordia (whose
subsequent growth is suppressed) initiate (labeled BR in Figure 2.3 D). However, kn1
was strongly expressed in SPMs that form in the axils of bract primordia (Figure 2.3 D).
In Bif1 mutants, kn1 was expressed as normal in the inflorescence meristem, vasculature
and stem (Figure 2.3 E, F). In plants heterozygous for Bif1, areas with no kn1 expression
were interspersed with areas of kn1 expression as expected for the few SPMs that initiate
(Figure 2.3 E). In plants homozygous for Bif1, there was usually no evidence of SPM
formation on the flanks of the inflorescence meristem (Figure 2.3 F). As down regulation
of kn1 was visible on the flanks of the Bif1 inflorescence meristem (Figure 2.3 E, F), this
indicates that bract primordia are set aside in Bif1 mutants and that the occasional small
ridges visible in Bif1 mutants may be suppressed bract primordia. However, the in situs
48
with kn1 clearly show that SPMs do not form in the axils of the bract primordia in plants
homozygous for Bif1.
2.3.3 Bif1 mutants have defects in SM initiation rather than SPM determinacy
In normal plants, on the main spike and lateral branches, the SPMs produce a pair of
SMs. Bif1 mutants have a reduced number of spikelets, in large part due to the reduced
numbers of SPMs. When SPMs initiate in Bif1 mutants they often produce single instead
of paired spikelets (Figure 2.1 E). This indicates that Bif1 mutants have defects either in
SM initiation or SPM determinacy. To distinguish between these two possibilities, we
constructed double mutants between Bif1 and ramosa1 (ra1). ra1 encodes an EPF zinc
finger transcription factor which confers determinacy on the SPM (Vollbrecht et al.
2005). In ra1 mutants, SPMs lack determinacy and grow out to become long
indeterminate branches instead of producing determinate spikelet pairs (Gernart 1912;
Bommert et al. 2005). As a result, ra1 mutants produce additional long branches in both
the tassel and ear (Figure 2.4 A, B).
We found that even in the ra1 mutant background, Bif1 homozygotes were unable
to make additional long branches in the tassel (Figure 2.4 A). The Bif1/Bif1; ra1/ra1
double mutant had a barren tassel phenotype similar to Bif1 (Figure 2.4 A). Quantitative
analysis showed that total branch number and spikelet number were not statistically
different between Bif1/Bif1; ra1/ra1 and Bif1/Bif1 (branch number: P-value = 0.054,
spikelet number: P-value = 0.192, Figure 2.4 F, G). Therefore, when no SPMs were
produced in Bif1 homozygotes, ra1 could not act on them. On the other hand, in the
49
Bif1/Bif1; ra1/ra1 ear, several branches grew out from the rachis (Fig. 4B, close up
shown in Figure 2.4 E). It appeared that when SPMs initiated in the Bif1/Bif1; ra1/ra1
ear, they converted to branches due to the absence of ra1 (Figure 2.4 B, E). Hence, the
Bif1 mutant does not have defects in SPM determinacy once SPMs have initiated.
Further insight was obtained by characterizing Bif1/+; ra1/ra1 double mutants.
The tassel of Bif1/+; ra1/ra1 double mutants had more long branches and spikelets than
Bif1/+ (Figure 2.4 A). Quantitative analysis showed that there was a significant increase
in branch number in Bif1/+; ra1/ra1 compared to Bif1/+ (P-value < 0.001, Figure 2.4 F).
This suggests that when SPMs initiated, they grew out to become lateral branches.
However, the branches on Bif1/+; ra1/ra1 were more barren than typical ra1 branches
and did not have a statistically different number of spikelets compared to Bif1/+ plants
(P-value = 0.94, Figure 2.4 G, H, I). Similarly, the Bif1/+; ra1/ra1 ear was more highly
branched than the Bif1/Bif1; ra1/ra1 ear but few spikelets were produced on the branches
(Figure 2.4 B; close up of a individual branch shown in Figure 2.4 D). These results
indicate that Bif1 mutants have defects in the initiation of secondary axillary meristems,
SMs, rather than defects in the determinacy of primary axillary meristems, SPMs.
2.3.4 Spikelet and floral meristems are defective in Bif1 mutants
Dissection of the few spikelets produced in Bif1 mutant plants indicated that Bif1
spikelets had fewer florets than normal and the florets had fewer floral organs. In order
to quantify these defects, 100 spikelets were dissected from both Bif1 heterozygous and
50
homozygous plants and the number of florets and floral organs determined relative to
normal sibs.
In normal plants, each spikelet bears a pair of florets (Figure 2.5 A). In Bif1
heterozygous plants, only 64% of spikelets produced two florets (Figure 2.5 A), while in
Bif1 homozygotes only 3% of spikelets produced two florets (Figure 2.5 A). These
results indicate that in Bif1 mutants, SMs are defective as they are unable to initiate the
normal number of tertiary axillary meristems, FMs.
Normal tassels produce florets that contain a lemma, palea, two lodicules and
three stamens. Quantitative analysis indicated that in Bif1 mutants, the florets had fewer
floral organs than normal with the homozygote being more severely affected than the
heterozygote (Figure 2.5 B, C). The number of lemma and palea were reduced in Bif1
mutants with 87% of spikelets from Bif1 heterozygotes and 56% of spikelets from Bif1
homozygotes producing both organs (Figure 2.5 B). Lodicules were not counted as their
small size and transparency made them difficult to count with accuracy under a dissecting
microscope. Stamen number was reduced in Bif1 mutants with only 29% of Bif1/+
florets and 12% of Bif1/Bif1 florets containing the normal three stamens (Figure 2.5 C).
Interestingly, a small percentage of Bif1 mutant florets contained four stamens, indicating
that floral organ number could be increased as well as decreased. The failure to initiate
the normal number of floral organs indicates that FMs are also defective in Bif1 mutants.
51
2.3.5 Expression studies show that bif2 and ba1 are expressed at a lower level in Bif1 mutants
Like Bif1, bif2 and ba1 mutants are also defective in the initiation of all types of axillary
meristems in the inflorescence (McSteen and Hake 2001; Ritter et al. 2002). To
determine whether the Bif1 mutation affected the expression of bif2 or ba1, real time RT-
PCR experiments were performed. bif2 and ba1 are both expressed in tassels and ears in
normal plants (Gallavotti et al. 2004; McSteen et al. 2007). bif2 is expressed in axillary
meristems, lateral organs and vasculature while ba1 has a more restricted expression
pattern during axillary meristem initiation (Gallavotti et al. 2004; McSteen et al. 2007).
RNA was isolated from immature tassels and ears of plants homozygous for Bif1 and
from normal siblings. Real time RT-PCR experiments indicated that both bif2 and ba1
RNA levels were reduced in tassels and ears of plants homozygous for Bif1 (Figure 2.6
A-D). bif2 levels were reduced to 36-62% of normal levels in tassel and ears respectively
(Figure 2.6 A,B), some of which could be explained by the reduction in the number of
BMs, SPMs, SMs, FMs and floral organs in Bif1 mutants. On the other hand, ba1 levels
were dramatically reduced to 4-13% of normal levels (Figure 2.6 C, D). Considering that
ba1 is expressed in a very restricted pattern as axillary meristems initiate, these results
provide further support that the Bif1 mutation affects early stages of axillary meristem
initiation.
52
2.3.6 Double mutant analysis indicates that bif1 and bif2 play a role in vegetative development
bif2 mutants have a phenotype very similar to that of Bif1 homozygotes, with very few
tassel branches and spikelets (McSteen and Hake 2001; McSteen et al. 2007). To
determine the genetic interaction between Bif1 and bif2, double mutant lines were
constructed. Bif1; bif2 double mutant plants had very dramatic effects on both vegetative
and inflorescence development.
Inflorescence phenotype: The inflorescence phenotype of Bif1; bif2 double
mutants was more severe than either single mutant with no branches or spikelets
(Figure 2.7 A, B, C). Quantitative analysis showed that the absence of spikelets in
Bif1/Bif1; bif2/bif2 double mutants was a statistically significant reduction in spikelet
number compared to Bif1/Bif1 (P-value = 0.004) or bif2 single mutants (P-value =0.001,
Figure 2.7 C). Furthermore, genetic and molecular analyses indicated that plants that
were heterozygous for Bif1 and homozygous for bif2 resembled Bif1 homozygotes
(Figure 2.7 A, B, C). These results suggest that bif1 and bif2 play redundant roles in
branch and spikelet initiation in the inflorescence.
Vegetative phenotype: Bif1; bif2 double mutant plants were less than half the
height of normal plants (Figure 2.7 D, E). To determine if the reduction in plant height
was due to a difference in the number of phytomers produced, the number of leaves were
counted (Figure 2.7 F). Both Bif1 and bif2 (McSteen et al. 2007) have a minor effect on
leaf number on their own, with a small but statistically significant reduction in the
number of leaves compared to normal siblings (P-value=0.001, Figure 2.7 F). However,
the Bif1/Bif1; bif2/bif2 double mutant had a non-additive effect with a large and
53
significant reduction in leaf number compared to either Bif1/Bif1 (P-value <0.001) or
bif2/bif2 (P-value = 0.001) single mutants. The dramatic effect on leaf number in the
Bif1; bif2 double mutant implies that bif1 and bif2 also play redundant roles in the
production of leaves by the vegetative shoot apical meristem.
2.3.7 Double mutant analysis indicates that Bif1 is epistatic to ba1 in the tassel
The barren stalk1 (ba1) mutant is deficient in both vegetative and inflorescence axillary
meristem initiation, and as a result lacks tillers and ears, as well as branches and spikelets
in the tassel (Ritter et al. 2002; Gallavotti et al. 2004). Although epistasis is challenging
to determine when mutants have a similar phenotype, Bif1 mutants can be distinguished
from ba1 mutants by the appearance of the inflorescence stem (rachis). Bif1 mutants
have a smooth thin rachis, while ba1 mutants have a thick rachis with very regular
pronounced protrusions due to the production of larger than normal suppressed bract
primordia (Ritter et al. 2002). Bif1/+; ba1/ba1 double mutants resembled ba1 single
mutants, however the surface of the rachis was slightly smoother than usually observed in
ba1 tassels (Figure 2.8 A). Bif1/Bif1; ba1/ba1 double mutants resembled Bif1
homozygotes with a smooth thin tassel rachis. As the Bif1/Bif1; ba1/ba1 double mutant
abolished the regular protrusions normally seen in ba1 mutants, this indicates that Bif1 is
epistatic to ba1 in the tassel. The inflorescence phenotype of the double mutant was not
enhanced with respect to spikelet number which was not unexpected as ba1 mutants
typically do not produce any spikelets (Figure 2.8 B). Similarly, the double mutant did
not produce any ears (Figure 2.8 C). Moreover, this analysis also showed that the Bif1
54
mutants alone did not have any defects in the production of ears (Figure 2.8 C). Unlike
the interaction between Bif1 and bif2, there was no enhancement of the vegetative defects
of Bif1 by ba1 (data not shown), indicating that ba1 does not play a redundant role in leaf
initiation during vegetative development.
2.3.8 Bif1 mutants have a reduced level of auxin transport
As Bif1 mutants had such a dramatic interaction with bif2, which plays a role in auxin
transport, we tested whether Bif1 mutants also have defects in auxin transport. bif2
mutants have a reduced level of auxin transport in the mature inflorescence stem of the
tassel (McSteen et al. 2007). Preliminary experiments showed that Bif1 mutants similarly
had reduced transport in the mature tassel inflorescence stem (data not shown).
However, both Bif1 and bif2 mutants have reduced vasculature in the mature
inflorescence stem ((McSteen et al. 2007) and data not shown). Bif1 mutants also have a
reduction in vasculature in the immature tassel inflorescence early in development
(Figure 2.10 A, B, C). However, Bif1 mutants do not have significant reduction in
vasculature in the developing ear inflorescence (Figure 2.10 D, E, F). Therefore, to
determine if Bif1 mutants had defects in auxin transport early in development, we
developed a protocol to measure auxin transport within the ear inflorescence.
Immature ear inflorescences up to two cm in length were incubated overnight in
either orientation in a solution of 1.5 µM 3H labeled IAA. Wild type ears showed an
appreciable level of basipetal transport which was inhibited by co-incubation with 20 µM
N-1-naphthylphthalamic acid (NPA), a frequently used auxin transport inhibitor
55
(Figure 2.9 A, lane 1 and 2). However, acropetal transport was very low at this point in
development (Figure 2.9 A, lane 3 and 4).
To test whether Bif1 ear inflorescences had a reduced level of auxin transport,
basipetal transport was measured in plants that were heterozygous or homozygous for
Bif1 compared to normal siblings (Figure 2.9 B). Plants that were heterozygous for Bif1
had approximately 1/3 the level of transport as normal siblings (Figure 2.9, lane 3), and
these levels were further reduced by co-incubation with 20 µM NPA (Figure 2.9 B, lane
4). Homozygous Bif1 ears had an ever further reduction in active auxin transport
(Figure 2.9 B, lane 5), which was not significantly different from normal siblings treated
with NPA (P-value = 0.75). Therefore, Bif1 mutants have a reduced level of auxin
transport indicating that the primary defect in Bif1 mutants may be in the regulation of
auxin transport.
2.4 Discussion
We have identified a new player in the pathway for axillary meristem initiation during
maize inflorescence development. Bif1 mutants have a very similar phenotype to bif2
mutants with defects in the initiation of all axillary meristems in the inflorescence. The
synergistic interaction of Bif1 with bif2 indicates that bif1 acts redundantly with bif2
during both vegetative and inflorescence development. We propose that the defects in
Bif1 mutants are caused by a reduction in auxin transport and that the function of bif1 is
to regulate auxin transport.
56
2.4.1 bif1 plays a role in axillary meristem initiation
Plants that are homozygous for Bif1 have a very similar phenotype to bif2 mutants
(McSteen and Hake 2001). Similarities with bif2 mutants include a reduction in the
number of branches, spikelets, florets and floral organs in the tassel and a reduction in
kernel number in the ear. Moreover, Bif1 mutants produce single instead of paired
spikelets which is also characteristic of bif2 mutants. The tassel and ear rachis is smooth
with occasional irregular ridges, similar to bif2. In addition, the apical ear inflorescence
meristem can be fasciated, similar to bif2.
Characterization of the developing inflorescence by SEM analysis, histology and
kn1 expression shows that there is a specific defect in axillary meristem initiation in Bif1
mutants. We propose that bif1 plays a role in axillary meristem initiation in the
inflorescence. All axillary meristems in the inflorescence - BM, SPM, SM and FM – are
affected in the mutants. However, unlike bif2, Bif1 mutants do not have defects in the
initiation of the axillary meristem that gives rise to the ear shoot. Ears are produced in
Bif1 mutants as normal and there is no enhancement of the ear number defects in Bif1;
bif2 double mutants (data not shown). Moreover, unlike bif2, double mutant analysis
with teosinte branched1 (tb1), (Doebley et al. 1997; Hubbard et al. 2002; McSteen et al.
2007), shows that the Bif1 mutation does not have a major effect on vegetative axillary
meristem (tiller) production (data not shown). Therefore, one of the few differences
between Bif1 and bif2 mutations is the extent of their effect on tiller and ear production.
During vegetative development, Bif1 mutants have a small but significant
reduction in the number of leaves resulting in a concomitant reduction in plant height.
57
bif2 mutants also have a minor effect on the initiation of leaves during vegetative
development (McSteen et al. 2007). The dramatic effect of the Bif1; bif2 double mutant
on vegetative development indicates that bif1 and bif2 play redundant roles in the
production of leaves by the vegetative apical meristem. Therefore, our analysis shows
that in addition to the role of bif1 and bif2 in initiation of axillary meristems during
inflorescence development, bif1 and bif2 also play overlapping roles in the production of
lateral organs during vegetative development.
2.4.2 Role of bif1 in auxin transport
Gradients of auxin are required for polar growth in plants (Benkova et al. 2003; Heisler et
al. 2005). In pinformed1 (pin1) and pinoid (pid) mutants in Arabidopsis, a reduction in
auxin transport abolishes the initiation of axillary meristems leading to a “pin”
inflorescence phenotype analogous to the barren inflorescence phenotype in maize
(Okada et al. 1991; Bennett et al. 1995; Galweiler et al. 1998; Reinhardt et al. 2003).
Double mutants in members of the YUCCA gene family, required for auxin biosynthesis,
also cause a pin inflorescence phenotype (Cheng et al. 2006). However, either loss or
gain of function of the transcription factor MONOPTEROS leads to a pin inflorescence
phenotype, illustrating that loss or gain of auxin signaling abolishes axillary meristem
initiation (Przemeck et al. 1996; Hardtke et al. 2004). Therefore, defects in auxin
biosynthesis, transport or response lead to a failure to initiate axillary meristems in the
inflorescence in Arabidopsis (Cheng et al. 2007).
58
We propose that bif1 acts together with bif2 in the control of auxin transport in the
maize inflorescence. Many of the phenotypes seen in Bif1 and bif2 mutants are also seen
in plants treated with auxin transport inhibitors (Wu and McSteen 2007). For example,
the failure to initiate axillary meristems in the inflorescence, single spikelets, reduced
vasculature and fewer leaves are also seen in plants that have been treated with polar
auxin transport inhibitors (Scanlon 2003; Wu and McSteen 2007). Therefore, we tested
the levels of auxin transport in the inflorescence of Bif1 mutants and found auxin
transport to be reduced, implying that bif1 plays a role in auxin transport.
The Bif1 mutation is semi-dominant so it could be either a dominant loss of
function (eg: antimorph or hypomorph) or dominant gain of function (eg: hypermorph or
neomorph) mutation. It was not possible to use dosage analysis to determine whether
Bif1 is a loss or gain of function mutation as Bif1 is not uncovered by the known
translocation lines on chromosome eight. However, as the Bif1 mutation causes a
reduction of auxin transport, we can conclude that the bif1 gene is either a positive or a
negative regulator of auxin transport.
2.4.3 Genetic interaction between Bif1 and other barren inflorescence mutations
To determine the genetic interaction between Bif1 and previously known barren
inflorescence mutations we performed double mutant and expression analyses. We infer
that bif1 acts upstream of ba1 as the Bif1; ba1 double mutant resembled Bif1 in the tassel.
In addition, the levels of ba1 expression were dramatically reduced in Bif1 mutants.
Further support for this hypothesis is provided by the proposal that ba1 acts downstream
59
of auxin transport (Wu and McSteen 2007). The ba1 mutant produces bracts in a very
regular pattern indicating that phyllotaxis is not disrupted in the mutant and that auxin
transport is normal (Ritter et al. 2002). Furthermore, ba1 is not expressed after treatment
with auxin transport inhibitors, indicating that ba1 expression depends on auxin transport
(Wu and McSteen 2007). We propose that ba1, being a transcription factor, is required
for the response to the auxin signal for axillary meristem initiation. We propose that bif1
acts upstream of auxin transport and hence is upstream of ba1.
Expression analysis shows that bif2 levels are somewhat reduced in Bif1 mutants.
Some of the reduction in bif2 expression could be explained by the absence of structures
that express bif2, or this result could imply that Bif1 acts upstream of bif2. However, the
synergistic effect observed in Bif1; bif2 double mutants implies that bif1 and bif2 have
overlapping functions. Both mutants have a very similar phenotype but the double
mutant is much more severe than either single mutant indicating that bif1 and bif2 may
play redundant roles in vegetative and inflorescence development. The dosage effect of
the Bif1; bif2 interaction further supports that they impact the same process. From the
results of the double mutant and expression analyses, together with previous results, we
propose that bif1 and bif2 both act upstream of auxin transport.
To determine the molecular mechanism by which bif1 regulates auxin transport,
future work will identify the bif1 gene by map based cloning. With the sequencing of the
maize genome and the availability of genome sequence of related grasses, chromosome
walking is now routine in maize (Salvi et al. 2002; Wang et al. 2005; Alleman et al. 2006;
Bortiri et al. 2006; Bortiri et al. 2006; Satoh-Nagasawa et al. 2006; Taramino et al. 2007).
Many regulators of auxin transport have been identified in other species, however, only
60
pin and pid mutants have a pin inflorescence phenotype (Brown et al. 2001; Gil et al.
2001; Noh et al. 2001; Geisler et al. 2003; Geldner et al. 2003; Multani et al. 2003;
Bennett et al. 2006; Sieburth et al. 2006). The closest maize homologs of pin and pid do
not map to Bif1 indicating that the bif1 gene possibly may be a novel regulator of auxin
transport in the inflorescence.
61
(A) Mature tassels of normal, Bif1/+ and Bif1/Bif1 plants. In the normal tassel, long branches are
indicated at the base of the main spike. Spikelet pairs cover the branches and the main spike. In
the Bif1 mutants, there are reduced numbers of branches and spikelets in the tassel. (B) Mature
ears of normal, Bif1/+ and Bif1/Bif1 plants, showing fewer kernels and disorganized rows in Bif1
mutants. (C) Quantification of tassel branch number. (D) Quantification of tassel spikelet
number. (E) Percentage of spikelets that occur singly versus paired. Bars represent mean value
and error bars represent standard error of the mean.
Figure 2.1: Mature inflorescence phenotype of the Bif1 mutant.
62
(A) Normal tassel, showing files of developing spikelet pair meristems (SPMs) on the flanks of
the inflorescence meristem (IM). (B) Bif1/+ tassel, with reduced numbers of SPMs. (C)
Bif1/Bif1 tassel with few SPMs. (D) Normal ear, showing organized rows of SPM. (E)
Bif1/Bif1 ear, with a fasciated inflorescence meristem and few SPM. Scale bar = 100µm.
Figure 2.2: Scanning Electron Microscopy (SEM) images of developing Bif1 inflorescences.
63
(A - C) Longitudinal sections of 5 week old tassels stained with TBO, with SPMs visible as areas
of intense staining. (A) Three developing SPM on the flanks of the inflorescence meristem in a
normal tassel. (B) Bif1/+, showing a single SPM in the same area as there are three SPMs in
normal. (C) Bif1/Bif1 with a slight protrusion on the surface of the rachis but no evidence of
developing SPM. (D - F) RNA in situ hybridization with kn1. (D) Meristematic cells and
vasculature are indicated by kn1 expression in normal tassels. The absence of kn1 on the flanks
of the inflorescence meristem (IM) indicates the formation of the suppressed bract primordia
(BR) that subtend SPMs. (E) Bif1/+ inflorescences have fewer areas of kn1 expression on the
flanks of the inflorescence. (F) Bif1/Bif1 inflorescence with kn1 expression only in the
inflorescence meristem and in the vasculature. Scale bar = 100µm.
Figure 2.3: Histology and RNA in situ hybridization with kn1 in developing Bif1 tassels.
64
(A) Mature tassel phenotype showing all genetic classes from a segregating Bif1; ra1 family. (B)
Ear phenotype of a segregating Bif1; ra1 family. (C - E) Higher magnification images showing
individual branches from ears. (C) Branch from a ra1/ra1 ear. (D) Branch from a Bif1/+;
ra1/ra1 ear. (E) Bif1/Bif1; ra1/ra1 ear. (F - I) Quantitative analysis of Bif1; ra1 double mutants.
For all charts, bars represent mean value of data set, and error bars represent standard error of the
mean. (F) Average number of branches per tassel. (G) Average number of spikelets per tassel.
(H) Average number of spikelets per branch, measured on a branch at the base of the tassel.
(I) Average number of spikelets in the top two cm of the tassel main spike.
Figure 2.4: Analysis of Bif1; ra1 double mutants.
65
(A) Percentage of spikelets containing 2, 1 or 0 florets per spikelet. (B) Quantification of lemma
and palea number per floret. (C) Percentage of florets containing the indicated number of
stamens per floret.
Figure 2.5: Quantification of floret and floral organ numbers in Bif1 mutants.
66
(A) Expression level of bif2 in the immature tassel of Bif1 mutants relative to normal siblings.
(B) Expression level of bif2 in the immature ears of Bif1 mutants relative to normal siblings.
(C) Expression level of ba1 in the immature tassel of Bif1 mutants relative to normal siblings.
(D) Expression level of ba1 in the immature ears of Bif1 mutants relative to normal siblings.
Mean plus or minus s.e.m. is shown for one representative experiment using three biological and
three technical replicates for each sample.
Figure 2.6: Real time RT-PCR analysis of the expression of bif2 and ba1 in Bif1 mutants.
67
(A) Mature tassel phenotype of a Bif1; bif2 segregating family. (B, C) Quantification of tassel
characteristics in a Bif1; bif2 segregating family. (B) Average tassel branch number.
(C) Average spikelet number per tassel. (D) Vegetative phenotype of Bif1; bif2 family showing
reduced plant height in Bif1; bif2 double mutants. (E - F) Quantification of vegetative
phenotypes. (E) Average plant height in cm. (F) Average leaf number.
Figure 2.7: Analysis of Bif1; bif2 double mutants.
68
(A) Mature tassel phenotype of Bif1; ba1 family. (B) Average number of spikelets per tassel.
(C) Average number of ears per plant.
Figure 2.8: Analysis of Bif1; ba1 double mutants.
69
Dark grey is without NPA, light gray is with NPA. (A) Measurement of basipetal (lane 1, 2) and
acropetal (lane 3, 4) transport in normal ears. (B) Measurement of basipetal transport in
immature ears of a family segregating for Bif1. Lane 1, 2 is normal siblings, Lane 3, 4 is Bif1/+
and Lane 5, 6 is Bif1/Bif1.
Figure 2.9: Measurement of auxin transport in normal and Bif1 inflorescences.
70
(A - C) Transverse sections of five week old tassels stained with TBO. Arrow head indicates
main spike. (A) Normal, (B) Bif1/+, (C) Bif1/Bif1. (D - F) Transverse sections of eight week
old ears stained with TBO. (D) Normal, (E) Bif1/+, (F) Bif1/Bif1. Scale bar = 100µm.
Figure 2.10: Histological analysis of vasculature in cross sections of developing Bif1
inflorescences.
71
Table 2.1: Chi-square analysis of double mutant segregation Genotype Expected ratio Expected number (E) Observed number (O) Deviation (D-E) Deviation2/E
Bif1; ra1*
+/+; +/+ 3 37.5 42 4.5 0.54
Bif1/+ 6 75 68 -7 0.63
Bif1/Bif1 3 37.5 40 -2.5 0.16
ra1 1 12.5 13 0.5 0.02
Bif1/+; ra1 2 25 22 -3 0.36
Bif1/Bif1; ra1 1 12.5 15 2.5 0.5
Total 200 200 2.24
Bif1; bif2†
+/+; +/+ 3 24.19 30 5.81 1.4
Bif1/+ 6 48.38 52 3.63 0.27
Bif1/Bif1 3 24.19 24 -0.19 0.00
bif2 1 8.06 10 1.94 0.47
Bif1/+; bif2 2 16.13 8 -8.13 4.09
Bif1/Bif1; bif2 1 8.06 5 -3.06 1.16
Total 129 129 7.39
Bif1; ba1†
+/+; +/+ 3 18.75 23 4.25 0.96
Bif1/+ 6 37.5 29 -8.5 1.93
Bif1/Bif1 3 18.75 14 -4.75 1.20
ba1 1 6.25 10 3.75 2.25
Bif1/+; ba1 2 12.5 14 1.5 0.18
Bif1/Bif1; ba1 1 6.25 10 3.75 2.25
Total 100 100 8.77
* df = 5, 0.9 < P < 0.5
† df = 5, 0.2 < P < 0.05
72
2.5 References
Alleman, M., L. Sidorenko, K. McGinnis, V. Seshadri, J. Dorweiler, J. White, K. Sikkink
and V. L. Chandler (2006). "An RNA-dependent RNA polymerase required for
paramutation in maize." Nature 442: 292-298.
Benjamins, R., A. Quint, D. Weijers, P. Hooykaas and R. Offringa (2001). "The PINOID
protein kinase regulates organ development in Arabidopsis by enhancing polar
auxin transport." Development 128(20): 4057-4067.
Benkova, E., M. Michniewicz, M. Sauer, T. Teichmann, D. Seifertova, G. Jurgens and J.
Friml (2003). "Local, efflux-dependent auxin gradients as a common module for
plant organ formation." Cell 115(5): 591-602.
Bennett, S. R. M., J. Alvarez, G. Bossinger and D. R. Smyth (1995). "Morphogenesis in
pinoid mutants of Arabidopsis thaliana." Plant Journal 8(4): 505-520.
Bennett, T., T. Sieberer, B. Willett, J. Booker, C. Luschnig and O. Leyser (2006). "The
Arabidopsis MAX pathway controls shoot branching by regulating auxin
transport." Current Biology 16: 553-563.
Bommert, P., C. Lunde, J. Nardmann, E. Vollbrecht, M. Running, D. Jackson, S. Hake
and W. Werr (2005). "thick tassel dwarf1 encodes a putative maize ortholog of
the Arabidopsis CLAVATA1 leucine-rich repeat-like kinase." Development
132(6): 1235-1245.
Bommert, P., N. Satoh-Nagasawa, D. Jackson and H. Y. Hirano (2005). "Genetics and
evolution of inflorescence and flower development in grasses." Plant and Cell
Physiology 46(1): 69-78.
Bortiri, E., G. Chuck, E. Vollbrecht, T. Rocheford, R. Martienssen and S. Hake (2006).
"The ramosa2 LATERAL ORGAN BOUNDARY protein that determines the fate
of stem cells in branch meristems of maize." Plant Cell 18(574-585).
73
Bortiri, E. and S. Hake (2007). "Flowering and determinacy in maize." Journal of
Experimental Botany 58: 909-916.
Bortiri, E., D. Jackson and S. Hake (2006). "Advances in maize genomics: the emergence
of positional cloning." Current Opinion in Plant Biology 9: 164-171.
Brown, D. E., A. M. Rashotte, A. S. Murphy, J. Normanly, B. W. Tague, W. A. Peer, L.
Taiz and G. K. Muday (2001). "Flavonoids act as negative regulators of auxin
transport in vivo in Arabidopsis." Plant Physiology 126(2): 524-535.
Chen, J. and S. L. Dellaporta (1994). Urea based plant DNA miniprep. The Maize
Handbook. M. Freeling and V. Walbot. New York, Springer-Verlag: 526-527.
Cheng, P. C., R. I. Greyson and D. B. Walden (1983). "Organ initiation and the
development of unisexual flowers in the tassel and ear of Zea Mays." American
Journal of Botany 70(3): 450-462.
Cheng, Y. F., X. H. Dai and Y. Zhao (2007). "Auxin synthesized by the YUCCA flavin
monooxygenases is essential for embryogenesis and leaf formation in
Arabidopsis." Plant Cell 19(8): 2430-2439.
Cheng, Y. F., X. H. Dai and Y. D. Zhao (2006). "Auxin biosynthesis by the YUCCA
flavin monooxygenases controls the formation of floral organs and vascular
tissues in Arabidopsis." Genes & Development 20(13): 1790-1799.
Christensen, S. K., N. Dagenais, J. Chory and D. Weigel (2000). "Regulation of auxin
response by the protein kinase PINOID." Cell 100(4): 469-478.
Clifford, H. T. (1987). Spikelet and floral morphology. Grass Systematics and Evolution.
T. R. Soderstrom, K. W. Hilu, C. S. Campbell and M. E. Barkworth. Washington,
D.C., Smithsonion Institution Press: 21-30.
74
Coe, E. H., M. G. Neuffer and D. A. Hoisington (1988). The Genetics of Corn. Corn and
Corn Improvement. G. F. Sprague and J. W. Dudley. Madison, Wisconsin, ASA-
CSSA-SSSA. 18: 81-258.
Doebley, J., A. Stec and L. Hubbard (1997). "The evolution of apical dominance in
maize." Nature 386(6624): 485-488.
Gallavotti, A., Q. Zhao, J. Kyozuka, R. B. Meeley, M. K. Ritter, J. F. Doebley, M. E. Pe
and R. J. Schmidt (2004). "The role of barren stalk1 in the architecture of maize."
Nature 432: 630-635.
Galweiler, L., C. H. Guan, A. Muller, E. Wisman, K. Mendgen, A. Yephremov and K.
Palme (1998). "Regulation of polar auxin transport by AtPIN1 in Arabidopsis
vascular tissue." Science 282(5397): 2226-2230.
Geisler, M., H. U. Kolukisaoglu, R. Bouchard, K. Billion, J. Berger, B. Saal, N. Frangne,
Z. Koncz-Kálmán, C. Koncz, R. Dudler, J. J. Blakeslee, A. Murphy, E. Martinoia
and L. Schulz (2003). "TWISTED DWARF1, a unique plasma membrane-
anchored immunophilin-like protein, interacts with Arabidopsis multidrug-
resistance-like transporters AtPGP and AtPGP19." Molecular Biology of the Cell
14(10): 4238-4249.
Geldner, N., N. Anders, H. Wolters, J. Keicher, W. Kornberger, P. Muller, A. Delbarre,
T. Ueda, A. Nakano and G. Jurgens (2003). "The Arabidopsis GNOM ARF-GEF
mediates endosomal recycling, auxin transport, and auxin-dependent plant
growth." Cell 112(2): 219-230.
Gernart, W. (1912). "A new subspecies of Zea Mays L." American Naturalist 46: 616-
622.
Gil, P., E. Dewey, J. Friml, Y. Zhao, K. C. Snowden, J. Putterill, K. Palme, M. Estelle
and J. Chory (2001). "BIG: a calossin-like protein required for polar auxin
transport in Arabidopsis." Genes & Development 15(15): 1985-1997.
75
Hardtke, C. S., W. Ckurshumova, D. P. Vidaurre, S. A. Singh, G. Stamatiou, S. B.
Tiwari, G. Hagen, T. Guilfoyle and T. Berleth (2004). "Overlapping and non-
redundant functions of the Arabidopsis auxin response factors MONOPTEROUS
and NONPHOTOTROPIC HYPOCOTYL 4." Development 131(1089-1100).
Heisler, M. G., C. Ohno, P. Das, P. Sieber, G. V. Reddy, J. Long and E. M. Meyerowitz
(2005). "Patterns of auxin transport and gene expression during primordium
development revealed by live imaging of the Arabidopsis inflorescence
meristem." Current Biology 15: 1899-1911.
Hubbard, L., P. McSteen, J. Doebley and S. Hake (2002). "Expression patterns and
mutant phenotype of teosinte branched1 correlate with growth suppression in
maize and teosinte." Genetics 162(4): 1927-1935.
Irish, E. E. (1996). "Regulation of sex determination in maize." Bioessays 18(5): 363-
369.
Irish, E. E. (1997). "Class II tassel seed mutations provide evidence for multiple types of
inflorescence meristems in maize (Poaceae)." American Journal of Botany
84(11): 1502-1515.
Jackson, D., B. Veit and S. Hake (1994). "Expression of maize knotted1 related
homeobox genes in the shoot apical meristem predicts patterns of morphogenesis
in the vegetative shoot." Development 120(2): 405-413.
Kellogg, E. (2007). "Floral displays: genetic control of grass inflorescences." Current
Opinion in Plant Biology 10: 26-31.
Kellogg, E. A. (2000). "The grasses: A case study in macroevolution." Annual Review of
Ecology and Systematics 31: 217-238.
76
Kerstetter, R. A., D. LaudenciaChingcuanco, L. G. Smith and S. Hake (1997). "Loss-of-
function mutations in the maize homeobox gene, knotted1, are defective in shoot
meristem maintenance." Development 124(16): 3045-3054.
Lee, S. H. and H. T. Cho (2006). "PINOID positively regulates auxin efflux in
Arabidopsis root hair cells and tobacco cells." Plant Cell 18(1604-1616).
Livak, K. J. and T. D. Schmittgen (2001). "Analysis of relative gene expression data
using real-time quantitative PCR and the 2T-ΔΔC method." Methods 35: 402-408.
McSteen, P. (2006). "Branching out: The ramosa pathway and the evolution of grass
inflorescence morphology." Plant Cell 18(3): 518-522.
McSteen, P. and S. Hake (1998). "Genetic control of plant development." Current
Opinion in Biotechnology 9(2): 189-195.
McSteen, P. and S. Hake (2001). "barren inflorescence2 regulates axillary meristem
development in the maize inflorescence." Development 128(15): 2881-2891.
McSteen, P., D. Laudencia-Chingcuanco and J. Colasanti (2000). "A floret by any other
name: control of meristem identity in maize." Trends in Plant Science 5(2): 61-66.
McSteen, P. and O. Leyser (2005). "Shoot branching." Annual Review of Plant Biology
56: 353-374.
McSteen, P., S. Malcomber, A. Skirpan, C. Lunde, X. Wu, E. Kellogg and S. Hake
(2007). "barren inflorescence2 encodes a co-ortholog of the PINOID
serine/threonine kinase and is required for organogenesis during inflorescence and
vegetative development in maize." Plant Physiology 144: 1000-1011.
Multani, D. S., S. P. Briggs, M. A. Chamberlin, J. J. Blakeslee, A. S. Murphy and G. S.
Johal (2003). "Loss of an MDR transporter in compact stalks of maize br2 and
sorghum dw3 mutants." Science 302(5642): 81-84.
77
Neuffer, M. G., E. H. Coe and S. Wessler (1997). The Mutants of Maize. Plainview, NY,
Cold Spring Harbor Laboratory Press.
Neuffer, M. G. and K. A. Sheridan (1977). "Dominant mutants from EMS treated
pollen." Maize Newsletter 51: 59-60.
Noh, B., A. S. Murphy and E. P. Spalding (2001). "Multidrug resistance-like genes of
Arabidopsis required for auxin transport and auxin-mediated development." Plant
Cell 13(11): 2441-2454.
Okada, K., J. Ueda, M. K. Komaki, C. J. Bell and Y. Shimura (1991). "Requirement of
the auxin polar transport system in early stages of Arabidopsis floral bud
formation." Plant Cell 3(7): 677-684.
Przemeck, G. K. H., J. Mattsson, C. S. Hardtke, Z. R. Sung and T. Berleth (1996).
"Studies on the role of the Arabidopsis gene MONOPTEROS in vascular
development and plant cell axialization." Planta 200(2): 229-237.
Reinhardt, D., T. Mandel and C. Kuhlemeier (2000). "Auxin regulates the initiation and
radial position of plant lateral organs." Plant Cell 12(4): 507-518.
Reinhardt, D., E. R. Pesce, P. Stieger, T. Mandel, K. Baltensperger, M. Bennett, J. Traas,
J. Friml and C. Kuhlemeier (2003). "Regulation of phyllotaxis by polar auxin
transport." Nature 426(6964): 255-260.
Ritter, M. K., C. M. Padilla and R. J. Schmidt (2002). "The maize mutant barren stalk1 is
defective in axillary meristem development." American Journal of Botany 89(2):
203-210.
Salvi, S., R. Tuberosa, E. Chiapparino, M. Maccaferri, S. Veillet, L. van Beuningen, P.
Isaac, K. Edwards and R. L. Phillips (2002). "Toward positional cloning of Vgt1,
a QTL controlling the transition from the vegetative to the reproduction phase in
maize." Plant Molecular Biology 48: 601-613.
78
Satoh-Nagasawa, N., N. Nagasawa, S. Malcomber, H. Sakai and D. Jackson (2006). "A
trehalose metabolic enzyme controls inflorescence architecture in maize." Nature
441(7090): 227-230.
Scanlon, M. J. (2003). "The polar auxin transport inhibitor N-1-naphthylphthalamic acid
disrupts leaf initiation, KNOX protein regulation, and formation of leaf margins
in maize." Plant Physiology 133(2): 597-605.
Sheridan, W. F. (1988). "Maize developmental genetics: Genes of morphogenesis."
Annual Review of Genetics 22: 353-385.
Sieburth, L. E., G. Muday, E. J. King, G. Benton, S. Kim, K. Metcalf, L. Meyers, E.
Seamen and J. M. Van Norman (2006). "SCARFACE encodes an ARF-GAP that
is required for normal auxin efflux and vein patterning in Arabidopsis." Plant Cell
18: 1396-1411.
Steeves, T. and I. Sussex (1989). Patterns in plant development. Cambridge, UK,
Cambridge University Press.
Taramino, G., M. Sauer, J. L. Stauffer, D. S. Multani, X. Niu, H. Sakai and F.
Hochholdinger (2007). "The maize (Zea Mays L.) RTCS gene encodes a LOB
domain protein that is a key regulator of embryonic seminal and post-embryonic
shoot-borne root initiation." The Plant Journal 50: 649-659.
Veit, B. (2006). "Stem cell signaling networks in plants." Plant Molecular Biology 60:
793-810.
Veit, B., R. J. Schmidt, S. Hake and M. F. Yanofsky (1993). "Maize Floral Development
- New Genes and Old Mutants." Plant Cell 5(10): 1205-1215.
Vernoux, T., J. Kronenberger, O. Grandjean, P. Laufs and J. Traas (2000). "PIN-
FORMED 1 regulates cell fate at the periphery of the shoot apical meristem."
Development 127(23): 5157-5165.
79
Vollbrecht, E., L. Reiser and S. Hake (2000). "Shoot meristem size is dependent on
inbred background and presence of the maize homeobox gene, knotted1."
Development 127(14): 3161-3172.
Vollbrecht, E., P. S. Springer, L. Goh, E. S. Buckler and R. Martienssen (2005).
"Architecture of floral branch systems in maize and related species." Nature 436:
1119-1126.
Wang, H., T. Nussbaum-Wagler, B. L. Li, Q. Zhao, Y. Vigouroux, M. Faller, K.
Bomblies, L. Lukens and J. F. Doebley (2005). "The origin of the naked grains of
maize." Nature 436(7051): 714-719.
Wu, X. and P. McSteen (2007). "The role of auxin transport during inflorescence
development in Maize (Zea Mays, Poaceae)." American Journal of Botany
94(11): 1745-1755.
CHAPTER 3
sparse inflorescence1 encodes a monocot specific YUCCA-like
gene required for vegetative and reproductive development in
maize
This chapter was published in Proceedings of the National Academy of Science (2008):
179: 389-401.
Solmaz Barazesh completed the phenotypic characterization work and double mutant
analysis, contributed to the cloning (Figure 3.1, Figure 3.5, Figure 3.6, Table 3.1 and
Table 3.2), and wrote the first draft of the paper.
Andrea Gallavotti completed the cloning of spi1, expression analysis and localization of
ZmPIN1a in spi1 (Figure 3.2, Figure 3.7, Figure 3.3, Figure 3.5).
Simon Malcomber completed phylogenetic analysis (Figure 3.4).
81
3.1 Introduction
The plant hormone auxin is required for initiation and polar growth of all organ
primordia. Auxin is synthesized by a number of pathways in the cell and is transported
from cell to cell by diffusion and by the activity of influx and efflux carriers (Delker et al.
2008). During vegetative development, auxin is required for many developmental
processes, including leaf and lateral root initiation, whereas during inflorescence
development, auxin is required for the initiation of floral meristems and floral organs
(Okada et al. 1991; Reinhardt et al. 2000; Benkova et al. 2003; Reinhardt et al. 2003).
Extensive research in Arabidopsis has shown the importance of auxin transport during
lateral organ and axillary meristem initiation (Okada et al. 1991; Reinhardt et al. 2000;
Reinhardt et al. 2003). In addition, recent work has highlighted the role of localized auxin
biosynthesis in all aspects of plant development (Zhao et al. 2001; Cheng et al. 2006;
Cheng et al. 2007; Stepanova et al. 2008; Tao et al. 2008). The role of auxin in monocots
such as maize is not as well understood. Although some aspects of the control of auxin
transport appear to be conserved between monocots and eudicots (Scanlon 2003; Xu et al.
2005; McSteen et al. 2007; Morita and Kyouzuka 2007; Wu and McSteen 2007;
Gallavotti et al. 2008), there are also key differences (Skirpan et al. 2008).
Maize plants produce separate male and female inflorescences (McSteen et al.
2000). The male inflorescence, the tassel, is situated at the shoot apex, while the female
inflorescence, the ear, is produced from an axillary meristem several nodes below the
tassel. The tassel consists of a main spike with several long lateral branches at the base
(Figure 3.1A, B). Both the main spike and branches are covered with short branches, each
82
of which bears a pair of spikelets. Each spikelet produces two leaf-like glumes that
enclose a pair of florets. Florets consist of a lemma and palea (outer whorl structures
derived from bracts or sepals), two lodicules (derived from petals) and three stamens in
the tassel or a central carpel in the ear. Early development of both tassel and ear is similar
and selective abortion of organs later in development causes the production of unisexual
inflorescences (Irish 1996).
Four types of axillary meristem produce the branched male inflorescence (Irish
1997). The first is the branch meristem (BM), which is indeterminate and produces the
long branches at the base of the tassel (Figure 3.1A). Several long branches are produced
before the determinate spikelet pair meristems (SPM) are formed. SPMs produce short
branches bearing the spikelet pairs. Spikelets are produced from spikelet meristems (SM),
which then transition to floral meristems (FM), which give rise to florets and floral
organs. The female inflorescence develops similarly except it does not produce BMs.
Genes required for the initiation of axillary meristems in maize have been
identified by characterization of two mutants with a barren phenotype, barren stalk1
(ba1) and barren inflorescence2 (bif2) (McSteen and Hake 2001; Ritter et al. 2002;
Gallavotti et al. 2004; McSteen et al. 2007). bif2 encodes a serine/threonine protein
kinase co-orthologous to PINOID (PID), which functions in the regulation of polar auxin
transport in Arabidopsis (Christensen et al. 2000; Benjamins et al. 2001; Friml et al.
2004; Lee and Cho 2006; McSteen et al. 2007; Michniewicz et al. 2007). bif2 mutants
have a reduced number of branches, spikelets, florets and floral organs in both tassel and
ear (McSteen and Hake 2001). Double mutants between bif2 and teosinte branched1
(tb1), a mutation that causes the outgrowth of vegetative axillary meristems, show that
83
bif2 also plays a role in initiation of axillary meristems during vegetative development
(Doebley et al. 1997; McSteen et al. 2007). In addition, bif2 has vegetative phenotypes
such as a reduction in plant stature and leaf number (McSteen et al. 2007). These
phenotypes and the bif2 expression pattern indicate that bif2 plays a role in both lateral
organ and axillary meristem initiation. BIF2 interacts with and phosphorylates BA1,
which encodes a basic helix-loop-helix transcription factor required for axillary meristem
initiation (Gallavotti et al. 2004; Skirpan et al. 2008).
To further understand the mechanisms regulating axillary meristem initiation, we
isolated and characterized a novel barren mutant, sparse inflorescence1 (spi1), with
defects in the formation of branches, spikelets, florets and floral organs. spi1 encodes a
flavin monooxygenase with similarity to the YUCCA (YUC) genes of Arabidopsis, which
catalyze the rate limiting step in one of the tryptophan dependent auxin biosynthetic
pathways (Zhao et al. 2001). Unlike Arabidopsis, where knockouts of at least two YUC
genes are required to see developmental defects (Cheng et al. 2006; Cheng et al. 2007),
single spi1 loss of function mutants have a dramatic phenotype, with a significant
reduction in the number of axillary meristems and lateral organs. Phylogenetic analyses
suggest that this could be explained by a specific inflorescence development function
acquired by spi1, together with the independent expansion of the YUC family in
monocots and eudicots. In addition, double mutants between spi1 and bif2 have a
synergistic interaction that demonstrates the role of spi1 and bif2 in vegetative
development. These findings emphasize the importance of both auxin biosynthesis and
auxin transport during lateral organ and axillary meristem initiation in maize.
84
3.2 Results and Discussion
3.2.1 spi1 mutants have defects during vegetative and reproductive development
spi1 tassels have fewer branches and spikelets, and spi1 ears are small, with fewer kernels
(Figure 3.1 B, C). Quantitative analysis of the mature tassel phenotype showed that spi1
mutants have a reduction in branch and spikelet number, suggesting a defect in BM and
SPM initiation (Table 3.1). We used scanning electron microscopy (SEM) of immature
tassel and ear to determine if the reduction in BMs and SPMs in spi1 inflorescences were
the result of a failure to initiate these meristems or a failure to maintain their growth. In
wild type maize plants, BMs and SPMs were visible on the flanks of the inflorescence
(Figure 3.1 D). In contrast, the surface of the spi1 mutant tassel was smooth, with very
few SPMs (Figure 3.1 E). Similarly, in the ear, a reduction in the number of SPMs was
clearly visible (Figure 3.1 H). This analysis shows that the reduction in branch and
spikelet number is caused by the failure to produce both BMs and SPMs.
Analysis of the mature tassel phenotype also revealed that spi1 tassels were
reduced to about three quarters of the length of normal tassels (Figure 3.1 B, data not
shown) and mature ears displayed a similar reduction in size (Figure 3.1 C). To
investigate the cause of the defect in the inflorescence meristem, we performed SEM
analysis on later stages of tassel development. Analysis of spi1 mutants showed that,
unlike normal, SPMs grew over the tip of the inflorescence (arrowhead, Figure 3.1 F).
The growth of spikelets over the inflorescence tip was also observed in the ear
85
(arrowheads, Figure 3.1 C, H), showing that spi1 inflorescences have additional defects
in the apical inflorescence late in development.
Spikelet and floral meristem initiation was also defective in spi1 mutants. Only
about half of spi1 spikelets produced the normal two florets per spikelet whereas the
remaining spikelets contained one or no florets (Table 3.2). The number of floral organs
was also reduced, with most spi1 florets producing less than the full complement of
stamens (Table 3.2). This indicates that SMs and FMs are also defective in spi1 mutants
and thus all four types of reproductive axillary meristems are affected in spi1 mutants.
To determine if spi1 also functioned in axillary meristem initiation during
vegetative development, we constructed double mutants between spi1 and tb1 (Figure 3.6
A). The tb1 mutant has a highly branched phenotype because all normally quiescent
vegetative axillary meristems elongate to produce branches called tillers (Doebley et al.
1997). spi1; tb1 double mutants produced fewer tillers compared to tb1 single mutants
(Figure 3.6 B), indicating that spi1 also plays a role in axillary meristem initiation during
vegetative development.
3.2.2 spi1 encodes a YUCCA-like flavin monooxygenase
The spi1-01-008-16 mutant, generated by EMS mutagenesis, was initially mapped to
chromosome 3 by linkage to the SSR marker umc2008. By screening a mapping
population of 210 mutant individuals, spi1 was mapped to between markers
AZM5_96828 (2 recombinants (R)/420 chromosomes) and umc1320 (7R/420). A
syntenic region in both rice and sorghum was identified, and markers were developed for
86
the corresponding maize genes (Figure 3.2 A). These markers were used to delimit the
spi1 locus to a region on FPC contig 147 between markers MAGIv4_42118 (1R/420) and
AZM5_96828. Analysis of the region in rice and sorghum identified several candidate
genes, including a predicted flavin monooxygenase with similarity to the Arabidopsis
YUC genes (Zhao et al. 2001), which was found to be closely linked to the spi1 locus
(0R/420). The sequence of the corresponding maize YUC gene was obtained by database
search and RT-PCR. This gene was sequenced in the spi1-01-008-16 allele and a point
mutation was identified in the highly conserved Flavin Adenine Dinucleotide (FAD)
binding domain, causing a glycine to arginine change that was not present in the
progenitor (Figure 3.2 B). Sequencing of three additional spi1 alleles identified two in-
frame deletions in conserved regions of spi1 (spi1-E914 and spi1-ref) and an insertion of
a Mutator transposable element in the 5’ untranslated region (spi1-125) (Figure 3.2 B,
Figure 3.7). These lesions in four independent spi1 alleles show unequivocally that the
spi1 gene encodes a YUC-like flavin monooxygenase.
3.2.3 spi1 expression is localized in proximity to newly emerging primordia and axillary meristems
spi1 expression was detected by RT-PCR in all tissues tested except root and endosperm
(Figure 3.3 A). In order to investigate the localization of spi1 expression during
inflorescence development, RNA in situ hybridization was performed on immature tassel
and ear. Early in development, spi1 expression was first observed on the flanks of the
inflorescence, presumably marking the newly forming SPMs (arrowhead, Figure 3.3 B).
Subsequently, this expression was retained on the adaxial side of emerging SPMs
87
(Figure 3.3 C). spi1 was also expressed in SPMs in the process of forming SMs
(Figure 3.3 D). In SMs, spi1 became localized to just a few cells adaxial to where the
lower FM will develop (Figure 3.3 E). As floral organs initiated, spi1 was expressed in a
small group of cells proximal to the developing floral organs (Figure 3.3 F). The domain
of spi1 expression was consistently limited to the two outermost meristem layers. In
summary, spi1 was transiently expressed in a few cells proximal to newly emerging
axillary meristems and lateral primordia at each stage of inflorescence development.
Expression analysis of Arabidopsis and Petunia YUC-like genes also revealed distinct
temporal and spatial expression patterns during inflorescence and flower development
(Tobena-Santamaria et al. 2002; Cheng et al. 2006; Cheng et al. 2007). These
observations suggest that localized auxin biosynthesis is required for normal axillary
meristem and lateral organ initiation during maize inflorescence development.
3.2.4 Phylogenetic analysis shows that spi1 is a member of a monocot specific clade of YUC-like genes
Bayesian phylogenetic analyses of 62 land plant YUC-like genes, rooted using two fungal
sequences, estimates a well supported (>95% clade credibility [CC]) monocot clade
comprising the grass species Zea Mays spi1, Oryza sativa YUC1 (OsYUC1; Os1g064540/
Os1g45760), Sorghum bicolor Sb03g029440 and Joinvillea ascendens JaSPI1, an
immediate relative of grasses (Figure 3.4). The spi1 clade is sister to a well-supported
clade containing two lineages of grass YUC-like genes including OsYUC4 and OsYUC5
(Yamamoto et al. 2007). The phylogeny estimates that the spi1, OsYUC4 and OsYUC5
clades are products of duplications within monocots and have no clear co-ortholog in
88
eudicots. The spi1/OsYUC4/OsYUC5 clade is sister to a clade containing both monocot
and eudicot sequences, including Arabidopsis AtYUC1, 2, 4 and 6, and the rice genes
OsYUC2 and OsYUC3 (Zhao et al. 2001; Cheng et al. 2006; Yamamoto et al. 2007).
Within this clade, AtYUC1 and YUC4 are nested within a well-supported eudicot clade,
with AtYUC4 co-orthologous to Petunia and tomato FLOOZY (PhFZY and ToFZY,
respectively) (Tobena-Santamaria et al. 2002; Exposito-Rodriguez et al. 2007). An
additional well-supported eudicot clade containing AtYUC3, 5, 7, 8 and 9 suggests that
AtYUC3 and 7, as well as AtYUC5, 8 and 9, are products of gene duplications since
poplar and Arabidopsis last shared a common ancestor. The clade containing the
previously characterized rice OsYUC8/NARROW LEAF7 (NAL7)/OsCONSTITUTIVELY
WILTED (OsCOW1) (Fujino et al. 2007; Woo et al. 2007) gene is sister to the clade
containing AtYUC1 to 9 and OsYUC1 to 7 and is estimated to have diverged from these
other eudicot and monocot genes near the base of the flowering plant clade. Based on the
position of the moss (Physcomitrella patens) sequences, the clade containing AtYUC1 to
9 and OsYUC1 to 8 originated within land plants, so spi1 last shared a common ancestor
with the AtYUC genes 125-450 MYA. AtYUC10 and 11, and OsYUC9 to 14 are more
distantly related to the other eudicot and monocot YUC genes, having diverged prior to
the origin of land plants.
Therefore, phylogenetic analysis reveals an ancient origin of YUC-like genes in
land plants with several lineage specific gene duplication events in monocots and
eudicots leading to a complex pattern of relationships. Maize spi1 is orthologous to rice
OsYUC1 and sorghum Sb03g029440 (based on both synteny and sequence) and
Joinvillea JaSPI1 (based on sequence) and is estimated to have originated from a gene
89
duplication event within the monocot clade. However, expression and functional analyses
reveal that the roles of OsYUC1 and spi1 in plant development have diverged. OsYUC1
expression is detected in all tissues, including roots by RT-PCR analysis (Yamamoto et
al. 2007). Within the inflorescence, OsYUC1 is localized in the vasculature rather than
axillary meristems using a GUS reporter assay (Yamamoto et al. 2007). In contrast, spi1
is expressed in most tissues except roots and endosperm, and within the inflorescence,
spi1 is expressed in axillary meristems and not in the vasculature. Furthermore, OsYUC1
knockdown mutants are dwarfed due to severe defects in both shoot and root elongation,
but no inflorescence phenotype was reported (Yamamoto et al. 2007). spi1 mutant plants
are slightly shorter than normal plants but the most distinctive phenotype is the defective
initiation of axillary meristems in the inflorescences. These data indicate that there has
been a change of OsYUC1/spi1 expression and function during the diversification of the
grass family.
The relationship of the grass spi1 clade to eudicots is complex due to the multiple
rounds of genome duplication in monocots and eudicots. Although not strongly supported
in our phylogenetic analysis (90% CC), the Bayesian consensus phylogram estimates a
sister relationship between the spi1/OsYUC1, OsYUC4 and OsYUC5 clade, and a clade
containing both eudicot AtYUC1, 2, 4, and 6 and monocot members OsYUC2 and 3. In
support of this relationship, Arabidopsis yuc1;yuc2;yuc4;yuc6 quadruple mutants and
Petunia fzy mutants have some phenotypes in common with maize spi1 mutants (Tobena-
Santamaria et al. 2002; Cheng et al. 2006). Additional Petunia sequences are not
available but the mutant phenotype suggests that FZY plays an important role in Petunia.
Furthermore, the phylogenetic and genetic analyses suggest that spi1 might be the
90
dominant gene regulating auxin biosynthesis in maize inflorescence development, with
the maize orthologs of OsYUC2 to 5 hypothesized to have largely redundant and reduced
roles during inflorescence development.
3.2.5 Interactions between spi1 and genes regulating auxin transport
bif2 mutants have a similar phenotype to spi1 mutants, with a reduced number of tassel
branches and spikelets due to defects in axillary meristem initiation (Figure 3.5 A)
(McSteen and Hake 2001). As bif2 encodes a PID-like serine/threonine kinase proposed
to play a role in auxin transport (Christensen et al. 2000; Benjamins et al. 2001; Friml et
al. 2004; Lee and Cho 2006; McSteen et al. 2007; Michniewicz et al. 2007) and spi1
encodes an enzyme that functions in auxin biosynthesis (Zhao et al. 2001; Cheng et al.
2006), we constructed spi1;bif2 double mutants to investigate the interaction between
these two pathways. spi1; bif2 double mutants displayed a synergistic phenotype, with
severe defects in both vegetative and reproductive development (Figure 3.5 A, B). spi1;
bif2 mutants produced a completely barren tassel, with no branches or spikelets
(Figure 3.5 A, Table 3.1). Whole plant architecture was dramatically affected (Figure 3.5
B). Although spi1 and bif2 single mutants had a slight reduction in plant height, spi1; bif2
double mutants were reduced to about half the height of normal plants (Table 3.1). To
determine if the reduction in height was due to a reduction in the number of phytomers
produced, we counted the number of leaves. spi1 and bif2 single mutants produced one or
two fewer leaves than normal, but spi1; bif2 mutants produced on average six leaves less
91
than their normal sibs (Table 3.1). Therefore, spi1 and bif2 (together with other factors)
regulate leaf production during vegetative development.
To further investigate the interaction between auxin biosynthesis and auxin
transport, we crossed the spi1 mutant with a ZmPIN1a-YFP maize reporter line
(Gallavotti et al. 2008). The Arabidopsis PIN family encodes auxin efflux carriers and
sub cellular polar localization of PIN is an indication of the direction of auxin flow
(Galweiler et al. 1998; Petrasek et al. 2006; Wisniewska et al. 2006). In normal plants,
confocal images of developing tassels showed that ZmPIN1a-YFP expression was up
regulated at the site of axillary meristem initiation (Figure 3.5 C) (Gallavotti et al. 2008).
In spi1 mutants, ZmPIN1a-YFP expression was absent where axillary meristems failed to
initiate (Figure 3.5 D). Therefore, these results confirm that spi1 mediated auxin
biosynthesis is required for up regulation of ZmPIN1a expression during axillary
meristem initiation in maize inflorescence development.
These results show there is an important interconnection between auxin
biosynthesis and auxin transport, with both being required for plant development.
Synergism between auxin biosynthesis and auxin transport has also been reported in
Arabidopsis (Cheng et al. 2007; Cheng and Zhao 2007). As auxin plays a role in
regulating its own efflux and expression of PIN is auxin induced, an intimate feedback
between auxin biosynthesis and transport is not unexpected (Paciorek et al. 2005; Vieten
et al. 2005). Our results show for the first time that localized endogenous auxin
biosynthesis is required for the proper up regulation of PIN1 to initiate a new axillary
meristem. This provides a mechanistic understanding for the synergistic interaction
92
between auxin biosynthesis and transport by proposing that localized auxin biosynthesis
plays a role in inducing or regulating auxin transport components.
3.3 Conclusions
The spi1 gene functions in the formation of axillary meristems and lateral organs
throughout maize vegetative and reproductive development. spi1 encodes a YUC-like
gene related to genes described in eudicots, but is a member of a monocot specific clade.
Expression and functional analysis indicates that diverse YUC-like genes play a role in
the initiation of axillary meristems and lateral organs in distantly related flowering plants
including maize, Petunia and Arabidopsis (Tobena-Santamaria et al. 2002; Cheng et al.
2006; Cheng et al. 2007).
There are also important differences in YUC function between monocots and
eudicots. For example, yuc double, triple and quadruple mutants in Arabidopsis and fzy
mutants in Petunia have a bushy phenotype due to reduced apical dominance (Tobena-
Santamaria et al. 2002; Cheng et al. 2006). However, spi1 mutants have the opposite
effect with fewer branches due to the role of spi1 in vegetative axillary meristems.
Another unique aspect of the spi1 phenotype is the production of spikelets over the tip of
the apex which implies that auxin biosynthesis plays a role in normal apical meristem
function. Other YUC-like genes play diverse roles in leaf, root and embryogenic
development (Cheng et al. 2007; Fujino et al. 2007; Woo et al. 2007). Therefore,
functional as well as phylogenetic analyses suggest that the YUC gene family has
expanded in both eudicots and monocots with extensive functional diversification in
93
different species. Furthermore, spi1 and its ortholog in rice, OsYUC1, have differences in
mutant phenotype and expression pattern (Yamamoto et al. 2007), indicating a significant
diversification of function even within the grass family. Our results show that spi1 has
evolved a very specific and localized role in auxin biosynthesis during maize
inflorescence and vegetative development, and suggest that even though the general
mechanisms of auxin biosynthesis and transport appear to be widely conserved, the YUC
gene family is capable of rapid functional divergence with the potential to generate novel
plant morphologies.
3.4 Materials and Methods
3.4.1 spi1 alleles
The spi1-ref allele was identified in a Mutator transposon mutagenesis screen. spi1-125
and spi1-E914 were obtained from the RescueMu population
(http://www.maizegdb.org/rescuemu-phenotype.php). spi1-01-008-16 was originally
identified as a double mutant with a weak allele of ramosa1 (ra1-RS) in an EMS
enhancer/suppressor screen (AG and RJS, unpublished). All phenotypic analysis was
performed with the spi1-ref backcrossed into the B73 background eight times.
94
3.4.2 SEM and histology
Tassels were dissected from plants grown in the greenhouse to 5-7 weeks old, and ears
were dissected from plants grown in the field to 8 weeks old. Fixation, SEM and
histology were performed as previously described (Chapter 2).
3.4.3 spi1 cloning
For positional cloning, an F2 mapping population was generated by crossing the spi1;
ra1-RS double mutant with the maize inbred line B73. The spi region was delimited by
screening 210 F2 homozygous mutants using SSR markers. Syntenic regions in rice and
sorghum were identified using rice (www.gramene.org) and sorghum
(www.phytozome.net) sequences. New maize markers were designed using genome
sequence information available at TIGR (http://maize.tigr.org) and at MAGI
(http://magi.plantgenomics.iastate.edu). PCR primers SPI1-F1/SPI1-R1 and SPI1-
F2/SPI1-R2 (Table 3.3) were used to amplify and sequence the YUC-like gene in the spi1
alleles. Sequencing of multiple inbred lines verified that the in-frame deletion mutations
(spi1-ref and spi1-E914) were not inbred polymorphisms.
3.4.4 Expression analysis
For RT-PCR, 5 individual samples were pooled for each tissue tested (embryo 20 DAP,
endosperm 20 DAP, root, seedling, immature leaves, immature tassels and ears). Total
RNA was extracted using Trizol (Invitrogen) and further purified using the RNeasy Plant
95
Mini kit (Qiagen). 1μg of RNA was treated with DNase (Promega) and 12ng of RNA
was used in one-step RT-PCR reactions (One-step RT-PCR kit, Invitrogen). spi1 was
amplified with primers SPI1-F3/SPI1-R2 for 40 cycles, and the ubiquitin control was
amplified for 30 cycles (Table 3.5). For RNA in situ hybridizations, a probe was
constructed containing part of the coding sequence at the 3’end of the gene and the
3’UTR, amplified with SPI1-F2/SPI1-R2 (Table 3.5). Tissue samples were fixed in FAA
(50% ethanol, 10% formaldehyde and 5% acetic acid) for 2 hours. Tissue preparation and
in situ hybridization was performed as previously described (Gallavotti et al. 2004).
3.4.5 spi1 phylogeny
Sixty-three YUC-like genes were identified from moss (Physcomitrella), eudicots
(Arabidopsis, grape, poplar and tomato), and monocots (maize, rice and sorghum) using
BLAST searches at NCBI (http://www.ncbi.nlm.nih.gov/), PlantGDB
(http://www.plantgdb.org) and CoGe (http://synteny.cnr.berkeley.edu/CoGe/). Joinvillea
SPI1 was isolated from young inflorescence cDNA using 3' RACE RT-PCR with YUC-
559F and poly-T+ adaptor primers (Table 3.5). Two fungal sequences (Debaryomyces
and Pichia) were used as outgroups. Nucleotide sequences were aligned based on the
conceptual amino acid translation using MacClade 4.0 (Maddison and Maddison 2003)
and ClustalX (Jeanmougin et al. 1998), before being adjusted manually using MacClade.
Bayesian phylogenetic analyses used MrBayes 3.1 (Huelsenbeck and Ronquist 2001) on
the Beowulf parallel processing cluster at the University of Missouri - St. Louis and
comprised two separate searches of 5 million generations using default flat priors and the
96
General Time Reversible model of evolution with gamma distributed rates and invariant
sites (GTR+I+G). The aligned matrix was partitioned according to codon position and
different parameters estimated for each partition. Trees were sampled every 200
generations and burn-in trees were determined empirically by plotting the likelihood
score against generation number and assessing parameter convergence. After burn-in
trees had been removed Clade Credibility (CC) values and the 95% set of credible trees
were estimated using MrBayes 3.1 (Huelsenbeck and Ronquist 2001).
3.4.6 spi1 double mutant analysis
To construct double mutants between spi1 and bif2, plants heterozygous for spi1-ref were
crossed by plants heterozygous for bif2-77 (McSteen et al. 2007) in B73 and selfed.
Segregation of phenotypic classes failed to be rejected by Chi-square tests (Table 3.4).
Plants were genotyped for the bif2-77 mutation as previously described ((Barazesh and
McSteen 2008)), and for the spi1-ref deletion with primers SPI1-GF and SPI1-GR (Table
3.5). To construct double mutants between spi1 and tb1, plants heterozygous for spi1-ref
were crossed by tb1-ref in B73 (Doebley et al. 1997). spi1; tb1 double mutants were
identified by tiller and tassel phenotype. Primary and secondary tiller number was
counted at maturity.
97
3.4.7 Confocal microscopy.
The spi1-01-008-16 mutant was crossed to the maize ZmPIN1a-YFP fluorescent marker
line (Gallavotti et al. 2008) and then selfed. Immature tassels (2-5mm) were dissected
and imaged as previously described (Gallavotti et al. 2008).
98
(A) Schematic of the different types of axillary meristem initiated during maize inflorescence
development (left) and the structures they produce (right). (B) Tassels of normal (left) and spi1
(right), showing reduced numbers of branches and spikelets in the spi1 mutant. (C) Ears of
normal and spi1, showing reduced kernel number as well as production of kernels over the tip
(arrowhead) of spi1 ears. (D-H) Scanning electron microscope images of developing spi1 tassels
and ears. (D) Normal tassel. (E) spi1 tassel showing fewer spikelet pair meristems. (F) Close-up
of tip of spi1 tassel later in development showing defective apical inflorescence meristem with
spikelet meristems initiating over the tip (arrowhead). (G) Normal ear. (H) spi1 ear showing
fewer spikelet pair meristems. The tip is fasciated and produces spikelet meristems (arrowhead).
Scale bars = 100µm.
Figure 3.1: Characterization of the spi1 inflorescence.
99
(A) Schematic representation of the positional cloning of the spi1 gene. Black bars represent
chromosomal segments of rice, sorghum and maize (not to scale). Predicted genes for both rice
and sorghum are indicated. In maize, the region encompasses two BAC contigs (FPC contigs 146
and 147). The number of recombinants (R) is shown below each maize marker. Empty rectangles
represent BAC clones and the filled rectangle indicates the BAC clone containing spi1. (B) spi1
gene structure. Exons are represented as rectangles, mRNA sequence is indicated between the
arrow and the vertical bar. The putative enzymatic sites of the YUC proteins are shown in grey.
Upward and downward triangles symbolize deletions and insertion, respectively, in the
corresponding spi1 mutant alleles.
Figure 3.2: Cloning of spi1.
100
(A) spi1 qualitative RT-PCR in different tissue samples. ubq, ubiquitin as control. (B-F) spi1
RNA in situ hybridization in young inflorescences. (B) spi1 expression marks the site of new
spikelet pair meristem formation (arrowhead). (C-D) Developing spikelet pair meristems. (E) A
spikelet meristem giving rise to the lower floral meristem (arrowhead). (F) Floral meristem
forming stamen primordia (arrowheads). Scale bars = 20μm.
Figure 3.3: spi1 expression analysis.
101
Bayesian consensus phylogram of 62 YUC-like genes from land plants rooted using two fungal
sequences (Debaryomyces DhCBS767 and Pichia PsCBS6054). Thick branches supported by >
0.95 CC. Fungi (red): SACC = Saccharomycetaceae; Moss (green): FUNA = Funariaceae;
Angiosperm-eudicot (black): BRAS = Brassicaceae, SALI = Salicaceae, SOLA = Solanaceae,
VITA = Vitaceae; Angiosperm-monocot (blue): JOIN = Joinvilleaceae, POAC = Poaceae. Maize
spi1 and orthologs in rice (OsYUC1), sorghum (Sb03g029440) and Joinvillea (JaSPI1) in bold.
Figure 3.4: Phylogenetic analysis of YUC-like genes from diverse land plants.
102
(A) Mature tassel phenotype showing all phenotypic classes in spi1;bif2 family. (B) Whole plant
phenotype of all phenotypic classes of spi1;bif2 family. (C-D) ZmPIN1a-YFP expression in
young tassels. (C) In normal plants, ZmPIN1a-YFP expression marks the emerging axillary
meristems (arrowheads). (D) In spi1 mutants, ZmPIN1a-YFP expression is absent on the flanks
of the inflorescence when axillary meristems do not form. Expression is detected when axillary
meristems have initiated (arrowhead). Scale bars = 50μm.
Figure 3.5: Interaction between spi1 and genes required for auxin transport.
103
(A) Whole plant phenotype shown in all phenotypic classes of the spi1;tb1 family.
(B) Quantification of both primary and secondary tiller number in spi1;tb1 family (n=100).
Figure 3.6: Analysis of spi1;tb1 double mutants.
104
Numbers are relative to the SPI1 protein sequence. The in-frame deletions of mutant
alleles spi1-E914 and spi1-ref are boxed; the site of the amino acid change in spi1-01-
008-16 allele is indicated by a black vertical line. A black horizontal line outlines the
FAD-binding domain. Dark grey is used for amino acid identity and light grey for
similarity.
Figure 3.7: Partial amino acid alignment of SPI1 and other previously characterized YUCCA-like
proteins.
105
Table 3.1: Quantification of spi1 and bif2 single and double mutant phenotypes
Genotype Branch number1 Spikelet number1 Plant height (cm)2 Leaf number2
Normal 9.5 ± 0.7 585 ± 10.5 177.2 ± 3.8 19.2± 0.2
spi1 4 ± 0.6a 66.3 ± 6.5a 160.8 ± 5.7a 17.9 ± 0.4a
bif2 0.4 ± 0.2a 25 ± 3.9a 154 ± 7.8a 17.2 ± 0.6a
spi1;bif2 0 ± 0b 0.12 ± 0.3b 92 ± 12.4b 13.4 ± 1b 1n=10 for each genotype, 2n=120 for the segregating family a= Indicates that value is significantly different from normal, p<0.05
b= Indicates that value is significantly different from either single mutant, p<0.05
106
Table 3.2: Quantification of floret and floral organ number in spi1 mutant spikelets
Genotype % of spikelets with
2 1 0
florets
% of florets with
2 1 0
lemma/palea
% of florets with
3 2 1 0
stamens
Normal 100 0 0 98 2 0 98 2 0 0
spi1 52 20 28 87 10 3 14 39 36 12 n=100 each
107
Table 3.3: List of markers developed for map based cloning of spi1.
MARKER PRIMER SEQUENCES POLYMORPHISM
MAGIv4_113454 For-GTGTTTGCTTCTGCTTTTCATAGG
Rev-CCCCCAAGTATAATTCTGTGGTTC
PCR-size difference
MAGIv4_42118
For-TGAGGAAACAGGAATTGACAGAAG
Rev-ATGATGCTGAAGTCGATGATGTG
AatII digest
MAGIv4_101701
For-GCACGAAGCAGAGGATTAGTTAGG
Rev-CTCCGTCTGCTTAAGCTTCGTC
PCR-size difference
AZM5_96828
For-GTTGATTTATTGGGGGAAAAACACATACTA
Rev-CGTGTATACATCGTTCCACGATATCATCT
AluI digest
108
Table 3.4: Chi-square analysis of double mutant segregation.
Genotype Expected ratio Expected Number (E) Observed Number (O) Deviation (D-E) Deviation2/E
spi1; bif2*
Normal 9 72.56 78 5.44 0.41
spi1 3 24.19 20 -4.19 0.72
bif2 3 24.19 21 -3.19 0.42
spi1; bif2 1 8.06 10 1.94 0.46
Total 129 129 2.02
spi1; tb1*
Normal 9 56.25 57 0.75 0.01
spi1 3 18.75 23 4.25 0.96
tb1 3 18.75 15 -3.75 0.75
spi1; tb1 1 6.25 5 -1.25 0.25
Total 100 100 1.97
* df = 3, 0.5 < P < 0.9
109
Table 3.5: Table of primers. PRIMER NAME PRIMER SEQUENCE
SPI1-F1 CTTTGGACCATTTAGCCACTAACC
SPI1-R1 CTAACCTTAATTTTGCCGGTTTTG
SPI1-F2 CCATCGAGCTGAAGAACCTCAC
SPI1-R2 ATATAACCACTTGCATCGGTTGTG
SPI1-F3 GTAGTGGGAGCAGTGAAGGAGGTGA
UBIQUITIN-F1 TAAGCTGCCGATGTGCCTGCGTCG
UBIQUITIN-R1 CTGAAAGACAGAACATAATGAGCACAG
SPI1-GF GCAAGGAGGAGCAGTTCGACGCAATC
SPI1-GR GTCCCCTAGCCCAGTCTTACGCAC
YUC-559F GTSGGVTGCGGSAAYTCYGGC
POLY-T+ CCGGATCCCTCTAGAGCGGCCGC T(17)V
110
3.5 References
Barazesh, S. and P. McSteen (2008). "Barren inflorescence1 functions in organogenesis
during vegetative and inflorescence development in maize." Genetics 179: 389–
401.
Benjamins, R., A. Quint, D. Weijers, P. Hooykaas and R. Offringa (2001). "The PINOID
protein kinase regulates organ development in Arabidopsis by enhancing polar
auxin transport." Development 128(20): 4057-4067.
Benkova, E., M. Michniewicz, M. Sauer, T. Teichmann, D. Seifertova, G. Jurgens and J.
Friml (2003). "Local, efflux-dependent auxin gradients as a common module for
plant organ formation." Cell 115(5): 591-602.
Cheng, Y., X. Dai and Y. Zhao (2007). "Auxin synthesized by the YUCCA flavin
monooxygenases is essential for embryogenesis and leaf formation in
Arabidopsis." Plant Cell 19: 2430-2439.
Cheng, Y. F., X. H. Dai and Y. Zhao (2007). "Auxin synthesized by the YUCCA flavin
monooxygenases is essential for embryogenesis and leaf formation in
Arabidopsis." Plant Cell 19(8): 2430-2439.
Cheng, Y. F., X. H. Dai and Y. D. Zhao (2006). "Auxin biosynthesis by the YUCCA
flavin monooxygenases controls the formation of floral organs and vascular
tissues in Arabidopsis." Genes & Development 20(13): 1790-1799.
Cheng, Y. F. and Y. D. Zhao (2007). "A role for auxin in flower development." Journal
of Integrative Plant Biology 49(1): 99-104.
111
Christensen, S. K., N. Dagenais, J. Chory and D. Weigel (2000). "Regulation of auxin
response by the protein kinase PINOID." Cell 100(4): 469-478.
Delker, C., A. Raschke and M. Quint (2008). "Auxin dynamics: the dazzling complexity
of a small molecule's message." Planta 227(5): 929-941.
Doebley, J., A. Stec and L. Hubbard (1997). "The evolution of apical dominance in
maize." Nature 386(6624): 485-488.
Exposito-Rodriguez, M., A. A. Borges, A. Borges-Perez, M. Hernandez and J. A. Perez
(2007). "Cloning and biochemical characterization of ToFZY, a tomato gene
encoding a flavin monoxygenase involved in a tryptophan-dependent auxin
biosynthesis pathway." Journal of Plant Growth Regulation 26: 329-340.
Friml, J., Y. Xiong, M. Michniewicz, D. Weijers, A. Quint, O. Tietz, R. Benjamins, P. B.
F. Ouwerkerk, K. Ljung, G. Sandberg, P. J. J. Hooykaas, K. Palme and R.
Offringa (2004). "A PINOID-Dependent Binary Swithch in Apical-Basal PIN
Polar Targeting Directs Auxin Efflux." Science 306: 862-865.
Fujino, K., Y. Matsuda, K. Ozawa, T. Nishimura, T. Koshiba, M. W. Fraaije and H.
Sekiguchi (2007). "NARROW LEAF 7 controls leaf shape mediated by auxin in
rice." Molecular Genetics and Genomics 279(5): 499-507.
Gallavotti, A., Y. Yang, R. J. Schmidt and D. Jackson (2008). "The relationship between
auxin transport and maize branching." Plant Physiology 147: 1913-1923.
Gallavotti, A., Q. Zhao, J. Kyozuka, R. B. Meeley, M. K. Ritter, J. F. Doebley, M. E. Pe
and R. J. Schmidt (2004). "The role of barren stalk1 in the architecture of maize."
Nature 432: 630-635.
112
Galweiler, L., C. H. Guan, A. Muller, E. Wisman, K. Mendgen, A. Yephremov and K.
Palme (1998). "Regulation of polar auxin transport by AtPIN1 in Arabidopsis
vascular tissue." Science 282(5397): 2226-2230.
Huelsenbeck, J. P. and F. Ronquist (2001). "MRBAYES: Bayesian inference of
phylogenetic trees." Bioinformatics 17(8): 754-755.
Irish, E. E. (1996). "Regulation of sex determination in maize." Bioessays 18(5): 363-
369.
Irish, E. E. (1997). "Class II tassel seed mutations provide evidence for multiple types of
inflorescence meristems in maize (Poaceae)." American Journal of Botany
84(11): 1502-1515.
Jeanmougin, F., J. D. Thompson, M. Gouy, D. G. Higgins and T. J. Gibson (1998).
"Multiple sequence alignment with ClustalX." Trends in Biochemical Sciences
23(403-405).
Lee, S. H. and H. T. Cho (2006). "PINOID positively regulates auxin efflux in
Arabidopsis root hair cells and tobacco cells." Plant Cell 18(1604-1616).
Maddison, D. R. and C. W. Maddison (2003). MacClade: Analysis of phylogeny and
character evolution. Sunderland, MA, Sinauer Associates.
McSteen, P. and S. Hake (2001). "barren inflorescence2 regulates axillary meristem
development in the maize inflorescence." Development 128(15): 2881-2891.
McSteen, P., D. Laudencia-Chingcuanco and J. Colasanti (2000). "A floret by any other
name: control of meristem identity in maize." Trends in Plant Science 5(2): 61-66.
113
McSteen, P., S. Malcomber, A. Skirpan, C. Lunde, X. Wu, E. Kellogg and S. Hake
(2007). "barren inflorescence2 encodes a co-ortholog of the PINOID
serine/threonine kinase and is required for organogenesis during inflorescence and
vegetative development in maize." Plant Physiology 144: 1000-1011.
Michniewicz, M., M. K. Zago, L. Abas, D. Weijers, A. Schweighofer, I. Meskiene, M. G.
Heisler, C. Ohno, J. Zhang, F. Huang, R. Schwab, D. Weigel, E. M. Meyerowitz,
C. Luschnig, R. Offringa and J. Friml (2007). "Antagonistic regulation of PIN
phosphorylation by PP2A and PINOID directs auxin flux." Cell 130(6): 1044-
1056.
Morita, Y. and J. Kyouzuka (2007). "Characterization of OsPID, the Rice Ortholog of
PINOID, and its possible involvement in the control of polar auxin transport."
Plant and Cell Physiology 144: 540-549.
Okada, K., J. Ueda, M. K. Komaki, C. J. Bell and Y. Shimura (1991). "Requirement of
the auxin polar transport system in early stages of Arabidopsis floral bud
formation." Plant Cell 3(7): 677-684.
Paciorek, T., E. Zazimalova, N. Ruthardt, J. Petrasek, Y. D. Stierhof, J. Kleine-Vehn, D.
A. Morris, N. Emans, G. Jurgens, N. Geldner and J. Friml (2005). "Auxin inhibits
endocytosis and promotes its own efflux from cells." Nature 435(30): 1251-1256.
Petrasek, J., J. Mravec, R. Bouchard, J. J. Blakeslee, M. Abas, D. Seifertova, J.
Wisniewska, Z. Tadele, M. Kubes, M. Covanova, P. Dhonukshe, P. Skupa, E.
Benkova, L. Perry, P. Krecek, O. R. Lee, G. R. Fink, M. Geisler, A. S. Murphy,
C. S. Luschnig, E. Zazimalova and J. Friml (2006). "PIN proteins Perform a Rate-
Limiting Function in Cellular Auxin Efflux." Sciencexpress.
114
Reinhardt, D., T. Mandel and C. Kuhlemeier (2000). "Auxin regulates the initiation and
radial position of plant lateral organs." Plant Cell 12(4): 507-518.
Reinhardt, D., E. R. Pesce, P. Stieger, T. Mandel, K. Baltensperger, M. Bennett, J. Traas,
J. Friml and C. Kuhlemeier (2003). "Regulation of phyllotaxis by polar auxin
transport." Nature 426(6964): 255-260.
Ritter, M. K., C. M. Padilla and R. J. Schmidt (2002). "The maize mutant barren stalk1 is
defective in axillary meristem development." American Journal of Botany 89(2):
203-210.
Scanlon, M. J. (2003). "The polar auxin transport inhibitor N-1-naphthylphthalamic acid
disrupts leaf initiation, KNOX protein regulation, and formation of leaf margins
in maize." Plant Physiology 133(2): 597-605.
Skirpan, A., X. Wu and P. McSteen (2008). "Genetic and physical interaction suggest
that BARREN STALK1 is a target of BARREN INFLORESCENCE2 in maize
inflorescence development." The Plant Journal.
Stepanova, A. N., J. Robertson-Hoyt, J. Yun, L. Benavente, D.-Y. Xie, K. Dolezal, A.
Schlereth, G. Jurgens and J. M. Alonso (2008). "TAA1-mediated auxin
biosynthesis is essential for hormone crosstalk and plant development." Cell 133:
177-191.
Tao, Y., F. L. Ferrer, K. Ljung, F. Pojer, F. Hong, J. Long, L. Li, J. E. Moreno, M. E.
Bowman and L. J. Ivans (2008). "Rapid synthesis of auxin via a new tryptophan-
dependent pathway is required for shade avoidance in plants." Cell 133: 164-176.
Tobena-Santamaria, R., M. Bliek, K. Ljung, G. Sandberg, J. N. M. Mol, E. Souer and R.
Koes (2002). "FLOOZY of petunia is a flavin mono-oxygenase-like protein
115
required for the specification of leaf and flower architecture." Genes &
Development 16(6): 753-763.
Vieten, A., S. Vanneste, J. Wisniewska, E. Benkova, R. Benjamins, T. Beeckman, C.
Luschnig and J. Friml (2005). "Functional redundancy of PIN proteins is
accompanied by auxin-dependent cross-regulation of PIN expression."
Development 132: 4521-4531.
Wisniewska, J., J. Xu, D. Seifertova, P. B. Brewer, K. Ruzicka, I. Blilou, D. Rosque, E.
Benkova, B. Scheres and J. Friml (2006). "Polar PIN localization directs auxin
flow in plants." Sciencexpress.
Woo, Y. M., H. J. Park, M. Su'udi, J. I. Yang, J. J. Park, K. Back, Y. M. Park and G. An
(2007). "Constitutively wilted 1, a member of the rice YUCCA gene family, is
required for maintaining water homeostasis and an appropriate root to shoot
ratio." Plant Molecular Biology 65(1-2): 125-136.
Wu, X. and P. McSteen (2007). "The role of auxin transport during inflorescence
development in Maize (Zea Mays, Poaceae)." American Journal of Botany
94(11): 1745-1755.
Xu, M., L. Zhu, H. X. Shou and P. Wu (2005). "A PIN1 family gene, OsPIN1, involved
in auxin-dependent adventitious root emergence and tillering in rice." Plant and
Cell Physiology 46: 1674-1681.
Yamamoto, Y., N. Kamiya, Y. Morinaka, M. Matsuoka and T. Sazuka (2007). "Auxin
biosynthesis by the YUCCA genes in rice." Plant Physiology 143(3): 1362-1371.
Zhao, Y. D., S. K. Christensen, C. Fankhauser, J. R. Cashman, J. D. Cohen, D. Weigel
and J. Chory (2001). "A role for flavin monooxygenase-like enzymes in auxin
biosynthesis." Science 291(5502): 306-309.
CHAPTER 4
Non-autonomous effects of the spi1 mutation
4.1 Introduction
The shoot apical meristem (SAM), a cluster of cells positioned at the tip of the
developing shoot, has the potential to give rise to any organ of the plant (Steeves and
Sussex 1989). The cells of the SAM are organized into several functional zones,
including the peripheral zone, where differentiation of new organs occurs, and the central
zone, a core of meristematic cells which remain undifferentiated (McSteen and Hake
1998; Veit 2006). The maintenance of the central zone provides the plant with the ability
to continue organogenesis throughout its lifetime.
During vegetative development, the SAM initiates the vegetative tissues of the
plant: the leaves, nodes, and internodes, which are produced in units termed phytomers
(Steeves and Sussex 1989; McSteen and Leyser 2005). Axillary meristems initiate in the
axils of leaves. The axillary meristems have the potential to grow out to become side
branches that reiterate the main shoot, however, outgrowth of the axillary meristems is
often suppressed during the vegetative phase of growth.
During reproductive development, the SAM enlarges and elongates to become the
inflorescence apical meristem, which gives rise to the flowering structures of the plant
117
(McSteen et al. 2000). The inflorescence apical meristem produces modified phytomers,
consisting of bract leaves, with axillary meristems produced in the axil each bract leaf.
Maize has a highly branched inflorescence, with a complex inflorescence
architecture produced by several different types of axillary meristem (McSteen et al.
2000; Bommert et al. 2005; Bortiri and Hake 2007). This makes maize an excellent
model species for investigation of axillary meristem development. The male
inflorescence of maize, the tassel, consists of a central rachis bearing several long
branches at the base (McSteen et al. 2000; Barazesh and McSteen 2008; Chapter 1).
Both the central rachis and branches bear pairs of spikelets, each of which contain a pair
of florets. The four types of axillary meristem that create the tassel are the branch
meristems (BMs), which produce the long branches, the spikelet pair meristems (SPMs),
which elaborate the short branches bearing spikelet pairs, the spikelet meristems (SMs),
which give rise to the spikelets, and the floral meristems (FMs), which make the florets
and floral organs (Cheng et al. 1983; Irish 1997; McSteen et al. 2000; Bommert et al.
2005).
The plant hormone auxin has been identified as an important regulator of the
initiation of axillary meristems during inflorescence development (Benkova et al. 2003;
Wu and McSteen 2007). In particular, the polar transport of auxin has been implicated as
an essential process for the normal development of inflorescence structures in both
eudicots and monocots (Okada et al. 1991; Reinhardt et al. 2000; Reinhardt et al. 2003;
Morita and Kyouzuka 2007). In Arabidopsis, the well characterized PINFORMED1
(PIN1) and PINOID (PID) genes encode components of the auxin transport pathway, and
mutations in these genes result in defective axillary meristem initiation during
118
inflorescence development, forming pin-like inflorescences (Bennett et al. 1995;
Benjamins et al. 2001; Wisniewska et al. 2006). In maize, Barren inflorescence1 (Bif1)
and barren inflorescence2 (bif2) mutants have similar phenotypes to the pin1 and pid
mutants, with reduced numbers of branches, spikelets, florets and floral organs, (McSteen
and Hake 2001; Barazesh and McSteen 2008; Chapter 1). bif2 has been shown to encode
a co-ortholog of PID, and recent work on Bif1 suggests that it also functions as a
regulator of auxin transport (McSteen et al. 2007; Barazesh and McSteen 2008; Chapter
2). A third maize mutant with inflorescence development defects, barrenstalk1 (ba1)
encodes a basic helix-loop-helix transcription factor proposed to function either up or
downstream of auxin transport (Ritter et al. 2002; Gallavotti et al. 2004; Gallavotti et al.
2008; Skirpan et al. 2008). This demonstrates the role of auxin transport in axillary
meristem initiation in both Arabidopsis and maize.
Recent publications have revealed the importance of localized auxin biosynthesis
in axillary meristem initiation (Zhao et al. 2001; Cheng et al. 2006; Cheng and Zhao
2007; Stepanova et al. 2008; Tao et al. 2008). The YUCCA (YUC) family of genes
encode flavin mono-oxygenases that catalyze a rate-limiting step in tryptophan-
dependent auxin biosynthesis (Zhao et al. 2001). The YUC genes function in localized
auxin biosynthesis required for normal plant development. In Arabidopsis, the YUC
genes form a large, functionally redundant gene family, and it has been suggested that
this allows plants to make subtle adjustments in local auxin levels at different time points
throughout development (Zhao 2008). Arabidopsis quadruple yuc1; 2; 4; 6 mutants are
dwarfed, with reduced leaf production, fewer vascular tissues and defects in inflorescence
119
development, demonstrating the importance of localized auxin biosynthesis in many
aspects of plant development.
In maize, the recently identified sparse inflorescence1 (spi1) gene encodes a
flavin mono-oxygenase enzyme with similarity to the YUC auxin biosynthesis enzymes
(Gallavotti et al. 2008; Chapter 3). In contrast to the Arabidopsis YUC gene family,
where several genes must be mutated for developmental defects to be observed, mutation
at the single spi1 locus produces a plant with severe defects in inflorescence
development. These defects include reduced numbers of branches, spikelets, florets and
floral organs in the tassel, and reduced numbers of kernels in the ear. The similarity of
the spi1 phenotype to that of auxin transport mutants such as Bif1 and bif2 suggests that
localized auxin biosynthesis fulfills overlapping functions with auxin transport during
inflorescence development (McSteen and Hake 2001; Barazesh and McSteen 2008;
Gallavotti et al. 2008; Chapter 2; Chapter 3). Furthermore, the synergistic phenotype of
the spi1; bif2 double mutant, with a dramatic reduction in plant height and leaf number
coupled with a completely sterile tassel, confirms that there is overlap between the
pathways of auxin biosynthesis and transport (Gallavotti et al. 2008; Chapter 3).
Previous analysis concluded that spi1 functions in axillary meristem and lateral
organ initiation throughout development (Gallavotti et al. 2008; Chapter 3). In this paper,
we further investigate the specific role of spi1 in inflorescence development.
Histological analysis is utilized to determine if defects in cell elongation cause the
reduction in tassel length observed in spi1 mutants. We present the first evidence that a
reduction in localized auxin biosynthesis can lead to a reduction in cell expansion. The
abnormal initiation of SPMs over the apex of the inflorescence is investigated using spi1;
120
bif2 mutants. In addition, genetic analysis of double mutants between spi1 and other
genes in the auxin pathway, such as Bif1, and spi1 and barren stalk1 (ba1), are used to
further investigate the relationship between auxin biosynthesis, transport and response.
4.2 Materials and Methods
4.2.1 Origin of spi1-ref allele
The spi1-ref allele was identified in a Mutator transposon screen. All phenotypic
analysis was performed on spi1-ref backcrossed 8 times to B73.
4.2.2 Double mutant analyses
All mutant stocks were backcrossed to B73 at least 6 times before being used to
construct double mutants with spi1. For analysis of immature (5 week old) spi1; bif2
double mutants, plants were grown in the greenhouse to 5 weeks old. Plants were
genotyped for the bif2-77 mutation and the spi1-ref mutation, to identify double mutants,
as previously described (Gallavotti et al. 2008; Chapter 3.4.6). Tassels were dissected
from 5 week old plants, and fixation and SEM was carried out, as previously described
(Barazesh and McSteen 2008; Chapter 2.2.4).
For mature plant analysis, all plants were grown in the field to maturity (2 months
old). To reduce environmental effects, families were planted twice at different locations.
Two or three families of 120 kernels were planted at each location. Chi-square analysis
121
of segregation failed to reject the null hypothesis. All plants were genotyped for spi1-ref
as described (Gallavotti et al. 2008; Chapter 3.4.6). Where appropriate, plants were also
genotyped for bif2, kn1-R1, or ba1, to assist with double mutant identification. PCR
primers for genotyping bif2-77 mutants and ba1 mutants were as described (Barazesh and
McSteen 2008; Chapter 2.2.2). For genotyping kn1-R1, primers kn1F: 5’ ATA GCC
AGC TAC CCA ATG TT 3’; kn1R: 5’ TGG TAT TTA GTA AGA ACG CT 3’; and
kn1dt: 5’ CAA GGC AGT ACT CCA ATA GT 3’ were used (Kerstetter et al. 1997). At
maturity, tassel length was measured from the node at the base of the flag leaf to the tip
of the tassel. For spi1; Bif1 and spi1; ba1, tassel branch number, and spikelet number
were counted. Plant height and leaf number were measured, using the method previously
described (Barazesh and McSteen 2008; Chapter 2.2.2). For spi1; kn1 and spi1; ba1,
visible ear number was also counted.
4.22.3 Histology
For histological analysis, families segregating spi1-ref were grown in the
greenhouse to 4 weeks old (tassels were 2-3mm). Because the spi1 phenotype was not
easily visible at this early stage of development, plants were genotyped for the spi1-ref
mutation as described (Gallavotti et al. 2008; Chapter 3.4.6). Tassels were dissected,
fixed and histology performed as described (Barazesh and McSteen 2008; Chapter 2.2.4).
122
4.2.4 Cell size measurements
To measure the length and width of epidermal cells of mature tassels, impressions
were taken from the surface of the tassel using clear nail polish. Double sided tape was
used to lift the nail polish from the surface of the tassel and adhere it to the slide.
Impressions were then viewed at 20X magnification using a Nikon microscope, and the
length and width of the cells was quantified.
To measure the length and width of cortex cells of immature tassels, families
segregating for spi1-ref were grown the greenhouse to 5 weeks old (tassels were 5-7
mm). Tassels were dissected, fixed and histological analysis performed as described
(Barazesh and McSteen 2008; Chapter 2.2.4). Toluidine blue O stained sections were
viewed at 40x magnification using a Nikon microscope, and cell length and width were
measured.
4.2.5 RT-PCR
Total RNA was extracted from 5 week old (5-7mm) normal, spi1, bif2 and ba1 tassels
and 8 week old (8-10 mm) normal, spi1, bif2 and ba1 ears, and reverse transcription and
RT-PCR carried out, with all conditions and methods as previously described (Barazesh
and McSteen 2008; Chapter 2.2.5). For detection of spi1-ref expression, the Taqman
probe was FAM-5’AGG ATC CCC TTC CCC AAC GGC T 3’ and the RT-PCR primers
were spi1-F 5’ ACG GAG GCG ACG TGT TCA 3’ and spi1-R 5’ TAG AGC CCG TTC
TTC CCT TTC 3’. The control for normalization was ubiquitin, primers and probe were
as previously described (Barazesh and McSteen 2008; Chapter 2.2.5). For detection of
123
bif2 and ba1 expression, RT-PCR primers and probes were as described. Three technical
replicates of each real time PCR reaction were carried out on three biological replicates
of each experiment. Normalized expression levels were determined using the
comparative threshold method (Livak and Schmittgen 2001).
4.3 Results
4.3.1 Abnormal initiation of SPMs at the tassel apex is not the cause of reduced
tassel length in spi1 mutants
An interesting aspect of the spi1 mutant phenotype is the reduction in tassel length
compared to normal tassels. Investigation of the cause of this reduction in tassel length
could yield insight into the role of spi1 and localized auxin biosynthesis during
inflorescence development. SEM analysis of immature spi1 tassels showed that spikelets
develop over the apex of the tassel, an area that normally remains undifferentiated until
development is completed (Gallavotti et al. 2008; Chapter 3). Development of SPMs
over the apex of the tassel could consume the apical meristem, stopping growth of the
tassel. This would suggest an additional role for spi1, and localized auxin biosynthesis,
in maintaining the undifferentiated central zone of the apical meristem.
In order to test this hypothesis, double mutants between spi1 and bif2 were
constructed. Previous analysis of mature spi1; bif2 tassels showed that spi1; bif2 plants
produce sterile tassels with no branches or spikelets (Gallavotti et al. 2008 ; Chapter 3)
(Figure 4.1 A). Because spi1; bif2 produce no SPMs, they provide a genetic tool to
124
dissect the role of growth of SPMs at the tip of the inflorescence in preventing normal
tassel growth in spi1 mutants. SEM analysis of immature spi1; bif2 tassels was carried
out to verify that spi1; bif2 mutants fail to initiate SPMs (Figure 1 B-G). Developing
SPMs were visible in normal, spi1 and bif2 5 week old tassels, whereas no axillary
meristems were visible in spi1; bif2 tassels of the same age (Figure 1 B - G). Close-ups
of the apex of the spi1 tassel clearly show SPMs developing over the tip, whilst no SPMs
are visible in spi1; bif2 double mutants (Figure 1 F, G). To measure mature tassel length,
families segregating spi1; bif2 were grown to maturity, and tassel length was measured
from the node of the flag leaf to the tip of the tassel. The length of the bif2 single mutant
tassel was not significantly different to that of normal tassels (p = 0.076). Despite the
lack of SPMs, the tassel length of the spi1; bif2 double mutants was reduced similar to
the spi1 single mutant (Figure 1 H). spi1; bif2 tassels were about three quarters the
length of normal tassels (Figure 1 H, p < 0.001), and there was no statistical difference
between spi1 and spi1; bif2 tassel length (p = 0.366). This result indicates that the
growth of SPMs over the tip of the inflorescence was not the cause of the reduction in
tassel length in spi1 mutants.
4.3.2 spi1 does not have defects in apical meristem maintenance
We determined that the growth of SPMs at the tassel apex did not cause the
reduction in spi1 mutant tassel length; however, we did not rule out a role for spi1 in
apical meristem maintenance. The short tassels of spi1 could be caused by defects within
the apical inflorescence meristem, and the growth of SPMs over the apex could be a
125
consequence of this. In order to investigate this possibility, the histology of spi1 tassels
was analyzed at early stages of development. Sections of 2-3 mm tassels that had just
undergone the floral transition (dissected from plants approximately 4 weeks old) were
stained with Toluidine Blue O (TBO) to visualize the structure of cells of the apical
meristem of the spi1 mutant. At this stage of development, the histology of the spi1
tassel was similar to normal, with no visible defects in the apical meristem (Figure 2 A,
B).
Double mutants between spi1 and knotted1 (kn1) were utilized for additional
investigation of the role of spi1 in the apical meristem. The apical meristem of kn1 loss-
of-function mutants is smaller than normal due to defects in meristem maintenance, and
therefore is unable to initiate as many axillary meristems as normal (Vollbrecht et al.
1991; Kerstetter et al. 1997). The reduced number of axillary meristems gives rise to a
sparse inflorescence with fewer branches and spikelets than normal (Figure 3 A, C, D).
SEM analysis of spi1 mutants revealed that the size of the apical meristem in spi1
mutants is similar to that of normal plants. We found that the phenotype of the spi1; kn1
mutant was not enhanced compared to spi1. spi1; kn1 double mutants produced an
average of 3.3 tassel branches, similar to the average reported for spi1 single mutants (p =
0.338) (Figure 3 C). spi1; kn1 double mutants produced an average of 57 spikelets,
slightly more than the number of spikelets produced by spi1 single mutants, but the
difference was not statistically significant (p = 0.567).
Furthermore, kn1 loss-of-function mutants do not have a defect in tassel length,
indicating that a reduction in apical meristem maintenance does not cause a short tassel
126
phenotype (Figure 3 B). We also noted that the tassel length defect observed in spi1
single mutants was not enhanced in spi1; kn1 double mutants (p = 0.203).
It has been previously reported that kn1 loss-of-function mutants produce fewer
ears than normal (Kerstetter et al. 1997). Quantification of ear number in the spi1; kn1
double mutant population verified this, with kn1 mutants producing an average of 1 ear,
compared to an average of 1.84 ears produced by each normal plant (p = 0.001). spi1
mutant plants produced an average of 1.7 ears per plant, not significantly different to
normal (p = 0.425). We found that the spi1; kn1 double mutants failed to initiate any
ears at all, indicating that there may be some overlap in spi1 and kn1 function in ear
development. Vegetative development of the spi1; kn1 double mutant was also analyzed,
and found not to be significantly different from spi1 single mutants (Figure 4 A-C).
4.3.3 spi1 functions in cell elongation in the developing tassel
We hypothesized that the decreased inflorescence size characteristic of spi1
mutants could be caused by a defect in cell expansion or proliferation during
inflorescence development. To investigate this, epidermal cell size was measured in
mature spi1 tassels. Impressions were taken from the surface of the tassel of field grown
spi1 and normal plants at maturity (8 weeks old) (Figure 5 A, B). The impressions were
then viewed under the microscope, and cell size was measured (Figure 5 C, D). It was
found that cell length was decreased in mutant tassels compared to normal though width
was unaffected (Figure 5 C, D).
127
To investigate if all cell types were similarly affected, the cortex cells of
immature (5 week old) tassels were also analyzed. Tassels were dissected from plants,
fixed, sectioned and the sections were stained with TBO and viewed under the
microscope. The length and width of cells from the cortex of the tassel was measured
(Figure 5 E, F). Results indicated that the average cell length in spi1 mutant tassels was
reduced compared to the length of normal cells (Figure 5 G); although the width of spi1
cells was similar to normal (Figure 5 H). Similar results were obtained for both
longitudinal and transverse tassel sections (data not shown).
4.3.4 Bif1 and ba1 mutants have defects in cell elongation in the developing tassel
We observed that both Bif1 and ba1 double mutants had shorter tassels than normal
(Figure 6 B and Figure 8 C). To determine if Bif1 and ba1 mutants had cell elongation
defects, we quantified measured the length and width of mature epidermal cells in both
genetic backgrounds (Figure 5 I). The length of the cells of mature Bif1 and ba1 tassels
was found to be significantly reduced compared to normal. This phenotype had not
previously been described for either mutant.
4.3.5 spi1 interaction with Bif1
The severe phenotype of the spi1; bif2 double mutant, with it’s dramatically reduced
plant height and a sterile tassel with no branches or spikelets, suggested synergism
between auxin biosynthesis and transport (Figure 1 A) (Barazesh and McSteen 2008). To
128
gain further insight into the connection between auxin biosynthesis and transport, and to
better understand the role of spi1 in the auxin pathway, double mutants were constructed
between spi1 and Bif1. Bif1 is very similar in phenotype to bif2, and is proposed to
function as a regulator of auxin transport (Barazesh and McSteen 2008). spi1; Bif1
double mutants had a severe tassel phenotype, with very few tassel branches or spikelets
(Figure 6 A-C). spi1; Bif1 mutants produced sterile tassels (Figure 6 A). spi1; Bif1
double mutants very few tassel branches, the same as Bif1 homozygous mutants (p =
0.052) and more severe than spi1 single mutants ((p < 0.001) (Figure 6 C, D). The
severity of the spi1; Bif1 inflorescence phenotype indicates that Bif1 has a similar
function to bif2 in the inflorescence.
We were surprised to observe that, unlike spi1; bif2 double mutants the spi1; Bif1
double mutants did not have a severe vegetative phenotype (Figure 7 A – C) (Barazesh
and McSteen 2008). spi1; Bif1 double mutants were shorter than normal (p < 0.001) but
not significantly shorter than spi1 single mutant plants (p = 0.429) (Figure 7 A, B). Leaf
number was also reduced in spi1; Bif1 double mutants compared to normal (p < 0.001),
but was not significantly different to the leaf number of spi1 single mutants (p = 0.066).
(Figure 7 C). Therefore, there was no synergism in the genetic interaction between spi1
and Bif1 during vegetative development.
4.3.6 spi1 interaction with ba1
To investigate the role of spi1 in the pathway of auxin biosynthesis, transport and
response, double mutants were constructed between spi1 and barren stalk1 (ba1). ba1
129
encodes a basic helix-loop-helix transcription factor which is required for the initiation of
axillary meristems during both vegetative and reproductive development (Gallavotti et al.
2004). ba1 mutants produce no ears or tillers, and tassels with no branches and few, if
any, spikelets (Ritter et al. 2002). ba1 is proposed to function either up or down-stream
of auxin transport, so its exact role in auxin transport is unclear (Gallavotti et al. 2008;
Skirpan et al. 2008). ba1 mutants have a regular pattern of bumps on the surface of the
tassel rachis, which have been identified as the remnants of suppressed bract primordia
(Ritter et al. 2002). The development of these bumps indicates that auxin transport is
functional during bract leaf initiation, and further evidence for this comes from recent
experiments which showed that ZmPIN1a localization is normal in ba1 mutants during
bract leaf initiation (Gallavotti et al. 2008). It is thought that a failure in auxin transport
during axillary meristem initiation, or alternatively, a defect in the response to the auxin
signal, leads to a failure of axillary meristem initiation in ba1 mutants (Barazesh and
McSteen 2008; Gallavotti et al. 2008; Skirpan et al. 2008).
The phenotype of the spi1; ba1 double mutants was similar to ba1 single mutants,
with no ears produced and very barren tassels (Figure 8 A-E). spi1; ba1 mutants
produced no tassel branches, which was not statistically different from ba1 single
mutants (Figure 8 D). spi1; ba1 double mutants failed to produce any spikelets, a more
severe phenotype than either spi1 (p < 0.0001) or ba1 (p < 0.001) (Figure 8 E). spi1; ba1
double mutants failed to produce ears, the same as ba1 single mutants (Figure 8 F).
Interestingly, spi1; ba1 double mutant tassels were more severely reduced in length than
either spi1 (p = 0.004) or ba1 single mutants (p < 0.001) (Figure 8 C).
130
A key piece of data came with the observation that the surface of the spi1; ba1
tassel rachis was smooth, similar to spi1 single mutants (Figure 8 A, B). The smooth
surface of the tassel rachis is evidence that bract leaf primordia fail to initiate, therefore
auxin biosynthesis is required for bract leaf initiation.
4.3.7 The molecular interaction of auxin biosynthesis and transport
Real time RT-PCR experiments were used to quantify the expression of spi1 in spi1-ref
tassels, and another also in tassels of another spi1 allele, spi1-19746. The basis of the
spi1-19746 mutation has not yet been determined. It was found that spi1 expression was
significantly decreased in both spi1 alleles (Figure 9 A).
To obtain further insight into the interaction between auxin biosynthesis and
transport, real time RT-PCR experiments were used to investigate the molecular
interactions between spi1, bif2 and ba1. It was found that the level of spi1 mRNA in
bif2 mutants was reduced compared to normal (Figure 9 B). The level of bif2 mRNA in
spi1 tassels and ears was also measured and found to be reduced compared to normal
(Figure 9 C, D). The expression of spi1 and bif2 is localized to axillary meristems in
normal tassels, and therefore the reduced number of axillary meristems in both bif2 and
spi1 mutants may account for the reduced level of spi1 and bif2 mRNA detected in these
plants.
Further real time RT-PCR experiments were carried out to investigate the
expression of ba1 in spi1 tassels. It was found that ba1 RNA levels are slightly reduced
in spi1 mutants compared to normal tassels (Figure 9 E, F). Again, this reduction in ba1
131
mRNA level could be due to the morphology of the spi1 mutant. In contrast, spi1
expression in spi1 mutants is significantly reduced, which implies that auxin biosynthesis
is required for spi1 expression.
4.4 Discussion
spi1 encodes a YUC-like flavin monooxygenase which functions in local auxin
biosynthesis (Zhao et al. 2001; Gallavotti et al. 2008). Characterization of spi1 mutants
revealed that spi1 is required for the initiation of axillary meristems and lateral organs in
both vegetative and reproductive development (Gallavotti et al. 2008). Analysis of spi1;
bif2 double mutants revealed synergism between the processes of auxin biosynthesis and
transport. This suggested that spi1 and bif2 could overlap in function. Here, we present
SEM, histological and genetic experiments which were carried out to investigate the
function of spi1. We determined that spi1 interacts with genes regulating auxin transport
and response.
4.4.1 spi1 has a short inflorescence linked to a defect in cell elongation
It was hypothesized that the short tassel phenotype of the spi1 mutant could be caused by
premature differentiation of the apical meristem, which was supported by SEM images of
spikelets growing over the apex of the tassel. spi1; bif2 double mutants were utilized to
investigate this, because no spikelets are produced in this genetic background. It was
found that even though spi1; bif2 mutants produced no spikelets, spi1; bif2 tassels were
132
still short in length, similar to spi1 single mutants. From this finding, we inferred that the
growth of spikelets over the tip of the spi1 tassel does not the cause the reduction in tassel
length. Additional evidence supporting this conclusion comes from histological analysis
of very young spi1 tassels (1-2 mm, before SPM initiation), which showed that the
morphology of the apical inflorescence meristem is normal at this stage.
Further analysis of the role of spi1 in apical meristem maintenance was carried
out using double mutants between spi1 and kn1. spi1; kn1 plants showed that mutation of
kn1 did not exacerbate not the phenotype of spi1, from which we infer that spi1 does not
function in apical meristem maintenance.
Auxin has long been known to function in the regulation of cell elongation and
expansion, and so it is feasible that mutants in auxin biosynthesis genes, such as spi1,
could show cell elongation defects (Christian et al. 2006). A link between auxin
biosynthesis and cell expansion was established by experiments involving erecta (er)
loss-of-function mutants of Arabidopsis, which are defective in internode and pedicel
elongation. Over expression of the auxin biosynthesis gene YUC5 in the er loss-of-
function mutant background suppressed the er phenotype by increasing the elongation of
epidermal pavement cells (Woodward et al. 2005). This result showed that an increase in
localized auxin biosynthesis lead to an increase in cell elongation.
The processes of cell division and expansion are required to produce organs of
normal size (Doonan 2000). To determine if a failure in either of these processes was the
cause of the reduction of tassel length observed in spi1 mutants, histology was used to
visualize tassel cell structure. It was found that spi1 tassel cells are significantly reduced
length compared to normal (p < 0.0001). This suggests that spi1, and therefore localized
133
auxin biosynthesis, is required for cell expansion. These results are the first evidence that
a decrease in localized auxin biosynthesis causes a decrease in cell elongation, and
supports previous evidence that over-expression of YUC5 in er loss-of-function mutants
causes an increase in cell expansion (Woodward et al. 2005). Interestingly, during the
course of this work, we discovered that Bif1 and ba1 mutants also display a reduction in
tassel length, and determined that, similar to spi1, this defect is due to defective cell
elongation. As both Bif1 and ba1 are predicted to have function in auxin related
processes, this finding emphasizes the importance of auxin in cell elongation during
tassel development (Gallavotti et al. 2004; Barazesh and McSteen 2008; Gallavotti et al.
2008; Skirpan et al. 2008).
4.4.2 spi1 functions in cell expansion
RNA in situ hybridization showed that spi1 is expressed at the base of axillary meristems
in developing tassels, but no spi1 expression was detected in the apical inflorescence
meristem, or in the vasculature tissues (Gallavotti et al. 2008). Histological analysis of
transverse sections of tassels and ears showed that spi1 mutants have reduced numbers of
vascular bundles, and in addition, the vascular bundles are arranged in an abnormal
pattern, strong evidence that spi1 functions in the initiation of vasculature. Because spi1
appears to function in tissues which show no evidence of spi1 expression, we infer that
auxin synthesized by spi1 moves to other cells, and therefore that spi1 functions in a non-
cell autonomous manner. This is consistent with the previous finding that the petunia
YUC gene FLOOZY acts non-cell autonomously (Tobena-Santamaria et al. 2002).
134
Furthermore, spi1 is not expressed in the apical meristem, yet a mutant phenotype is
displayed there. In addition, spi1 is not expressed in epidermal and cortex cells of the
tassel, which display defects in cell elongation. This suggests that auxin synthesized by
spi1 is immediately transported. A failure in this process results in defects at sites
different from the site of spi1 expression.
4.4.3 spi1 functions in a non cell autonomous manner
RNA in situ hybridization showed that spi1 is expressed at the base of axillary meristems
in developing tassels, but no spi1 expression was detected in the apical inflorescence
meristem, or in the vasculature tissues (Gallavotti et al. 2008). Histological analysis of
transverse sections of tassels and ears showed that spi1 mutants have reduced numbers of
vascular bundles, and in addition, the vascular bundles are arranged in an abnormal
pattern, strong evidence that spi1 functions in the initiation of vasculature. Because spi1
appears to function in tissues which show no evidence of spi1 expression, we infer that
auxin synthesized by spi1 moves to other cells, and therefore that spi1 functions in a non-
cell autonomous manner. This is consistent with the previous finding that the petunia
YUC gene FLOOZY acts non-cell autonomously (Tobena-Santamaria et al. 2002).
Furthermore, spi1 is not expressed in the apical meristem, yet a mutant phenotype is
displayed there. In addition, spi1 is not expressed in epidermal and cortex cells of the
tassel, which display defects in cell elongation. This suggests that auxin synthesized by
spi1 is immediately transported. A failure in this process results in defects at sites
different from the site of spi1 expression.
135
4.4.4 Synergism between auxin biosynthesis and transport
Bif1 is a semi-dominant mutation that causes defects in axillary meristem initiation
during inflorescence development (Barazesh and McSteen 2008). Based on the
synergistic vegetative and reproductive phenotypes of the Bif1; bif2 double mutant, Bif1
is proposed to overlap in function with bif2, possibly acting as a regulator of auxin
transport. Supporting this proposed role for Bif1, ZmPIN1a protein is mis-localized in
Bif1 mutants, indicating that Bif1 acts upstream of PAT (Gallavotti et al. 2008).
The severe tassel phenotype of spi1; Bif1 provides additional evidence of
synergism between auxin biosynthesis and transport. An interconnection between auxin
transport and biosynthesis has previously been observed in Arabidopsis: yuc1yuc4pin1
triple mutants fail to produce leaves, a synergistic phenotype not reported for pin1 alone
or yuc1; yuc4 mutants.
Interestingly, spi1; Bif1 double mutants displayed an additive phenotype during
vegetative development. This is in contrast to the significant reduction in plant height
and leaf number displayed in both the spi1; bif2 and Bif1; bif2 double mutants. From this
finding, we infer that bif2 and Bif1 diverge in function during vegetative development.
Supporting this, previous work showed that Bif1; tb1 double mutants do not produce a
significantly reduced number of tillers compared to tb1 single mutants, indicating that the
Bif1 mutant does not severely affect vegetative axillary meristem initiation and
development (Barazesh and McSteen 2008). In contrast, bif2; tb1 double mutants
produce significantly fewer tillers than tb1 single mutants, implying that bif2 plays a
more central role than Bif1 in vegetative development (McSteen and Hake 2001).
136
Further evidence of localized auxin biosynthesis impacting the auxin pathway
comes from spi1; ba1 double mutants. From the phenotype of the spi1; ba1 double
mutant, we infer that spi1 is epistatic to ba1, and therefore that spi1 is upstream of ba1.
ba1 has previously been proposed to function either up- and down-stream of auxin
transport (Gallavotti et al. 2008; Skirpan et al. 2008); however these results favor a role
for ba1 downstream of auxin transport. This is supported by real time RT-PCR analysis,
which shows that levels of ba1 mRNA are decreased in spi1 mutants. Furthermore, the
spi1; ba1 double mutant phenotype suggests that spi1 is required for bract leaf initiation.
This is similar to the results obtained for bif2; ba1 and Bif1; ba1 double mutants, which
also had smooth tassel rachis, showing that both auxin biosynthesis and transport are
required for bract leaf initiation.
4.4.5 A model for the interaction between spi1 and auxin transport
One plausible explanation for this interaction between spi1 and auxin transport is that a
threshold level of auxin is required for axillary meristem or lateral organ initiation to
occur, and this level may be reached by a combination of auxin transport to the site, and
localized auxin biosynthesis (Zhao 2008). An alternative hypothesis is that localized
auxin biosynthesis may function as a signal for polar auxin transport (Zhao 2008). Auxin
modeling work has suggested that the initiation and positioning of organ primordia is
controlled by the activity and localization of PIN1. An auxin maximum provided by up-
regulation of PIN1 is required to initiate incipient primordia. At this stage, PIN1 directs
auxin towards the primordia. This is followed by a reversal of PIN1 localization away
137
from the site of organ initiation, which allows the next primordia to initiate. Experiments
using the auxin responsive promoter DR5 showed that PIN1 localization correlates with
changes in auxin levels (Reinhardt et al. 2003; Heisler et al. 2005; Smith et al. 2006).
Recent experiments showed that ZmPIN1a is mis-localized in spi1 mutants,
implying that auxin biosynthesis is required for correct PIN1 localization (Gallavotti et
al. 2008). In addition, it could be argued that PIN1 induces spi1 expression, supported by
real time RT-PCR data that suggests that auxin induces spi1 expression. From this data,
we hypothesize that PIN convergence directs auxin to the site of primordium initiation,
establishing an influx of auxin that induces spi1 expression. Localized auxin
biosynthesis by spi1 then establishes correct PIN1 localization to initiate the primordia.
This model provides an explanation for the interconnection between auxin biosynthesis
and transport that our work on the spi1 mutant has revealed.
138
(A) Mature tassel phenotype of a spi1; bif2 segregating family. (B) - (E) Scanning electron
microscope (SEM) images of developing spi1; bif2 tassels. (F) SEM close-up of the apex of the
spi1 tassel. (G) SEM close-up of the apex of the spi1; bif2 tassel.
(H) Quantification of tassel length.
Scale bars = 100 μM
Figure 4.1: spi1;bif2 double mutant analysis.
139
(A) - (B) Longitudinal sections of 4 week old normal and spi1 tassels, stained with TBO. (C) -
(D) Transverse sections of 5 week old normal and spi1 tassels, stained with TBO. Vascular
bundles are visible as areas of intense staining, indicated by arrows. spi1 mutants have fewer
vascular bundles than normal, particularly in the main spike of the tassel. (E) – (F) Transverse
sections of 8 week old normal and spi1 ears. Vascular bundles are visible as areas of intense
staining. The vascular bundles of the spi1 mutant are arranged in an abnormal pattern.
Figure 4.2: Histology of developing spi1 tassels and ears.
140
(A) Mature tassel phenotype of a spi1; kn1 segregating family. (B - D) Quantification of tassel
characteristics in a spi1; kn1 segregating family. (B) Average tassel length in cm. (C) Average
tassel branch number. (D) Average spikelet number per tassel.
(E) Quantification of the number of ears per plant.
Figure 4.3: Analysis of spi1; kn1 double mutants.
141
(A) Vegetatve phenotype of a spi1; kn1 segregating family. (B-C) Quantification of vegetative
phenotype. (B) Average Plant Height in cm. (C) Average leaf number.
Figure 4.4: spi1; kn1 double mutant vegetative analysis.
142
(A - B) Impressions of the epidermal cells of mature (8 week old) normal and spi1 mutant
tassels. (A) Epidermal cells of mature normal tassel. (B) Epidermal cells of mature spi1 tassel.
(C) Quantification of mature epidermal cell width of normal and spi1 plants. (D) Quantification
of mature epidermal cell length of normal and spi1 plants. (E – F) Longitudinal sections of
immature (5 week old) normal and spi1 tassels stained with TBO. (E) Cortex cells of immature
normal tassel. (F) Cortex cells of immature spi1 tassel. (G) Quantification of immature cortex
cell width of normal and spi1 plants. (H) Quantification of immature cortex cell length of normal
and spi1 plants.
Figure 4.5: Analysis of cell size in immature and mature spi1 mutants.
143
(A) Mature tassel phenotype of a spi1; Bif1 segregating family. (B - D) Quantification of tassel
characteristics in a spi1; Bif1 segregating family. (B) Average tassel length in cm. (C) Average
tassel branch number. (D) Average spikelet number per tassel. (E) Average length of epidermal
cells of mature tassels from normal, spi1, ba1, Bif1 and spi1; Bif1 plants.
Figure 4.6: spi1; Bif1 double mutant inflorescence analysis.
144
(A) Vegetative phenotype of a spi1; Bif1 segregating family. (B- C) Quantification of vegetative
phenotypes . (B) Average plant height in cm. (C) Average leaf number.
Figure 4.7: spi1; Bif1 double mutant vegetative analysis.
145
(A) Mature tassel phenotype of all genetic classes segregating in the spi1; ba1 family. (B)
Quantification of tassel length. (C) Quantification of tassel branch number. (D) Quantification of
spikelet number. (E) Quantification of ear number.
Figure 4.8: spi1; ba1 double mutant analysis
146
(A) Relative spi1 mRNA level in spi1-ref and spi1-19746 tassel. (B) Relative spi1 mRNA level
in bif2 tassel. (C) Relative bif2 mRNA level in spi1 tassel. (B) Relative bif2 mRNA level in spi1
ear. (E) Relative ba1 mRNA level in spi1 tassel. (F) Relative ba1 mRNA level in spi1 ear.
Figure 4.9: Real time RT-PCR analysis of bif2 expression in spi1 mutants.
147
Table 4.1: Chi-square analysis of double mutant segregation.
Genotype Expected ratio Expected Number (E) Observed Number (O) Deviation (D–E) Deviation2/E spi1; bif2*
Normal 9 72.56 78 5.44 0.41 spi1 3 24.19 20 -4.19 0.72 bif2 3 24.19 21 -3.19 0.42 spi1; bif2 1 8.06 10 1.94 0.46 Total 129 129 2.02
spi1; kn1* Normal 9 74.25 80 5.75 0.45 spi1 3 25.45 26 1.25 0.06 kn1 3 24.25 19 -5.75 1.34 spi1; kn1 1 8.25 7 -1.25 0.19 Total 132 132 2.03
spi1; Bif1† Normal 3 22.31 24 1.69 0.13 Bif1/+ 6 44.63 41 -3.63 0.29 Bif1/Bif1 3 22.31 21 -1.31 0.08 spi1 1 7.44 10 2.56 0.88 spi1; Bif1/+ 2 14.88 14 -0.88 0.05 spi1; Bif1/Bif1 1 7.44 9 1.56 0.33 Total 119 119 1.76
spi1; ba1* Normal 9 61.8 65 3.1 0.1 spi1 3 20.6 16 -4.6 1.0 ba1 3 20.6 24 3.3 0.5 spi1; ba1 1 6.8 5 -1.8 0.5 Total 110 110 2.2
* df = 3, 0.5 < P < 0.7 † df = 5, 0.5 < P < 0.9
148
4.5 References
Barazesh, S. and P. McSteen (2008). "Barren inflorescence1 functions in organogenesis
during vegetative and inflorescence development in maize." Genetics 179: 389–
401.
Barazesh, S. and P. McSteen (2008). "Hormonal control of grass inflorescence
development." Trends in Plant Science 13(12): in press.
Benjamins, R., A. Quint, D. Weijers, P. Hooykaas and R. Offringa (2001). "The PINOID
protein kinase regulates organ development in Arabidopsis by enhancing polar
auxin transport." Development 128(20): 4057-4067.
Benkova, E., M. Michniewicz, M. Sauer, T. Teichmann, D. Seifertova, G. Jurgens and J.
Friml (2003). "Local, efflux-dependent auxin gradients as a common module for
plant organ formation." Cell 115(5): 591-602.
Bennett, S. R. M., J. Alvarez, G. Bossinger and D. R. Smyth (1995). "Morphogenesis in
pinoid mutants of Arabidopsis thaliana." Plant Journal 8(4): 505-520.
Bommert, P., N. Satoh-Nagasawa, D. Jackson and H. Y. Hirano (2005). "Genetics and
evolution of inflorescence and flower development in grasses." Plant and Cell
Physiology 46(1): 69-78.
149
Bortiri, E. and S. Hake (2007). "Flowering and determinacy in maize." Journal of
Experimental Botany 58: 909-916.
Cheng, P. C., R. I. Greyson and D. B. Walden (1983). "Organ initiation and the
development of unisexual flowers in the tassel and ear of Zea Mays." American
Journal of Botany 70(3): 450-462.
Cheng, Y. F., X. H. Dai and Y. D. Zhao (2006). "Auxin biosynthesis by the YUCCA
flavin monooxygenases controls the formation of floral organs and vascular
tissues in Arabidopsis." Genes & Development 20(13): 1790-1799.
Cheng, Y. F. and Y. D. Zhao (2007). "A role for auxin in flower development." Journal
of Integrative Plant Biology 49(1): 99-104.
Christian, M., B. Steffens, D. Schenck, S. Burmester, M. Bottger and H. Luthen (2006).
"How does auxin enhance cell elongation? Roles of auxin-binding proteins and
potassium channels in growth control." Plant Biology 8(3): 346-352.
Doonan, J. (2000). "Social controls on cell proliferation in plants." Current Opinion in
Plant Biology 3(6): 482-487.
150
Gallavotti, A., S. Barazesh, S. Malcomber, D. Hall, D. Jackson, R. J. Schmidt and P.
McSteen (2008). "sparse inflorescence1 encodes a monocot specific YUCCA-like
flavin monooxygenase required for vegetative and reproductive development in
maize." Proceedings of the National Academy of Sciences of the United States of
America 105(39): 15196-15207.
Gallavotti, A., Y. Yang, R. J. Schmidt and D. Jackson (2008). "The relationship between
auxin transport and maize branching." Plant Physiology 147: 1913-1923.
Gallavotti, A., Q. Zhao, J. Kyozuka, R. B. Meeley, M. K. Ritter, J. F. Doebley, M. E. Pe
and R. J. Schmidt (2004). "The role of barren stalk1 in the architecture of maize."
Nature 432: 630-635.
Heisler, M. G., C. Ohno, P. Das, P. Sieber, G. V. Reddy, J. Long and E. M. Meyerowitz
(2005). "Patterns of auxin transport and gene expression during primordium
development revealed by live imaging of the Arabidopsis inflorescence
meristem." Current Biology 15: 1899-1911.
Irish, E. E. (1997). "Class II tassel seed mutations provide evidence for multiple types of
inflorescence meristems in maize (Poaceae)." American Journal of Botany
84(11): 1502-1515.
151
Kerstetter, R. A., D. LaudenciaChingcuanco, L. G. Smith and S. Hake (1997). "Loss-of-
function mutations in the maize homeobox gene, knotted1, are defective in shoot
meristem maintenance." Development 124(16): 3045-3054.
Livak, K. J. and T. D. Schmittgen (2001). "Analysis of relative gene expression data
using real-time quantitative PCR and the 2T-ΔΔC method." Methods 35: 402-408.
McSteen, P. and S. Hake (1998). "Genetic control of plant development." Current
Opinion in Biotechnology 9(2): 189-195.
McSteen, P. and S. Hake (2001). "barren inflorescence2 regulates axillary meristem
development in the maize inflorescence." Development 128(15): 2881-2891.
McSteen, P., D. Laudencia-Chingcuanco and J. Colasanti (2000). "A floret by any other
name: control of meristem identity in maize." Trends in Plant Science 5(2): 61-66.
McSteen, P. and O. Leyser (2005). "Shoot branching." Annual Review of Plant Biology
56: 353-374.
McSteen, P., S. Malcomber, A. Skirpan, C. Lunde, X. Wu, E. Kellogg and S. Hake
(2007). "barren inflorescence2 encodes a co-ortholog of the PINOID
serine/threonine kinase and is required for organogenesis during inflorescence and
vegetative development in maize." Plant Physiology 144: 1000-1011.
152
Morita, Y. and J. Kyouzuka (2007). "Characterization of OsPID, the rice ortholog of
PINOID, and its possible involvement in the control of polar auxin transport."
Plant and Cell Physiology 144: 540-549.
Okada, K., J. Ueda, M. K. Komaki, C. J. Bell and Y. Shimura (1991). "Requirement of
the auxin polar transport system in early stages of Arabidopsis floral bud
formation." Plant Cell 3(7): 677-684.
Reinhardt, D., T. Mandel and C. Kuhlemeier (2000). "Auxin regulates the initiation and
radial position of plant lateral organs." Plant Cell 12(4): 507-518.
Reinhardt, D., E. R. Pesce, P. Stieger, T. Mandel, K. Baltensperger, M. Bennett, J. Traas,
J. Friml and C. Kuhlemeier (2003). "Regulation of phyllotaxis by polar auxin
transport." Nature 426(6964): 255-260.
Ritter, M. K., C. M. Padilla and R. J. Schmidt (2002). "The maize mutant barren stalk1 is
defective in axillary meristem development." American Journal of Botany 89(2):
203-210.
Skirpan, A., X. Wu and P. McSteen (2008). "Genetic and physical interaction suggest
that BARREN STALK1 is a target of BARREN INFLORESCENCE2 in maize
inflorescence development." The Plant Journal 55: 87-797
153
Smith, R. S., S. Guyomarc'h, T. Mandel, D. Reinhardt, C. Kuhlemeier and P.
Prusinkiewicz (2006). "A plausible model of phyllotaxis." Proceedings of the
National Academy of Sciences of the United States of America 103(5): 1301-
1306.
Steeves, T. and I. Sussex (1989). Patterns in plant development. Cambridge, UK,
Cambridge University Press.
Stepanova, A. N., J. Robertson-Hoyt, J. Yun, L. Benavente, D.-Y. Xie, K. Dolezal, A.
Schlereth, G. Jurgens and J. M. Alonso (2008). "TAA1-mediated auxin
biosynthesis is essential for hormone crosstalk and plant development." Cell 133:
177-191.
Tao, Y., F. L. Ferrer, K. Ljung, F. Pojer, F. Hong, J. Long, L. Li, J. E. Moreno, M. E.
Bowman and L. J. Ivans (2008). "Rapid synthesis of auxin via a new tryptophan-
dependent pathway is required for shade avoidance in plants." Cell 133: 164-176.
Tobena-Santamaria, R., M. Bliek, K. Ljung, G. Sandberg, J. N. M. Mol, E. Souer and R.
Koes (2002). "FLOOZY of petunia is a flavin mono-oxygenase-like protein
required for the specification of leaf and flower architecture." Genes &
Development 16(6): 753-763.
154
Veit, B. (2006). "Stem cell signaling networks in plants." Plant Molecular Biology 60:
793-810.
Vollbrecht, E., B. Veit, N. Sinha and S. Hake (1991). "The Developmental Gene
Knotted-1 Is a Member of a Maize Homeobox Gene Family." Nature 350(6315):
241-243.
Wisniewska, J., J. Xu, D. Seifertova, P. B. Brewer, K. Ruzicka, I. Blilou, D. Rosque, E.
Benkova, B. Scheres and J. Friml (2006). "Polar PIN localization directs auxin
flow in plants." Sciencexpress.
Woodward, C., S. M. Bemis, E. J. Hill, S. Sawa, T. Koshiba and K. U. Torii (2005).
"Interaction of auxin and ERECTA in elaborating Arabidopsis inflorescence
architecture revealed by the activation tagging of a new member of the YUCCA
family putative flavin monooxygenases." Plant Physiology 139(1): 192-203.
Wu, X. and P. McSteen (2007). "The role of auxin transport during inflorescence
development in Maize (Zea Mays, Poaceae)." American Journal of Botany
94(11): 1745-1755.
Zhao, Y. (2008). "The role of local biosynthesis of auxin and cytokinin in plant
development." Current Opinion in Plant Biology 11: 16-22.
155
Zhao, Y. D., S. K. Christensen, C. Fankhauser, J. R. Cashman, J. D. Cohen, D. Weigel
and J. Chory (2001). "A role for flavin monooxygenase-like enzymes in auxin
biosynthesis." Science 291(5502): 306-309.
156
CHAPTER 5
Summary and Conclusions
5.1 Summary
The research described in this thesis has contributed to a greater understanding of the
integral role played by auxin during inflorescence development in maize. We have
characterized the phenotype and genetic interactions of the classical maize mutant Bif1,
and concluded that Bif1 functions as a regulator of auxin transport (Chapter 2). We have
also characterized the novel maize mutant spi1, and revealed that spi1 encodes a YUCCA-
like auxin biosynthesis gene (Chapter 3). Furthermore, we describe the elucidation of
the specific functions of localized auxin biosynthesis during inflorescence development
(Chapter 4).
5.2 Conclusions
5.2.1 Identification of a potential regulator of auxin transport
Previous work has established that polar auxin transport is required for the initiation of
axillary meristems during inflorescence development. In Arabidopsis, mutants with
defects in components of the auxin transport machinery, such as PIN1 and PID, produce
defective inflorescences devoid of florets. In maize, bif2, the co-ortholog of PID, also
produces defective inflorescences, with reduced numbers of branches, spikelets and
florets (McSteen and Hake 2001; McSteen et al.2007). Chapter 2 describes the
157
characterization of Bif1, a maize mutant with a similar phenotype to bif2, suggesting that
the two genes function in similar pathways. Genetic techniques were utilized to establish
that Bif1 has overlapping function with bif2 in both vegetative and reproductive
development, from which we infer that Bif1 encodes an auxin transport regulator
(McSteen and Hake 2001; McSteen et al. 2007). Because no PIN or PID-like genes have
been found to map in the proximity of Bif1, it is likely that this work has identified a new
player in the auxin transport pathway.
5.2.2 Map-based cloning of bif1
A future goal of research in this field will be to clone bif1 and determine the nature of the
BIF1 protein. This information would yield great insight into the mechanism of auxin
transport, especially if BIF1 is a novel protein, as hypothesized. This goal is within sight.
bif1 has already been mapped to an area within 6 cM on chromosome 8 (Appendix). The
rice and sorghum genome sequence is now available, and a draft of the maize genome
sequence has been released and will be completed by the end of the year. This has made
positional cloning a feasible method of cloning genes in maize (Bortiri et al. 2006). The
next step in cloning bif1 will be to utilize the new genomic data available to identify
additional markers in the region.
After bif1 is cloned, the next step would be to investigate the interaction between
bif1 with other inflorescence development mutants, such as bif2, ba1 and spi1. This
would be done by RT-PCR to look at expression levels, and RNA in situ hybridization to
investigate localization of expression.
158
5.2.3 The interaction between localized auxin biosynthesis and auxin transport
The importance of localized auxin biosynthesis in plant development was illustrated by
work on the YUC genes of Arabidopsis, rice and petunia (Zhao 2008). Loss-of-function
YUC mutants have defects in embryogenesis and seedling, vascular and inflorescence
development, demonstrating the important role of localized auxin biosynthesis in plant
development (Cheng et al. 2006). However, because of functional redundancy amongst
members of the YUC gene family, several YUC genes must be mutated to see these
phenotypes (Cheng et al. 2007). In Chapter 3, the characterization and cloning of spi1, a
YUC-like gene from maize, is described. The spi1 mutant has defects in axillary
meristem and lateral organ initiation during inflorescence development. spi1 is the first
example of mutation at a single YUC gene causing severe inflorescence defects. spi1;
bif2 double mutants have a synergistic phenotype, and ZmPIN1a is mis-localized in spi1
mutants. These results indicate that spi1 functions in the regulation of auxin transport.
Further investigation of the specific role of spi1 is described in chapter 4. It was
found that spi1 mutants produce tassels that are reduced in length compared to normal.
Detailed analysis of the causes of this reduction in tassel length revealed that the cells of
the spi1 tassels fail to elongate. Therefore, localized auxin biosynthesis is required for
cell elongation during tassel development. It is likely that localized auxin biosynthesis
could function to up-regulate auxin transport at specific time points of development, such
as cell elongation during tassel development.
159
A link between auxin biosynthesis and transport is implied by several pieces of
evidence. In chapter 4, an interaction between localized auxin biosynthesis and
localization of PIN1.
5.2.4 Future experimentation
The experiments described in chapter 4 suggest that spi1 does not function in apical
meristem maintenance, however the cause of the abnormal development of spikelets over
the apex of the spi1 tassel is still unclear. RNA in situ hybridization using kn1 as a
marker would be a useful tool. The expression patterns of additional meristem markers
in the apical meristem would provide insight into the role of spi1 in the apical meristem.
Although this work has established a link between auxin biosynthesis and
transport, the molecular basis of the interaction between the two processes is still
unknown. Future experimentation could investigate this interaction further by
determining if auxin biosynthesis regulates auxin transport, or if auxin transport regulates
auxin biosynthesis. Biochemical techniques could be used to identify proteins interacting
with spi1.
160
5.3 Future Perspectives
5.3.1 The role of other hormones in inflorescence development
In this thesis I have focused on the role of auxin in inflorescence development. However,
it is well known that a variety of plant hormones function in many phases of plant
development, including inflorescence development. The plant hormone cytokinin
functions in apical meristem maintenance, and identification of the log mutant of rice has
revealed the importance of cytokinin in inflorescence development. LOG encodes a
phosphoribohydrolase which functions in cytokinin biosynthesis. Mutations in LOG
result in a smaller apical meristem, which causes defects such as a reduction in panicle
size, and a decrease in floral organ number. Other hormones such as gibberellic acid and
treahlose function in meristem determinacy. Mutants such as the tasselseed class of
mutants have defects in meristem determinacy, resulting in defects in the separation of
male and female inflorescences, and in the numbers of floral organs.
It is unlikely that these hormones act separately. A challenge facing future
investigators in this field will be to integrate research into each of these hormones to
create a global model for inflorescence development, which is the key to understanding
this process.
161
5.4 References
Bortiri, E., D. Jackson and S. Hake (2006). "Advances in maize genomics: the
emergence of positional cloning." Current Opinion in Plant Biology 9 : 164-171.
Cheng, Y. F., X. H. Dai and Y. Zhao (2007). "Auxin synthesized by the YUCCA flavin
monooxygenases is essential for embryogenesis and leaf formation in
Arabidopsis." Plant Cell 19 (8): 2430-2439.
Cheng, Y. F., X. H. Dai and Y. D. Zhao (2006). "Auxin biosynthesis by the YUCCA
flavin monooxygenases controls the formation of floral organs and vascular
tissues in Arabidopsis." Genes & Development 20 (13): 1790-1799.
McSteen, P. and S. Hake (2001). "barren inflorescence2 regulates axillary meristem
development in the maize inflorescence." Development 128 (15): 2881-2891.
McSteen, P., S. Malcomber, A. Skirpan, C. Lunde, X. Wu, E. Kellogg and S. Hake
(2007). "barren inflorescence2 encodes a co-ortholog of the PINOID
serine/threonine kinase and is required for organogenesis during inflorescence
and vegetative development in maize." Plant Physiology 144 : 1000-1011.
Zhao, Y. (2008). "The role of local biosynthesis of auxin and cytokinin in plant
development." Current Opinion in Plant Biology 11 : 16-22.
APPENDIX
Positional cloning of barren inflorescence1
A.1 Introduction
Significant progress has been made towards cloning the barren inflorescence1 gene using
a positional cloning approach. barren inflorescence1 (bif1) was previously mapped to
Chromosome 8, bin 2. To obtain a more accurate map location for bif1, a mapping
population was constructed by crossing Bif1 heterozygotes in the B73 inbred background
to normal plants of the Mo17 inbred background and then backcrossed to Mo17.
Markers located in the bif1 region were identified based on genetic maps available at
www.maizegdb.org. Markers which displayed polymorphism between B73 and Mo17
were used to identify recombinants in the mapping population. This enabled us to narrow
down the Bif1 interval to approximately 6 cM.
A.2 Results
A.2.1 Construction of mapping population
Bif1 heterozygotes introgressed a minimum of 6 times into the B73 background were
crossed to Mo17 plants and then backcrossed to Mo17. Seed obtained from these crosses
was planted in the field resulting in a mapping population of approximately 1100
163
individuals. Tissue was collected from two week old plants and DNA extracted using a
Tissue Lyzer, as described in Chapter 2. Using genetic maps of chromosome 8 available
at www.maizegdb.org, markers polymorphic between the B73 and Mo17 genetic
backgrounds were identified.
A.2.2 Identification of recombinants
A small mapping population of 300 individuals was grown in the greenhouse and used to
identify two markers flanking the bif1 region that were polymorphic between B73 and
Mo17 (idp98 and umc1360). These markers were used to genotype every individual of
the field grown mapping population. At maturity, the mapping population was scored for
the Bif1 heterozygous phenotype. 20 recombinants were identified for idp98, and 27 for
umc1360. Additional tissue was harvested from these individuals to verify genotyping.
A second field mapping population was planted in 2008 to obtain a more accurate map
location.
A.2.3 Fine Mapping of recombinants
Additional markers located in the region between idp98 and umc1360 were identified
using www.maizegdb.org, and used to screen the recombinant population to narrow the
bif1 interval. Our most recent data indicates that the closest markers are umc1974 and
idp327.
164
A.3 Discussion and future work
bif1 has been mapped to chromosome 8, bin 2, between markers idp617 and umc1360.
The maize, rice and sorghum genome sequence will be used to design additional markers
in to narrow the bif1 region further. The rice and sorghum genome sequence can also be
used to search for candidate genes in the region. Furthermore, we have identified three
additional Bif1 alleles, which will enable us to verify the gene has been cloned.
165
(A) Screen shot of the bif1 interval, obtained from www.maizesequence.org.
Figure A.1: The bif1 region
Figure A.2: Map location of bif1
167
VITA - Solmaz Barazesh
EDUCATION
Ph.D. The Pennsylvania State University December 2008 Integrative Biosciences, Ecological and Molecular Plant Physiology
B.S. The University of Minnesota, Twin Cities December 2002 Biochemisty PUBLICATIONS
Barazesh, S; and McSteen, P. barren inflorescence1 plays an important role in organogenesis during both inflorescence and vegetative development in maize. Genetics, (2008), vol. 179: 389 – 401. Gallavotti, A*; Barazesh, S*; Hall, D; Jackson, D; Schmidt, R; and McSteen, P. sparse inflorescence1 encodes a monocot specific YUCCA-like flavin monooxygenase required for vegetative and reproductive development in maize. Proceedings of the National Academy of Sciences, (2008), vol. 105, no. 39, 15196-15201. *Joint first authors
Barazesh, S; and McSteen, P. Hormones and genes controlling axillary meristem development in the inflorescence. Trends in Plant Science (2008) doi:10.1016/j.tplants.2008.09.007 .
SEMINARS
Plant Biology Seminar Series, The Pennsylvania State University, December 3, 2007. Plant Biology Seminar Series, The Pennsylvania State University, October 27. 2008. POSTERS Characterization of the Bif1 mutant in maize. 47th Annual Maize Genetics Conference, Lake Geneva, March 10-13, 2005
Characterization of the Barren inflorescence1. Meristems 2005 Conference, Iowa State University, Ames, IA. June 2-5, 2005.
Genetic analysis of Bif1 demonstrates a role in axillary meristem initiation. 48th Annual Maize Genetics Conference, Pacific Grove, CA. March 9-12, 2006
Cloning and Characterization of vanishing tassel1 (vt1). 49th Annual Maize Genetics Conference, St. Charles, IL. March 22-25, 2007 sparse inflorescence1 encodes an auxin biosynthesis gene which functions in axillary meristem initiation in the inflorescence. 50th Annual Maize Genetics Conference. Washington, D.C., February 27-March 2,2008.