University of Kentucky University of Kentucky

UKnowledge UKnowledge

Theses and Dissertations--Plant and Soil Sciences Plant and Soil Sciences

2016

THE EFFECTS OF MANUFACTURED NANOMATERIAL THE EFFECTS OF MANUFACTURED NANOMATERIAL

TRANSFORMATIONS ON BIOAVAILABILITY, TOXICITY AND TRANSFORMATIONS ON BIOAVAILABILITY, TOXICITY AND

TRANSCRIPTOMIC RESPONSES OF TRANSCRIPTOMIC RESPONSES OF CAENORHABDITIS ELEGANS

Daniel L. Starnes Univeristy of Kentucky, daniel.starnes@uky.edu Digital Object Identifier: http://dx.doi.org/10.13023/ETD.2016.058

Right click to open a feedback form in a new tab to let us know how this document benefits you. Right click to open a feedback form in a new tab to let us know how this document benefits you.

Recommended Citation Recommended Citation Starnes, Daniel L., "THE EFFECTS OF MANUFACTURED NANOMATERIAL TRANSFORMATIONS ON BIOAVAILABILITY, TOXICITY AND TRANSCRIPTOMIC RESPONSES OF CAENORHABDITIS ELEGANS" (2016). Theses and Dissertations--Plant and Soil Sciences. 74. https://uknowledge.uky.edu/pss_etds/74

This Doctoral Dissertation is brought to you for free and open access by the Plant and Soil Sciences at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Plant and Soil Sciences by an authorized administrator of UKnowledge. For more information, please contact UKnowledge@lsv.uky.edu.

STUDENT AGREEMENT: STUDENT AGREEMENT:

I represent that my thesis or dissertation and abstract are my original work. Proper attribution

has been given to all outside sources. I understand that I am solely responsible for obtaining

any needed copyright permissions. I have obtained needed written permission statement(s)

from the owner(s) of each third-party copyrighted matter to be included in my work, allowing

electronic distribution (if such use is not permitted by the fair use doctrine) which will be

submitted to UKnowledge as Additional File.

I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and

royalty-free license to archive and make accessible my work in whole or in part in all forms of

media, now or hereafter known. I agree that the document mentioned above may be made

available immediately for worldwide access unless an embargo applies.

I retain all other ownership rights to the copyright of my work. I also retain the right to use in

future works (such as articles or books) all or part of my work. I understand that I am free to

register the copyright to my work.

REVIEW, APPROVAL AND ACCEPTANCE REVIEW, APPROVAL AND ACCEPTANCE

The document mentioned above has been reviewed and accepted by the student’s advisor, on

behalf of the advisory committee, and by the Director of Graduate Studies (DGS), on behalf of

the program; we verify that this is the final, approved version of the student’s thesis including all

changes required by the advisory committee. The undersigned agree to abide by the statements

above.

Daniel L. Starnes, Student

Dr. Olga Tsyusko, Major Professor

Dr. Mark Coyne, Director of Graduate Studies

THE EFFECTS OF MANUFACTURED NANOMATERIAL TRANSFORMATIONS ON BIOAVAILABILITY, TOXICITY AND TRANSCRIPTOMIC RESPONSES OF

CAENORHABDITIS ELEGANS

DISSERTATION

A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the

College of Agriculture, Food, and Environment at the University of Kentucky

By

Daniel Lee Starnes

Lexington, Kentucky

Co-Directors: Dr. Olga Tsyusko and Dr. Paul Bertsch

Lexington, Kentucky

2016

Copyright © Daniel Lee Starnes 2016

ABSTRACT OF DISSERTATION

THE EFFECTS OF MANUFACTURED NANOMATERIAL TRANSFORMATIONS ON BIOAVAILABILITY, TOXICITY AND TRANSCRIPTOMIC RESPONSES OF

CAENORHABDITIS ELEGANS

In recent decades, there has been a rapid expansion in the use of manufactured nanoparticles (MNPs). Experimental evidence and material flow models predict that MNPs enter wastewater treatment plants and partition to sewage sludge and majority of that sludge is land applied as biosolids. During wastewater treatment and after land application, MNPs undergo biogeochemical transformations (aging). The primary transformation process for silver MNPs (Ag-MNPs) is sulfidation, while zinc oxide MNPs (ZnO-MNPs) most likely undergo phosphatation and sulfidation. Our overall goal was to assess bioavailability and toxicogenomic impacts of both pristine, defined as-synthesized, and aged Ag- and ZnO-MNPs, as well as their respective ions, to a model organism, the soil nematode Caenorhabditis elegans.

We first investigated the toxicity of pristine Ag-MNPs, sulfidized Ag-MNPs (sAg-MNPs), and AgNO3 to identify the most sensitive ecologically relevant endpoint in C. elegans. We identified reproduction as the most sensitive endpoint for all treatments with sAg-MNPs being about 10-fold less toxic than pristine Ag-MNPs. Using synchrotron x-ray microspectroscopy we demonstrated that AgNO3 and pristine Ag-MNPs had similar bioavailability while aged sAg-MNPs caused toxicity without being taken up by C. elegans. Comparisons of the genomic impacts of both MNPs revealed that Ag-MNPs and sAg-MNPs have transcriptomic profiles distinct from each other and from AgNO3. The toxicity mechanisms of sAg-MNPs are possibly associated with damaging effects to cuticle.

We also investigated the effects pristine zinc oxide MNPs (ZnO-MNPs) and aged ZnO-MNPs, including phosphatated (pZnO-MNPs) and sulfidized (sZnO-MNPs), as well as ZnSO4 have on C. elegans using a toxicogenomic approach. Aging of ZnO-MNPs reduced toxicity nearly 10-fold. Toxicity of pristine ZnO-MNPs was similar to the toxicity caused by ZnSO4 but less than 30% of responding genes was shared between these two treatments. This suggests that some of the effects of pristine ZnO-MNPs are also particle-specific. The genomic results showed that based on Gene Ontology and induced biological pathways all MNP treatments shared more similarities than any MNP treatment did with ZnSO4.

This dissertation demonstrates that the toxicity of Ag- and ZnO-MNPs to C. elegans is reduced and operates through different mechanisms after transformation during the wastewater treatment process.

KEYWORDS: Silver Nanomaterials, Zinc oxide nanomaterials, Bioaccumulation, Nanomaterial transformations, Wastewater treatment, Agriculture

_______________________________ Student’s Signature _______________________________ Date

Daniel Lee Starnes

4-21-2016

THE EFFECTS OF MANUFACTURED NANOMATERIAL TRANSFORMATIONS ON BIOAVAILABILITY, TOXICITY AND TRANSCRIPTOMIC RESPONSES OF

CAENORHABDITIS ELEGANS

By

Daniel Lee Starnes

_________________________ Co-Director of Dissertation

_________________________

Co-Director of Dissertation

_________________________ Director of Graduate Studies

_________________________

Date

Dr. Olga Tsyusko

Dr. Paul Bertsch

Dr. Mark Coyne

4-21-2016

Dedication

This dissertation is sincerely dedicated to Dr. Olga Tsyusko and Dr. Jason Unrine for their steadfast support over the years, and to my wife, Mrs. Catherine Starnes for your

unwavering faith and love.

iii

ACKNOWLEDGEMENTS

Ultimately I am responsible for the following dissertation. However, the

following work represents the combined efforts of many people. To rephrase Newton, I

have had the support of academic giants that without their wisdom and guidance this

endeavor would have been folly. First I must acknowledge my Co-Advisors, Dr. Olga

Tsyusko and Dr. Paul Bertsch, for their leadership and mentorship. Next, I would like to

acknowledge Dr. Jason Unrine, for his tireless efforts to push me to higher levels of

academic and scholarly standards. I would like to thank the balance of my committee and

outside examiner, respectively: Dr. Timothy McClintock, Dr. Mary Vore, and Dr.

Natasha Kyprianou. This dissertation has benefited tremendously from the guidance,

recommendations, and input from each member mentioned here. I would also like to

thank the statistical support that I have received during this dissertation from the Applied

Statistic Lab at the University of Kentucky, Dr. Constance Wood, and Mrs. Catherine

Starnes.

Beyond the research support above, I have a great deal of thanks to give to my

supportive friends and family that made this dissertation successful. Above all, I must

thank my wife, Mrs. Catherine P. Starnes, for her support of this process beyond her

statistical inputs. This project, simply put, would not have been completed without her

unwavering support during my dissertation. I would like to thank my dear friends, Mr.

Rick Lewis and Ms. Emily Oostveen for all that they have done in and out of the

laboratory; they both brought great levity to this project. Lastly, I would like to thank my

father, Mr. Lawrence Starnes, and mother, Mrs. Linda Starnes, for supporting my love of

all things Science and Agriculture.

iv

TABLE OF CONTENTS ACKNOWLEDGEMENTS ............................................................................................... iii LIST OF TABLES ............................................................................................................ vii LIST OF FIGURES ......................................................................................................... viii Chapter 1: Manufactured nanoparticles, a new class of emerging contaminants ............... 1

Applications of MNPs ..................................................................................................... 2 Entry of MNPs into terrestrial environment .................................................................... 3 Transformations of MNPs ............................................................................................... 5 Toxicity of MNPs in terrestrial ecosystems .................................................................... 7

Effects of MNPs on bacteria and fungi ........................................................................ 8 Effects of MNPs on plants ........................................................................................... 8 Effects of MNPs on other soil organisms .................................................................. 10

Caenorhabditis elegans as a model organism ............................................................... 10 Nanotoxicity studies in C. elegans and their challenges ............................................... 12

Mechanisms of MNP toxicity to C. elegans ............................................................... 15 Conclusions ................................................................................................................... 17 Objectives and Hypothesis ............................................................................................ 18

Chapter 2: Impact of sulfidation on the bioavailability and toxicity of silver nanoparticles to Caenorhabditis elegans. ................................................................................................ 20

Abstract ......................................................................................................................... 20 Introduction ................................................................................................................... 21 Materials and Methods .................................................................................................. 23

Silver Nanoparticle Synthesis and Characterization................................................. 23 Exposure Medium ...................................................................................................... 24 Dissolution Experiments ............................................................................................ 24 Nematode exposure and toxicity experiments ........................................................... 24 Particle-specific effects versus Ion-specific effects ................................................... 26 Synchrotron x-ray fluorescence microscopy ............................................................. 27 Statistical Methods .................................................................................................... 27

Results ........................................................................................................................... 28 Characterization and Dissolution Measurements ..................................................... 28 Toxicity and Bioavailability ....................................................................................... 29 Bioavailability ........................................................................................................... 34

Discussion ..................................................................................................................... 36 Chapter 3: Distinct transcriptomic responses of Caenorhabditis elegans to pristine and sulfidized silver nanoparticles. .......................................................................................... 42

Abstract ......................................................................................................................... 43 Introduction ................................................................................................................... 43 Materials and Methods .................................................................................................. 46

Silver nanoparticle synthesis and characterization ................................................... 46 Nematode exposure and microarrays ........................................................................ 47 qRT-PCR: Validation of Microarray Data. ............................................................... 50

Results and Discussion .................................................................................................. 51 qRT-PCR confirmation .............................................................................................. 55 Biological Pathways and Gene Ontology .................................................................. 55

v

Toxicity using Mutant Strains and RNA interference ................................................ 62 Conclusions ................................................................................................................... 65

Chapter 4: Toxicogenomic responses of Caenorhabditis elegans to pristine and aged Zinc Oxide nanoparticles. ......................................................................................................... 67

Capsule .......................................................................................................................... 67 Highlights ...................................................................................................................... 67 Abstract ......................................................................................................................... 67 Introduction ................................................................................................................... 68 Materials and Methods .................................................................................................. 71

Zinc Oxide Nanoparticle Synthesis and Characterization ........................................ 71 Aging .......................................................................................................................... 71 Exposure Medium ...................................................................................................... 72 Dissolution Experiments ............................................................................................ 73 Nematode exposure and toxicity experiments ........................................................... 73 Particle-specific versus Ion-specific effects .............................................................. 75 Nematode exposure and microarrays ........................................................................ 75 qRT-PCR: Validation of Microarray Data. ............................................................... 76 Statistical Analysis ..................................................................................................... 77

Results and Discussion .................................................................................................. 78 Characterization and Dissolution ............................................................................. 78 Toxicity ...................................................................................................................... 80 Reproduction ............................................................................................................. 83 Microarray results ..................................................................................................... 84 qRT-PCR confirmation .............................................................................................. 87 Biological Pathways and Gene Ontologies ............................................................... 88

Conclusions ................................................................................................................... 95 Acknowledgements ....................................................................................................... 96

Chapter 5: Conclusions and Future Direction ................................................................... 98 Appendices ...................................................................................................................... 103

Chapter 2 Appendix .................................................................................................... 103 Chapter 3 Appendix .................................................................................................... 107 Chapter 4 Appendix .................................................................................................... 114

References ....................................................................................................................... 126 Vitae ................................................................................................................................ 146

vi

LIST OF TABLES Table 3.1 List of pathways that were identified by DAVID ............................................57 Table 3.2 List of Gene Ontology terms ...........................................................................60 Table 4.1 List of pathways that were identified by Partek ..............................................89 Table 4.2 List of Biological Process Gene Ontology terms .............................................92 Table 4.3 List of Molecular Function Gene Ontology terms ...........................................94 Table 4.4 List of Cellular Compartments Gene Ontology terms .....................................94 Table A-3.1 ABI assay IDs used for qRT-PCR confirmation .........................................109 Table A-4.1 ABI assay IDs used for qRT-PCR confirmation .........................................118 Table A-4.2 Complete List of Biological Process Gene Ontology terms ........................119 Table A-4.3 Complete List of Molecular Function Gene Ontology terms ......................123 Table A-4.4 Complete List of Cellular Compartments Gene Ontology terms ................125

vii

LIST OF FIGURES Figure 1.1 The cumulative number of products with manufactured nanoparticles in the Project for Emerging Nanotechnology Consumer Product Inventory .............................2 Figure 1.2 Potential mechanism for toxicity of manufactured nanoparticles (MNPs) in Caenorhabditis elegans ...................................................................................................17 Figure 2.1 The percent dissolution of pristine silver manufactured nanoparticles ..........29 Figure 2.2 Mortality of Caenorhabditis elegans after 24 hours without feeding ............30 Figure 2.3 Mortality of Caenorhabditis elegans after 24 hours in the presences of bacterial food ...................................................................................................................31 Figure 2.4 Mortality of Caenorhabditis elegans after 24 hours without feeding when exposed to particle free supernatants versus whole solutions ..........................................32 Figure 2.5 Observed mean body length of Caenorhabditis elegans measured after 48 hours .................................................................................................................................33 Figure 2.6 Mean total number of offspring per adult nematode Caenorhabditis elegans after 48 hours ...................................................................................................................34 Figure 2.7 Ag Kα1 fluorescence of Caenorhabditis elegans specimens that were exposed to LC30 ..............................................................................................................................35 Figure 3.1 Hierarchical clustering of significantly expressed genes from Caenorhabditis elegans .............................................................................................................................53 Figure 3.2 Venn diagram of the significantly up/down regulated genes .........................54 Figure 3.3 Mortality of L3 Caenorhabditis elegans after 24 hours without feeding .......64 Figure 4.1 The percent dissolution of pristine zinc oxide manufactured nanoparticles ..80 Figure 4.2 Mortality of L3 Caenorhabditis elegans after 24 hours without feeding .......82 Figure 4.3 Mortality of Caenorhabditis elegans after 24 hours without feeding when exposed to particle free supernatants versus whole solutions ..........................................83 Figure 4.4 Mean total number of offspring per adult nematode Caenorhabditis elegans..........................................................................................................................................84 Figure 4.5 Venn diagram of the significantly up/down regulated genes .........................85 Figure 4.6 Hierarchical clustering of significantly expressed genes from Caenorhabditis elegans .............................................................................................................................87 Figure A2-1 Representative transmission electron micrographs .....................................104 Figure A2-2 Intensity weighted Z-average hydrodynamic diameter ...............................105 Figure A2-3 Volume weighted Z-average hydrodynamic diameter ................................106 Figure A3-1 Gene expression from N2 wild type nematodes for the house keeping gene..........................................................................................................................................108 Figure A3-2 Microarray result for gene expression of 5 ground-like and 6 collagen genes..........................................................................................................................................110 Figure A3-3 Gene expression from N2 wild type nematodes of four genes ...................111 Figure A3-4 Gene expression from L3 wild type N2 nematodes ....................................112 Figure A3-5 Mortality of L3 Caenorhabditis elegans after 24 hours without feeding exposure ...........................................................................................................................113 Figure A4-1 Zeta Potential distribution of pristine Zinc Oxide manufactured nanoparticles ....................................................................................................................114 Figure A4-2 X-ray absorption spectroscopy ....................................................................115

viii

Figure A4-3 X-ray absorption spectroscopy ....................................................................116 Figure A4-4 Intensity weighted Z-average .....................................................................117

1

Chapter 1: Manufactured nanoparticles, a new class of emerging contaminants

Nanoparticles (NP), both natural and anthropogenic, are defined as having at least

one dimension less than 100 nm1. When materials have such dimensions, their properties

can vary as a function of size; this has been exploited to create new technologies in the

field of nanotechnology. Naturally occurring NPs have been present during the whole of

Earth’s history 2. Natural NPs include the majority of clays, metal oxides, metal

oxyhydroxides, and volcanic ash. The largest source of natural NPs is weathering of

terrestrial soils, with clays comprising 107-8 Tg (Tg=trillion grams)3. The use of

inorganic NPs by humans, such as Ag and Au, for dichroic color effects dates back as far

as the fourth century of Roman and Greek empires 4. Recently, the production levels, as

well as market penetration of manufactured nanoparticles (MNPs) have increased rapidly,

appearing in a multitude of different consumer products from cosmetics and medical

devices, to industrial grade lubricants 5. Current projections indicate that, by the middle

of this decade, global trade in MNPs will exceed 2.3 trillion dollars 6. The Project on

Emerging Nanotechnologies (PEN) developed a consumer product inventory (CPI) of

consumer goods and has catalogued over 1800 consumer products that contain some form

of MNPs, either directly in the products or at some stage of their production. The CPI

undoubtedly underestimates the number of MNP containing products, since the

manufacturers are not required to report MNP additions to products to regulatory

agencies. Approximately 200-300 new products are being added to the CPI each year,

with the caveat that these are mainly products advertised on the internet (Figure 1.1.)7.

The expansion in the use and development of MNPs has given rise to a multitude of

scientific questions about the fate of MNPs, their impacts on the environment, and

2

ultimately on human health 8. Many of the nano-related publications have focused on the

toxicity (human and/or ecological) of MNPs with fewer studies focusing on their

environmental fate 9.

Figure 1.1. The cumulative number of products with manufactured nanoparticles in the Project for Emerging Nanotechnology Consumer Product Inventory (CPI). The blue bars are based on actual numbers in CPI; red bars are predicted using linear regression.*Graphic adapted from Vance et al., 2015.

Applications of MNPs Some of the most commonly used MNPs in consumer products are Ag, Au,

carbon nanotubes, CeO2, TiO2, and ZnO 10. Ag-MNPs have been extensively utilized for

their antimicrobial properties; affecting a wide range of bacteria, both gram positive and

negative 11-13. Ag-MNPs have also been shown to have fungicidal properties14-16.

Because of these properties, Ag-MNPs are being utilized in many medical applications

such as catheters, textiles, cosmetics, and plastic containers 17-20. Au-MNPs are being

0

500

1000

1500

2000

2500

Number of Products

Year

3

deployed in cancer detection, as biosensors, and as an enhancer of catalysis 21-23. Carbon

nanotubes (CNT) have many uses including marine anti-fouling coating on ship hulls,

high strength to weight composite materials, and biosensors 24-26. Cerium oxide MNPs are

a popular diesel fuel additive in much of Europe. They are used to reduce diesel

particulate emissions and increase combustion efficiency 27. Zinc oxide MNPs (ZnO-

MNPs) and titanium dioxide MNPs (TiO2-MNPs) are both heavily utilized for their UV

protective properties and can be found extensively in cosmetics and sunscreens 28-30. In

addition, ZnO-MNPs are being investigated for use as a chemotherapeutic agent since

they have been shown to promote cell death through DNA fragmentation, mitochondrial

damage, and promote autophagy31-33. ZnO-MNPs have potential application as a

materials coating as it has been shown that ZnO-MNPs can be used as an antimicrobial

agent while maintaining up to 90% of light transmittance through glass substrates and

also adding to the mechanical strength of the glass 34. Other applications of ZnO-MNPs

include adding the MNPs to food packaging and containers to reduce food spoilage 35.

Finally, ZnO-MNPs are also being investigated for use as cheap, highly sensitive, and

tunable optical and chemical sensors 36, 37. Production estimates for the United States

have a predicted upper bound of around 20 tons per year for Ag-MNPs and 38,000 tons

per year for TiO2-MNPs; the predicted upper bound for ZnO-MNPs is 2100 tons per year

38, 39. Given the high number of products containing nanomaterials, MNPs released from

these products through regular use or accidental release eventually enter the environment.

Entry of MNPs into terrestrial environment Though there are several pathways for MNPs to enter the environment, the

primary route identified is through wastewater treatment plants (WWTP), where majority

of MNPs partition into sewage sludge, and after treated sludge is applied in the form of

4

biosolids as a soil amendment. Nearly three out of four households in the United States

(U.S.) are connected to a WWTP and over half of the biosolids at WWTP are being land

applied in the U.S. and in Europe 40, 41,42-44. Due to the high production volumes, three

species of MNPs (Ag, ZnO, and TiO2) represent a significant amount of the total MNPs

that are predicted to enter terrestrial ecosystems 43, 45, 46. Based on models developed by

Gottschalk et al. in 2009, MNP concentrations in biosolids-amended soils were predicted

to increase 3.2-fold for Ag-MNPs, 5-fold for TiO2-MNPs, and 3.3-fold for ZnO-MNPs

between 2008 and 2012 47. However, biosolids are not applied evenly with higher

application expected in the farm peri-urban areas which will result in increased MNP

concentrations in these soils. European Union soils amended with biosolids from

WWTPs are expected to have upper bound annual increases in Ag-MNPs of 0.03 µg kg-

1y-1, TiO2-MNPs 3600 µg kg-1y-1, and ZnO-MNPs of 0.3 µg kg-1y-1 48. The predicted

concentration of nano-derived Ag in biosolids in the E.U. is about 1mg kg-1. Taking into

consideration this concentration and the finding that 1-3% of biosolids occur within the

tillage depth (~17 cm), the estimates for Ag concentration within the tillage depth after

annual application of biosolids can reach up to 30 µg/kg/y 49. However, the

concentration of Ag in the soil pore water will be much lower. According to Whitley et

al. (2013), after two months of aging the Ag concentrations in soil pore water was only

about 5% from the bulk Ag soil concentrations and it decreased to 1% over six month of

aging50.

Currently, our understanding of how these increasing loads of MNPs will affect

the biotic communities within soils and how that could translate to impacts to agricultural

production, human health, and environmental quality is insufficient to fully assess the

5

risk that MNPs pose. However, even at the environmentally relevant low Ag

concentrations, there are evidences for the effects on ecosystem functions through the

studies performed with mesocosms51. In this study, the authors found that biosolids slurry

spiked with Ag-MNPs had effects greater than or equal to the effects of biosolids slurry

spiked with AgNO3. The Ag-MNPs used in the study were transformed in the biosolids

and the Ag-MNPs still had impacts on microbial biomass and composition, altered

extracellular enzymatic activity, and even had effects on the plant species in the

mesocosms. The biomagnification and trophic transfer of MNPs have been also examined

by a few studies using Au-MNPs. One study examined trophic transfer of Au-MNPs from

tobacco plant (Nicotiana tabacum), grown hydroponically in Au-MNP solutions, to

tobacco hornworm (Manduca sexta) and found that M. sexta was able to biomagnify Au-

MNPs52. A second study found that bullfrogs (Rana catesbeiana) fed earthworms

(Eisenia fetida) grown in the presence of Au-MNPs had a higher Au body burden when

compared to the bullfrogs exposed to Au-NPs through an oral gavage53. These studies

taken together suggest that MNPs do have the ability to bioaccumulate in food chains and

have ecosystem level effects.

Transformations of MNPs Once MNPs are released into the environment, they will be exposed to a dynamic

suite of factors such as variations in ionic strength and composition, organic and

inorganic ligands, variable pH, natural organic matter (NOM), and UV radiation all of

which have been reported to alter MNPs 54-58. Dissolution of MNPs is governed by

several factors including pH, redox potential, and the presence of various ligands59-61.

Some MNPs such as Au, CeO2, and TiO2 are unlikely to undergo dissolution under most

environmental conditions 62-64. However, MNPs like ZnO and Ag have been shown to

6

undergo dissolution, which will be greatly influenced by environmental conditions 55, 61,

65, 66. MNPs are also subject to aggregation both during manufacture and after

environmental release. Many of the same factors that affect dissolution also affect the

propensity of the MNPs to aggregate. In addition to the environmental factors, the surface

chemistry of the MNPs will also influence the formation of aggregates. MNPs with

highly positive or negatively charged surfaces that create electrostatic repulsion tend to

remain suspended. This electrostatic stabilization arises from the repulsive nature of like

charges in close proximity. In addition to this, charged MNPs can attract counter-ions

forming an electrical double layer and this can promote the stability of the MNPs67. The

aggregation of MNPs is favored in environments with high ionic strengths and/or the

presence of divalent cations68, 69. MNPs can form either homo- or hetero-aggregates.

Homo-aggregates are comprised of MNPs of the same type. In contrast, hetero-

aggregates are comprised of multiple particle types 61. The presence of natural organic

matter and other macromolecules can sufficiently coat MNPs. These coatings, once

solvated become relatively incompressible and when the distance between two particles

decrease, a strong repulsive force which promotes the stability of MNPs in suspension

increases70, 71. Interactions of MNPs with NOM have been shown to decrease the surface

charge of Ag, Au, CeO2, TiO2, and ZnO-MNPs 72-77. Altering surface charge and/or

complexation with NOM has been shown to promote the formation of homo- and hetero-

aggregates of MNPs, which can subsequently alter the MNPs bioavailability, mobility,

and toxicity 78. The exudates from the aquatic plant Egeria densa was shown to promote

colloidal stability of polyvinylpyrrolidone coated Ag-MNPs, promote dissolution of gum

7

arabic coated Ag-MNPs, and reduce the toxicity of both Ag-MNPs to zebrafish (Danio

rerio) 79, 80.

In addition to aggregation and dissolution, chemical transformations of the MNP

cores occur. Ag-MNPs entering the WWTPs have been the focus of several studies;

based on WWTPs having high SH- concentrations and low redox potential, virtually all of

the Ag is converted to Ag2S44, 66, 81. Ag-MNPs undergo surface mediated oxysulfidation,

which results in removal of coatings, a significant change in zeta potential, and a sizeable

decrease in solubility compared to the pristine Ag-MNPs 61, 66, 82. Kent at al. (2015)

demonstrated that Ag-NPs can suflidize directly without complete dissolution and

formation of secondary precipitates82. ZnO-MNPs discharged from parent consumer

goods into wastewater streams will enter environments enriched with PO43- and SH- as

they move through the WWTP. ZnO-MNPs are quickly transformed into Zn3(PO4)2 and

other Zn species which result in a significant decrease in the release of Zn2+ 83, 84. Lombi

et al. (2012) showed that for both fresh and aged biosolids the dominant Zn species was

initially ZnS. Additionally, they found that over time the speciation shifted from ZnS to

Zn3(PO4)283, 85. In a pilot-scale WWTP, Ag was transformed to Ag2S, while ZnO was

transformed to ZnS, Zn3(PO4)2 and Zn2+ bound to iron oxohydroxides 86. The effects of

the transformed MNPs introduced to soil through biosolids on biota have only recently

begun to be explored87-89 .

Toxicity of MNPs in terrestrial ecosystems The field of nanotoxicology has developed as a response to the rapid expansion of

the use of nanotechnology 2, 5. Three key issues have been identified as high priorities for

developing adequate testing of MNPs: i) the organisms being tested and the endpoints

8

used, ii) the exposure pathways, and iii) the specific species of MNPs used in tests and

analytical techniques to detect and quantify the MNPs 90, 91. As noted by Behra and Krug,

a great challenge in toxicological research on MNPs is that their environmental fate and

bioavailability can be affected by a multitude of conditions from pH to the amount of

UV-radiation. As a result of these issues, nanotoxicology is has proven to be a

challenging field which requires, thorough MNP characterization, and appropriate test

organisms.

Effects of MNPs on bacteria and fungi Numerous studies have identified that various MNPs have deleterious effects on

bacterial and fungal species. Gold NPs have been shown to effectively inhibit the growth

of nine different bacteria, and for Enterobacter faecalis, this effect exceeded the

inhibition induced by positive tetracycline controls 92. Ag, TiO2, and ZnO -MNPs have

all been demonstrated to possess antibacterial properties by acting to disrupt membranes,

generating reactive oxygen species (ROS), and interfering with biofilm formation 20, 93-96.

Generation of ROS at the surface of ZnO-MNPs was shown to be an effective inhibitor of

bacterial growth with smaller ZnO-MNPs being more effective than larger ones (12 vs 45

nm)97. Ag-MNPs have also been shown to deleteriously affect nitrogen fixing bacteria,

which has potential important effects on nutrient cycling in soils 98. It has been reported

that Ag-MNPs can effectively reduce the germination frequency of spore forming fungi

Bipolaris sorokiniana and Magnaporthe grisea 99. Others have shown that Ag-MNPs

could be used to fight pathogenic fungal species 100, 101.

Effects of MNPs on plants Agronomic crops grown in soils that have been amended with WWTP biosolids

as a fertilizer will potentially encounter MNPs. Dissolved zinc and ZnO-MNPs have been

9

shown to reduce germination in corn and ryegrass and reduce root elongation in radish,

rapeseed, lettuce, corn, and cucumber 102. ZnO-MNPs were found to impair root growth

in ryegrass by injuring epidermal and cortical cells and these effects could not be fully

explained by the dissolution of the MNPs 103. In a study that addressed the phytotoxicity

of silica MNPs (SiO2-MNPs) to Arabidopsis thaliana, plants exposed to SiO2-MNPs

experienced reduced biomass, diameter of rosettes, and stem length 104. Ag-MNPs have

been observed to cause a reduction in seed germination and root growth inhibition at

concentrations that exceed the effects of equivalent Ag+ concentrations 105. Biosolids

enriched with transformation products of Ag-, TiO2-, and ZnO-MNPs significantly

decreased the number of nodules formed per plant in Medicago truncatula compared to

biosolids enriched with transformation products of bulk ZnO (Zn2+), bulk TiO2 and

AgNO3 at similar metal concentrations. Additionally, this study reported that the

microbial community was also impacted, showing significant decreases in fungi, both

gram negative and positive bacteria, and eukaryotes in the soils enriched with MNPs. In a

companion study to determine if the toxicity observed was due to microbial toxicity or

plant toxicity, several stress response genes were identified to be significantly

upregulated in the soils amended with biosolids enriched with MNPs. A few of the genes

identified included cytochrome p450, glutathione-s-transferase, peroxidase, and

isoflavone reductase. The plants exposed to biosolids with MNPs and biosolids with bulk

metals shared the oxidative phosphorylation pathway; however, many other metabolic

and metabolism related pathways were unique to roots/shoots exposed to the biosolids

with MNPs 87.

10

Effects of MNPs on other soil organisms When earthworms, Eisenia fetida, were exposed to Ag-MNPs, the toxicity as well

as their molecular responses were primarily attributable to Ag ions, although in the case

of Ag-MNPs, this was partly due to dissolution within the tissues rather than in the soil.

The concentrations of Ag-MNPs predicted in soils amended with biosolids were below

the levels that caused any decrease in reproduction; however, behavioral avoidance

occurred at concentrations which were similar to those expected in the biosolids

themselves 106-109. Springtails (Folsomia candida) were not found to be affected by Ag-

MNPs incorporated into soil media. However, F. candida were sensitive to AgNO3 and

with increasing amounts of Ag-MNPs potentially reaching the soil, this could represent a

significant risk to this sensitive soil species 110. There have been multiple studies on the

impact of several different MNPs on Caenorhabditis elegans which has been widely

accepted as a robust model organism to test MNP toxicity. This will be discussed in the

next sections.

Caenorhabditis elegans as a model organism Nematodes constitute the largest class of soil dwelling invertebrates with 25,00

species classified to date111. Nematodes make up nearly 80% of the animals on earth, and

can be found in nearly all terrestrial, freshwater, and marine environments112. Nematodes

are grazers of plants, fungi, and bacteria and their feeding pressures greatly influence

nutrient cycling and plant growth 113. Caenorhabditis elegans is a transparent,

hermaphroditic, free-living roundworm with approximate length of one mm. It has been

extensively studied by multiple laboratories, resulting in a full understanding of the

worm’s nutritional requirements and life cycle 114, 115. Émile Maupas was the first to

describe Rhabditis elegans, renamed in 1952 to C. elegans, in 1897 outside Algiers,

11

Algeria, noting that the nematode was always found in soils rich with humus 116. In 1965,

Sydney Brenner proposed C. elegans as a model organism for testing and studying

developmental biology in animals 114. Caenorhabditis elegans was the first eukaryotic

organism to have its whole genome sequenced and was found to contain slightly more

than 21,000 genes spanning 6 chromosomes 117. Three Nobel prizes have been awarded

to C. elegans researchers. One of these went to Fire and Mello in 2006 for the discovery

of RNA interference technology (RNAi) which uses RNA to post-transcriptionally

suppress gene expression. This suppression allows for highly specific knockdown of

genes at low doses118. In most eukaryotic organisms, direct injection of double stranded

RNA (dsRNA) is needed to achieve gene suppression. In contrast, C. elegans is capable

of taking up the dsRNA by feeding on E. coli modified to express the dsRNA or by

passive absorption from media 119. Additionally, C. elegans is a useful toxicity testing

platform because results obtained for C. elegans can be used to make predictions in other

higher eukaryotic organisms 120. Cole et al., (2004) showed that the EC50 for locomotion

in C. elegans was significantly correlated with the LD50 for several organic pesticides in

mice and rats 121. It has been shown that using C. elegans as a proxy provides an

inexpensive, high throughput platform to screen large numbers of chemicals due to the

high degree of conservation in molecular pathways between mammals and C. elegans 122.

Over the last two decades, C. elegans has also become a model organism for

ecotoxicity testing and has been used in numerous aquatic and soil toxicity studies 123-127

to investigate the toxic effects of several major classes of environmental contaminants.

Different metals (Cd, Hg, Pb, Al, Ag, Be, Cr,, Cu, Ni, Sb, Sr, and Zn) have been shown

to be toxic to C. elegans when investigating both lethal and sub-lethal (growth, feeding,

12

movement, reproduction) endpoints 123, 128-130. A major class of environmental

contaminants are persistent organic pollutants (POPs), which are chemicals that do not

readily degrade in the environment, such as organochlorine-pesticides131. Caenorhabditis

elegans has been used to assess the toxicity of a variety of POPs such as quinolones,

hexachlorobenzene, and carbamates. The findings of these studies revealed that both

POPs were able to cause lethal effects as well as sub-lethal effects132, 133. Caenorhabditis

elegans has also been employed to investigate the effects of oil and combinations of oil

and dispersants from the Deep Water Horizon (DWH) oil spill in the Gulf of Mexico. The

report showed that both the crude oil from DWH and the most common dispersants used

in the cleanup had deleterious effects on nematode growth and reproduction 134. In

summary, some of the greatest advantages of using C. elegans as a model organism for

investigating the ecotoxicology of MNPs are that they possess rapid reproduction, a short

generation time, a sequenced and annotated genome, multiple phenotypes and genotypes,

that are readily available, a large set of functional genomic tools (mutant strains and

RNAi) and low maintenance costs. One limitation to using C. elegans is that it would be

difficult to expose nematodes to MNPs directly in soils. However, it is not impossible

since several studies have been performed with C. elegans exposed to other contaminants

in soils135-137.

Nanotoxicity studies in C. elegans and their challenges Several studies have employed C. elegans to determine toxicity of MNPs, such as

Ag-MNPs and ZnO-MNPs. Both Ag- and ZnO-MNPs have been shown to cause

increased mortality, decreased growth, and suppressed reproduction 89, 138-151. MNPs

such as Ag- and ZnO-MNPs are soluble in the environment and therefore ion releases

must be included in the risk assessment when evaluating the toxicity of soluble MNPs 152.

13

It has also been shown that the observed effects of Ag-MNP exposure cannot be fully

explained by dissolution of Ag-MNPs, suggesting that toxicity is also due to particle

specific effects that need to be more thoroughly investigated 18, 141, 142, 153, 154. The effects

of ZnO-MNPs on C. elegans also could not be fully explained by ionic interactions alone,

and thus suggest there is a potential for particle specific effects 155, 156. The dissolution of

Ag-MNPs and ZnO-MNPs represents an additional confounding variable; therefore,

experiments with soluble MNPs should be conducted using both, MNPs and an

appropriate metal ion, to differentiate between the effects of the MNPs and intrinsic ion

effects.

One factor that makes direct comparisons between most of the current studies

challenging is the different media that have been utilized to expose the nematodes. It has

been reported that Ag-MNPs have the capacity to decrease the survival reproduction, and

growth rates of wild type C. elegans above the levels of equivalent Ag+ when the

exposures were conducted in high ionic strength solution (K-media; I=10.3, 0.03M KCl,

0.05M NaCl)142. Use of high ionic strength media results in rapid aggregation of Ag-

MNPs and could cause increased dermal exposure due to settling of both the nematodes

and Ag-MNP aggregates at the bottom of the plates. Yang et al. (2012) found that the

exposure media drastically alters the toxicity of the MNPs. The use of moderately hard

reconstituted water (MHRW), which has a lower ionic strength than the commonly

employed K-media for toxicity testing with C. elegans, resulted in an increase in the

toxicity of Ag-MNPs154. This could be due to reaction with consitituents, such as chloride

in K-medial with the precipitation of AgCl. Myer et al., (2010) reported an EC50 for

growth of 2.5 mg/L while Starnes et al., (2015) reported an EC50 for growth at 1.12

14

mg/L89, 141 when C. elegans were exposed to Ag-MNPs. Much of the difference between

the two studies can be attributed to two primary factors. The first is the use of K-media in

the former study, which promotes aggregation of the Ag-MNPs, versus the use of

MHRW in the later study, which stabilizes the particles. Second, K-media has a high Cl-

content which exceeds AgCl, solubility limits reducing the concentration of Ag+ to which

the nematodes are exposed. Thus, media selection in liquid exposures can greatly

influence toxicity of MNPs. Tyne et al., (2013) prepared a new testing media called

synthetic soil pore water (SSPW), which more accurately reflects the conditions that

nematodes would experience within the soil environment. They exposed nematodes in

SSPW using Ag-MNPs which were similar to that of Starnes et al. (2015) and found an

EC50 for reproduction at 2.85 mg/L compared to 0.56 mg/L89, 143 for the Ag-MNPs

exposure in MHRW reported in the Starnes et al study. The difference in EC50 likely can

be attributed to the decreased stress experience by C. elegans in the SSPW.

In addition to liquid media some of the studies have been conducted using

different solid media. For instance, Kim et al. (2012) reported LC50 of 55 mg/L while

Hunt et al. (2014) reported a LC50 of 25 mg/L146, 147 for C. elegans exposed to Ag-MNPs

and the difference in the LC50s is due to the use of different solid media. Studies that used

solid media for exposure reported LC50s that are 10 to 100 fold higher than studies that

used liquid media for exposure. There are three primary differences in the solid and

liquid exposures. First, adding MNPs to hot agar solutions during media preparation for

use in solid media exposures could cause the MNPs to aggregate. Second, in solid media

exposures, the nanoparticles would have to diffuse out of the agar matrix to elicit a

response. It is also possible that the MNPs could be interacting with the functional groups

15

in the agar, thereby altering their toxicity. Finally, the nematodes in liquid suspension

will have both dietary and dermal exposure to the MNPs.

Mechanisms of MNP toxicity to C. elegans The mechanisms of MNP toxicity in C. elegans will be influenced by the physico-

chemical properties of the particles and the exposure scenario, such as choice of media

and the use of pristine or transformed nanomaterials. Potential nanotoxicity mechanisms

described by Choi et al., (2014) are presented in the Figure 1.2 157. This mechanism was

based on the published studies that used pristine MNPs. For pristine MNPs, it has been

demonstrated that MNPs are being taken up in C. elegans from the gut 158. Our recent

study with sulfidized Ag-MNPs, suggests that the primary site of response is likely at the

cuticle level, since the toxicity was elicited in the absence of Ag uptake89.

Recently, the toxicogenomic approach that was previously used to investigate the

effects of metals (As, Cd, Cr, Cu, Pb)159-161 and organochlorine compounds (PCBs)162 on

C. elegans is now being utilized to study the effects of MNPs (Au, Ag, CeO2, TiO2)142,

163-166. To date, there are only few studies investigating effects of MNPs including Au-,

Ag-, and TiO2 on C. elegans using this approach. Exposing C. elegans to Au-MNPs

significantly altered patterns of gene expression with 255 down- and 542 up-regulated

genes, activated several biological pathways, and induced the endoplasmic reticulum

stress and unfolded protein response 166. Roh et al., (2009) investigated the effects of Ag-

MNPs on mortality, growth, reproduction, and genomic response in C. elegans. Their

study attributed reproductive failure to oxidative stress via mutant C. elegans strains for

sod-3 and daf-12142. Previous toxicogenomic studies in C. elegans have clearly shown

that MNPs alter genomic expression profiles. Specifically, MNPs have bene shown to

induce stress response pathways such as oxidative stress, endoplasmic reticulum stress,

16

and increase expression of apoptosis genes. Yang et al., 2014 examined the effects of Ag-

MNPs (both bare and coated) and AgNO3 and found that C. elegans mutant strains for

genes related to apoptosis, immune response and metabolic stress were more sensitive

compared to wild type N2 controls 144. Additionally, they reported that mutants for genes

in daf-16 pathway were most sensitive to AgNO3. This study supports the idea that C.

elegans are responding to MNPs differently than to Ag+ even when exposed at equitoxic

concentrations (LC50) 167. In this same study, the authors also addressed if the toxicity of

Ag-MNPs is solely due to the release of dissolved Ag. By utilizing a series of toxicity

rescue experiments that used compounds that targeted Ag+ and reactive oxygen species

(ROS) independently, they determined that the toxicity of bare Ag-MNPs was due to the

ROS generated by particles and not by release of ions from Ag-MNPs 167.

Titanium dioxide MNPs have been found to induce transcriptomic responses at

environmentally relevant concentrations. One TiO2-MNP toxicogenomic study found that

the MNPs were able to upregulate oxidative stress genes such as sod-2, sod-3, and mtl-2

while another study identified cyp-35 and sod-1 140, 164. Currently, more detailed studies

are needed to better understand the specific mode of action that MNPs have in causing

toxic insult to C. elegans.

17

Figure 1.2. Potential mechanism for toxicity of manufactured nanoparticles (MNPs) in Caenorhabditis elegans. Mz+ are metal ions released from MNPs; ROS are reactive oxygen species. Reproduced with permission from: Choi J, O. Tsyusko, J. Unrine, N. Chatterjee, J. Ahn, X. Yang, B. Thornton, I. Ryde, D. Starnes and J. Meyer. Environmental Chemistry 2014, 11, 227-246 Copyright [2014] CSIRO Publishing

Conclusions Nanomaterials are becoming increasingly commonplace in consumer,

commercial, and industrial applications. Given that the global market for nanomaterials

has been valued above $2.3 trillion USD, there is little doubt that more products will

enter the market in coming years 6. Furthermore, with the majority of the literature

focused on pristine MNPs under simple laboratory conditions, there exists a significant

gap in our understanding of the MNPs in the terrestrial environment. It has also been

found that very few, if any, MNPs will reach the environment in a pristine, as

18

synthesized, condition. Rather, MNPs enter the environment as biogeochemically

transformed products referred to as aged MNPs. In efforts to predict the environmental

impacts, it is crucial to study aged MNPs. The principal transformation for Ag-MNPs in

WWTPs is sulfidation and for ZnO-MNPs is sulfidation and phosphatation. Given that

the majority of MNPs reach the environment after passing through WWTPs, the focus of

the following experiments is on the comparing the effects of the pristine, as synthesized,

and aged (biogeochemically transformed) MNPs. These experiments, and others like

them, are urgently needed when creating any predicative models and sufficiently

protective regulations.

Objectives and Hypothesis

The objectives of my dissertation research are 1) To determine particle and ion

specific toxicological and transcriptomic effects of both pristine and aged MNPs (Ag-

and ZnO-MNPs) to a model organism C. elegans and 2) To investigate the possible

mechanisms of toxicity of these pristine and aged MNPs using available genomic

functional tools for C. elegans and validate genes and associated pathways/protein

networks identified from the microarray analysis.

The first hypothesis is that the toxicity of soluble MNPs (Ag- and ZnO-MNPs)

will be partially controlled by free metal ions due to dissolution of these MNPs. The

second hypothesis is that observed toxicogenomic effects of MNPs on the soil nematode,

C. elegans, will be the result of the combined interactions of the organism with ions and

the intact pristine MNPs or intact aged MNPs.

19

In this dissertation, chapter 2 addresses the effects of pristine and sulfidized Ag-

MNPs and Ag ions (AgNO3) by comparing the impacts to C. elegans mortality, growth,

and reproduction using established toxicological protocols. Chapter 2 also addresses the

differences in the Ag bioavailability of AgNO3, pristine, and sulfidized Ag-MNPs by

exposing C. elegans to their equitoxic concentrations and examining Ag uptake using X-

ray fluorescence microscopy. In chapter 3, the differential transcriptomic responses to

AgNO3, pristine, and aged Ag-MNPs using whole-genome microarrays, qRT-PCR, RNAi

and mutant screenings are investigated. Finally, in chapter 4, the effects of pristine and

two aged ZnO-MNPs as well as ZnSO4 on C. elegans mortality, reproduction, and

transcriptomic responses are examined.

20

Chapter 2: Impact of sulfidation on the bioavailability and toxicity of silver nanoparticles to Caenorhabditis elegans. Reproduced with permission from: Starnes D., Unrine, J., Starnes, C., Collin, B.,

Oostveen, E., Ma, R., Lowry, G., Bertsch, P., Tsyusko, O. Environmental Pollution 2015,

196, 239-246. Copyright [2015] Elsevier B.V.

http://www.sciencedirect.com/science/article/pii/S0269749114004266

Capsule: Sulfidation of silver nanoparticles decreases their dissolution and the associated bioavailability and toxicity to Caenorhabditis elegans.

Highlights

Effects caused by release of ions from silver nanoparticles only dominates

toxicity at low Ag concentrations.

Sulfidation of silver nanoparticles decreased toxicity for all endpoints examined.

Reproduction was found to be the most sensitive endpoint.

Sulfidation decreases the bioavailability of silver nanoparticles to C. elegans.

Abstract Sulfidation is a major transformation product for manufactured silver

nanoparticles (Ag-MNPs) in the wastewater treatment process. We studied the

dissolution, uptake, and toxicity of Ag-MNPs and sulfidized Ag-MNPs (sAg-MNPs) to a

model soil organism, Caenorhabditis elegans. Our results show that reproduction was

the most sensitive endpoint tested for both our Ag-MNPs and sAg-MNPs. We also

demonstrate that sulfidation not only decreases solubility of Ag-MNPs, but also reduces

the bioavailability of intact sAg-MNPs. The relative contribution of released Ag+

compared to intact particles to toxicity was concentration dependent. At lower total Ag

concentration, a greater proportion of the toxicity could be explained by dissolved Ag,

21

whereas at higher total Ag concentration, the toxicity appeared to be dominated by

particle specific effects.

Keywords: soil, transformation, wastewater treatment, nanotechnology, bioaccumulation

Introduction It is estimated that over 20 tons of silver nanoparticles (Ag-MNPs) are produced

annually in the United States (US) ,with over 300 tons estimated globally, making Ag-

MNPs the third most important class of MNPs based on production volume 40, 168. Silver

NPs are extensively utilized for their anti-microbial properties in textiles, plastics, and in

a variety of health care products 169. During manufacture, use, and product disposal, Ag-

MNPs can be released to wastewater streams 18, where they have been shown to partition

largely to sewage sludge during the wastewater treatment process 44, 170. Nearly 75% of

US households are serviced by wastewater treatment plants (WWTPs) and over half of

the biosolids generated are land applied as agricultural fertilizer (EPA 1995). Therefore,

land application of biosolids is the primary route of Ag-MNP introduction to terrestrial

ecosystems 9, 45, 50. As NPs enter WWTPs, they are subjected to biogeochemical

transformations, collectively referred to as aging. The biogeochemically driven aging

processes include NP interactions with a range of organic and inorganic ligands along a

steep redox and often pH gradient 61, 155, 171. For Ag-MNPs, the most important

transformation is the sulfidation of zerovalent Ag-MNPs to mixed Ag(0)-Ag-S phases or

Ag2S 44, 50, 61, 66. Experiments with bench and pilot scale WWTPs indicate that Ag is

completely transformed to Ag2S in the sludge. Such transformations of Ag-MNPs can

alter their solubility, bioavailability, and toxicity 84, 140, 172, 173. Toxicity of pristine Ag-

MNPs has been shown to be driven by both ion- or particle-specific effects 61. Xiu and

22

Yang independently reported that toxicity was driven by the ions produced by Ag-MNP

154, 174. While other have reported Ag-MNPs can cause toxic effects greater than their

equivalent ionic (metal salt) concentrations96, 141, 175. The sulfidation of Ag-MNPs has

been shown to reduce the effects of Ag-MNPs attributable to Ag ion release due to their

reduced solubility 50, 66, 140, 176.

Several studies have previously demonstrated that exposure to Ag-MNPs can

elicit a range of toxic responses in a variety of organisms including algae, bacteria, and

eukaryotic organisms in both aquatic and terrestrial systems 142, 177-179. Impacts of Ag-

MNPs on terrestrial organisms, such as earthworms (Eisenia fetida), have been

investigated and include avoidance behavior, decreased reproduction, and changes in

expression of several stress response genes linked to oxidative stress 106, 108, 109, 180.

An emerging tool for assessing the toxicity of NPs is the use of the model

organism, a nematode, Caenorhabditis elegans, which is frequently found in decaying

plant material associated with soil123, 138, 141, 142, 147, 164, 166, 181. The popularity of C. elegans

as a test species to evaluate NP toxicity is driven by its invariable cell fate map, fully

mapped genome, the availability of mutants, short generation time, and low maintenance

cost 91, 120, 123, 141, 142, 147, 164, 181-183. In addition, C. elegans can survive and reproduce in a

range of media, including those with low ionic strength, which is a more environmentally

representative medium for toxicity testing with Ag-MNPs than e.g. physiological buffer

183.

To date, the majority of nanotoxicity studies generally and those utilizing C.

elegans specifically, have focused on the effects of pristine Ag-MNPs without taking into

23

account the effects of particle aging 77. Pristine Ag-MNPs have previously been shown to

cause increased mortality, decreased growth, and decreased reproduction, as well as

increased oxidative stress in C. elegans 141, 147, 154, 184. Levard et al. demonstrated

decreases in mortality and impacts to growth of the nematodes exposed to sulfidized Ag-

MNP (sAg-MNPs) when compared to pristine Ag-MNPs at a S to Ag ratio as low as

0.019 140. To our knowledge there are no published studies that demonstrated impacts of

sulfidation of Ag-MNPs using other sensitive endpoints in C. elegans, such as

reproduction or that attempt to quantify differences in Ag bioavailability between Ag-

MNPs and sAg-MNPs.

The objectives of this study are to investigate and compare the bioavailability and

toxicity of Ag-MNPs and sAg-MNPs to C. elegans. Additionally, our aim is to determine

if the observed toxicity of Ag-MNPs and sAg-MNPs are exclusively related to the

dissolved ion or also include particle-specific effects. We hypothesize that sAg-MNPs

will have decreased toxicity and bioavailability compared to pristine Ag-MNPs. We also

hypothesize that the ion specific effects of both sulfidized and pristine Ag-MNPs will

decrease with increasing exposure concentration based on the limited solubility of these

materials, i.e. as the particle to ion ratio increases.

Materials and Methods

Silver Nanoparticle Synthesis and Characterization Polyvinylpyrrolidone (PVP) coated (pristine) Ag-MNPs were synthesized as

previously described 185. These particles were then sulfidated (to produce sAg-MNPs)

similarly to Levard et al. (2011). More detailed descriptions for sAg-MNPs preparation

and particle characterization is provided in SI.

24

Exposure Medium The choice of medium can strongly influence the toxicity of Ag-MNPs; therefore,

we chose MHRW(I= 0.00395) which is a common toxicity testing medium. This

medium is low in chloride (0.11 mmol) minimizing precipitation of insoluble AgCl 143,

154. We examined the effects of sAg-MNPs in addition to unsulfidated Ag-MNPs.

Further, as unsulfidated Ag-MNPs are prone to dissolution and release of free Ag+,

AgNO3 (Ag+) was used as an ion control in all experiments.

Dissolution Experiments Dissolution was determined by centrifuging 2.0 mL samples in MHRW at

16,800g in polypropylene microcentrifuge tubes for 3 hours after 1 and 24 hour

incubation at 20°C in darkness. Stoke's law predicts that this sedimented Ag-MNPs larger

than 1 nm in diameter. AgNO3 controls (at 10 µg Ag L-1) were also used to account for

any ion loss during centrifugation. We measured dissolution of Ag-MNPs and sAg-MNPs

at two concentrations of 1.5 and 0.05 mg Ag L-1. Immediately after centrifugation, the top

1 mL of supernatant was removed and adjusted to 0.12 M HCl. One mL of non-

centrifuged samples was digested in 9 mL of concentrated HNO3 and 3 mL of

concentrated HCl, heated in a microwave to 100°C, held at that temperature for 10 min,

and diluted to final acid concentration of 0.45 M HNO3/0.012 M HCl for analysis.

Samples were analyzed for Ag using inductively coupled plasma mass spectrometry

(ICP-MS) (Agilent 7500cx, Santa Clara, CA) with duplicate digestions, matrix spikes,

cross calibration verification, and reagent blanks.

Nematode exposure and toxicity experiments The toxicity protocols employed represent modifications of previously established

C. elegans toxicity testing methods 123, 129 and those previously used in our lab 166 with

25

modifications stated below. Wild type N2 Bristol strain of C. elegans was obtained from

the Caenorhabditis Genetics Center and were age-synchronized using NaClO/NaOH

solution 129. Mortality with feeding, growth, and reproduction experiments were

conducted in the presence of bacterial food, Escherichia coli (OP50 strain), was added

(OD600 = 1) at the rate of 10 µL mL-1 of exposure solution. Exposure solutions for growth

and reproduction experiments were replaced after 24 h and fresh bacterial food was

added.

Mortality. For mortality testing, larval L3 stage nematodes were exposed to varying

concentrations of Ag-MNPs, sAg-MNPs, and AgNO3 in MHRW with and without

bacterial food for 24 h in a 24 well polycarbonate tissue culture plate. At least five

concentrations were used for every treatment. Unfed nematodes were exposed to Ag-

MNPs (50-100 µg Ag L-1), sAg-MNPs (250-1500 µg Ag L-1), and AgNO3 (2.5-10 µg Ag

L-1); fed nematodes were exposed to Ag-MNP (1000-4500 µg Ag L-1), sAg-MNP (2000-

10,000 µg Ag L-1), and AgNO3 (25-85 µg Ag L-1). Exposures without feeding were

conducted to differentiate between mortality due to dissolution and mortality due to intact

particles, where dissolution and subsequent binding of Ag+ ions to microbial cells would

have complicated interpretation186. Experiments with feeding were conducted to

establish ranges for growth and reproduction experiments. Feeding is necessary to

prevent dauer formation at early stages of larval development in growth and reproduction

assays. Each treatment had 4 replicates per concentration with 10 (±1) nematodes in each

well and all concentrations were tested in two independent experiments.

Growth. Eggs were hatched in the exposure solutions made with MHRW with OP50

food source (10 µL mL-1). Nematodes were exposed in 15 mL centrifuge tubes with 4 mL

26

of the exposure medium; Ag-MNPs (500-3000 µg Ag L-1), sAg-MNP (3000-9000 µg Ag

L-1), and AgNO3 (6.25-30 µg Ag L-1) in MHRW. Nematode body length was measured

after 48 hours. Nematodes were allowed to settle for 30 min and at least 30 nematodes

were removed from exposures and treated with sodium azide (3 µL of 170 mM, to

straighten them) and imaged using a light microscope. Measurements were then made

using NIS-Elements BR 3.0 image processing software (Nikon). Each concentration was

tested in two independent experiments.

Reproduction. Eggs were hatched on K-agar plates with OP50 bacterial lawns 129 and

were placed into the exposure solutions. For each exposure, six L1 nematodes were

exposed to at least five concentrations per treatment of Ag-MNPs (250-1000 µg Ag L-1),

sAg-MNPs (1000-5000 µg Ag L-1), and AgNO3 (5-25 µg Ag L-1) in MHRW. After 50 h

of exposure, individual nematodes were transferred to K-agar plates for egg laying.

Adult worms were transferred to fresh K-Agar plates every 24 h for 72 h. Plates were

incubated for 24 h to allow hatching, then stained with rose bengal (0.5 mg L-1), heated to

50°C for 55 min, then fully hatched juveniles were counted. Each exposure was tested in

two independent experiments.

Particle-specific effects versus Ion-specific effects To determine the effect of Ag+

produced by the Ag-MNPs and sAg-MNPs,

particle free supernatants were generated after 24 h incubation and prepared as described

above in the dissolution experiment section. Nematodes exposed to particle free

supernatants were compared to nematodes exposed to whole suspensions that had been

incubated for 24 h. Concentrations above the LC50 were selected for all treatments, and

exposure conditions were the same as in the experiments for mortality without feeding.

27

Synchrotron x-ray fluorescence microscopy Distribution of Ag was examined in L4 stage C. elegans exposed to Ag+ (10 µg L-

1), Ag-MNPs (1000 µg Ag L-1), and sAg-MNPs (3000 µg Ag L-1) for 4 h. These

concentrations were selected because relatively high tissue concentrations are required

for detection by X-ray fluorescence and because they resulted in similar mortality after 4

h of exposure (~ 30%). Approximately 100-150 nematodes were collected, washed twice

with MHRW, and preserved in 20% ethanol prior to X-ray analysis. Scanning X-ray

fluorescence microscopic measurements were performed at sectors 13 and 20 at the

Advanced Photon Source, Argonne National Laboratory (Lemont, IL, USA). Additional

details on synchrotron methods are provided in SI.

Statistical Methods For growth, reproduction, and mortality, means and standard errors were

calculated per treatment and concentration. Probit analysis using the PROBIT procedure

in SAS v9.3 (SAS Institute, Cary, NC, USA) was used to determine the LC10 and LC50

values, presented at 95% confidence intervals. To test whether the observed mortality

was due to particle specific effects or simply due to the release of Ag+ into solution,

student’s t-tests were used to compare the mortality of nematodes exposed to particle free

supernatants and those exposed to the whole suspensions. Student’s t-tests with Dunnett’s

multiple comparison corrections were applied to test whether each concentration within a

treatment was significantly different from control for all experiments. Homogeneity of

variance and normality of errors assumptions were checked using Q-Q plots and

studentized residual plots. EC10 and, when appropriate, EC50 values were calculated from

parameters determined using linear regression. SAS v9.3 was used for all statistical

28

analyses and SigmaPlot 12.3 (Systat, San Jose, CA, USA) was used to generate all

figures.

Results

Characterization and Dissolution Measurements We observed that the zeta potential of the Ag-MNPs decreased with sulfidation

from -6.1 mV for Ag-MNPs to -28.1 mV for sAg-MNP. However, the size of the NPs

changed less than 10% with sulfidation when measured by TEM, 58.3 ± 12.9 nm (mean ±

standard deviation) for Ag-MNPs and 64.5 ±19.4 nm for sAg-MNPs. A similar change

was observed in the z-average hydrodynamic diameter, for Ag-MNPs 79.6 ± 0.5 and 88.5

± 0.5 for sAg-MNP. The TEM images (SI1) and DLS particle size distributions (intensity

and volume weighted) in MHRW (SI2 and SI3) corresponding to the data described

above are provided in the supplemental information (SI). For both Ag-MNPs and sAg-

MNPs the dissolved Ag, expressed as a % of the total, was greater at for the 50 µg L-1

Ag-MNP concentration compared to the 1500 µg L-1 Ag-MNP concentration, with a more

pronounced difference at 24 h compared to 3 h. For Ag-MNP at 3 h the percent dissolved

Ag was found to be 3.5% and 1.25% for 50 and 1500 µg L-1, respectively, and at 24 h

was found to be 5.8 and 2.9 % for 50 and 1500 µg L-1, respectively (Figure 2.1). For the

sAg-MNP the dissolved Ag at 3 h was found to be 0.05% and 0.03% for 50 and 1500 µg

L-1, respectively, and was found to be 0.43% and 0.23% at 24 h for 50 and 1500 µg L-1,

respectively. (Figure 2.1). The dissolution of sAg-MNP at 24 h was found to be reduced

by 13-fold and 12-fold at 50 µg L-1 and 1500 µg L-1, respectively compared to Ag-MNPs.

29

Figure 2.1. The percent dissolution of pristine silver manufactured nanoparticles (Ag-MNP) and artificially aged silver manufactured nanoparticles (sAg-MNP) at 3 and 24 hours at two concentrations (50 and 1500 µg L-1) in moderately hard reconstituted water (main) and sAg-MNP (insert) at full scale. Error bars represent the minimum and maximum total Ag concentration.

Toxicity and Bioavailability Reproduction was found to be the most sensitive endpoint tested while growth

was the least sensitive. For all endpoints tested, sAg-MNP required at least a 2-fold

higher concentration to achieve equivalent levels of toxicity as compared to Ag-MNPs.

Mortality. Mortality in the absence of food for sAg-MNP never exceeded 40%. The LC10s

(95% CI) for Ag+, Ag-MNPs, and sAg-MNPs were 5.1 (4.35, 5.70) µg L-1, 51.7 (47.75,

54.84) µg L-1, and 315.5 (48.09, 515.07) µg L-1, respectively. The LC50 for Ag+, Ag-

30

MNPs, and sAg-MNPs were 7.5 (7.01, 7.89) µg L-1 72.5 (70.19, 74.90) µg L-1 and 4612

(2166.00, 130428.00) µg L-1, respectively (Figure 2.2).

Figure 2.2. Mortality of Caenorhabditis elegans after 24 hours without feeding exposure to Ag+, pristine silver manufactured nanoparticles (Ag-MNP), and artificially aged manufactured nanoparticles (sAg-MNP) in moderately hard reconstituted water. Red portions of Ag-MNPs and sAg-MNPs bars represent the amount of mortality that can be attributed to their dissolution. Data are presented as mean percent mortality with error bars indicating standard error of the mean. Mortality at all concentrations was found to be significantly greater than control (p < 0.001), except for Ag+

2.5 µg L-, Ag-MNPs 50 µg L-1, and sAg-MNPs 250 µg L-1.

The concentrations at which C. elegans exhibited equivalent mortality were 4 to 30 fold

higher in the experiment with feeding than without feeding at the LC10. The LC10 (95%

CI) for Ag+, Ag-MNPs, and sAg-MNPs were 24.8 (12.83, 33.94) µg L-1, 2002 µg L-1, and

4106 µg (2442, 6072) L-1, respectively, for fed organisms. The LC50 (95% CI) for Ag+

was 54.8 (43.31, 63.40) µg L-1 and for Ag-MNP was 3119 (2976, 3262) µg L-1.

Nematodes exposed to 10,000 µg L-1, the highest concentration of sAg-MNPs tested, only

resulted in an observed mortality of 20% (Figure 2.3).

31

Figure 2.3. Mortality of Caenorhabditis elegans after 24 hours in the presences of bacterial food (Escherichia coli strain OP50) when exposed to Ag+, pristine silver manufactured nanoparticles (Ag-MNPs), and artificially aged manufactured nanoparticles (sAg-MNPs) in moderately hard reconstituted water. Data are presented as mean percent mortality with error bars indicating standard error of the mean. Mortality was significantly different from control at all Ag+ concentrations; all Ag-MNP concentrations except for 1000 and 1500 µg L-; and only 5,000 and 10,000 sAg-MNP µg L- were found to be significantly different than control (p < 0.001).

Particle versus Ion Specific mortality. Except for the 50 µg L-1 Ag-MNP treatment, the

mortality observed at all other concentrations cannot be fully explained by dissolution

and release of Ag+ for both Ag-MNPs and sAg-MNPs (Figure 2.2). The proportion of

mortality attributable to ion release from NPs into the exposure medium as measured by

the dissolution experiments over 24 h, decreased with increasing exposure concentration

for both Ag-MNPs and sAg-MNPs. The mortalities for the nematodes exposed to each

particle free supernatants of Ag-MNPs and sAg-MNPs were less than 10% and were not

significantly different from that in controls, while mortality in the whole suspensions

32

were at 78% for Ag-MNPs and 62% for sAg-MNPs (Figure 2.4). When the nematodes

were exposed to supernatants of Ag+ the mortality was 85%, similar to the 88% mortality

observed in the whole (un-centrifuged) Ag+ solution (P = 0.2554).

Figure 2.4. Mortality of Caenorhabditis elegans after 24 hours without feeding when exposed to particle free supernatants (Supernatant) versus whole solutions of Ag+, pristine silver manufactured nanoparticles (Ag-MNPs), and artificially aged manufactured nanoparticles (sAg-MNPs) (Whole Solution) in moderately hard reconstituted water. Data are presented as mean percent mortality with error bars indicating standard error of the mean. * Indicate treatments found to be significantly different than control (p < 0.001).

Growth. Nematodes exposed to Ag+, Ag-MNPs, and sAg-MNPs all exhibited

significantly shorter body lengths compared to control, regardless of concentration

(P<0.001 for all comparisons) (Figure 2.5) . The greatest decrease from the control in

mean body length was observed in Ag+ exposed nematodes, followed by Ag-MNP

exposed nematodes, with the smallest decrease in response to sAg-MNP exposed

nematodes. Regardless of concentration, nematodes exposed to sAg-MNP had a

33

significantly greater average body length than those exposed to Ag+ or Ag-MNP (p <

0.001 for both comparisons), and those nematodes exposed to Ag-MNP had a

significantly greater average body length than those exposed to Ag+ (p < 0.001). The

EC10 for Ag+, Ag-MNPs and sAg-MNPs were 6.6 µg L-1, 1118 µg L-1, and 5946 µg L-1,

respectively.

Figure 2.5. Observed mean body length of Caenorhabditis elegans measured after 48 hours from L1 stage exposed to Ag+, pristine silver manufactured nanoparticles (Ag-MNP), and artificially aged manufactured nanoparticles (sAg-MNP) in moderately hard reconstituted water in the presence of bacterial food (Escherichia coli strain OP50). Data are presented as mean percent mortality with error bars indicating standard error of the mean. All concentrations were found to be significantly different than control (p < 0.001).

Reproduction. Nematodes exposed to Ag+, Ag-MNPs, and sAg-MNPs exhibited

significant decrease in number of offspring per adult compared to control, regardless of

concentration (p < 0.001 for all comparisons) (Figure 2.6) Nematodes exposed to sAg-

MNPs had a significantly higher average number of offspring per adult than those

34

exposed to Ag+ (p = 0.015) or Ag-MNPs (p = 0.004), regardless of concentration. The

EC10 for Ag+ was 3.1 µg L-1 and EC10 for Ag-MNPs and sAg-MNPs were 113.1 µg L-1

and 802.4 µg L-1, respectively. The EC50 for Ag+ was 15.3 µg L-1, for Ag-MNPs was 566

µg L-1, and for the sAg-MNPs it was 4011 µg L-1.

Figure 2.6. Mean total number of offspring per adult nematode Caenorhabditis elegans after 48 hours from L1 stage exposed to Ag+, pristine silver manufactured nanoparticles (Ag-MNP), and artificially aged silver manufactured nanoparticles (sAg-MNPs) in moderately hard reconstituted water in the presence of bacterial food (Escherichia coli strain OP50). Data are presented as mean percent mortality with error bars indicating standard error of the mean. * Indicate treatments found to be significantly different than control (p ≤ 0.001).

Bioavailability. From µ-XRF Ag fluorescence intensity maps of C. elegans exposed to

Ag+, Ag-MNPs, and sAg-MNP at approximately LC30 concentrations (estimated after 4

hrs of exposure), lower intensities of Ag were observed in sAg-MNP treatment than Ag+

or Ag-MNP treatments. Nematodes exposed to Ag+ and Ag-MNPs showed similar spatial

35

distributions and emission intensities for Ag (Figure 2.7). Tissue concentrations were too

low to collect x-ray absorption spectroscopic data to determine speciation.

Figure 2.7. Ag Kα1 fluorescence of Caenorhabditis elegans specimens (stage L4) that were exposed to LC30 for Ag+ (Top), pristine silver manufactured nanoparticles (Middle), and artificially aged silver manufactured nanoparticles (Lower) in moderately hard reconstituted water in the absence of bacterial food, as determined using a synchrotron-based X-ray fluorescence microprobe. Color bar indicates normalized Ag Kα1 fluorescence intensity. The data are normalized to the incident beam ion chamber reading, so they are normalized with respect to each other.

36

Discussion Importantly, our results demonstrate that it is not just the decrease in solubility of

Ag2S relative to Ag (0) that accounts for the observed reductions in toxicity, but also a

decrease in the uptake of intact sAg-MNPs resulting in decreased particle-specific effects

of sAg-MNPs compared to pristine Ag(0)-MNPs (vide infra). Whether the observed

toxicological effects of Ag-MNPs are due to particle-specific effects, or simply due to the

release of Ag+ into solution has been a matter of debate since the first reports of Ag MNP

toxicity 154, 174, 175. Using multiple experimental approaches, we demonstrate that intact

particles in the exposure media cause toxicity. Although it is likely that dissolution of the

particles following uptake elicits toxicity through the release of ions, we consider this

route of cellular uptake and tissue specific delivery to be particle-specific 109. It is also

possible that presence of the nematodes or food can promote dissolution of Ag-MNPs. If,

the released dissolved Ag is immediately bound to ligands in the nematodes and the food,

the Ag-MNPs would release more dissolved Ag to maintain the equilibrium between

dissolved and particulate Ag. This could lead to an underestimation of the effects due to

dissolved ions. From previously published data, there appears to be an emerging

agreement that the toxic effects of Ag-MNPs are due in part to the release of Ag+ and in

part from particle effects during exposure 138, 141, 147. The results of this study also support

this emerging paradigm. However, we believe that this is among the first studies to

clearly demonstrate that the relative importance of dissolution and release of Ag+ in the

exposure media for toxicity is concentration dependent. Recently, Croteau et al.

suggested that ion release from particles is concentration dependent187. We also found

that as a percentage of the total Ag, the dissolution was greater at lower concentrations.

Therefore, it is likely that some previous conflicting reports concerning the importance of

37

dissolution may be due to differences in exposure concentration 154, 174. Although we

observed that sulfidation of Ag-MNPs greatly reduces the amount of Ag+ released and

associated toxicity at any of the concentrations tested, a large proportion of the effects of

sAg-MNPs observed in this study were particle specific. The reduction in the release of

Ag+ as a result of sulfidation has been reported 61, 66, 140, 188; however, we believe this to

be the first report demonstrating particle specific effects of sAg-MNPs. The role of sAg-

MNPs was not simply a continuing source of dissolved ions to be scavenged by ligands

in the nematodes, since the XRF imaging indicated that toxicity was not associated with

equivalent Ag body burdens as for the AgNO3 or Ag-MNP treatments.

Meyer et al. (2010) demonstrated that C. elegans are able to internalize Ag-MNPs

with different coatings and smaller size than the Ag-MNPs we tested and also our results

are in agreement with other paper from the same group where sulfidation significantly

decreased toxicity (Levard et al. 2013a), but the effects on reproduction and differences

in bioavailability were not investigated by the authors141. The lowered particle specific

toxicity of sAg-MNPs compared to Ag-MNPs can be in part explained by their decreased

bioavailability, as was observed from the synchrotron based X-ray fluorescence images.

The Ag concentrations in the nematodes exposed to the sAg-MNPs at LC30 were below

the XRF detection limit. In contrast, internal Ag concentrations in nematodes treated with

AgNO3 and Ag-MNPs were readily detectable suggesting that the particle specific

toxicity elicited by sAg-MNPs may not involve uptake. A less likely alternative

hypothesis is that it is caused by very low tissue concentrations of sAg-MNPs that were

below the XRF detection limit. The toxicity is also not explained by soluble impurities,

coatings, or other decomposition products released from the sAg-MNPs since particle

38

free supernatants caused minimal mortality. One possible mechanism by which sAg-

MNPs could cause an effect in the absence of uptake is through cuticle damage, since the

cuticle serves as a primary defense of the nematode against environmental stressors 91, 147,

189.

Although there have been several investigations into the effects that the exposure

medium has on the toxicity of Ag-MNPs, little attention has been paid to the

presences/absence of a food source on toxicity190. We expected there to be a decrease in

the toxicity in the presence of bacterial food as the nematodes being fed should have

increased resistance to the stress caused by Ag-MNP exposure and because partitioning

of particles and the released Ag ions to bacteria could also be anticipated to reduce

toxicity. Our results show that the addition of bacterial food decreased the toxicity in

contrast to Ellegaard-Jensen et al., (2012) who found an opposite effect. They speculated

that bacteria represent a dietary exposure route via trophic transfer. Higher ionic strength

media have been shown to decrease toxicity of Ag-MNPs 143, 154, 191. We used a different

exposure medium (MHRW) than Ellegaard-Jensen et al., (2012) who utilized K-meduma,

which has approximately a 3-fold higher ionic strength that MHRW. Additionally, the

study of Ellegaard-Jensen et al., (2012) used 28 nm Ag-MNPs that were also coated with

PVP but were approximately three times smaller than the Ag-MNPs used in our study.

The solubility192 and dissolution rate of Ag MNPs increases with decreasing size193.

These differences may explain in part the discrepancy between the studies.

We are unaware of any other investigations that have examined both the

bioavailability and toxicity of Ag-MNPs and sAg-MNPs for three ecologically relevant

endpoints in C. elegans. Our experimental approach also allowed us to tease out the

39

relative importance of particle specific versus ion specific effects for Ag-MNPs and sAg-

MNPs. Our results combined with those of Levard et al. (2013) demonstrate that aging of

Ag-MNPs in the presence of sulfide reduces toxicity as measured by both mortality and

growth 140. The results of Levard et al., (2013a) demonstrate that sAg-MNPs at 1,500 µg

Ag L-1 caused less than 5 percent mortality and an EC50 for growth was over 10,000 µg

Ag L-1 in C. elegans using particles similar to sAg-MNPs we employed. However, the

impact of sAg-MNPs on reproduction in C. elegans, which is the most sensitive endpoint

we examined, has not been previously reported.

Overall, these results demonstrate greatly reduced toxicity of sAg-MNPs as

compared to Ag-MNPs, suggesting that transformation via the WWTP would likely result

in a greatly reduced toxicity of Ag-MNPs. This indicates that hazards of Ag-MNP

exposure are likely greater in applications where Ag-MNPs are introduced directly to soil

rather than through biosolids application. For example, Ag-MNPs are being researched

for use as pesticides or as pesticide delivery vehicles 194, 195. However, Ag-MNPs that are

introduced as unsulfidized materials are quickly sulfidated in reducing environments such

as freshwater sediment196.The recognition that the relative importance of particle specific

effects are concentration dependent may also bring some clarity to observed

inconsistencies in the literature. Finally, it is apparent from this study, that sAg-MNPs

may elicit toxicity independent of Ag+ ion release. Whitley et al. (2013) observed that

sAg-MNPs were present in pore water of soils amended with Ag-MNP spiked biosolids.

Although particle specific toxicity of sAg-MNPs is not great in C. elegans, it would be

prudent to test the toxicity of sAg-MNPs in other receptor species and in food chain

40

exposures where significant dissolution could occur in the gastrointestinal systems of

certain ecoreceptors.

Acknowledgments

Funding for this research was provided by the United States Environmental

Protection Agency (U.S. EPA) (RD 834574). JU, GL and OT are supported by the U.S.

EPA and National Science Foundation (NSF) through cooperative agreement EF-

0830093, Center for Environmental Implications of Nanotechnology (CEINT). Any

opinions, findings, conclusions, or recommendations expressed in this material are those

of the author(s) and do not necessarily reflect the views of the EPA or NSF. This work

has not been subjected to EPA or NSF review, and no official endorsement should be

inferred. Portions of this work were performed a GeoSoilEnviroCARS (Sector 13),

Advanced Photon Source (APS), Argonne National Laboratory and PNC/XSD (Sector

20). GeoSoilEnviroCARS is supported by the National Science Foundation-Earth

Sciences (EAR-1128799) and Department of Energy-GeoSciences (DE-FG02-

94ER14466). PNC/XSD facilities are supported by the US Department of Energy - Basic

Energy Sciences, a Major Resources Support grant from NSERC, the University of

Washington, the Canadian Light Source and the Advanced Photon Source. Use of the

APS was supported by the U.S. Department of Energy, Office of Science, Office of Basic

Energy Sciences, under Contract No. DE-AC02-06CH11357.

Statistical support was provided by the Applied Statistics Lab and the Center for

Clinical and Translational Science (CCTS) at the University of Kentucky. The CCTS is

supported by grant number UL1TR000117 from the National Center for Advancing

41

Translational Sciences (NCATS), funded by the Office of the Director, National

Institutes of Health (NIH) and supported by the NIH Roadmap for Medical Research.

42

Chapter 3: Distinct transcriptomic responses of Caenorhabditis elegans to pristine and sulfidized silver nanoparticles.

Reproduced with permission from: Starnes D., Lichtenberg, S., Unrine, J., Starnes, C.,

Oostveen, E., Lowry, G., Bertsch, P., and Tsyusko, O. Environmental Pollution (2015)

Accepted January 7th, 2016. Copyright [2016] Elsevier B.V.

Graphical Abstract

Capsule

The toxicity of fully sulfidized Ag nanoparticles is not due to release of ions.

Highlights

Some effects of pristine silver nanoparticles can be linked to Ag+

Sulfidized silver nanoparticles have effects independent of Ag+

Sulfidized silver nanoparticle responses suggest cuticle damage

Distinct toxicity pathways indicated for all three treatments

43

Abstract Manufactured nanoparticles (MNPs) rapidly undergo aging processes once released from

products. Silver sulfide (Ag2S) is the major transformation product formed during the

wastewater treatment process for Ag-MNPs. We examined toxicogenomic responses of

pristine Ag-MNPs, sulfidized Ag-MNPs (sAg-MNP), and AgNO3 to a model soil

organism, Caenorhabditis elegans. Transcriptomic profiling of nematodes which were

exposed at the EC30 for reproduction for AgNO3, Ag-MNPs, and sAg-MNPs resulted in

571 differentially expressed genes. We independently verified expression of 4 genes

(numr-1, rol-8, col-158, and grl-20) using qRT-PCR. Only 11% of differentially

expressed genes were common among the three treatments. Gene ontology enrichment

analysis also revealed that Ag-MNPs and sAg-MNPs had distinct toxicity mechanisms

and did not share any of the biological processes. The processes most affected by Ag-

MNPs relate to metabolism, while those processes most affected by sAg-MNPs relate to

molting and the cuticle, and the most impacted processes for AgNO3 exposed nematodes

was stress related. Additionally, as observed from qRT-PCR and mutant experiments, the

responses to sAg-MNPs were distinct from AgNO3 while some of the effects of pristine

MNPs were similar to AgNO3, suggesting that effects from Ag-MNPs is partially due to

dissolved silver ions.

Keywords: antimicrobial, nanomaterial, toxicogenomics, soil, wastewater

Introduction Silver nanoparticles (Ag-MNPs) are the third highest manufactured nanoparticle

(MNP) produced by volume, with current annual production exceeding 300 tons globally

168. Ag-MNPs are used in textiles, plastics, and medical devices principally for their anti-

microbial properties197, 198, although they are also used in electronics, such as in

44

conductive inks199. Previous studies demonstrate that Ag-MNPs can be released from

composite materials and enter wastewater streams, where the majority of Ag-MNPs

partition to the sludge 18,173. Nearly 75% of all households in the United States are

serviced by wastewater treatment plants (WWTP), with the majority of the sludge

generated being land applied as biosolids to agricultural fields 41. Repeated applications

of Ag-MNP laden biosolids constitute the primary route by which Ag-MNPs are expected

to be introduced to terrestrial ecosystems 45, 50, 200. Once released to the environment,

many metal and metal oxide MNPs have been shown to undergo biogeochemical

transformations 201-204. Both laboratory incubation, pilot, and full scale WWTP

experiments demonstrate that Ag-MNPs are subject to rapid transformation from Ag(0)

to Ag2S 44, 61, 84, 172.

Notwithstanding the likely sulfidation of Ag NMPs, the vast majority of

ecotoxicological studies involving Ag-MNPs, have focused on the effects of pristine Ag-

MNPs and not sulfidized forms. Several studies have previously shown that pristine Ag-

MNPs can cause increased mortality, reduced body length, and compromised

reproductive performance in the model soil nematode Caenorhabditis elegans 138, 141-143,

147, 183, 190. We previously demonstrated that sulfidation of Ag-MNPs greatly reduced their

adverse effects on C. elegans mortality, growth, and reproduction 89. Utilizing

synchrotron-based X-ray fluorescence (XRF) microscopy we demonstrated that the

uptake of Ag was lower for C. elegans exposed to sulfidized Ag-MNPs compared to

pristine Ag-MNPs. This demonstrated that the observed toxicity from sAg-MNPs was not

likely due to uptake and accumulation of Ag. Further, we quantified particle dissolution

and its contribution to toxicity in that study which was very low for the sAg-MNP

45

treatment (Starnes et al., 2015). It is possible that the toxicity of sAg-MNPs could be

explained by cuticle damage since internal tissue Ag concentrations were so low. It has

also demonstrated that sulfidation significantly reduced the toxicity (mortality and

growth) of Ag-MNPs to C. elegans 89, 140. Decreases in toxicity of sulfidized Ag-MNPs

compared to pristine Ag-MNPs have also been demonstrated for zebrafish (Danio rerio),

duckweed (Lemna minuta), killfish (Fundulus heteroclitus), and Escherichia coli 140, 205.

Whether the driving force behind Ag-MNP toxicity in ecological receptors is due

solely to effects of released Ag+ ions to particle specific effects, or a combination of the

two is currently debated. For example, Xiu et al. and Yang et al. independently reported

that toxicity, in E. coli and C. elegans respectively, was driven by ions released from Ag-

MNPs 154, 174, while others have found that the toxicity of Ag-MNP exceed the

equivalent metal salt concentrations in nitrifying bacteria cultures 96, 141, 175. It has also

been reported that toxicity can be driven by a combination of ions and intact

nanoparticles 144. Our previous work demonstrates that the importance for toxicity of

dissolved ion relative to particle specific effects are dependent on the exposure

concentration 89. At low exposure concentrations, effects are dominated by release of

Ag+ ions, while at higher exposure concentrations particle specific effects are more

prominent 89.

A powerful emerging tool for investigating potential environmental and

ecotoxicological impacts of MNPs is the model organism C. elegans, an ubiquitous soil

dwelling nematode is primarily associated with decaying plant material 123, 138, 141, 142, 147,

164, 166, 206. The attractiveness of C. elegans to test MNP toxicity is attributable to the

fully mapped genome, invariable cell fate map, short generation time, availability of

46

mutants covering much of the genome, low maintenance cost, and amenability to RNA

interference methods 91, 96, 120, 123, 142, 147, 164, 181, 182. Genome wide screening of C. elegans

have been already used to investigate the effects of MNPs (Ag-, Au-, CeO2-, and TiO2)

142, 164, 166, 207-209. However, to our knowledge, this is the first study to examine

transcriptomic responses to aged sulfidized Ag-MNPs by a model organism. It is

anticipated that transcriptomic responses will elucidate mechanisms of sulfidized Ag-

MNP toxicity that we previously reported were not explained by the release of Ag+ ions

89.

The objective of this study was to compare the transcriptomic responses of C.

elegans exposed to pristine and sulfidized Ag-MNPs and AgNO3. We hypothesized that

that the mode of toxicity is different between pristine and aged MNPs and that the

responses of C. elegans to MNPs would differ from those in response to AgNO3

exposure. To confirm the role of select genes in the mechanisms of toxicity, we also

employed experiments with mutant strains and RNA interference for selected genes that

demonstrated opposite responses to one or more treatments.

Materials and Methods

Silver nanoparticle synthesis and characterization Polyvinylpyrrolidone (PVP) coated (pristine) Ag-MNPs were synthesized and

then fully sulfidized (completely converted to Ag2S). Synthesis and sulfidation as well

as characterization of the pristine Ag-MNPs and sulfidized Ag-MNPs (sAg-MNPs) are

described in our previous work 89. The particle synthesis methods are also described in

the supplemental information (SI). Polyvinylpyrrolidone is one of the most common

coatings used for dispersal of Ag-MNPs210. As reported previously, the Ag-MNPs and

47

fully sulfidized Ag-MNPs had a zeta potentials in the exposure medium of -6.1 mV and -

28.1 mV, respectively, as determined by phase analysis light scattering. The Z-average

hydrodynamic diameters for Ag-MNPs and sAg-MNPs suspended in the exposure

medium (described below) as determined by dynamic light scattering was 79.6 ± 0.5 nm

and 88.5 ± 0.5 nm, respectively. Complete sulfidation of the Ag-MNPs was verified by

powder X-ray diffraction as described in Starnes et al., (2015)89. Ag concentrations of all

stock solutions used to prepare the exposures were determined using inductively coupled

plasma mass spectrometry (ICP-MS) after digestion of the particles in aqua regia. We

also quantified the dissolution of the of both Ag-MNPs and sAg-MNPs over the exposure

period of 24 h without presence of bacteria and C. elegans using ultracentrifugation and

ICP-MS in our previous work and found dissolution rates of 5.8% and 0.43%

respectively89. Unfortunately, dissolution is not readily measured in the presence of

biomass. Any Ag ions bound to bacterial cells or nematodes would be removed by

ultrafiltration or ultracentrifugation and not accounted for in the dissolution

measurement. To measure loss of Ag to the exposure container walls, we incubated asset

of three replicates of exposure solutions for 24 h and then removed the solutions and

analyzed them. Concentrations were compared to solutions acid digested directly in the

tubes without removal.

Nematode exposure and microarrays Wild type N2 Bristol strain of C. elegans were obtained from the Caenorhabditis

Genetics Center (CGC). Caenorhabditis elegans were age-synchronized using

NaClO/NaOH solution to isolate eggs. The eggs were placed on K-agar plates with

bacterial lawns until needed. All exposures were carried out in moderately hard

48

reconstituted water (4 mg L-1 KCl, 60 mg L-1 MgSO4, 60 mg L-1 CaSO4, mg L-1, 96 mg L-

1 NaHCO3) 211.

Approximately 5000 L1 stage nematodes per replicate were exposed to AgNO3

(10 µg Ag L-1), Ag-MNPs (350 µg Ag L-1), and sAg-MNPs (1500 µg Ag L-1) for 48

hours. The selected concentrations were the EC30 values for reproduction based on our

previous work 89. The equitoxic concentrations, corresponding to the EC30 for

reproduction for each substance, were chosen so that modes of toxicity could be

differentiated where the severity and nature of the effects was similar rather than

examining transcriptomic responses at similar Ag concentrations, which would have

resulted in a very different nature and severity of effects. The exposures were conducted

in the presence of bacterial food, E. coli (OP50 strain), at the rate of 10 µL stock solution

per mL of exposure solution (OD600 = 1 for stock solution). To ensure a consistent

exposure over the course of 48 hours exposure solutions were replaced after 24 h with

fresh ones and fresh bacterial food was added. Exposures were carried out in 15 mL

polypropylene centrifuge tubes containing 4 mL of exposure solution. The tubes were

arranged horizontally in the incubator and three replicates per treatment were prepared.

After exposure the nematodes were twice washed for 30 minutes with bacteria free

moderately hard reconstituted water to remove most of the bacteria from the nematodes.

Bacterial RNA contamination is not a concern since the techniques for measuring mRNA

concentrations are sequence specific to C. elegans. RNA was then extracted from each

replicate using Trizol with subsequent purification with Qiagen RNAeasy Kit (Qiagen,

Chatsworth, CA). Cells were lysed using multiple freeze-thaw cycles (-80 and 37°C) as

previously described 166. All samples were checked for RNA degradation using a

49

Nanodrop ND-2000 spectrophotometer and Agilent 2100 Bioanalyzer to examine the

quality and quantity of the RNA samples. All RNA samples had RNA integrity numbers

of 9 and above and were sent to the Microarray Core Facility at the University of

Kentucky to be processed using Affymetrix C. elegans whole genome microarrays. Total

of 1 µg of RNA was used to prepare the biotin-labeled cRNA probes, which were

hybridized to the microarray chips for 16, washed in fluidics station, and stained

following standard GeneChip expression analysis technical manual. The chips were

scanned using Affymetrix GCS 3000 7G scanner. Raw data files were normalized using

the robust multi-array average (RMA) algorithm followed by quantile normalization

implemented in Partek Genomics Suite 6.4 (Partek, Inc., St. Louis, MO)212. Data were

screened for differences of each treatment (Ag-MNP, sAg-MNP, and AgNO3) from

control using one-way ANOVA with contrasts. The false discovery rate (FDR) threshold

was set at 0.2 and the fold change was required to be greater than ±1.5, and a P-value ≤

0.05. The FDR of 0.2 was selected to balance the protection against false positives while

minimizing the rate of false negatives. Using Partek, genes that were significantly

different from control in at least one treatment were then analyzed using agglomerative

hierarchical cluster analysis (HCA). HCA is a 2-Pass clustering method; the first pass is a

K-means clustering and in the second pass the K-means clusters are joined by

agglomerative clustering 213. Lists of genes that were significantly different than control

for each treatment were generated in Partek and exported to Integrated Pathway Analysis

(IPA, Ingenuity Systems) to investigate the possible involvement of relevant pathways.

These lists were also uploaded to the Database for Annotation, Visualization and

Integrated Discovery v 6.7 (DAVID) utilizing functional clustering tools to identify

50

significant changes in enrichments annotations between treatments214. In DAVID

functional annotation tool gene ontology terms for biological process (BP), molecular

function (MF), cellular compartment (CC), and Kyoto Encyclopedia of Genes and

Genomes (KEGG) Pathway were selected. To avoid redundancy in the same gene sets

being represented in multiple functional clusters the DAVID options of

“GOTERM_BP_ALL”, “GOTERM_MF_ALL, and “GOTERM_CC_ALL” were

selected. All microarray data have been submitted to the National Center for

Biotechnology Information (NCBI) (Accession number GSE70509).

qRT-PCR: Validation of Microarray Data. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) analyses

were performed on samples in triplicates (both biological and technical) from

independent experiment. Glucose-6 phosphate isomerase I (gpi-1) was selected as the

reference gene, which had no significant changes across treatments in either microarray

or qRT-PCR analysis (Fig. S1). Four differentially expressed genes with one of the

highest expression levels and that had opposite responses to one or two treatments were

selected for qRT-PCR confirmation. Among them were collagen (col-158), ground-like

(grl-20), roller (rol-8), and nuclear localized metal responsive (numr-1) genes. 300 ng of

RNA were converted to cDNA using a High-Capacity RNA-to-cDNA kit™ (Applied

Biosystems) and RNA was cleaned with DNAse I for 15 minutes prior to cDNA

conversion (Qiagen, Chatsworth, CA). qRT-PCR reactions were carried out in 10 µL

volumes using TaqMan fast advanced master mix, TaqMan gene expression arrays for

each gene (Table S1), and diluted 1:19 cDNA. All gene probes (except for numr-1)

spanned introns and StepOne Plus system (Applied Biosystems) was used for all

amplifications with a program of 10 min at 95 °C, followed by 40 cycles of 10 s at 95 °C

51

and 30 s at 60 °C. All treatments for each gene were run in triplicates. Negative controls

and minus reverse transcription (−RT) negative controls were run for every gene/sample

to check for DNA contamination.

Toxicity testing using mutant strains and RNA interference. Mutant strains for rol-8 and

numr-1 were obtained from the CGC. Mortality testing for mutant strains were carried

out using age synchronized L3 stage nematodes exposed for 24 hours at 25°C in the dark

to 3 concentrations of AgNO3 (6.1, 7.5, 9.1 µg Ag L-1), Ag-MNPs (52, 75, 85 µg Ag L-1),

and sAg-MNPs (525, 2000, 3500 µg Ag L-1). .Two sample student t-tests were used to

test for significant changes in mortality from N2 wild type at each treatment and

concentration.

Testing of selected differentially expressed genes (col-158 and grl-20) using

RNAi knock-down was employed by feeding N2 wild-type nematodes E. coli strains that

expressed the required dsRNA for 2 generations prior to age synchronization for

mortality testing129. Escherichia coli strains were obtained from Source Bioscience

(Nottingham, United Kindom) and standard RNAi protocols were followed 215. Mortality

screens for RNAi experiments were carried out under the same conditions described

above.that were fed either E. coli OP50 (OP50) or E. coli expressing the required dsRNA

(OP50ds). To confirm that RNAi was successful, reduction in expression levels of col-158

and grl-20 were verified using qRT-PCR.

Results and Discussion The purpose of this study was to compare the transcriptomic effects of a pristine

Ag-MNP, sulfidized sAg-MNP and AgNO3 at similar effect concentrations (EC30 for

reproduction) on C. elegans. Each of the three treatments caused a distinct response with

52

only 20 differentially expressed genes shared among them. However, out of these shared

genes, 11 responded in opposite directions with 5 ground-like genes (grl) and 6 collagen

genes (col) being upregulated in the sAg-MNPs and down-regulated in the AgNO3 and

Ag-MNP treatments (Fig. A3-2). These differential responses for the shared genes further

confirm that the transcriptomic responses are unique to each treatment. A hierarchical

cluster analysis based on 571 differentially expressed genes reveals that replicates cluster

within their respective treatments, indicating that replicates within a treatment have gene

expression profiles with greater similarity to each other than to replicates from a different

treatment (Figure 3.1). All treatments are grouped in two major clusters, with AgNO3

forming one cluster and the control and both MNPs the second. Within the second

cluster, Ag-MNPs showed the greatest dissimilarity to both controls and sAg-MNPs.

Within the set of the 571 differentially expressed genes, only 3.5% were

significantly expressed in all three treatments. Over 85% of these genes were unique to

one of the three treatments. The greatest overlap in significantly expressed genes

occurred between AgNO3 and Ag-MNPs and accounted for approximately 10% of the

total differentially expressed genes while the overlap between Ag-MNPs and sAg-MNPs

accounted for approximately 5% of the genes (Figure 3.2). These low percentages of

shared genes indicate that genomic responses for the sAg- MNPs are different from the

pristine Ag-MNPs. Our previous work showed more than 10 times as much dissolved Ag

was released from the pristine Ag-MNPs than from the aged sAg-MNP over the course of

the exposure89.

53

Figure 3.1. Hierarchical clustering of significantly expressed genes from Caenorhabditis elegans exposed for 48 hours to Ag+, pristine silver manufactured nanoparticles (Ag-MNP), and sulfidized silver manufactured nanoparticles (sAg-MNP) in moderately hard reconstituted water.

The amount of dissolved Ag released from Ag-MNPs in the microarray

experiment was likely affected by the presence of nematodes and bacteria during

exposures. However, our transcriptomic results still indicate that the observed toxicity

was not solely caused by the release of Ag ions. Had the toxicity of the Ag-MNPs been

due solely to effects of Ag ions, the replicates of hierarchical clustering would have been

randomly distributed and the list of overlapping genes between each MNPs and AgNO3

would have been much larger (Figures 3.1 and 3.2). The percent of Ag lost to the

container walls is estimated to be 0 ± 3.5, 33.4 ± 1.2 and 30.2 ± 2.7 in the AgNO3, Ag-

MNP and sAg-MNP treatments, respectively. It is unclear how this affects exposure since

54

the nematodes dwell on the bottom of the container. It also has no implications for the

interpretation of the results since the transcriptomic profiles are compared at equitoxic

concentrations rather than equal mass concentrations. The toxicity of the sAg-MNP

particles could not be due to the release of S since the concentration of S in the particles

was only 1.6 µM compared to the S concentration in the exposure medium of around 850

µM. Similarly our previous studies showed that the toxicity of the Ag-MNPs was not due

to free PVP polymer in solution89. Finally, the toxicity is unlikely to be due to an indirect

effect on the E. coli OP50 since previous studies have shown that Ag-MNP toxicity

occurs in E. coli at concentrations approximately 50-100 times greater than our exposure

concentrations216. We also did not observe a decrease in cell density at our exposure

concentrations.

Figure 3.2. Venn diagram of the significantly up/down regulated genes with a fold change greater than ± 1.5, FDR of 0.2, and p-value ≤ 0.05. Caenorhabditis elegans exposed for 48 hours to AgNO3, pristine Ag manufactured nanoparticles (Ag-MNPs), and sulfidized silver manufactured nanoparticles (sAg-MNPs) in moderately hard reconstituted water.

55

There are few toxicogenomic studies examining the effects of MNPs such as Ag-,

Au-, and TiO2-MNPs to C. elegans in the literature 142, 163, 166. These studies have shown

that MNPs can alter the gene expression profiles of C. elegans in pathways associated

with stress response, reproduction, and lysosomal activity. There are limited data to

indicate whether the toxicity of soluble NPs, such as Ag and ZnO, is primarily due to the

ions or the intact particles. Taken together our data and the data from other C. elegans

studies suggest that the toxicity of Ag-MNPs is a result of both ionic and intact

nanoparticles 89, 138, 141, 147.

qRT-PCR confirmation The expressions of four genes selected from the shared and unique gene

expression pools were confirmed independently with qRT-PCR (Fig. A3-3). Among

these four genes, there are three related to cuticle function and two of these (col-158, grl-

20) are from the shared pool that were significantly up-regulated only in response to aged

sAg-MNPs, but down-regulated to Ag-MNPs and AgNO3. The third gene, roller (rol-8),

is from the unique genes that responded only to sAg-MNPs and this was also up-

regulated. The fourth gene, nuclear metal responsive gene (numr-1), is shared between

Ag-MNPs and AgNO3 and was up-regulated in both exposures, but showed no effect in

sAg-MNPs exposure. Numr-1 is a nuclear localized metal response gene and therefore

should be closely related due to toxicity from metal ion exposure 217.

Biological Pathways and Gene Ontology No pathways were identified in any treatment using Integrated Pathway Analysis.

However, four KEGG pathways in total were identified using DAVID for all treatments

(1 for each of the MNPs and two for AgNO3). These pathways (Table 3.1) showed no

commonality between any of the treatments further confirming uniqueness of the

56

responses. None of these pathways were found by Roh et al., where C. elegans was

exposed to uncoated pristine Ag-MNPs, but this was not unexpected since the current

study utilized PVP coated Ag-MNP, a different testing medium, and exposure times that

were nearly three times longer than used by Roh 142.

For pristine Ag-MNPs, 5 genes were identified in the lysosomal pathway

suggesting that lysosomes are involved in processing the particles. Results from previous

studies of MNPs in both in-vivo as well as in-vitro models have implicated that

lysosomes are involved in the detoxification of several types of MNPs (Au, Ag, and Fe),

the acidic nature of the lysosome may promote the dissolution of the MNPs 145, 218-220.

Yang et al. demonstrated that using lysosomal function mutants greatly enhanced the

toxicity of Ag-MNP, though different genes and Ag-MNPs were utilized in the study,

there is a clear indication that lysosomes are integral to the toxic response in C. elegans

144. Three of the genes in the lysosome pathway were hypothetical proteins and two were

cysteine protease related genes (cpr-1 and cpr-2) that encode lysosomal proteins. Both

cpr-1 and cpr-2 were significantly down-regulated in Ag-MNP exposures. One of the

cysteine protease related genes, cpr-1, has been linked to the proper protein degradation

within lysosomes while the other, cpr-2, has been linked to immune response of C.

elegans to Staphylococcus aureus infection 66, 221, 222. Additionally, cpr-2 is a orthologue

of the human cathespin b gene (ctsb) which is a lysosomal cysteine protease and has a

role in the progression of chronic inflammatory diseases such as rheumatoid arthritis and

neurodegenerative diseases such as Alzheimer’s 223, 224.

Table 3.1. List of pathways that were identified by DAVID using lists of significantly altered genes from N2 wild type nematodes when exposed to Ag+, pristine silver manufactured nanoparticles (Ag-MNPs), and sulfidized silver manufactured nanoparticles (sAg-MNPs) at the LC30 for 48 hours.

KEGG ID

Pathway Genes in Pathway

Fold Enrichment

P-Value Exposure

cel00982 Drug Metabolism 5 1.8 0.0026 AgNO3

cel00680 Methane Metabolism 3 1.1 0.0083 AgNO3

cel04142 Lysosome 5 7.5 0.0025 Ag-MNP

cel04020 Calcium Signaling Pathway 3 1.5 0.0057 sAg-MNP

57

58

In the sAg-MNP exposure, the calcium signaling pathway was identified and the

three genes associated with it were all found to be significantly down-regulated such as

(egg laying deficient (egl-30), and two uncoordinated (unc-43, unc-68) genes. All three

of these genes have been linked to egg laying, additionally unc-43 and unc-68 are also

involved in locomotion, cell fate determination, and synaptic regulation 129, 211, 214, 225.

This finding provide support for our previous results which showed that reproduction was

significantly reduced when the nematodes were exposed to sAg-MNPs89, 226-229).

Interestingly, sAg-MNPs induced a calcium signaling pathway (cel04020) that was also

identified by Tsyusko et al., when exposing C. elegans to Au nanoparticles 166. However,

the genes associated with this pathway in this study were different from those in the Au-

NP study.

Two pathways were identified in the AgNO3 exposure. The first, drug metabolism

pathway, contained two significantly down-regulated genes (hypothetical dehydrogenase

protein and flavin containing monooxygenase fmo-2) and three genes that were

significantly upregulated (glutathione S-transferase gst-10, gst-30, and UDP-

glucuronosyl transferase ugt-50). One of the significantly down-regulated genes, fmo-2,

has already been shown upregulated in AgNO3 and Ag-MNP toxicity 139. However, Eom

et al. used a shorter exposure time with a higher dose of AgNO3 than the current study

139. The three upregulated genes in the pathway are all phase II xenobiotic detoxification

enzymes 230-232. The second pathway, methane metabolism, had three catalase (ctl) genes

associated with the pathway that were significantly upregulated. These genes, ctl-1, 2,

and 3 are three catalase genes found in C. elegans, and knockout mutants for ctl-2 have

been previously shown to cause increases in morality when exposed to Ag-MNPs167. In

59

addition, ct1-1 and 2 are upregulated by daf-16 which is a key part of the stress and

aging response associated with the insulin signaling pathway 233.

For gene ontologies, when investigating the gene list for each treatment a total of

18 Biological Processes (BP), six Molecular Function (MF), and no Cellular

Compartment (CC) were identified (Table 3.2). There was little commonality among the

treatments. Ag-MNP gene list returned GO terms related to metabolic processing of

enzymes (GO: 0006732) and cofactors (GO: 0018988), while sAg-MNP returned

regulation of growth (GO: 0045927), molting cycle (GO: 0018988) and post-embryonic

development (GO: 00009791) terms. The tenth GO term for aging identified for Ag-

MNPs (GO: 0007568) was shared with AgNO3 and was the only BP GO term that was

shared among the treatments. AgNO3 had nine out of ten GO terms relating to stress

terms such as heat (GO: 0009408), unfolded protein (GO: 0006986), reactive oxygen

species (GO: 0000302), and abiotic stimulus (GO: 0009628) .

Table 3.2. List of Biological Process (BP) and Molecular Function (MF) Gene Ontology terms that were identified by DAVID using lists of significantly altered genes from N2 wild type nematodes when exposed to AgNO3, pristine Ag manufactured nanoparticles (Ag-MNPs), and sulfidized silver nanoparticles (sAg-MNPs) at the EC30 for 48 hours.

Go Term BP Category Genes in Category

P-Value Fold Enrichment

Exposure

GO:34976 Response to ER stress 5 8.60E-06 4.03 AgNO3

GO:0033554 Cellular Response to Stress 10 2.50E-05 4.03 AgNO3

GO:0006986 Response to unfolded protein 5 2.80E-05 4.03 AgNO3

GO:0009408 Response to Heat 5 6.90E-04 4.03 AgNO3

GO:0010033 Response to Organic Substances 5 3.80E-03 4.03 AgNO3

GO:0009628 Response to abiotic stimulus 6 9.00E-03 4.03 AgNO3

GO:0007568 Aging 12 8.40E-04 3.17 AgNO3

GO:0042542 Response to Hydrogen Peroxide 4 1.60E-04 1.88 AgNO3

GO:0000302 Response to ROS 4 3.40E-04 1.88 AgNO3

GO:0007568 Aging 8 8.10E-04 3.09 Ag-MNP

GO:00006084 Acetyl-CoA metabolic process 3 9.30E-04 1.69 Ag-MNP

GO:0006732 Coenzyme metabolic process 4 1.80E-02 1.69 Ag-MNP

GO:0051186 Cofactor metabolic process 4 5.00E-02 1.69 Ag-MNP

60

GO:0018988 Molting cycle, protein-based cuticle

10 5.00E-04 3.29 sAg-MNP

GO:0045927 Positive Regulation of growth 28 1.20E-02 1.47 sAg-MNP

GO:0006030 Chitin metabolic process 3 2.80E-02 1.38 sAg-MNP

GO:0006022 aminoglycan metabolic process 3 3.62E-02 1.38 sAg-MNP

GO:00009791 Post-Embryonic Development 25 3.40E-02 1.27 sAg-MNP

GO Term MF

Category Genes in Category

P-Value Fold Enrichment

Exposure

GO:0008233 peptidase activity 15 1.50E-02 1.83 AgNO3

GO:0017171 Serine hydrolase activity 6 1.10E-02 1.73 AgNO3

GO:0008238 exopeptidase activity 4 3.60E-02 1.73 AgNO3

GO:0004096 Catalase Activity 3 3.00E-03 1.12 AgNO3

GO:0008061 Chitin binding 3 1.50E-02 1.4 sAg-MNP

GO:0001871 Pattern Binding 3 2.30E-02 1.4 sAg-MNP

61

62

When the MF clustering was run using DAVID only AgNO3 and sAg-MNPs had

significant clusters indicated and neither lists had any common terms. GO terms of chitin

binding (GO: 0008061) and pattern binding (GO: 0001871) were identified for sAg-

MNPs. The AgNO3 gene list contained GO terms such as peptidase activity (GO:

0008233), serine hydrolase activity (GO: 0017171), and catalase activity (GO: 0004096).

All of the MF GO for Ag-MNPs are enzymatic terms whereas the MF GO terms

for sAg-MNPs related to structural cuticle components of the nematode. This is in

agreement with our previous study and supports our hypothesis that the cuticle is the

primary target for sAg-MNPs89. In that study we determined the distribution of Ag in

animals exposed to equitoxic concentrations (LC30 over 4hr) of AgNO3, Ag-MNPs and

sAg-MNPs using synchrotron-based X-ray fluorescence microscopy. The nematodes

exposed to sAg-MNPs had non-detectable internal Ag concentrations. Animals exposed

to pristine Ag-MNPs or AgNO3 had readily detectable internal Ag concentrations with

those in the Ag-MNP treatment being than the AgNO3 treatment. We hypothesized that

the toxicity of sAg-MNPs could be explained by cuticle damage and these gene

expression profiles support this hypothesis, since many genes involved in cuticle

structure were differentially expressed in the sAg-MNP treatment.

Toxicity using Mutant Strains and RNA interference The four genes used for the qRT-PCR confirmation involved in cuticle funciton

(rol-8, col-158, grl-20) and metal ion response (numr-1) were further used for the

functional testing with C. elegans mutant strains or using RNAi. If there is an increase or

decrease in toxicity in the mutant or RNAi knockdowns versus wild type nematodes after

exposures to one or several treatments that indicates that these genes are possibly

63

involved in toxicity or detoxification mechanisms. When mortality testing was conduted

on the rol-8 mutant strain (Figure 3.3a) there were signficant increases in toxicity as

compared to wild type nematodes for AgNO3 at 7.5 and 9.1 µg Ag L-1, Ag-MNP only at

52 µg L-1, and all levels of sAg-MNP. rol-8 is associated with deformations in the

cuticlue of the nematode which causes them to move using a lefthand barrel roll motion

234. Based on the results of the microarray and qRT-PCR experiements, the signficant

increase in rol-8 expression was only observed for the Ag-MNP and sAg-MNP.

However, it was suprising to see AgNO3 causing an increase in toxicity in rol-8 mutant.

This result may on one hand suggest that the response of this gene is due to released ions.

However, since both microarray analysis and the independent qRT-PCR experiments did

not show up-regulation of rol-8, the increased mortality in rol-8 mutants could be due to

the mutant strain being more suceptible to any stressor and or toxicant due to decreased

integrity of the cuticle.

In numr-1 mutants, significant increases in mortality as compared to wild type

nematodes were found at all treatment levels in both AgNO3 and Ag-MNP, but no such

increase was observed in sAg-MNP at any level (Figure 3.3B). Numr-1 has been shown

to be responsive to AgNO3 and its response to pristine Ag-MNP and AgNO3 is indicative

that some of the effects are also due to dissolved ions 217. Our previous study showed that

the dissolved Ag released from sAg-MNP (0.43%) over 24 hr is more than 13 times

lower than from pristine Ag-MNP (5.8%) 89, which would explain why we did not

observe up-regulation in numr-1 expression in response to sAg-MNP . This suggests that

numr-1 is involved in toxicity mechanism due to released ions from only pristine but not

sAg-MNPs.

64

Figure 3.3. Mortality of L3 Caenorhabditis elegans after 24 hours without feeding exposure to Ag+, pristine silver manufactured nanoparticles (Ag-MNPs), and sulfidized silver manufactured nanoparticles (sAg-MNPs) in moderately hard reconstituted water. Data are presented as mean percent mortality with error bars indicating standard error of the mean. An asterisk (*) indicates significantly different than N2 at α = 0.05 within each treatment and concentration.

RNAi knockdown was used for two genes, col-158 and grl-20. The col genes are

linked to the structure and function of the cuticle of the nematodes, the grl genes are in

the ground-like group which is the hedgehog related superfamily, whose function, though

not yet fully understood, has been linked to cuticle construction235-237. The grl-20 and

another collagen gene col-36, which is also up-regulated in response to sAg-MNPs, have

been previously suggested to co-regulate each other suggesting similar function. The

successful knockdown of both genes was confirmed using qRT-PCR (Fig. A3-4). No

signficant changes in the mortality as compared to wild type nematodes in any treatment

or level were observed for these genes (A3-5 a and b). The lack of the effect in these

genes could be due to the differences in length of expsoure between the mortality

experiments and the reproduction experiments. The col-158 and grl-20 could be involved

65

at time points in the growth cycle outside of the 24 hour mortality experiments.

Additionally there are at least 130 cuticle col genes and at least 33 grl genes that could

be compensating for the knockdown of these individual genes235, 238. In addition to these

two col and grl genes, there were 9 more col or grl genes in the shared pool that were

also up-regulated only in response to sAg-MNPs. It is possible that multiple genes must

be knocked down to observe an increase in toxicity.

Conclusions This study demonstrates that exposure of C. elegans to Ag-MNPs and sAg-MNPs

at EC30-reproduction results in different transcriptomic profiles. Based on these

transcriptomic results combined with our previous results relating dissolution, toxicity

and Ag bioaccumulation, we conclude that the toxicity of Ag-MNPs and sAg-MNPs is

due to different mechanisms. While the toxicity of pristine Ag-MNPs is partly explained

by dissolution and release of Ag ions, a proportion of the toxicity is due to particle

specific effects. The relative contribution of ionic versus particle specific effects was

previously shown to be concentration dependent; however, both mechanisms involve

uptake and bioaccumulation of Ag. In contrast, the toxicity of sAg-MNPs is largely

independent of free ion release and Ag bioaccumulation. The results presented here

support the hypothesis that cuticle damage is the primary mechanism of toxicity of sAg-

MNPs to C. elegans. While the decreased solubility of sAg-MNPs relative to Ag-MNPs

is correlated with decreased toxicity, release of free ions is not the primary mechanism of

reproductive toxicity of fully sulfidized sAg-MNPs.

66

Acknowledgments

We acknowledge D. Wall and C. Chen for microarray services and R. Ma, B. Collin, D.

Arndt, S. Shrestha, and A. Wamucho for laboratory assistance. Caenorhabditis elegans

strains were provided by the Caenorhabditis Genetics Center, which is funded by the NIH

Office of Research Infrastructure Programs (P40 OD010440). Funding for this research

was provided by the United States Environmental Protection Agency (U.S. EPA) Science

to Achieve Results Grant RD 834574. JU, GL and OT are supported by the U.S. EPA and

National Science Foundation (NSF) through cooperative agreement EF-0830093, Center

for Environmental Implications of Nanotechnology (CEINT). SL was partial funded by

the Tracy Farmer Institute for Sustainability and the Environment. Any opinions,

findings, conclusions, or recommendations expressed in this material are those of the

author(s) and do not necessarily reflect the views of the EPA or NSF. This work has not

been subjected to EPA or NSF review, and no official endorsement should be inferred.

67

Chapter 4: Toxicogenomic responses of Caenorhabditis elegans to pristine and aged Zinc Oxide nanoparticles. Starnes D., Lichtenberg, S., Unrine, J., Starnes, C., Elhaj Baddar, Z., Shrestha, S., Spear,

A., Bertsch, P., and Tsyusko, O.

Capsule The toxicity of phosphate aged and sulfidized Zinc Oxide nanoparticles is not fully due to

release of ions.

Highlights Toxicity of pristine ZnO nanoparticles is similar to toxicity of Zn2+

Some effects of pristine and aged ZnO nanoparticles can be linked to Zn2+

Aged ZnO nanoparticles have effects independent of Zn2+

Distinct toxicity pathways were not indicated for all four treatments

Abstract Manufactured nanoparticles (MNPs) undergo aging processes immediately following

release to the environment. Zinc oxide MNPs (ZnO-MNPs) entering wastewater

treatment streams encounter an environment enriched with SH- and PO43-, which results

in production of two major transformation products, zinc phosphate (pZnO-MNPs) and

zinc sulfide (sZnO-MNPs). We examined the toxicogenomic responses of pristine ZnO-

MNPs, aged pZnO-, and sZnO-MNPs, as well as ZnSO4 to the model organism soil

nematode, Caenorhabditis elegans. We found that aging reduced the toxicity of ZnO-

MNPs nearly ten-fold, while there was almost no difference in the toxicity of pristine

ZnO-MNPs and ZnSO4. Transcriptomic responses were screened at EC30 for reproduction

for each form of Zn and resulted in a total of 1848 differentially expressed genes. We

68

independently verified the expression of 3 genes (numr-1, pgp-6, scrm-8) using qRT-

PCR. Only 4.2% (79 genes) of the total gene list was shared by all treatments. Among

these genes were mtl-1, mtl-2 and numr-1, the genes associated with metal ion exposure.

Only 2.1% of the genes were shared between any MNP treatment and ZnSO4. Gene

Ontology enrichment analysis returned many shared terms among all treatments related

to stress associated with external factors and various immunity related terms. Only the

lysosome pathway was shared by both aged MNPs and ZnSO4 exposed nematodes.

Hierarchal cluster analysis showed that all MNP treatments clustered closer together than

any treatment did with ZnSO4. Taken together, these data suggest that responses of the

pristine and aged ZnO-MNPs cannot be attributed solely to Zn2+ effects.

Keywords: antimicrobial, nanomaterial, toxicogenomics, soil, wastewater

Introduction The growth of the nanotechnology industry continues to be robust, as indicated by

increases in both the number of products containing nanomaterials and the variety of

manufactured nanoparticles reaching the market (MNPs). Many products containing

MNPs are being incorporated into consumer products prior to full consideration of the

potential environmental implications. Zinc oxide MNPs (ZnO-MNPs) possess unique

physico-chemical properties that allow for a wide array of applications from biosensors to

optical devices, to personal care products239. Recent estimates for global production of

ZnO-MNPs exceeds 500 tons annually with nearly all of those MNPs being used in

cosmetics, sunscreens, and paints 240. With increased ZnO-MNPs use in consumer

products, the primary pathway that ZnO-MNPs will take to reach the environment is

through the land application of biosolids from wastewater treatment plants (WWTP)241,

69

242. Nearly 60% (US), 70% (United Kingdom), and 80% (Spain) of all biosolids from

WWTPs are being land applied as agricultural fertilizers41, 47, 242, 243. Given that

wastewater and sewage sludge is enriched in SH- and PO4-3-, two of the primary

transformation processes for ZnO-MPNs will result in formation of Zn-phosphate and

sulfide containing solid phases85, 86, 244.

Pristine, which is defined as “as synthesized”, ZnO-MNPs have already been

shown to cause toxicity in C. elegans, by negatively impacting their growth,

reproduction, and increasing their mortality above 400 mg L-1 and an LC50 at 620 mg L-1

in acetate buffered K-media148. In that same study fluorescently labeled ZnO-MNPs were

utilized and it was found that the MNPs were deposited in the intestinal tissues of the

nematodes. ZnO-MNPs have been shown to have a wide concentration range for

mortality to C. elegans, from 2.2 mg L-1 up to the 780 mg L-1 150, 156. This large range can

be attributed to the differences in media selected for exposures. Ma et al., used

buffered/unbuffered K-media while Wang at al., used ultra-pure water with no salt

additions. Using Danio rerio (zebrafish), Xiaoshan et al., showed that ZnO-MNPs were

more effective at generating reactive oxygen species in embryos compared to Zn2+ when

exposed to equal concentrations on a Zn basis245. ZnO-MNPs have been shown to induce

oxidative stress responsive genes in C. elegans 148, Eisenia fetida 15, Arabidopsis thaliana

246, and zebrafish 245.

The majority of the research conducted on the toxicity of ZnO-MNPs has utilized

some formulation or commercially available pristine ZnO-MNPs, while the effects of

aged ZnO-MNPs have only recently started to receive attention. Some focus has been

given to the primary aged product of Ag-MNPs, which has been shown to be sulfidized

70

Ag-MNPs66. Previous studies have addressed the impacts of sulfidation on the toxicity of

Ag-MNPs to C. elegans and Escherichia coli and all showed significant decreases in the

toxicity and bioavailability of the aged Ag-MNPs89, 140, 176. Research has also shown that

when legume Medicago trucatula was grown in soils-amended with biosolids containing

a mixture of transformed Ag-, ZnO- and TiO2-MNPs, it adversely affected the plant’s

nodulation rate and caused plant toxicity. In that study the transcriptomic data combined

with the metal uptake data suggested that the observed effects were likely due to Zn247,

248. To our knowledge, there are no studies that have investigated the toxicogenomic

effects of pristine ZnO-MNPs as compared to phosphate aged ZnO- and sulfidized ZnO-

MNPs. Given that both these aged forms of ZnO-MNP are predicted to be present in

biosolids applied to agricultural fields or formed after application, this represents a gap in

the understanding of the risks that ZnO-MNPs possess to environmental health.

Furthermore no other study investigated the effects of aged ZnO-MNPs using such

sensitive endpoint as reproduction, or determined if the genomic responses to these aged

MNPs are distinct from either pristine or bulk metal exposure.

The purpose of this study was to investigate and compare the toxicity and

transcriptomic responses of C. elegans exposed to pristine (as synthesized) ZnO-,

phosphate aged ZnO-, sulfidized ZnO-MNPs, and ZnSO4. Our hypothesis is that the

mode of toxicity will differ between pristine and aged ZnO-MNPs and that those would

be distinct from the response to ZnSO4 exposure. Due to degree of solubility exhibited by

ZnO-MNPs we also hypothesize that part of the response by C. elegans will be due to the

production of Zn2+, we therefore also investigated the dissolution of pristine and aged

ZnO-MNPs.

71

Materials and Methods

Zinc Oxide Nanoparticle Synthesis and Characterization Protocols for ZnO-MNPs synthesis and characterization were adapted from

previously published research from our lab249, 250. Pristine and the aged ZnO-MNPs

started with the dispersion of uncoated ZnO (Nanosun, Micronisers, Melbourne, Victoria,

Australia) with a primary nominal particle size of 30 nm. Primary particle size

distribution for both pristine and aged ZnO-MNPs was determined using transmission

electron microscopy (TEM, JOEL 2010F); 10 µL of 200 mg Zn L-1 ZnO-MNPs were

placed on formvar coated 200 mesh Cu grids and allowed to air dry in a laminar flow

hood, 100 particles were measured from three separate microgrsaphs. The pH of the

exposure solutions used to determine electrophoretic mobility and hydrodynamic radius

was 8.2 for all MNPs in synthetic soil pore water (SSPW). The mean intensity weighted

(z-average) hydrodynamic diameters were measured in exposure media (SSPW) at 100

mg Zn L-1 using dynamic light scattering (DLS, Malvern ZetaSizer Nano-ZS, Malvern,

United Kingdom). Zeta potentials (ZP) of both pristine and aged ZnO were calculated

using the Hückel approximation in SSPW using 100 mg Zn L-1 suspensions from

electrophoretic mobilities measured by phase analysis light scattering (PALS, Malvern

Zetasizer Nano-ZS).

Aging Phosphate aged ZnO-MNPs were generated by weighing 25 mg Zn L-1 of

nanoSun ZnO powder into 50 ml polypropylene centrifuge tubes and dispersing in a 5.3

mM solution of Na2HPO4 (pH adjusted to 6). 10 replicates were created and each tube

was sealed with paraffin and placed horizontally in wracks on a reciprocating shaker for 5

days according to Rathnayake et al., 2014249. Following incubation tubes were

72

centrifuged at 3320 g for 20 minutes. Supernatants were decanted and pellet was

resuspended in ultra-pure water. This process was repeated three times to ensure that all

Na2HPO4 was removed. Sulfidized ZnO-MNPs were generated by weighing 42 mg Zn L-

1 of nanoSun powder into 50 ml polypropylene centrifuge tubes and dispersing in 0.06 M

solution of Na2S in He sparged water. Ten replicates were created and each was filled to

maximum capacity to minimize the headspace in the tube. Tubes were sealed with double

layer of paraffin and placed horizontally in wracks on a reciprocating shaker for 5 days.

Following incubation tubes were centrifuged at 5000 g for 1 hr. Supernatants were

decanted and pellet was re-suspended in ultra-pure water. This process was repeated 3

times to ensure that all Na2S was removed. After final wash, aged nanoparticles were

lyophilized. Stock solutions of the aged and pristine MNPs were dispersed in ultra-pure

water at 100 mg Zn L-1 with continuous sonication in a water cooled-cup-horn sonicator

for 45 minutes at 100% power (Misonix, Newtown CT, USA).

Exposure Medium The choice of medium can strongly influence the toxicity of MNPs; therefore, we

chose synthetic soil pore water (SSPW) given that C. elegans is a soil-dwelling nematode

(Na 4 mM, Mg 0.5 mM, Al 1 µM, K 1.0 mM, Ca 1.25 mM, NO3 3.5 mM, SO4 0.5 mM,

PO4 1.0 µM, and I=10.3 mM). A complete description of SSPW can be found in Tyne et

al.; however, we modified our solutions by eliminating the iron to reduce the likelihood

of iron-ion complexes and aggregation events, and we excluded fulvic acid to further

isolate the effects of aging on ZnO-MNP toxicity143. We also aeriated the solution

overnight and adjusted the pH to 8.2 with 0.1 M NaOH143.We examined the effects of

phosphate aged ZnO-MNPs (pZnO-MNPs) and sulfidized ZnO-MNPs (sZnO-MNPs) in

73

addition to pristine ZnO-MNPs. Further, as ZnO-MNPs are prone to dissolution and

release of free Zn2+, ZnSO4 was used as an ion control in all experiments.

Dissolution Experiments Dissolution was determined by centrifuging 2.0 mL samples in SSPW at 16,800 x

g in acid washed polypropylene microcentrifuge tubes for 3 hours after 1 and 24 hour

incubation at 20°C in darkness. Stoke's law predicts that this would sediment ZnO larger

than 1 nm in diameter. We measured dissolution of ZnO-, pZnO-, and sZnO-MNPs at

two concentrations of 0.75 and 7.5 mg Zn L-1. Immediately after centrifugation, the top 1

mL of supernatant was removed and adjusted to 0.75 M HNO3. One mL of non-

centrifuged samples was digested in 2 mL of 5% trace metal grade HNO3, heated in a

microwave to 100°C, held at that temperature for 10 min, and diluted to final acid

concentration of 0.15 M HNO3 for analysis. Samples were analyzed for Zn using

inductively coupled plasma mass spectrometry (ICP-MS) (Agilent 7500cx, Santa Clara,

CA) with duplicate digestions, matrix spikes, cross calibration verification, and reagent

blanks.

Nematode exposure and toxicity experiments The toxicity protocols employed represent modifications of previously established

C. elegans toxicity testing methods used in our previous publications89, 166. Wild type N2

Bristol strain of C. elegans was obtained from the Caenorhabditis Genetics Center (CGC)

and were age-synchronized using NaClO/NaOH solution 251.

For mortality testing, larval L3 stage nematodes were exposed to varying

concentrations of ZnSO4, ZnO-, pZnO-, and sZnO-MNPs in SSPW without bacterial food

for 24 h in a 24 well polycarbonate tissue culture plate. Four concentrations were used for

74

every treatment. Unfed nematodes were exposed to ZnSO4 (5-20 mg Zn L-1), ZnO-MNPs

(5-20 mg Zn L-1), pZnO-MNPs (50-200 mg Zn L-1) and sZnO-MNPs (50-200 mg Zn L-1).

Exposures without feeding were conducted to differentiate between mortality due to

dissolution and mortality due to intact particles, where dissolution and subsequent

binding of Zn2+ ions to microbial cells would have complicated interpretation252. Each

treatment had four replicates per concentration with 10 (±1) nematodes in each well and

all concentrations were tested in two independent experiments.

For reproduction, eggs were hatched on K-agar plates with OP50 bacterial lawns

251 and were placed into the exposure solutions. For each exposure, six L1 nematodes

were exposed to four concentrations per treatment of ZnSO4 (0.5-2.0 mg Zn L-1), ZnO-

MNPs (0.5-2.0 mg Zn L-1), pZnO-MNPs (5.0-20.0 mg Zn L-1) and sZnO-MNPs (5.0-20.0

mg Zn L-1) in SSPW. These concentrations were chosen to stay beneath the LC10 of the

mortality experiments with feeding from previous results (unpublished data).

Reproduction experiments were conducted in the presence of bacterial food, Escherichia

coli (OP50 strain), added (OD600 = 1) at the rate of 10 µL mL-1 of exposure solution.

Exposure solutions for reproduction experiments were replaced after 24 h and fresh

bacterial food was added. After 50 h of exposure, individual nematodes were transferred

to K-agar plates for egg laying. Adult worms were transferred to fresh K-Agar plates

every 24 h for 72 h. Plates were incubated for 24 h to allow hatching, then stained with

rose bengal (0.5 mg L-1), heated to 50°C for 55 min, then fully hatched juveniles were

counted. Each exposure was tested in two independent experiments. EC30 values were

calculated from parameters determined using linear regression.

75

Particle-specific versus Ion-specific effects To determine the effect of Zn2+

produced by the ZnO-, pZnO-, and sZnO-MNPs,

particle free supernatants were generated after 24 h incubation and prepared as described

above in the dissolution experiment section. Nematodes exposed to particle free

supernatants were compared to nematodes exposed to whole suspensions that had been

incubated for 24 h. The highest concentration was selected for all treatments, and the

exposure conditions were the same as in the experiments for mortality tests (ZnSO4 and

ZnO-MNPs 20 mg L-1, pZnO-MNPs and sZnO-MNPs 200 mg L-1).

Nematode exposure and microarrays Nematodes at L1 stage were exposed to ZnSO4 (0.75 mg Zn L-1), ZnO-MNPs

(0.75 mg Zn L-1), pZnO-MNPs (7.5 mg Zn L-1) and sZnO-MNPs (7.5 mg Zn L-1) for 48

hours. Equitoxic concentrations (the EC30 for reproduction) were chosen so that modes

of toxicity could be differentiated where the severity and nature of the effects was similar

rather than examining transcriptomic responses at similar Zn concentrations, which

would have resulted in a very different nature and severity of effects. Additionally, these

concentrations were selected to avoid over representation of genes associated with cell

death and necrosis. All exposures for microarrays were conducted in the presence of

bacterial food, E. coli (OP50 strain), at the rate of 10 µL stock solution per mL of

exposure solution (OD600 = 1 for stock solution). To ensure a consistent exposure over

the course of 48 hours, exposure solutions were replaced after 24 h with fresh ones and

fresh bacterial food was added. Exposures were carried out in 15 mL polypropylene

centrifuge tubes containing 4 mL of exposure solution. The tubes were arranged

horizontally in the incubator and three replicates per treatment were prepared. After

exposure, RNA was extracted from each replicate using Trizol with subsequent

76

purification with Qiagen RNAeasy Kit (Qiagen, Chatsworth, CA). Cells were lysed using

multiple freeze-thaw cycles (-80 and 37°C) as previously described 166. All samples were

checked for RNA degradation using a Nanodrop ND-2000 spectrophotometer and

Agilent 2100 Bioanalyzer to examine the quality and quantity of the RNA samples. All

RNA samples had RNA integrity numbers of nine and above and were sent to the

Microarray Core Facility at the University of Kentucky to be processed using Affymetrix

C. elegans whole genome whole transcript (WT) microarrays. A total of 100 ng of total

RNA was used to generate fragmented, labeled ss-cDNA using Affymetrix WT Plus kit.

5.0 µg of the fragmented, labeled ss-cDNA were hybridized to EleGene 1.0 ST arrays for

16 h at 45°C and shaken at 60 RPM. The arrays were washed and stained using the

Affymetrix 450 fluidics station and scanned on the Affymetrix GeneChip 7G scanner.

Raw data files were normalized using the robust multi-array average (RMA) algorithm

followed by quantile normalization implemented in Partek Genomics Suite 6.4 (Partek,

Inc., St. Louis, MO)225. Lists of genes that were significantly different than control for

each treatment were generated in Partek. These lists were then used for pathway analysis

using the integrated Kyoto Encyclopedia of Genes and Genomes (KEGG) search tools to

investigate the possible involvement of relevant pathways. We then utilized the gene

ontology analysis functionality to screen terms for biological process (BP), molecular

function (MF), and cellular compartment (CC) using Partek default settings. All

microarray data are being submitted to the National Center for Biotechnology

Information (NCBI).

qRT-PCR: Validation of Microarray Data. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) analyses

were performed on samples in triplicates (both biological and technical) from

77

independent experiment. Y45F10D.4 (Y45) was selected as the reference gene, which

had no significant changes across treatments in either microarray or qRT-PCR analysis.

Y45 encodes for a putative iron-sulfur cluster enzyme has been shown to be an excellent

candidate for use as reference gene in nanotoxicity tests174. Three differentially expressed

genes were selected for qRT-PCR confirmation. Among them were p-glycoprotein (pgp-

6), nuclear localized metal responsive (numr-1), and scramblase (scrm-8) genes. 300 ng

of RNA were converted to cDNA using a High-Capacity RNA-to-cDNA kit™ (Applied

Biosystems) and RNA was cleaned with DNAse I for 15 minutes prior to cDNA

conversion (Qiagen, Chatsworth, CA). qRT-PCR reactions were carried out in 10 µL

volumes using TaqMan fast advanced master mix, TaqMan gene expression arrays for

each gene (Table A4-T1), and diluted 1:19 cDNA. All gene probes spanned exons and

StepOne Plus system (Applied Biosystems) was used for all amplifications with a

program of 10 min at 95 °C, followed by 40 cycles of 10 s at 95 °C and 30 s at 60 °C. All

treatments for each gene were run in triplicates. Negative controls and minus reverse

transcription (−RT) negative controls were run for every gene/sample to check for DNA

contamination.

Statistical Analysis Student’s t-tests with Dunnett’s multiple comparison corrections were applied to

test whether each concentration within a treatment was significantly different from

control for mortality and reproduction experiments. Homogeneity of variance and

normality of errors assumptions were checked using Q-Q plots and studentized residual

plots. EC10 and, when appropriate, EC50 values were calculated from parameters

determined using linear regression. SAS v9.4 (SAS Institute, Cary, NC, USA) was used

78

for all statistical analyses and SigmaPlot 12.3 (Systat, San Jose, CA, USA) was used to

generate mortality and reproduction figures.

Microarray data were screened for differences of each treatment (ZnO-, pZnO-,

sZnO-MNPs and ZnSO4) from control using one-way ANOVA with contrasts. The false

discovery rate (FDR) threshold was set at 0.2 and the fold change was required to be

greater than ±1.5, and a P-value ≤ 0.05. The FDR of 0.2 was selected to balance the

protection against false positives while minimizing the rate of false negatives. Using

Partek, genes that were significantly different from control in at least one treatment were

then analyzed using agglomerative hierarchical cluster analysis (HCA). HCA is a 2-Pass

clustering method; the first pass is a K-means clustering and in the second pass the K-

means clusters are joined by agglomerative clustering 213.

Results and Discussion

Characterization and Dissolution The zeta potential (ZP) of pristine ZnO-MNPs in SSPW was found to be 35.1

mV. After aging with phosphate the ZP dropped to -42 mV while with sulfidation the ZP

decreased to 7.1 mV. Changes in MPN surface charge can greatly alter their attraction of

counter ions, effect MNP interactions with biological membranes, and effect MNP

toxicity253. See chapter 4 appendix for ZP distributions for all three MNPs (A4-1). The

size of the pristine ZnO- and pZnO-MNPs when measured by TEM was 32 ± 8 nm (mean

± standard deviation) and 307 ± 150 nm, respectively. Due to aggregation of the particles,

TEM based measurements was not possible for sZnO. Representative TEM images and

XAS spectra for pZnO- and sZnO-MNPs can be seen in appendix figures (A4-2, 3). The

hydrodynamic diameter of the pristine ZnO-MNPs was observed to be 265 ± 0.258 and

pZnO-MNPs and sZnO-MNPs showed 1715 ± 0.872 and 1022 ± 0.532 respectively. See

79

appendix information for size distributions by intensity for all three MNPs (A4-4). These

data were consistent with other published work on phosphate and sulfidized ZnO-MNPs,

most of the differences found in hydrodynamic diameter and ZP would be attributable to

the differences in media used for testing.

For all MNPs, we observed concentration-dependent dissolution with the

dissolved Zn, expressed as a percent of the total, being greater at the lower 0.75 mg L-1

Zn concentrations as compared to the higher 7.5 mg L-1 Zn at both 2 hr and 24 hr (Figure

4.1). Additionally, pZnO-MNPs exhibited higher percent of dissolution after 24 hours for

both 0.75 and 7.5 mg L-1 concentrations. sZnO-MNPs exhibited lower percent dissolution

at both concentrations and time points relative to pristine, and pZnO-MNPs. The greater

dissolution of pZnO- compared to sZnO- and even ZnO-MNPs is unexpected because

zinc phosphate has a Ksp value of 10-33 compared to ZnS Ksp of 10-25 254. However, the

protocol used by Rathnayake et al., (2014) for phosphatation had 40% residual ZnO

while the sulfidation protocol results in nearly complete sulfidation249, 250. As shown

previously by Rathnayake et al., (2014) we would have expected to see lower rates of

dissolution in pZnO-MNP at the exposure pH of 8.2, however our particles were

synthesized at pH 6.0 and the results could also indicate that the pZnO-MNP may not

have been fully phosphatized249.

80

Figure 4.1. The percent dissolution of pristine zinc oxide manufactured nanoparticles (ZnO-MNPs), phosphate aged particles (pZnO-MNPs), and sulfidized particles (sZnO-MNPs) at 3 and 24 hours at two concentrations (0.75 and 7.5 mg Zn L-1). Error bars represent the standard deviation of the mean.

Toxicity Pristine ZnO-MNPs demonstrated similar toxicity for both endpoints (mortality

and reproduction) as ZnSO4, suggesting that these effects are likely due to ions. The

toxicity was significantly decreased when C. elegans was exposed to aged ZnO-MNPs as

compared to pristine ZnO-MNPs. For both endpoints a 10-fold higher concentration was

necessary to achieve similar levels of toxicity when comparing either ZnSO4 or pristine

ZnO-MNPs to pZnO- and sZnO-MNPs. Similar trends with the aged MNPs were

observed when investigating the toxicity of sulfidized Ag-MNPs; however, in contrast

with this study, we observed that the toxicity of Ag+ was about 10 fold higher than

pristine Ag-MNP89.

Mortality Mortality in the absence of food for all treatments never exceeded 30%. Only

nematodes exposed to 20 mg Zn L-1 of ZnSO4 and pristine ZnO-MNPs had mortality

0

10

20

30

40

50

60

70

ZnO-MNP pZnO-MNP sZnO-MNP ZnO-MNP pZnO-MNP sZnO-MNP

0.75 mg/L 7.5 mg/L

% D

isso

lved

Zn

3 hr 24 hr

81

significantly different from controls, while for the aged MNPs the mortality at much

higher concentrations of 100 and 200 mg Zn L-1 were found to be significantly different

than control (p <0.05) (Figure 4.2). The observed decrease in toxicity between aged and

pristine ZnO-MNPs was consistent with previous experiments with aged Ag-MNPs. Our

results showed no difference between mortality caused by ZnO-MNPs and ZnSO4. Yet,

dissolution data demonstrates that the ZnO-MNPs are not fully dissolved, suggesting part

of the toxicity must be due, in part, to intact particles. Given the high solubility of pristine

ZnO-MNPs, it would be expected that most of toxicity would be due to released Zn2+.

However, we measured high levels of dissolution over 24 hours for phosphate aged ZnO-

MNPs; the toxicity for phosphate aged ZnO-MNPs was much lower than for pristine

ZnO-MNPs. Also, it is important to note that the solubility measurements were taken

without presence of bacteria and nematodes and therefore the dissolution observed in the

actual experiments with the bacteria/nematodes may not be the same. There are no

straight forward ways to measure dissolution in the presence of these organisms. Our

results are consistent with similar observations in a previous study between pristine ZnO

and ZnCl2 that the toxicity of ZnO and dissolved Zn is similar150. It is difficult to compare

our mortality data with previous studies given that LC50 in C. elegans toxicity studies has

been reported to be as low as 300 µg Zn L-1 and as high as > 1.0 g Zn L-1 148, 175, 255. This

variance can be attributed to the difference in media chosen for the exposures as well as

the larval stage in which the tests were conducted.

The mortalities for the nematodes exposed to each particle free supernatants of

ZnO-, pZnO-, and sZnO-MNPs showed nearly a threefold decrease compared to whole

solutions, and were not significantly different from that in controls, while mortality in the

82

whole suspensions were at 17% for ZnO-MNPs, 18% for pZnO-MNPs, and 19% for

sZnO-MNPs (Figure 4.3). When the nematodes were exposed to supernatants of ZnSO4,

the mortality was 21%, similar to the 20% mortality observed in the whole (un-

centrifuged) ZnSO4 solution (P > 0.05). These data were generated independently from

the experiments for the data presented in Figure 4.2, and the levels of toxicity are

consistent across both experiments. This indicates that although the toxicity of ZnSO4

and ZnO-MNPs are similar, the toxicity of ZnO-, pZnO- and sZnO-MNPs are not entirely

due to the release of Zn ions into solution prior to uptake.

Figure 4.2. Mortality of L3 Caenorhabditis elegans after 24 hours without feeding exposure to ZnSO4, pristine Zinc Oxide manufactured nanoparticles (ZnO-MNPs), phosphate aged (pZnO-MNPs), and sulfidized (sZnO-MNPs) in synthetic soil pore water. Data are presented as mean percent mortality with error bars indicating standard error of the mean. An asterisk (*) indicates significantly different than control at α = 0.05.

83

Figure 4.3. Mortality of Caenorhabditis elegans after 24 hours without feeding when exposed to particle free supernatants (Supernatant) versus whole solutions of ZnSO4, pristine Zinc Oxide manufactured nanoparticles (ZnO-MNPs), phosphate aged (pZnO-MNPs), and sulfidized (sZnO-MNPs) in synthetic soil pore water. Data are presented as mean percent mortality with error bars indicating standard error of the mean. An asterisk (*) indicates significantly different than control at α ≤ 0.05.

Reproduction. Nematodes exposed to all treatments exhibited significant reductions in the

number of offspring per adult compared to control, regardless of concentrations (p<0.005

for all comparisons). The EC10 for ZnSO4 was 0.251 mg L-1, for ZnO-MNPs was 0.257

mg L-1, pZnO- and sZnO-MNPs were 2.39 mg L-1 and 2.33 mg L-1, respectively. The

EC50 for ZnSO4 was 1.26 mg L-1, for ZnO-MNPs was 1.28 mg L-1, pZnO- and sZnO-

MNPs were 11.94 mg L-1 and 11.69 mg L-1, respectively (Figure 4.4). Our results showed

no differences in the effects on reproduction between ZnSO4 and pristine ZnO-MNPs

which is consistent with Ma et al., 2009, who showed no significant difference between

84

ZnO-MNPs and ZnCl2 for reproduction150. Our concentrations for EC50s are about 10

fold less than reported by Ma et al., while being similar to Gupta et al., 2015, who found

an EC50 of 0.7 mg Zn L-1 148, 175. The differences in nanoparticles and media composition

are likely the source of the variation in the EC50s reported for these studies.

Figure 4.4. Mean total number of offspring per adult nematode Caenorhabditis elegans after 48 hours from L1 stage exposed to ZnSO4, pristine Zinc Oxide manufactured nanoparticles (ZnO-MNPs), phosphate aged (spZnO-MNPs) and sulfidized (sZnO-MNPs) in synthetic soil pore water in the presence of bacterial food (Escherichia coli strain OP50). An asterisk (*) indicates significantly different than control at α = 0.05.

Microarray results Whole genome microarrays for each treatment yield 1848 genes that were

significantly expressed (p < 0.05, FC 2.0, and FDR 0.2) relative to control. Of these

genes, only 79 were shared by all treatments (4.2%) (Figure 4.5). Among them there were

85

up-regulated genes associated with response to metal ions, such as nuclear metal response

(numr-1) and both metallothionein (mtl-1, mtl-2) genes. This suggests that some of the

effects in all treatments can be attributed to ionic effects. Further, out of total of 147

genes responding to ZnSO4, only 28 genes were unique to ZnSO4 (1.5%), the rest were

shared among all treatments. One hundred and nineteen genes (6.4%) represent the pool

of genes that ZnSO4 shared with at least one MNP treatment. Pristine ZnO-MNPs from

total of 435 genes had only 26 unique genes while there were 367 (out of 817) and 65

(out of 449) unique genes for the aged, pZnO-and sZnO-MNPs, respectively. Of the

MNP treatments, pZnO-MNPs returned overall the most number of perturbed genes with

5-10 fold more genes returned than each of the other treatments.

Figure 4.5. Venn diagram of the significantly up/down regulated genes with a fold change greater than ± 2.0, FDR of 0.2, and p-value ≤ 0.05. Caenorhabditis elegans exposed for 48 hours, with feeding, to ZnSO4, pristine Zinc Oxide manufactured nanoparticles (ZnO-MNPs), phosphate aged (pZnO-MNPs) and sulfidized (sZnO-MNPs) in synthetic soil pore water.

86

From all differentially expressed genes, only 6% of the genes were returned overlapping

between ZnSO4 and all of MNP treatments. Had we attributed all observed effects solely

to ions, it would be expected for this overlap to be significantly larger. Taken into

context of the dissolution data (high dissolution for ZnO and pZnO-MNPs) and the gene

pools, had ions effects been dominant, the overlap between ZnSO4 and phosphate aged

pZnO-MNPs would have returned many more genes.

When hierarchical cluster analysis was performed on the list of significant genes

it was observed that chips within a treatment clustered together. We also observed that all

three MNP treatments clustered closer together than any did with ZnSO4 (Figure 4.6).

Again, had the toxicity of MNP treatments been only due to the production and release of

Zn2+, we would have expected a stochastic distribution of the replicates rather than

ordering into the two major groups as observed. There are a limited number of

toxicogenomic studies on MNPs currently available142, 163, 166. In a toxicogenomic study

of ZnO-MNPs in H. azteca, it was observed that there was an apparent random

distribution of the MNPs and Zn2+ replicates. This study suggests that for H. azeteca, the

transcriptomic response is dominated by common pathways shared between Zn2+ and

MNPs256. Only one study has been published directly comparing the toxicogenomic

effects of aged MNPs in C. elegans. In that study Ag+ and pristine Ag-MNPs showed

more commonality in response than was shared either between Ag+ and sulfidized sAg-

MNPs or between pristine and aged sAg-MNPs.

87

Figure 4.6. Hierarchical clustering of significantly expressed genes from Caenorhabditis elegans exposed for 48 hours to ZnSO4, pristine Zinc Oxide manufactured nanoparticles (ZnO-MNPs), phosphate aged (pZnO-MNPs), and sulfidized (sZnO-MNPs) in synthetic soil pore water.

qRT-PCR confirmation The up or down expression of four genes selected from both the shared and

unique gene expression pools were confirmed independently with qRT-PCR. Among

these four genes, there are two related to P-glycoproteins in the ATP-binding cassette

superfamily (pgp-5 and pgp-6) which are predicated to be important for the exporting of

exogenous toxins (pgp-6) and response to bacterial stimulus (pgp-5)160, 257. The third

gene, scramblase (scrm-8) is responsible for maintain phospholipid asymmetry and

signaling events in apoptosis in C. elegans and is homologues to phospholipid scramblase

1 (plscr-1), which is highly conserved in mammalian species258. The fourth gene, nuclear

88

localized metal response gene (numr-1), which is typically expressed in response to

toxicity from metal ion exposure 217, was observed to be up-regulated by all treatments.

Biological Pathways and Gene Ontologies Using Partek Genomics discovery suite’s pathway analysis, we discovered 15

significant pathways for at least one of the treatments. Only two pathways (Lysosome

and ABC transporters) were shared by multiple treatments and no pathways were

common to all treatments (Table 4.1). Most of the pathways were induced by exposure to

one of the aged pZnO-MNP treatment (12 out of the 15 pathways). ABC transporter

pathway was found to be shared by both pristine ZnO- and aged pZnO-MNPs, while the

lysosome pathway was shared among the ZnSO4 and both aged pZnO- and sZnO-MNP

treatments. The ABC transporter pathway has been shown to be involved with metal

detoxification of Cd2+. It is interesting that the lysosome pathway was identified during

pathway analysis for both aged ZnO-MNPs and ZnSO4. As the lysosome pathway has

been implicated previously in toxicogenomic studies of C. elegans exposed to Ag-MNPs,

it is reasonable to suggest that the acidic environment in these vesicles could be involved

in the dissolution of MNPs165. In another study of Au-MPs, significantly up-regulated

genes were calpains, which are associated with calpain-cathepsine mechanism leading to

lysosome rapture166.

Table 4.1. List of pathways that were identified by Partek using lists of significantly altered genes from Caenorhabditis elegans exposed for 48 hours to ZnSO4, pristine Zinc Oxide manufactured nanoparticles (ZnO-MNPs), phosphate aged (pZnO-MNPs), and sulfidized (sZnO-MNPs) in synthetic soil pore water.

KEGG ID Pathway Name Genes in Pathway

Fold Enrichment

P-Value Treatment

cel02010 ABC transporters 2 6.231 0.002 ZnO

cel04142 Lysosome 2 3.574 0.028 ZnSO4

cel00270 Cysteine and Methionine metabolism 4 5.739 0.003 pZnO

cel02010 ABC transporters 3 5.233 0.005 pZnO

cel00410 beta-Alanine metabolism 3 4.664 0.009 pZnO

cel00500 Starch and sucrose metabolism 3 4.347 0.013 pZnO

cel04142 Lysosome 5 4.344 0.013 pZnO

cel00380 Tryptophan metabolism 3 4.203 0.015 pZnO

cel00062 Fatty acid elongation 2 4.026 0.018 pZnO

cel01200 Carbon metabolism 5 3.850 0.021 pZnO

cel00640 Propanoate metabolism 3 3.818 0.022 pZnO

cel04068 FoxO signaling pathway 4 3.731 0.024 pZnO

cel01230 Biosynthesis of amino acids 4 3.503 0.030 pZnO

cel00280 Valine, leucine an isoleucine degradation 3 3.489 0.031 pZnO

cel04142 Lysosome 2 3.574 0.028 sZnO

89

90

The FoxO signaling pathway, which has been associated with oxidative stress,

were identified as a unique pathway for aged pZnO MNPs, consistent with previous

findings demonstrating that ZnO-MNPs are capable of generating reactive oxygen

species in sufficient quantities to cause toxicity in C. elegans175. Other pathways induced

by pZnO-MNPs were pathways associated with amino acid synthesis and metabolism

(cel00270, cel00410, cel00380,cel00280), which are linked to both longevity and general

stress responses in C. elegans259. Metabolic pathways (cel00500, cel00640) have been

thoroughly examined in relationship to the control of lifespan and aging of the

nematodes260-262. However, little information is currently available on the effect of MNPs

on these pathways and how the perturbation of these pathways is related to MNP toxicity.

Pathway analysis has shown that pZnO-MNPs perturbed the majority of pathways in this

study. Combined with the limited number of shared pathways with the other treatments, it

is difficult to attribute all of the observed effects to only ion-specific effects.

Furthermore, the two aged ZnO-MNP treatments were found to share only a single

pathway (lysosome) and that pristine ZnO-MNPs and phosphate aged pZnO-MNPs only

share a single pathway (ABC transporters). This suggests that there is some commonality

in the response to pristine and aged ZnO-MNPs by C. elegans. However, the additional

pathways in pZnO-MNPs and the lack of shared pathways between pristine ZnO- and

sZnO-MNPs supports the hypothesis that aged ZnO-MNPs have distinct effects that are

independent of their pristine starting materials.

Gene ontologies (GO) for each treatment reveal a total of 89 Biological Processes

(BP), 28 Molecular Function (MF), and 10 Cellular Compartment (CC) (Tables 4.2-4.4).

Each term identified had to meet a p-value cut off (P<0.05) and have at least 3 genes

91

associated with that GO term. Complete tables with GO ids, genes in category, p-values,

and fold enrichment can be found in the appendix (Tables A4-2 – A4-4). In the BP terms,

the majority of the overlap occurred with terms relating to defense, response, and stress,

while MF terms came from cuticle related terms, and in CC the only overlapping term

was for collagen trimmer (Tables 4.2-4.4). These overlapping terms represent 13% of the

returned terms with 87% of the terms being specific to MNP treatments. There were total

of eight BPs shared among all treatments. Among them are defense response, immune

response, innate immune response, response to bacterium, response to external stimulus,

response to stimulus, response to inorganic substance, response to stress. All these shared

BPs indicate that both ions and all MNP treatments caused stress in C. elegans and

interestingly, several of the responses (responses to bacterium, innate immunity) are

similar to the ones observed when C. elegans were exposed to pathogenic bacteria. The

indication to the response to metal ions was also found among BPs for all treatments such

as BP GO “response to cadmium ion” was shared among ions, pristine ZnO-MNPs, and

aged pZnO-MNPs and BP GO “response to metal ion” was shared among ions and both

aged MNPs. MFs shared by all treatments included two GOs, “structural constituent of

cuticle” and “structural molecule activity”, both of which include genes related to cuticle

function. In our previous study with Ag-MNPs, we also observed activation of many

genes associated with cuticle structure in response to aged sulfidized Ag-MNPs but not

ions165. The MF GO that was shared by all MNP treatments was “ATPase activity” this

could be a response to other stresses induced by Zn2+. The only shared by all treatments

CC GO term was “collagen trimer”, which is also associated with C. elegans cuticle.

Trimerization domains of collagens are necessary for proper collagen folding into triple

92

helix and mutations in these domains in collagens are associated with connective tissue

diseases in humans263.

Table 4.2. List of Biological Process (BP) Gene Ontology terms that were identified by Partek using lists of significantly altered genes from N2 wild type nematodes when exposed to ZnSO4, pristine zinc oxide manufactured nanoparticles (ZnO-MNPs), phosphate aged (pZnO-MNPs) and sulfidized (sZnO-MNPs) at the EC30 for 48 hours.

GO Term: Biological Process Exposure amino sugar metabolic process ZnSO4 aminoglycan metabolic process ZnSO4 aspartate family amino acid biosynthetic process

pZnO

aspartate family amino acid metabolic process

pZnO

cell cycle switching, mitotic to meiotic cell cycle

pZnO

cellular amino acid biosynthetic process pZnO chitin metabolic process ZnSO4 collagen and cuticulin-based cuticle development

ZnSO4

cuticle development ZnSO4 defense response ZnSO4, ZnO, pZnO,

sZnO defense response to bacterium pZnO defense response to Gram-negative bacterium

ZnSO4, pZnO, sZnO

defense response to Gram-positive bacterium

pZnO, sZnO

defense response to other organism ZnSO4, sZnO fatty acid metabolic process pZnO germ-line sex determination pZnO hermaphrodite germ-line sex determination pZnO immune response ZnO, pZnO, sZnO immune system process ZnSO4, ZnO, pZnO,

sZnO innate immune response ZnSO4, ZnO, pZnO,

sZnO lipid catabolic process pZnO, sZnO male gamete generation pZnO masculinization of hermaphroditic germ-line pZnO meiotic nuclear division pZnO

93

multi-organism process ZnO, sZnO positive regulation of cell cycle pZnO positive regulation of meiotic cell cycle pZnO regulation of translation pZnO response to bacterium ZnSO4, ZnO, pZnO,

sZnO response to biotic stimulus ZnSO4 response to cadmium ion ZnSO4, ZnO, pZnO response to chemical ZnSO4, ZnO, sZnO response to external biotic stimulus sZnO response to external stimulus ZnSO4, ZnO, pZnO,

sZnO response to inorganic substance ZnSO4, ZnO, pZnO,

sZnO response to metal ion ZnSO4, pZnO, sZnO response to other organism ZnO response to stimulus ZnSO4, ZnO, pZnO,

sZnO response to stress ZnSO4, ZnO, pZnO,

sZnO serine family amino acid biosynthetic process

pZnO

sex determination pZnO Spermatogenesis pZnO stress response to cadmium ion pZnO, sZnO stress response to metal ion pZnO, sZnO sulfur amino acid metabolic process sZnO sulfur compound metabolic process sZnO

94

Table 4.3. List of Molecular Function (MF) Gene Ontology terms that were identified by Partek using lists of significantly altered genes from N2 wild type nematodes when exposed to ZnSO4, pristine zinc oxide manufactured nanoparticles (ZnO-MNPs), phosphate aged (pZnO-MNPs) and sulfidized (sZnO-MNPs) at the EC30 for 48 hours.

GO Term: MF Exposure chitin binding ZnSO4, ZnO active transmembrane transporter activity pZnO, sZnO ATPase activity, coupled ZnO, pZnO, sZnO ATPase activity, coupled to transmembrane movement of substances

ZnO, pZnO, sZnO

carbohydrate binding sZnO hydrolase activity, acting on glycosyl bonds sZnO monooxygenase activity pZnO mRNA 3'-UTR binding pZnO mRNA binding pZnO nucleoside-triphosphatase activity ZnO pyrophosphatase activity ZnO structural constituent of cuticle ZnSO4,ZnO, pZnO,

sZnO structural molecule activity ZnSO4,ZnO, pZnO,

sZnO tetrapyrrole binding pZnO transferase activity, transferring glycosyl groups pZnO transferase activity, transferring hexosyl groups pZnO

Table 4.4. List of Cellular Compartments (CC) Gene Ontology terms that were identified by Partek using lists of significantly altered genes from N2 wild type nematodes when exposed to ZnSO4, pristine zinc oxide manufactured nanoparticles (ZnO-MNPs), phosphate aged (pZnO-MNPs) and sulfidized (sZnO-MNPs) at the EC30 for 48 hours.

GO Term: CC Exposure collagen trimer ZnSO4,ZnO, pZnO,

sZnO cytoplasmic ribonucleoprotein granule

pZnO

Lysosome pZnO membrane raft pZnO, sZnO P granule pZnO Vacuole pZnO

95

There were thirteen BP, three MF, and one CC that were shared between ZnSO4

and at least one other MNP treatment. Only four GO terms (2 BP, 2 MF) were shared by

ZnO-MNPs and at least one of the aged ZnO. Exposure to the aged pZnO-MNPs resulted

in the highest number of unique GOs (18 out of 45 in BP, 6 out of 16 MF, and 4 out of 6

CC) compared to exposure to other treatments. Among these GOs, most were BPs related

to reproduction, e.g., spermatogenesis, meiotic cell cycle, and germ-line sex

determination. Exposure to the aged sZnO-MNPs resulted in seven unique BP and two

unique MF terms. Exposure to aged sZnO-MNPs returned two BP terms related to sulfur

metabolism, while the MF terms where related to carbohydrate binding and hydrolase

activity, and no CC terms. The two aged ZnO-MNPs shared of total 15 BP terms; one

interesting term that was shared was related to lipid oxidation. The number of unique

GOs observed for the aged MNPs suggests that C. elegans is responding differentially to

pristine and aged ZnO-MNPs. The CC terms for pZnO-MNPs being related to P granules,

vacuoles, and lysosomes is suggestive that the fate of at least the phosphate aged ZnO-

MNPs could be the lysosome. Both pZnO-MNPs and sZnO-MNPs showed induction of

the lysosome pathway but sZnO-MNPs returned no GO terms relating to lysosomes or

granules. Given that there is little overlap in the pathways and the majority of the GO

Terms being returned to single treatments, this suggests that the responses to each of the

treatments is distinct and cannot be explained simply by the production of Zn2+.

Furthermore, there is divergence in the pathways and Go Terms of pristine and aged

ZnO-MNPs.

Conclusions We demonstrated that pristine (as-synthesized) ZnO-MNPs and Zn2+ exhibited

near identical responses to mortality and reproduction endpoints; this is in agreement

96

with previously published studies. However, ZnO-MNP genotoxicity could not be fully

explained by release of Zn ions in the exposure media. Furthermore, we also observed

nearly a ten-fold decrease in the toxicity to these endpoints after pristine ZnO-MNPs

were aged in the presence of either phosphate or sulfide, which is consistent with the

effects of sulfidized Ag-MNPs previously reported. Both aged pZnO-MNPs and sZnO-

MNPs represent two of the major transformation products expected to be present in

biosolids that are applied to agricultural fields, indicating that the wastewater treatment

process will decrease the initial toxicity of ZnO-MNPs in this exposure scenario. It

should be noted however, that subsequent transformations in the soil are not accounted

for here. Microarray data and pathway analysis showed that there are distinct responses

to MNP exposures and Zn2+ exposure. Additionally, we observed that aged MNPs, while

causing similar levels of toxicity, did not have identical genomic responses. More

research will be required to fully determine how much of the shared responses between

MNPs are truly particle specific and what can be attributed to ion-specific effects.

Acknowledgements We acknowledge the assistance of D. Wall,C. Chen ,D. Arndt, Wamucho,Y. Thompson,

Y., and T. Karathanasis,. Caenorhabditis elegans strains were provided by the

Caenorhabditis Genetics Center, which is funded by the NIH Office of Research

Infrastructure Programs (P40 OD010440). Funding for this research was provided by the

United States Environmental Protection Agency (U.S. EPA) Science to Achieve Results

Grant RD 834574. JU and OT are supported by the U.S. EPA and National Science

Foundation (NSF) through cooperative agreement EF-0830093, Center for

Environmental Implications of Nanotechnology (CEINT). SL was partial funded by the

Tracy Farmer Institute for Sustainability and the Environment at the University of

97

Kentucky. Any opinions, findings, conclusions, or recommendations expressed in this

material are those of the author(s) and do not necessarily reflect the views of the EPA or

NSF. This work has not been subjected to EPA or NSF review, and no official

endorsement should be inferred.

98

Chapter 5: Conclusions and Future Direction

This dissertation examined the ecotoxicological and transcriptomic responses, as

well as the toxicity pathways and mechanisms of pristine, defined as as-synthesized, and

aged Ag and ZnO manufactured nanoparticles (MNPs), using the model organism

Caenorhabditis elegans. Given their anti-microbial properties, which can be exploited in

consumer and medical products, the release of the Ag-MNPs is likely to continue to

increase47, 168, 169. Zinc oxide MNPs are currently the second most widely produced MNPs

globally (mass basis), and as more paints, cosmetics, plastics, and other consumer

products are produced, the potential for environmental contamination will further

increase7. Nematodes serve an important ecological role in soils as one of the principal

bacterial predators, thereby greatly influencing bacterial communities and contributing to

the nutrient cycling in soils. Soils have been shown to have nearly 25 times more bacteria

when nematodes are present; additionally, nitrogen mineralization is greatly increased113.

Nematodes can be found at nearly all latitudes on earth and therefore are a ubiquitous

organisms globally113. C. elegans has a fully mapped genome and an extensive suite of

functional genomics tools. The research presented in this dissertation has demonstrated

the utility of C. elegans as a model ecological receptor for examining the eco- and geno-

toxicity of MNPs as well as for identifying toxicity pathways. Using C. elegans, we have

compared the toxicity of pristine and aged MNPs and were able to unequivocally

delineate ion specific versus particle specific effects and identify differences in

transcriptomic responses and identify likely toxicity pathways.

The first set of experiments examined how sulfidation, the primary transformation

process for Ag-MNPs in wastewater treatment plants (WWTP), alters the toxicity and

99

toxicity pathways of Ag MNPs. It is unlikely that relevant quantities of Ag-MNPs will

reach terrestrial environments in the pristine condition. Therefore, the focus on

identification and comparison of the effects of pristine and sulfidized Ag-MNPs (sAg-

MNPs) to C. elegans was a justified priority. Additionally, as Ag-MNPs have a finite

solubility, it was also important to differentiate the effects of sAg-MNPs and Ag-MNPs

compared to ions released from dissolution, or a combination of the two. We employed

established C. elegans toxicity testing techniques for assessing the impacts of MNPs

using ecologically relevant endpoints (mortality, growth, and reproduction). Of those

endpoints, we identified that reproduction was the most impacted by both pristine and

aged Ag-MNP as well as the AgNO3. We also applied two novel approaches in an

attempt to differentiate between ion specific and particle specific effects. We exposed

nematodes to whole solutions of MNPs compared to their particle free supernatants and

found significant decreases in toxicity in supernatant exposed nematodes. We also

utilized synchrotron X-ray fluorescence microscopy and were able to determine that the

bioavailability of Ag from AgNO3 and pristine Ag-MNPs were different at similar

concentrations normalized by effect (the LC30) with greater Ag concentrations in tissues

from the Ag-MNP treatment. In contrast, nematodes exposed to sAg-MNPs had tissue Ag

concentrations below the detection limit of the X-ray fluorescence microscope,

suggesting that the toxicity of sAg-MNPs may be caused with minimal Ag uptake. These

experiments lead to the conclusion that we could not fully attribute the toxicological

effects of Ag-MNPs and sAg-MNPs to C. elegans solely due to dissolution of the MNPs

in the exposure media. Additionally, our findings showed a significant decrease in the

100

toxicity of Ag-MNPs after aging and that there is a reduction in the solubility and the

bioavailability of these aged sAg-MNPs relative to pristine Ag-MNPs.

To examine toxicity pathways and possible mechanisms of pristine and aged Ag-

MNPs, a toxicogenomic approach utilizing whole genome microarrays with validation

from qRT-PCR of selected genes, RNA interference (RNAi) assays, and mutant

(knockout) assays. Our results show that the majority of the differentially expressed

genes were unique to individual treatments (85%) and that only 3.5% were shared among

all treatments. In the shared gene list, 11 out of the 20 shared genes showed differential

expression among treatments where upregulation was observed in sAg-MNPs and down

regulation in Ag+ and pristine Ag-MNPs. Hierarchal cluster analysis showed that Ag-

MNPs and sAg-MNPs were more closely clustered than either with AgNO3. However,

sAg-MNPs clustered closer to the controls than to the Ag-MNP treated animals. Had all

observed toxicity been solely due to dissolution in the media, the individual replicates

would have clustered randomly and not according to treatment. For AgNO3 exposure,

Gene Ontology terms were primarily associated with cellular and endoplasmic reticulum

stress, while pristine Ag-MNPs returned more terms associated with cofactor and

coenzyme metabolism, and sAg-MNPs returned terms associated with the cuticle

function. Based on these factors it is likely that the majority of the effects from Ag-MNP

and sAg-MNP exposure are particle specific. This is confirmed by the fact that predicted

toxicity due to dissolved Ag, as measured by calculating expected mortality from the

AgNO3 concentration-response curves, was a substantially lower than the actual toxicity

in the Ag-MNP and sAg-MNP treatments. It is also confirmed by the amelioration of

toxicity when particles were removed from the exposure solution by centrifugation.

101

Taken together these results show that Ag-MNP transformation products present in

biosolids are less toxic to C. elegans and elicit toxicity through a distinct mechanism.

The principle transformation products of ZnO-MNPs in biosolids have been

shown to be ZnS and Zn3(PO4)2. To continue with our research on the effects of aged

MNPs, we exposed C. elegans to pristine ZnO-MNPs, phosphate aged (pZnO-MNPs) and

sulfide aged (sZnO-MNPs) as well as to ZnSO4. We observed that aged ZnO-MNPs had

nearly a 10 fold decrease in toxicity to mortality and reproduction as compared to pristine

ZnO-MNPs and ZnSO4. The solubility of sZnO-MNPs and pZnO-MNPs differed in

synthetic soil pore water. After 24 hours, the dissolution was higher in pZnO-MNPs than

sZnO-MNPs at both 0.75 and 7.5 mg L-1 concentrations. Interestingly, we observed

higher levels of dissolution in pZnO-MNPs compared to sZnO-MNPs, this is unexpected

given that the solubility of ZnS is more than 10 orders of magnitude higher than

Zn3(PO4)2. This is partially explained by the fact that the sulfide aging process resulted in

relatively pure ZnS, while the phosphate aging process left residual ZnO. Even though

there were several shared GO terms among all four treatments and we have also observed

up-regulation of three metal response genes (numr-1, mtl-1, and mtl-2) in response to ions

and all MNP treatments, we were not able to conclude that the total toxicogenomic

responses of the MNPs are solely due to the production of Zn2+. This conclusion was

drawn from the hierarchical cluster analysis as well as the lower number of shared genes,

only one shared lysosome pathway, and differences in the GO terms detected between

MNP treatments and ions. We have also observed interesting distinctions in the responses

of the aged and pristine ZnO-MNPs. Phosphate aged pZnO-MNPs returned several GO

terms related to reproduction, while GO terms unique to pristine ZnO-MNPs were related

102

to responses to a stimuli or stress. Sulfidized sZnO-MNPs returned unique terms relating

to sulfur metabolism which is not unexpected. Further, as with Ag-MNPs, toxicity of

ZnO-MNPs, sZnO-MNPs and pZnO-MNPs was ameliorated by removing particles from

suspension by centrifugation. One factor that might explain the nearly identical

concentration response relationship between ZnO-MNPs and ZnSO4 is rapid dissolution

of ZnO-MNPs after uptake in C. elegans¸ which has a gut pH of 4-5264.

There have been a confluence of limitations to our understanding of the full risks

associated with MNPs. Until recently, the major focus has been on aquatic, well defined,

simple matrices which may not adequately reflect the environments MNPs are being

released into. Nearly all studies have only evaluated the pristine MNPs and not

transformation products that are more representative of what organisms are exposed to in

natural environments. We have shown that C. elegans have distinct transcriptomic

responses to pristine MNPs and aged MNPs and that these responses are not solely due to

ionic effects. Our results also show that the biogeochemical transformations that MNPs

undergo once they are released from their parent materials greatly alter the toxicity,

bioavailability and toxicity pathways of the MNPs. The information in this dissertation is

valuable for guiding future research, discussion, and risk-based regulatory development.

103

Appendices

Chapter 2 Appendix Summary: 6 pages including 2 pages for method description, 3 figures

Materials and Methods

sAg-MNP Preparation

Ag-MNPs, initial concentration of Ag-MNP was approximately 5.34 g Ag L-1,

were combined with Na2S at a 2:1 molar ratio of S to Ag in a polypropylene centrifuge

tube without adjusting pH (~pH=11.8). The tube was incubated open to the air for 4

hours and sealed for 4 days. The particles were purified from the reaction mixture using

centrifugation and washed three times with 18 MΩ deionized water (DDI). Sulfidation of

the particles was verified by confirming that no detectable face-centered cubic Ag metal

remained and that acanthite (Ag2S) was present using powder X-ray diffraction.

Ag-MNP Characterization

Primary particle size distribution for both Ag-MNPs and sAg-MNPs was

determined using transmission electron microscopy (TEM, JOEL 2010F); 10 µL of 200

mg Ag L-1 Ag-MNPs were placed on formvar coated 200 mesh Cu grids and allowed to

air dry in a laminar flow hood, 100 particles were measured from three separate

micrographs. The pH of the exposure solutions used to determine electrophoretic

mobility and hydrodynamic radius was 7.6 for Ag-MNPs and 7.8 for sAg-MNPs in

moderately hard reconstituted water(MHRW).The mean intensity weighted (z-average)

hydrodynamic diameters were measured in exposure media (MHRW) at 100 mg Ag L-1

using dynamic light scattering (DLS, Malvern ZetaSizer Nano-ZS, Malvern, United

Kingdom). Zeta potentials of both Ag-MNPs and sAg-MNPs were calculated using the

Hückel approximation in MHRW using 100 mg Ag L-1 suspensions from electrophoretic

104

mobilities measured by phase analysis light scattering (PALS, Malvern Zetasizer Nano-

ZS).

Synchrotron x-ray fluorescence microscopy

Preliminary range finding experiments were conducted on beamline 13-IDE,

while the data presented here were collected on beamline 20-ID. At sector 20, incident x-

rays were monochromatized above the Ag K-edge (26 keV) and focused to a spot size of

1 x 1 µm2. Fresh samples were mounted on Al foil and transferred to a liquid N2 cryostat

(-196 °C). The Ag Kα1 emission (22.162 keV) was measured using a 13-element Ge

detector. X-ray fluorescence intensities were normalized to an upstream ion chamber

reading to account for variation in photon flux. The data were processed using image J

(http://rsb.info.nih.gov/ij/).

Figures

A2-1. Representative transmission electron micrographs of pristine silver manufactured nanoparticles (Left) and artificially aged silver manufactured nanoparticles (Right).

105

A2-2. Intensity weighted Z-average hydrodynamic diameter distribution of pristine silver manufactured silver nanoparticles (Top) and artificially aged silver nanoparticles (Bottom), after 1 hour measured in moderately hard reconstituted water.

106

A2-3. Volume weighted Z-average hydrodynamic diameter distribution of pristine silver manufactured silver nanoparticles (Top) and artificially aged silver nanoparticles (Bottom), after 1 hour measured in moderately hard reconstituted water.

107

Chapter 3 Appendix A complete description of our material synthesis methods and characterization results can

be found in our previous publication

(http://www.sciencedirect.com/science/article/pii/S0269749114004266).

sAg-MNP Preparation

Synthesis of the Ag MNPs was previously reported 265. Briefly the particles were

synthesized by heating AgNO3 and 50 kDa polyvinylpyrrolidone in ethylene glycol at

120ºC for 24 hours followed by purification and washing by centrifugation. Ag

concentrations were determined after dissolution in aqua regia and analysis by

inductively coupled plasma mass spectrometry and (ICP-MS). Initial concentration of

Ag-MNP was approximately 5.34 g Ag L-1, were combined with Na2S at a 2:1 molar

ratio of S to Ag in a polypropylene centrifuge tube without adjusting pH (~pH=11.8).

The tube was incubated open to the air for 4 hours and sealed for 4 days. The particles

were purified from the reaction mixture using centrifugation and washed three times with

18 MΩ deionized water (DDI). Sulfidation of the particles was verified by confirming

that no detectable face-centered cubic Ag metal remained and that acanthite (Ag2S) was

present using powder X-ray diffraction.

Ag-MNP Characterization methods

Primary particle size distribution for both Ag-MNPs and sAg-MNPs was

determined using transmission electron microscopy (TEM, JOEL 2010F); 10 µL of 200

mg Ag L-1 Ag-MNPs were placed on formvar coated 200 mesh Cu grids and allowed to

air dry in a laminar flow hood, 100 particles were measured from three separate

108

micrographs. The pH of the exposure solutions used to determine electrophoretic

mobility and hydrodynamic diameter was 7.6 for Ag-MNPs and 7.8 for sAg-MNPs in

moderately hard reconstituted water (MHRW).The mean intensity weighted (z-average)

hydrodynamic diameters were measured in exposure media (MHRW) at 100 mg Ag L-1

using dynamic light scattering (DLS, Malvern ZetaSizer Nano-ZS, Malvern, United

Kingdom). Zeta potentials of both Ag-MNPs and sAg-MNPs were calculated using the

Hückel approximation in MHRW using 100 mg Ag L-1 suspensions from electrophoretic

mobilities measured by phase analysis light scattering (PALS, Malvern Zetasizer Nano-

ZS).

Figure A3-1. Gene expression from N2 wild type nematodes for the house keeping gene Glucose-6 phosphate isomerase I (gpi-1) when exposed to AgNO3, pristine silver manufactured nanoparticles (Ag-MNPs), and sulfidized silver nanomaterials (sAg-MNPs) at the EC30 for 48 hours.

Gene Symbol

ABI Assay ID Efficiency %

Forward Primer Reverse Primer

rol-8* A151q0y 99.87 ATCCGATCGGCCAATCAA CATCTGCCGTTGCTCTTCTG

grl-20 Ce02461209 96.54

col-158 Ce 02482075 97.11

gpi-1 Ce 02425390 99.01

numr-1* A13951Q 95.87 CTCCACATCGTCGTCATTGTG GCTTCGAGATCTTGAACGATCA

All primer information is property of ABI, the primers and probes can be ordered using the ABI assay IDs. *

Indicates custom designed primers.

Table A3-1. ABI assay IDs used for qRT-PCR confirmation.

Figure A3-2. Microarray result for gene expression of 5 ground-like (Left) and 6 collagen genes (Right) when exposed to AgNO3, pristine Ag manufactured nanoparticles (Ag-MNP), and sulfidized silver nanoparticles (sAg-MNP) at the EC30 for 48 hours.

111

Figure A3-3. Gene expression from N2 wild type nematodes of four genes (rol-8, numr-1, col-158, and grl-20) when exposed to AgNO3, pristine silver manufactured nanoparticles (Ag-MNPs), and sulfidized silver nanoparticles (sAg-MNPs) at the EC30 for 48 hours. All genes were significantly different than controls at a p-value of <0.05, except for rol-8 after exposure to AgNO3 and Ag-MNP.

-4

-3

-2

-1

0

1

2

3

Contro l AgNO3 Ag-MNP sAg-MNP

Fol

d c

han

ge (

log

2)

Treatment

rol-8 numr-1 col-158 grl-20

112

Figure A3-4. Gene expression from L3 wild type N2 nematodes feed different strains of Escherichia coli food source for 24 hours to assess the effectiveness of the RNAi to knockdown the expression of grl-20 (31Q) and col-158 (78Q) along with wild type E. coli (OP50). Both 78Q and 31Q were significantly suppressed compared to OP50 at a p-value < 0.05.

‐2.5

‐2

‐1.5

‐1

‐0.5

0

0.5

1

1.5

2

2.5

gr l ‐20 co l ‐158

FOLD

CHANGE (LOG2)

TARGET GENE

N2(OP50) N2(31Q) N2(78Q)

Figure A3-5. Mortality of L3 Caenorhabditis elegans after 24 hours without feeding exposure to Ag+, pristine silver manufactured nanoparticles (Ag-MNP), and sulfidized silver manufactured nanoparticles (sAg-MNP) in moderately hard reconstituted water. Data are presented as mean percent mortality with error bars indicating standard error of the mean. An asterisk (*) indicates significantly different than N2 at α = 0.05 within each treatment and concentration.

114

Chapter 4 Appendix Summary: 11 pages including 5 figures and 4 tables

A4-1. Zeta Potential distribution of pristine Zinc Oxide manufactured nanoparticles (ZnO-MNPs), phosphate aged Zinc manufactured nanoparticles (pZnO-MNps) and sulfidized Zinc nanoparticles (sZnO-MNPs), measured in synthetic soil pore water.

115

A4-2. X-ray absorption spectroscopy EDS data and representative transmission electron micrographs of phosphate aged Zinc Oxide manufactured nanoparticles (pZnO-MNPs). Top insert picture is pZnO-MNPs at 20k times magnification and bottom insert picture is pZnO-MNPs at 50k times magnification.

116

A4-3. X-ray absorption spectroscopy EDS data and representative transmission electron micrographs of sulfidized Zinc Oxide manufactured nanoparticles (sZnO-MNPs). Top insert picture is sZnO-MNPs at 8k times magnification and bottom insert picture is sZnO-MNPs at 80k times magnification.

117

A4-4. Intensity weighted Z-average hydrodynamic diameter distribution of pristine Zinc manufactured nanoparticles (ZnO), phosphate aged Zinc manufactured nanoparticles (pZnO) and sulfidized Zinc nanoparticles (sZnO), measured in synthetic soil pore water.

Table A4-1. ABI assay IDs used for qRT-PCR confirmation.

Gene Symbol

ABI Assay ID

Efficiency %

Forward Primer Reverse Primer

pgp-5 Ce02500335_g1 95.33

pgp-6 Ce02500372_g1 96.01

scrm-8 Ce02504322_g1 96.65

Y45F10D.4 Ce02467252_g1 99.33

numr-1* A13951Q 97.81 CTCCACATCGTCGTCATTGTG GCTTCGAGATCTTGAACGATCA

All primer information is property of ABI, the primers and probes can be ordered using the ABI assay IDs. * Indicates custom designed primers.

118

Table A4-2. List of Biological Process (BP) Gene Ontology terms that were identified by Partek using lists of significantly altered genes from N2 wild type nematodes when exposed to ZnSO4, pristine zinc oxide manufactured nanoparticles (ZnO-MNPs), phosphate aged (pZnO-MNPs) and sulfidized (sZnO-MNPs) at the EC30 for 48 hours.

GoTerm BP

Category Genes in Category

P-Value Fold

EnrichmentExposure

6952 defense response 13 5.37E-09 19.043 ZnSO4 6950 response to stress 19 5.61E-09 18.9988 ZnSO4 2376 immune system process 10 1.82E-08 17.8237 ZnSO4 50896 response to stimulus 20 3.24E-08 17.2451 ZnSO4 45087 innate immune response 9 2.31E-07 15.2818 ZnSO4 6030 chitin metabolic process 3 6.45E-06 11.9521 ZnSO4 46686 response to cadmium ion 4 6.95E-06 11.8767 ZnSO4 6040 amino sugar metabolic process 3 2.23E-05 10.7119 ZnSO4 10038 response to metal ion 4 0.00016 8.71762 ZnSO4 6022 aminoglycan metabolic process 3 0.00034 7.99598 ZnSO4 10035 response to inorganic substance 4 0.00062 7.38167 ZnSO4 9607 response to biotic stimulus 5 0.00065 7.33235 ZnSO4 98542 defense response to other organism 4 0.00502 5.29347 ZnSO4

40002 collagen and cuticulin-based

cuticle development 4 0.00735 4.91265 ZnSO4

42335 cuticle development 4 0.00765 4.87318 ZnSO4 9605 response to external stimulus 5 0.00781 4.85224 ZnSO4

50829 defense response to Gram-negative

bacterium 3 0.00803 4.82413 ZnSO4

42221 response to chemical 4 0.01578 4.14918 ZnSO4 9617 response to bacterium 3 0.0218 3.82591 ZnSO4 6952 defense response 18 2.02E-11 24.6242 ZnO 2376 immune system process 12 8.25E-09 18.6126 ZnO

119

6950 response to stress 23 1.26E-08 18.1931 ZnO 45087 innate immune response 11 8.18E-08 16.3188 ZnO 6955 immune response 11 8.18E-08 16.3188 ZnO 50896 response to stimulus 24 1.55E-07 15.6778 ZnO 46686 defense response 5 9.55E-07 12.94211333 ZnO 50829 immune system process 7 2.22E-06 11.41389333 ZnO 10038 response to stress 6 3.02E-06 9.885673333 ZnO 98542 innate immune response 8 8.00E-06 8.357453333 ZnO 51707 response to other organism 8 8.79E-06 11.642 ZnO 10035 response to inorganic substance 6 2.37E-05 10.651 ZnO 9617 response to bacterium 7 2.73E-05 10.5087 ZnO

1990170 stress response to cadmium ion 3 0.00012 9.04803 ZnO 9605 response to external stimulus 8 0.0005 7.6023 ZnO 42221 response to chemical 7 0.00057 7.46442 ZnO 51704 multi-organism process 10 0.02365 3.74451 ZnO 6952 response to stress 36 1.90E-15 33.8977 pZnO 6950 immune system process 45 1.90E-08 17.7784 pZnO 2376 defense response to bacterium 18 1.66E-07 15.6117 pZnO 42742 response to bacterium 14 4.50E-07 14.6146 pZnO 9607 innate immune response 15 6.26E-07 14.2836 pZnO 45087 immune response 17 7.45E-07 14.1096 pZnO 6955 response to cadmium ion 17 7.45E-07 14.1096 pZnO 46686 response to stimulus 7 8.65E-07 13.9604 pZnO 50896 stress response to cadmium ion 47 1.56E-06 13.3693 pZnO

1990170 stress response to metal ion 5 5.60E-06 12.0924 pZnO

97501 defense response to Gram-negative

bacterium 5 1.22E-05 11.3154 pZnO

50829 response to metal ion 10 1.51E-05 11.0985 pZnO

120

10038 masculinization of hermaphroditic

germ-line 8 3.17E-05 10.3584 pZnO

42006 response to inorganic substance 5 0.00011 9.12733 pZnO 10035 response to external stimulus 8 0.00041 7.80126 pZnO 9605 germ-line sex determination 15 0.00061 7.40502 pZnO

18992 defense response to Gram-positive

bacterium 7 0.00089 7.02676 pZnO

50830 sex determination 6 0.00095 6.95599 pZnO

7530 hermaphrodite germ-line sex

determination 7 0.00242 6.02417 pZnO

40021 aspartate family amino acid

biosynthetic process 6 0.00265 5.93324 pZnO

34248 regulation of translation 6 0.00528 5.2435 pZnO

1901607 aspartate family amino acid

metabolic process 4 0.00791 4.83971 pZnO

7276 male gamete generation 16 0.01249 4.38307 pZnO 48232 spermatogenesis 5 0.01312 4.33364 pZnO

46394 cellular amino acid biosynthetic

process 6 0.01706 4.07113 pZnO

8652 sulfur compound metabolic process 4 0.0176 4.04 pZnO 6790 lipid catabolic process 5 0.02255 3.79208 pZnO

44272 positive regulation of meiotic cell

cycle 4 0.02291 3.77626 pZnO

51446 serine family amino acid

biosynthetic process 5 0.0273 3.60099 pZnO

42221 cell cycle switching, mitotic to

meiotic cell cycle 9 0.0357 3.33271 pZnO

60184 positive regulation of cell cycle 4 0.03618 3.31914 pZnO 45787 meiotic nuclear division 5 0.04516 3.09757 pZnO

121

7126 fatty acid metabolic process 9 0.04541 3.09197 pZnO

6631 sulfur amino acid metabolic

process 4 0.04852 3.02572 sZnO

6952 defense response 21 2.94E-14 31.1582 sZnO 50896 response to stimulus 28 6.91E-10 21.0932 sZnO 6950 response to stress 25 9.04E-10 20.8247 sZnO 2376 immune system process 13 1.03E-09 20.695 sZnO 45087 innate immune response 12 1.08E-08 18.3469 sZnO 6955 immune response 12 1.08E-08 18.3469 sZnO 46686 response to cadmium ion 5 1.12E-06 13.6993 sZnO 43207 response to external biotic stimulus 9 1.13E-06 13.6973 sZnO 98542 defense response to other organism 8 1.02E-05 11.4943 sZnO 9617 response to bacterium 7 3.37E-05 10.2971 sZnO 10038 response to metal ion 5 6.27E-05 9.6765 sZnO 9605 response to external stimulus 9 0.00012 9.07008 sZnO 97501 stress response to metal ion 3 0.00019 8.55572 sZnO 10035 response to inorganic substance 5 0.00033 8.01295 sZnO

50829 defense response to Gram-negative

bacterium 5 0.00041 7.8068 sZnO

42221 response to chemical 7 0.0007 7.26866 sZnO 16042 lipid catabolic process 3 0.00561 5.18258 sZnO

50830 defense response to Gram-positive

bacterium 3 0.00688 4.97962 sZnO

51704 multi-organism process 11 0.01167 4.451 sZnO

122

Table A4-3. List of Molecular Function (MF) Gene Ontology terms that were identified by Partek using lists of significantly altered genes from N2 wild type nematodes when exposed to ZnSO4, pristine zinc oxide manufactured nanoparticles (ZnO-MNPs), phosphate aged (pZnO-MNPs) and sulfidized (sZnO-MNPs) at the EC30 for 48 hours.

Go Term: MF

Category Genes in Category

P-Value Fold

Enrichment Exposure

42302 structural constituent of cuticle 15 6.07E-12 25.8273 ZnSO4 5198 structural molecule activity 16 6.44E-08 16.5579 ZnSO4 8061 chitin binding 3 6.45E-06 11.9521 ZnSO4 42302 structural constituent of cuticle 13 1.79E-07 15.5332 ZnO

42626 ATPase activity, coupled to

transmembrane movement of substances

8 3.19E-06 12.6566 ZnO

5198 structural molecule activity 15 7.58E-05 9.48739 ZnO 42623 ATPase activity, coupled 8 0.00013908 8.88049 ZnO 17111 nucleoside-triphosphatase activity 9 0.010998 4.51004 ZnO 16462 pyrophosphatase activity 9 0.0141894 4.25526 ZnO 42302 structural constituent of cuticle 25 9.11E-09 18.5135 pZnO

42626 ATPase activity, coupled to

transmembrane movement of substances

11 0.00011117 9.10449 pZnO

3730 mRNA 3'-UTR binding 5 0.00016339 8.71935 pZnO 5198 structural molecule activity 29 0.00045233 7.7011 pZnO 3729 mRNA binding 5 0.00080168 7.1288 pZnO

16758 transferase activity, transferring

hexosyl groups 13 0.00227614 6.08527 pZnO

42623 ATPase activity, coupled 12 0.00286986 5.85349 pZnO

16757 transferase activity, transferring

glycosyl groups 13 0.00624482 5.076 pZnO

123

22804 active transmembrane transporter

activity 12 0.00805273 4.82174 pZnO

16887 ATPase activity 13 0.0199169 3.91619 pZnO 4497 monooxygenase activity 8 0.022407 3.79838 pZnO 46906 tetrapyrrole binding 11 0.023181 3.76442 pZnO 42302 structural constituent of cuticle 17 4.48E-11 23.8288 sZnO 5198 structural molecule activity 19 3.41E-07 14.8922 sZnO

42626 ATPase activity, coupled to

transmembrane movement of substances

5 0.00251235 5.98654 sZnO

30246 carbohydrate binding 10 0.00406916 5.50432 sZnO 42623 ATPase activity, coupled 5 0.021161 3.8556 sZnO

16798 hydrolase activity, acting on glycosyl

bonds 3 0.0228562 3.77853 sZnO

22804 active transmembrane transporter

activity 5 0.034328 3.37179 sZnO

124

Table A4-4. List of Cellular Compartments (CC) Gene Ontology terms that were identified by Partek using lists of significantly altered genes from N2 wild type nematodes when exposed to ZnSO4, pristine zinc oxide manufactured nanoparticles (ZnO-MNPs), phosphate aged (pZnO-MNPs) and sulfidized (sZnO-MNPs) at the EC30 for 48 hours.

GoTerm: CC Category Genes in Category

P-Value Fold

EnrichmentExposure

5581 collagen trimer 3 0.00409714 5.49747 ZnSO4 5581 collagen trimer 3 0.0123931 4.39062 ZnO 45121 membrane raft 7 5.99E-05 9.72213 pZnO 5764 lysosome 6 0.000636159 7.36006 pZnO 5581 collagen trimer 7 0.00063737 7.35816 pZnO 5773 vacuole 6 0.00264987 5.93324 pZnO 43186 P granule 6 0.0239935 3.72997 pZnO

36464 cytoplasmic ribonucleoprotein

granule 6 0.0458981 3.08133 pZnO

45121 membrane raft 5 2.19E-05 10.7309 sZnO 5581 collagen trimer 5 0.000128716 8.9579 sZnO

125125

126

References

1. Institution, B. S., Terminology for nanomaterials. In British Standards Institution: London, 2007; p 16.

2. Kahru, A.; Dubourguier, H.-C., From ecotoxicology to nanoecotoxicology. Toxicology 2010, 269, (2–3), 105-119.

3. Hochella, M. F., Jr., Aruguete, D., Kim, B., and Madden, A., Naturally Occurring Inorganic Nanoparticles: General Assessment and a Global Budget for One of Earth’s Last Unexplored Major Geochemical Components. In Nature's Nanostructures, Barnard, S. a. G., H. , Ed. Pan Stanford Publishing Pte. Ltd.: Singapore, 2012; pp 1-31.

4. Montelongo, Y.; Tenorio-Pearl, J. O.; Williams, C.; Zhang, S.; Milne, W. I.; Wilkinson, T. D., Plasmonic nanoparticle scattering for color holograms. Proceedings of the National Academy of Sciences 2014, 111, (35), 12679-12683.

5. EPA, Nanotechnology White Paper. Office of the Science Advisor: Washington, D.C. USA, 2007.

6. Durán, N.; Marcato, P. D., Nanobiotechnology perspectives. Role of nanotechnology in the food industry: a review. International Journal of Food Science & Technology 2013, 48, (6), 1127-1134.

7. Vance, M. E.; Kuiken, T.; Vejerano, E. P.; McGinnis, S. P.; Hochella, M. F., Jr.; Rejeski, D.; Hull, M. S., Nanotechnology in the real world: Redeveloping the nanomaterial consumer products inventory. Beilstein Journal of Nanotechnology 2015, 6, 1769-1780.

8. Wiesner, M. R.; Lowry, G. V.; Alvarez, P.; Dionysiou, D.; Biswas, P., Assessing the Risks of Manufactured Nanomaterials. Environmental Science & Technology 2006, 40, (14), 4336-4345.

9. Hendren, C. O.; Lowry, M.; Grieger, K. D.; Money, E. S.; Johnston, J. M.; Wiesner, M. R.; Beaulieu, S. M., Modeling Approaches for Characterizing and Evaluating Environmental Exposure to Engineered Nanomaterials in Support of Risk-Based Decision Making. Environmental Science & Technology 2013, 47, (3), 1190-1205.

10. OECD Environment, H. a. S. P. REGULATED NANOMATERIALS: 2006-2009; 2011, 2011.

11. Gurunathan, S.; Han, J.; Kwon, D.-N.; Kim, J.-H., Enhanced antibacterial and anti-biofilm activities of silver nanoparticles against Gram-negative and Gram-positive bacteria. Nanoscale research letters 2014, 9, (1), 1-17.

12. Manikprabhu, D.; Lingappa, K., Synthesis of silver nanoparticles using the Streptomyces coelicolor klmp33 pigment: An antimicrobial agent against extended-spectrum beta-lactamase (ESBL) producing Escherichia coli. Materials Science and Engineering: C 2014, 45, 434-437.

13. Guzman, M.; Dille, J.; Godet, S., Synthesis and antibacterial activity of silver nanoparticles against gram-positive and gram-negative bacteria. Nanomedicine: Nanotechnology, Biology and Medicine 2012, 8, (1), 37-45.

14. Monteiro, D. R.; Gorup, L. F.; Silva, S.; Negri, M.; de Camargo, E. R.; Oliveira, R.; Barbosa, D. B.; Henriques, M., Silver colloidal nanoparticles: antifungal effect against adhered cells and biofilms of Candida albicans and Candida glabrata. Biofouling 2011, 27, (7), 711-719.

127

15. Kalishwaralal, K.; BarathManiKanth, S.; Pandian, S. R. K.; Deepak, V.; Gurunathan, S., Silver nanoparticles impede the biofilm formation by Pseudomonas aeruginosa and Staphylococcus epidermidis. Colloids and Surfaces B: Biointerfaces 2010, 79, (2), 340-344.

16. Sheng, Z.; Liu, Y., Effects of silver nanoparticles on wastewater biofilms. Water Research 2011, 45, (18), 6039-6050.

17. Tolaymat, T. M.; El Badawy, A. M.; Genaidy, A.; Scheckel, K. G.; Luxton, T. P.; Suidan, M., An evidence-based environmental perspective of manufactured silver nanoparticle in syntheses and applications: A systematic review and critical appraisal of peer-reviewed scientific papers. Science of The Total Environment 2010, 408, (5), 999-1006.

18. Benn, T.; Westerhoff, P., Nanoparticle silver released into water from commercially available sock fabrics. Environ Sci Technol 2008, 42, (11), 4133-4139.

19. Zhou, Y.; Kong, Y.; Kundu, S.; Cirillo, J. D.; Liang, H., Antibacterial activities of gold and silver nanoparticles against Escherichia coli and bacillus Calmette-Guerin. Journal of Nanobiotechnology 2012, 10, 19.

20. Kim, J. S.; Kuk, E.; Yu, K. N.; Kim, J.-H.; Park, S. J.; Lee, H. J.; Kim, S. H.; Park, Y. K.; Park, Y. H.; Hwang, C.-Y.; Kim, Y.-K.; Lee, Y.-S.; Jeong, D. H.; Cho, M.-H., Antimicrobial effects of silver nanoparticles. Nanomedicine: Nanotechnology, Biology and Medicine 2007, 3, (1), 95-101.

21. Wang, H.; Zheng, L.; Peng, C.; Guo, R.; Shen, M.; Shi, X.; Zhang, G., Computed tomography imaging of cancer cells using acetylated dendrimer-entrapped gold nanoparticles. Biomaterials 2011, 32, (11), 2979-2988.

22. Hong, W.; Bai, H.; Xu, Y.; Yao, Z.; Gu, Z.; Shi, G., Preparation of Gold Nanoparticle/Graphene Composites with Controlled Weight Contents and Their Application in Biosensors. The Journal of Physical Chemistry C 2010, 114, (4), 1822-1826.

23. MurdochM; Waterhouse, G. I. N.; Nadeem, M. A.; Metson, J. B.; Keane, M. A.; Howe, R. F.; LlorcaJ; IdrissH, The effect of gold loading and particle size on photocatalytic hydrogen production from ethanol over Au/TiO2 nanoparticles. Nat Chem 2011, 3, (6), 489-492.

24. Beigbeder, A.; Degee, P.; Conlan, S. L.; Mutton, R. J.; Clare, A. S.; Pettitt, M. E.; Callow, M. E.; Callow, J. A.; Dubois, P., Preparation and characterisation of silicone-based coatings filled with carbon nanotubes and natural sepiolite and their application as marine fouling-release coatings. Biofouling 2008, 24, (4), 291-302.

25. Chae, H. G.; Choi, Y. H.; Minus, M. L.; Kumar, S., Carbon nanotube reinforced small diameter polyacrylonitrile based carbon fiber. Composites Science and Technology 2009, 69, (3–4), 406-413.

26. Esser, B.; Schnorr, J. M.; Swager, T. M., Selective Detection of Ethylene Gas Using Carbon Nanotube-based Devices: Utility in Determination of Fruit Ripeness. Angewandte Chemie-International Edition 2012, 51, (23), 5752-5756.

27. Jung, H.; Kittelson, D. B.; Zachariah, M. R., The influence of a cerium additive on ultrafine diesel particle emissions and kinetics of oxidation. Combustion and Flame 2005, 142, (3), 276-288.

128

28. Becheri, A.; Dürr, M.; Lo Nostro, P.; Baglioni, P., Synthesis and characterization of zinc oxide nanoparticles: application to textiles as UV-absorbers. J Nanopart Res 2008, 10, (4), 679-689.

29. Yang, H.; Zhu, S.; Pan, N., Studying the mechanisms of titanium dioxide as ultraviolet-blocking additive for films and fabrics by an improved scheme. Journal of Applied Polymer Science 2004, 92, (5), 3201-3210.

30. Kaida, T.; Kobayashi, K.; Adachi, M.; Suzuki, F., Optical characteristics of titanium oxide interference film and the film laminated with oxides and their applications for cosmetics. J. Cosmet Sci. 2004, 55, (2), 2.

31. Cory, H.; Janet, L.; Alex, P.; Reddy, K. M.; Isaac, C.; Andrew, C.; Kevin, F.; Denise, W., Preferential killing of cancer cells and activated human T cells using ZnO nanoparticles. Nanotechnology 2008, 19, (29), 295103.

32. Akhtar, M. J.; Ahamed, M.; Kumar, S.; Khan, M. M.; Ahmad, J.; Alrokayan, S. A., Zinc oxide nanoparticles selectively induce apoptosis in human cancer cells through reactive oxygen species. Int J Nanomedicine 2012, 7, 845-857.

33. Yu, K.-N.; Yoon, T.-J.; Minai-Tehrani, A.; Kim, J.-E.; Park, S. J.; Jeong, M. S.; Ha, S.-W.; Lee, J.-K.; Kim, J. S.; Cho, M.-H., Zinc oxide nanoparticle induced autophagic cell death and mitochondrial damage via reactive oxygen species generation. Toxicology in Vitro 2013, 27, (4), 1187-1195.

34. Choi, H.-J.; Choi, J.-S.; Park, B.-J.; Eom, J.-H.; Heo, S.-Y.; Jung, M.-W.; An, K.-S.; Yoon, S.-G., Enhanced transparency, mechanical durability, and antibacterial activity of zinc nanoparticles on glass substrate. Scientific Reports 2014, 4, 6271.

35. Espitia, P. J. P.; Soares, d. N. F. F.; Coimbra, J. d. S. R.; Andrade, N. J.; Cruz, R. S.; Medeiros, E. A. A., Zinc Oxide Nanoparticles: Synthesis, Antimicrobial Activity and Food Packaging Applications. Food and Bioprocess Technology 2012, 5, (5), 1447-1464.

36. Thakar, R.; Chen, Y.; Snee, P. T., Efficient Emission from Core/(Doped) Shell Nanoparticles:  Applications for Chemical Sensing. Nano Letters 2007, 7, (11), 3429-3432.

37. Suchea, M.; Christoulakis, S.; Moschovis, K.; Katsarakis, N.; Kiriakidis, G., ZnO transparent thin films for gas sensor applications. Thin Solid Films 2006, 515, (2), 551-554.

38. Keller, A. A.; Vosti, W.; Wang, H.; Lazareva, A., Release of engineered nanomaterials from personal care products throughout their life cycle. J Nanopart Res 2014, 16, (7), 1-10.

39. Hendren, C. O.; Mesnard, X.; Dröge, J.; Wiesner, M. R., Estimating Production Data for Five Engineered Nanomaterials As a Basis for Exposure Assessment. Environmental Science & Technology 2011, 45, (7), 2562-2569.

40. Gottschalk, F.; Scholz, R. W.; Nowack, B., Probabilistic material flow modeling for assessing the environmental exposure to compounds: Methodology and an application to engineered nano-TiO2 particles. Environ. Model. Softw. 2010, 25, (3), 320-332.

41. EPA, A Guide to the Biosolids Risk Assessments for the EPA. In Washington, D.C., 1995.

129

42. Koelmans, A. A.; Nowack, B.; Wiesner, M. R., Comparison of manufactured and black carbon nanoparticle concentrations in aquatic sediments. Environmental Pollution 2009, 157, (4), 1110-1116.

43. Kiser, M. A.; Westerhoff, P.; Benn, T.; Wang, Y.; Pérez-Rivera, J.; Hristovski, K., Titanium Nanomaterial Removal and Release from Wastewater Treatment Plants. Environmental Science & Technology 2009, 43, (17), 6757-6763.

44. Kaegi, R.; Voegelin, A.; Sinnet, B.; Zuleeg, S.; Hagendorfer, H.; Burkhardt, M.; Siegrist, H., Behavior of metallic silver nanoparticles in a pilot wastewater treatment plant. Environ Sci Technol 2011, 45, (9), 3902-8.

45. Blaser, S. A.; Scheringer, M.; Macleod, M.; Hungerbuhler, K., Estimation of cumulative aquatic exposure and risk due to silver: contribution of nano-functionalized plastics and textiles. The Science of the total environment 2008, 390, (2-3), 396-409.

46. Johnson, A.; Bowes, M.; Crossley, A.; Jarive, H.; Juergens, M.; Lofts, S.; Park, B.; Singer, A.; Spurgeon, D.; Svendesen, C.; Tompson, I.; Williams, R., A comprehensive assessment of the fate, behavior and environmental risk associated with TiO2 nanoparticle products used in sunscreens in the UK. In 3rd nanoNet International Conference on the "Environmental Effects of Nanoparticles and Nanomaterials", University of Birmingham, 2008.

47. Gottschalk, F.; Sonderer, T.; Scholz, R. W.; Nowack, B., Modeled Environmental Concentrations of Engineered Nanomaterials (TiO2, ZnO, Ag, CNT, Fullerenes) for Different Regions. Environmental Science & Technology 2009, 43, (24), 9216-9222.

48. Sun, T. Y.; Gottschalk, F.; Hungerbuhler, K.; Nowack, B., Comprehensive probabilistic modelling of environmental emissions of engineered nanomaterials. Environ Pollut 2014, 185, 69-76.

49. Sun, T. Y.; Conroy, G.; Donner, E.; Hungerbuhler, K.; Lombi, E.; Nowack, B., Probabilistic modelling of engineered nanomaterial emissions to the environment: a spatio-temporal approach. Environmental Science: Nano 2015, 2, (4), 340-351.

50. Whitley, A. R.; Levard, C.; Oostveen, E.; Bertsch, P. M.; Matocha, C. J.; von der Kammer, F.; Unrine, J. M., Behavior of Ag nanoparticles in soil: effects of particle surface coating, aging and sewage sludge amendment. Environ Pollut 2013, 182, 141-9.

51. Colman, B. P.; Arnaout, C. L.; Anciaux, S.; Gunsch, C. K.; Hochella, M. F., Jr.; Kim, B.; Lowry, G. V.; McGill, B. M.; Reinsch, B. C.; Richardson, C. J.; Unrine, J. M.; Wright, J. P.; Yin, L.; Bernhardt, E. S., Low Concentrations of Silver Nanoparticles in Biosolids Cause Adverse Ecosystem Responses under Realistic Field Scenario. PLoS ONE 2013, 8, (2), e57189.

52. Judy, J. D.; Unrine, J. M.; Bertsch, P. M., Evidence for Biomagnification of Gold Nanoparticles within a Terrestrial Food Chain. Environmental Science & Technology 2011, 45, (2), 776-781.

53. Unrine, J. M.; Shoults-Wilson, W. A.; Zhurbich, O.; Bertsch, P. M.; Tsyusko, O. V., Trophic Transfer of Au Nanoparticles from Soil along a Simulated Terrestrial Food Chain. Environmental Science & Technology 2012, 46, (17), 9753-9760.

54. Akaighe, N.; MacCuspie, R. I.; Navarro, D. A.; Aga, D. S.; Banerjee, S.; Sohn, M.; Sharma, V. K., Humic Acid-Induced Silver Nanoparticle Formation Under

130

Environmentally Relevant Conditions. Environmental Science & Technology 2011, 45, (9), 3895-3901.

55. Bian, S.-W.; Mudunkotuwa, I. A.; Rupasinghe, T.; Grassian, V. H., Aggregation and Dissolution of 4 nm ZnO Nanoparticles in Aqueous Environments: Influence of pH, Ionic Strength, Size, and Adsorption of Humic Acid. Langmuir 2011, 27, (10), 6059-6068.

56. Shaban, Y. A.; El Sayed, M. A.; El Maradny, A. A.; Al Farawati, R. K.; Al Zobidi, M. I., Photocatalytic degradation of phenol in natural seawater using visible light active carbon modified (CM)-n-TiO2 nanoparticles under UV light and natural sunlight illuminations. Chemosphere 2013, 91, (3), 307-313.

57. Van Hoecke, K.; De Schamphelaere, K. A. C.; Van der Meeren, P.; Smagghe, G.; Janssen, C. R., Aggregation and ecotoxicity of CeO2 nanoparticles in synthetic and natural waters with variable pH, organic matter concentration and ionic strength. Environmental Pollution 2011, 159, (4), 970-976.

58. Yang, Y.; Nakada, N.; Nakajima, R.; Yasojima, M.; Wang, C.; Tanaka, H., pH, ionic strength and dissolved organic matter alter aggregation of fullerene C60 nanoparticles suspensions in wastewater. Journal of Hazardous Materials 2013, 244–245, 582-587.

59. Lowry, G. V.; Gregory, K. B.; Apte, S. C.; Lead, J. R., Transformations of Nanomaterials in the Environment. Environmental Science & Technology 2012, 46, (13), 6893-6899.

60. Wang, Z.; von dem Bussche, A.; Kabadi, P. K.; Kane, A. B.; Hurt, R. H., Biological and Environmental Transformations of Copper-Based Nanomaterials. ACS Nano 2013, 7, (10), 8715-8727.

61. Levard, C.; Hotze, E. M.; Lowry, G. V.; Brown, G. E., Jr., Environmental transformations of silver nanoparticles: impact on stability and toxicity. Environ Sci Technol 2012, 46, (13), 6900-14.

62. Webster, J. G., The solubility of gold and silver in the system AuAgSO2H2O at 25°C and 1 atm. Geochimica et Cosmochimica Acta 1986, 50, (9), 1837-1845.

63. Schmidt, J.; Vogelsberger, W., Aqueous long-term solubility of titania nanoparticles and titanium (IV) hydrolysis in a sodium chloride system studied by adsorptive stripping voltammetry. Journal of solution chemistry 2009, 38, (10), 1267-1282.

64. Cornelis, G.; Ryan, B.; McLaughlin, M. J.; Kirby, J. K.; Beak, D.; Chittleborough, D., Solubility and batch retention of CeO2 nanoparticles in soils. Environmental science & technology 2011, 45, (7), 2777-2782.

65. Liu, J.; Hurt, R. H., Ion release kinetics and particle persistence in aqueous nano-silver colloids. Environmental science & technology 2010, 44, (6), 2169-2175.

66. Levard, C.; Reinsch, B. C.; Michel, F. M.; Oumahi, C.; Lowry, G. V.; Brown, G. E., Sulfidation processes of PVP-coated silver nanoparticles in aqueous solution: impact on dissolution rate. Environ Sci Technol 2011, 45, (12), 5260-6.

67. Hierrezuelo, J.; Sadeghpour, A.; Szilagyi, I.; Vaccaro, A.; Borkovec, M., Electrostatic Stabilization of Charged Colloidal Particles with Adsorbed Polyelectrolytes of Opposite Charge. Langmuir 2010, 26, (19), 15109-15111.

68. Zhang, Y.; Chen, Y.; Westerhoff, P.; Crittenden, J., Impact of natural organic matter and divalent cations on the stability of aqueous nanoparticles. Water Research 2009, 43, (17), 4249-4257.

131

69. Espinasse, B.; Hotze, E. M.; Wiesner, M. R., Transport and retention of colloidal aggregates of C60 in porous media: Effects of organic macromolecules, ionic composition, and preparation method. Environmental science & technology 2007, 41, (21), 7396-7402.

70. Illés, E.; Tombácz, E., The effect of humic acid adsorption on pH-dependent surface charging and aggregation of magnetite nanoparticles. Journal of Colloid and Interface Science 2006, 295, (1), 115-123.

71. Napper, D. H., Steric stabilization. Journal of Colloid and Interface Science 1977, 58, (2), 390-407.

72. Delay, M.; Dolt, T.; Woellhaf, A.; Sembritzki, R.; Frimmel, F. H., Interactions and stability of silver nanoparticles in the aqueous phase: Influence of natural organic matter (NOM) and ionic strength. Journal of Chromatography A 2011, 1218, (27), 4206-4212.

73. Jiang, X.; Tong, M.; Kim, H., Influence of natural organic matter on the transport and deposition of zinc oxide nanoparticles in saturated porous media. Journal of Colloid and Interface Science 2012, 386, (1), 34-43.

74. Cupi, D.; Hartmann, N. B.; Baun, A., The influence of natural organic matter and aging on suspension stability in guideline toxicity testing of silver, zinc oxide, and titanium dioxide nanoparticles with Daphnia magna. Environmental Toxicology and Chemistry 2015, 34, (3), 497-506.

75. Louie, S. M.; Tilton, R. D.; Lowry, G. V., Effects of Molecular Weight Distribution and Chemical Properties of Natural Organic Matter on Gold Nanoparticle Aggregation. Environmental Science & Technology 2013, 47, (9), 4245-4254.

76. Li, K.; Chen, Y., Effect of natural organic matter on the aggregation kinetics of CeO2 nanoparticles in KCl and CaCl2 solutions: Measurements and modeling. Journal of Hazardous Materials 2012, 209–210, 264-270.

77. Collin, B.; Oostveen, E.; Tsyusko, O. V.; Unrine, J. M., Influence of natural organic matter and surface charge on the toxicity and bioaccumulation of functionalized ceria nanoparticles in Caenorhabditis elegans. Environ Sci Technol 2014, 48, (2), 1280-9.

78. Gao, J.; Youn, S.; Hovsepyan, A.; Llaneza, V. L.; Wang, Y.; Bitton, G.; Bonzongo, J.-C. J., Dispersion and Toxicity of Selected Manufactured Nanomaterials in Natural River Water Samples: Effects of Water Chemical Composition. Environmental Science & Technology 2009, 43, (9), 3322-3328.

79. Unrine, J. M.; Colman, B. P.; Bone, A. J.; Gondikas, A. P.; Matson, C. W., Biotic and Abiotic Interactions in Aquatic Microcosms Determine Fate and Toxicity of Ag Nanoparticles. Part 1. Aggregation and Dissolution. Environmental Science & Technology 2012, 46, (13), 6915-6924.

80. Bone, A. J.; Colman, B. P.; Gondikas, A. P.; Newton, K. M.; Harrold, K. H.; Cory, R. M.; Unrine, J. M.; Klaine, S. J.; Matson, C. W.; Di Giulio, R. T., Biotic and Abiotic Interactions in Aquatic Microcosms Determine Fate and Toxicity of Ag Nanoparticles: Part 2–Toxicity and Ag Speciation. Environmental Science & Technology 2012, 46, (13), 6925-6933.

81. Kim, B.; Park, C.-S.; Murayama, M.; Hochella, M. F., Discovery and Characterization of Silver Sulfide Nanoparticles in Final Sewage Sludge Products. Environmental Science & Technology 2010, 44, (19), 7509-7514.

132

82. Kent, R. D.; Oser, J. G.; Vikesland, P. J., Controlled Evaluation of Silver Nanoparticle Sulfidation in a Full-Scale Wastewater Treatment Plant. Environmental Science & Technology 2014, 48, (15), 8564-8572.

83. Lv, J.; Zhang, S.; Luo, L.; Han, W.; Zhang, J.; Yang, K.; Christie, P., Dissolution and Microstructural Transformation of ZnO Nanoparticles under the Influence of Phosphate. Environmental Science & Technology 2012, 46, (13), 7215-7221.

84. Ma, R.; Levard, C.; Judy, J. D.; Unrine, J. M.; Durenkamp, M.; Martin, B.; Jefferson, B.; Lowry, G. V., Fate of zinc oxide and silver nanoparticles in a pilot wastewater treatment plant and in processed biosolids. Environ Sci Technol 2014, 48, (1), 104-12.

85. Lombi, E.; Donner, E.; Tavakkoli, E.; Turney, T. W.; Naidu, R.; Miller, B. W.; Scheckel, K. G., Fate of Zinc Oxide Nanoparticles during Anaerobic Digestion of Wastewater and Post-Treatment Processing of Sewage Sludge. Environmental Science & Technology 2012, 46, (16), 9089-9096.

86. Ma, R.; Levard, C.; Judy, J. D.; Unrine, J. M.; Durenkamp, M.; Martin, B.; Jefferson, B.; Lowry, G. V., Fate of Zinc Oxide and Silver Nanoparticles in a Pilot Wastewater Treatment Plant and in Processed Biosolids. Environmental Science & Technology 2014, 48, (1), 104-112.

87. Chen, C.; Unrine, J. M.; Judy, J. D.; Lewis, R. W.; Guo, J.; McNear Jr, D. H.; Tsyusko, O. V., Toxicogenomic Responses of the Model Legume Medicago truncatula to Aged Biosolids Containing a Mixture of Nanomaterials (TiO2, Ag, and ZnO) from a Pilot Wastewater Treatment Plant. Environmental science & technology 2015, 49, (14), 8759-8768.

88. Judy, J. D.; McNear Jr, D. H.; Chen, C.; Lewis, R. W.; Tsyusko, O. V.; Bertsch, P. M.; Rao, W.; Stegemeier, J.; Lowry, G. V.; McGrath, S. P., Nanomaterials in biosolids inhibit nodulation, shift microbial community composition, and result in increased metal uptake relative to bulk/dissolved metals. Environmental science & technology 2015, 49, (14), 8751-8758.

89. Starnes, D. L.; Unrine, J. M.; Starnes, C. P.; Collin, B. E.; Oostveen, E. K.; Ma, R.; Lowry, G. V.; Bertsch, P. M.; Tsyusko, O. V., Impact of sulfidation on the bioavailability and toxicity of silver nanoparticles to Caenorhabditis elegans. Environmental Pollution 2015, 196, (0), 239-246.

90. Behra, R.; Krug, H., Nanoecotoxicology: Nanoparticles at large. Nat Nano 2008, 3, (5), 253-254.

91. Handy, R. D.; Cornelis, G.; Fernandes, T.; Tsyusko, O.; Decho, A.; Sabo-Attwood, T.; Metcalfe, C.; Steevens, J. A.; Klaine, S. J.; Koelmans, A. A.; Horne, N., Ecotoxicity test methods for engineered nanomaterials: practical experiences and recommendations from the bench. Environmental toxicology and chemistry / SETAC 2012, 31, (1), 15-31.

92. Arockiya Aarthi Rajathi, F.; Parthiban, C.; Ganesh Kumar, V.; Anantharaman, P., Biosynthesis of antibacterial gold nanoparticles using brown alga, Stoechospermum marginatum (kützing). Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 2012, 99, 166-173.

93. Hernández-Sierra, J. F.; Ruiz, F.; Cruz Pena, D. C.; Martínez-Gutiérrez, F.; Martínez, A. E.; de Jesús Pozos Guillén, A.; Tapia-Pérez, H.; Martínez Castañón, G., The antimicrobial sensitivity of Streptococcus mutans to nanoparticles of silver, zinc

133

oxide, and gold. Nanomedicine: Nanotechnology, Biology and Medicine 2008, 4, (3), 237-240.

94. Tsuang, Y.-H.; Sun, J.-S.; Huang, Y.-C.; Lu, C.-H.; Chang, W. H.-S.; Wang, C.-C., Studies of Photokilling of Bacteria Using Titanium Dioxide Nanoparticles. Artificial Organs 2008, 32, (2), 167-174.

95. Jose Ruben, M.; Jose Luis, E.; Alejandra, C.; Katherine, H.; Juan, B. K.; Jose Tapia, R.; Miguel Jose, Y., The bactericidal effect of silver nanoparticles. Nanotechnology 2005, 16, (10), 2346.

96. Choi, O.; Hu, Z., Size dependent and reactive oxygen species related nanosilver toxicity to nitrifying bacteria. Environ Sci Technol 2008, 42, (12), 4583-8.

97. Padmavathy, N.; Vijayaraghavan, R., Enhanced bioactivity of ZnO nanoparticles—an antimicrobial study. Science and Technology of Advanced Materials 2016.

98. Yang, Y.; Wang, J.; Xiu, Z.; Alvarez, P. J. J., Impacts of silver nanoparticles on cellular and transcriptional activity of nitrogen-cycling bacteria. Environmental Toxicology and Chemistry 2013, 32, (7), 1488-1494.

99. Jo, Y.-K.; Kim, B. H.; Jung, G., Antifungal Activity of Silver Ions and Nanoparticles on Phytopathogenic Fungi. Plant Disease 2009, 93, (10), 1037-1043.

100. Gajbhiye, M.; Kesharwani, J.; Ingle, A.; Gade, A.; Rai, M., Fungus-mediated synthesis of silver nanoparticles and their activity against pathogenic fungi in combination with fluconazole. Nanomedicine: Nanotechnology, Biology and Medicine 5, (4), 382-386.

101. Kim, K.-J.; Sung, W. S.; Moon, S.-K.; Choi, J.-S.; Kim, J. G.; Lee, D. G., Antifungal effect of silver nanoparticles on dermatophytes. J Microbiol Biotechnol 2008, 18, (8), 1482-1484.

102. Lin, D.; Xing, B., Phytotoxicity of nanoparticles: Inhibition of seed germination and root growth. Environmental Pollution 2007, 150, (2), 243-250.

103. Lin, D.; Xing, B., Root Uptake and Phytotoxicity of ZnO Nanoparticles. Environmental Science & Technology 2008, 42, (15), 5580-5585.

104. Slomberg, D. L.; Schoenfisch, M. H., Silica Nanoparticle Phytotoxicity to Arabidopsis thaliana. Environmental Science & Technology 2012, 46, (18), 10247-10254.

105. Ravindran, A.; Prathna, T. C.; Verma, V. K.; Chandrasekaran, N.; Mukherjee, A., Bovine serum albumin mediated decrease in silver nanoparticle phytotoxicity: root elongation and seed germination assay. Toxicological & Environmental Chemistry 2012, 94, (1), 91-98.

106. Shoults-Wilson, W. A.; Reinsch, B. C.; Tsyusko, O. V.; Bertsch, P. M.; Lowry, G. V.; Unrine, J. M., Effect of silver nanoparticle surface coating on bioaccumulation and reproductive toxicity in earthworms (Eisenia fetida). Nanotoxicology 2011, 5, (3), 432-44.

107. Shoults-Wilson, W. A.; Reinsch, B. C.; Tsyusko, O. V.; Bertsch, P. M.; Lowry, G. V.; Unrine, J. M., Role of Particle Size and Soil Type in Toxicity of Silver Nanoparticles to Earthworms All rights reserved. No part of this periodical may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or any information storage and retrieval system, without permission in writing from the publisher. Permission for printing and for

134

reprinting the material contained herein has been obtained by the publisher. Soil Science Society of America Journal 2011, 75, (2).

108. Shoults-Wilson, W. A.; Zhurbich, O. I.; McNear, D. H.; Tsyusko, O. V.; Bertsch, P. M.; Unrine, J. M., Evidence for avoidance of Ag nanoparticles by earthworms (Eisenia fetida). Ecotoxicology 2011, 20, (2), 385-96.

109. Tsyusko, O. V.; Hardas, S. S.; Shoults-Wilson, W. A.; Starnes, C. P.; Joice, G.; Butterfield, D. A.; Unrine, J. M., Short-term molecular-level effects of silver nanoparticle exposure on the earthworm, Eisenia fetida. Environ Pollut 2012, 171, 249-55.

110. Waalewijn-Kool, P. L.; Klein, K.; Forniés, R. M.; van Gestel, C. A., Bioaccumulation and toxicity of silver nanoparticles and silver nitrate to the soil arthropod Folsomia candida. Ecotoxicology 2014, 23, (9), 1629-1637.

111. Zhang, Z.-Q., Animal biodiversity: An update of classification and diversity in 2013. In : Zhang, Z.-Q. (Ed.) Animal Biodiversity: An Outline of Higher-level Classification and Survey of Taxonomic Richness (Addenda 2013). 2013 2013, 3703, (1), 7.

112. Lorenzen, S., The phylogenetic systematics of free living nematodes. Ray society: 1994.

113. Ingham, R. E.; Trofymow, J. A.; Ingham, E. R.; Coleman, D. C., Interactions of Bacteria, Fungi, and their Nematode Grazers: Effects on Nutrient Cycling and Plant Growth. Ecological Monographs 1985, 55, (1), 119-140.

114. Brenner, S., THE GENETICS OF CAENORHABDITIS ELEGANS. Genetics 1974, 77, (1), 71-94.

115. Dougherty, E.; Nicholas, W.; Hansen, E., AXENIC CULTIVATION OF CAENORHARDITIS BRIGGSAE (NEMATODA: RHABDITIDAE) WITH CHEMICALLY UNDEFINED SUPPLEMENTS; COMPARATIVE STUDIES WITH RELATED NEMATODES*. Annals of the New York Academy of Sciences 1959, 77, (2), 218-236.

116. Maupas, E., Modes et formes de reproduction des nematodes. In Archives de Zoologie Experimentale et Generale, 1900; Vol. 8, p 161.

117. Corsi, A., Wightman, B., Chalfie, M., A Transparent window into biology: A primer on Caenorhabditis elegans*. In Wormbook, Community, T. C. e. R., Ed. WormBook.

118. Fire, A.; Xu, S.; Montgomery, M. K.; Kostas, S. A.; Driver, S. E.; Mello, C. C., Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 1998, 391, (6669), 806-811.

119. Félix, M.-A., RNA interference in nematodes and the chance that favored Sydney Brenner. Journal of Biology 2008, 7, (9), 1-5.

120. Leung, M. C.; Williams, P. L.; Benedetto, A.; Au, C.; Helmcke, K. J.; Aschner, M.; Meyer, J. N., Caenorhabditis elegans: an emerging model in biomedical and environmental toxicology. Toxicological sciences : an official journal of the Society of Toxicology 2008, 106, (1), 5-28.

121. Cole, R. D.; Anderson, G. L.; Williams, P. L., The nematode Caenorhabditis elegans as a model of organophosphate-induced mammalian neurotoxicity. Toxicology and Applied Pharmacology 2004, 194, (3), 248-256.

135

122. Allard, P.; Kleinstreuer, N. C.; Knudsen, T. B.; Colaiácovo, M. P., A C. elegans Screening Platform for the Rapid Assessment of Chemical Disruption of Germline Function. Environmental Health Perspectives 2013, 121, (6), 717-724.

123. Williams, P. L.; Dusenbery, D. B., Aquatic toxicity testing using the nematode, Caenorhabditis elegans. Environmental toxicology and chemistry / SETAC 1990, 9, (10), 1285-1290.

124. Donkin, S. G.; Williams, P. L., Influence of developmental stage, salts and food presence on various end points using Caenorhabditis Elegans for aquatic toxicity testing. Environmental Toxicology and Chemistry 1995, 14, (12), 2139-2147.

125. Dhawan, R.; Dusenbery, D. B.; Williams, P. L., Comparison of lethality, reproduction, and behavior as toxicological endpoints in the nematode Caenorhabditis elegans. Journal of Toxicology and Environmental Health, Part A 1999, 58, 451-462.

126. Boyd, W. A.; Cole, R. D.; Anderson, G. L.; Williams, P. L., The effects of metals and food availability on the behavior of Caenorhabditis elegans. Environmental Toxicology and Chemistry 2003, 22, (12), 3049-3055.

127. Höss, S.; Williams, P., Ecotoxicty testing with nematodes. In Nematodes as Environmental indicators, CAB International: Cambridge, MA, USA, 2009; pp 208-224.

128. Peredney, C. L.; Williams, P. L., Utility of Caenorhabditis elegans for Assessing Heavy Metal Contamination in Artificial Soil. Arch. Environ. Contam. Toxicol. 2000, 39, (1), 113-118.

129. Williams, P. L.; Dusenbery, D. B., Using the nematode Caenorhabditis elegans to predict mammalian acute lethality to metallic salts. Toxicol Ind Health 1988, 4, (4), 469-478.

130. Anderson, G. L.; Boyd, W. A.; Williams, P. L., Assessment of sublethal endpoints for toxicity testing with the nematode Caenorhabditis elegans. Environmental Toxicology and Chemistry 2001, 20, (4), 833-838.

131. Fiedler, H., Persistent organic pollutants. Springer Science & Business Media: 2002; Vol. 3.

132. Negga, R.; Rudd, D. A.; Davis, N. S.; Justice, A. N.; Hatfield, H. E.; Valente, A. L.; Fields, A. S.; Fitsanakis, V. A., Exposure to Mn/Zn ethylene-bis-dithiocarbamate and glyphosate pesticides leads to neurodegeneration in Caenorhabditis elegans. NeuroToxicology 2011, 32, (3), 331-341.

133. Sochová, I.; Hofman, J.; Holoubek, I., Effects of seven organic pollutants on soil nematode Caenorhabditis elegans. Environment International 2007, 33, (6), 798-804.

134. Zhang, Y.; Chen, D.; Ennis, A.; Polli, J.; Xiao, P.; Zhang, B.; Stellwag, E.; Overton, A.; Pan, X., Chemical dispersant potentiates crude oil impacts on growth, reproduction, and gene expression in Caenorhabditis elegans. Arch Toxicol 2013, 87, (2), 371-382.

135. Donkin, S. G.; Dusenbery, D. B., A soil toxicity test using the nematode Caenorhabditis elegans and an effective method of recovery. Arch. Environ. Contam. Toxicol. 25, (2), 145-151.

136

136. Peredney, L. C.; Williams, L. P., Utility of Caenorhabditis elegans for Assessing Heavy Metal Contamination in Artificial Soil. Arch. Environ. Contam. Toxicol. 39, (1), 113-118.

137. Burrows, L. A.; Edwards, C. A., The use of integrated soil microcosms to predict effects of pesticides on soil ecosystems. European Journal of Soil Biology 2002, 38, (3–4), 245-249.

138. Ellegaard-Jensen, L.; Jensen, K. A.; Johansen, A., Nano-silver induces dose-response effects on the nematode Caenorhabditis elegans. Ecotoxicology and environmental safety 2012, 80, 216-23.

139. Eom, H.-J.; Ahn, J.-M.; Kim, Y.; Choi, J., Hypoxia inducible factor-1 (HIF-1)–flavin containing monooxygenase-2 (FMO-2) signaling acts in silver nanoparticles and silver ion toxicity in the nematode, Caenorhabditis elegans. Toxicology and Applied Pharmacology 2013, 270, (2), 106-113.

140. Levard, C.; Hotze, E. M.; Colman, B. P.; Dale, A. L.; Truong, L.; Yang, X. Y.; Bone, A. J.; Brown, G. E., Jr.; Tanguay, R. L.; Di Giulio, R. T.; Bernhardt, E. S.; Meyer, J. N.; Wiesner, M. R.; Lowry, G. V., Sulfidation of silver nanoparticles: natural antidote to their toxicity. Environ Sci Technol 2013, 47, (23), 13440-8.

141. Meyer, J. N.; Lord, C. A.; Yang, X. Y.; Turner, E. A.; Badireddy, A. R.; Marinakos, S. M.; Chilkoti, A.; Wiesner, M. R.; Auffan, M., Intracellular uptake and associated toxicity of silver nanoparticles in Caenorhabditis elegans. Aquatic toxicology 2010, 100, (2), 140-50.

142. Roh, J. Y.; Sim, S. J.; Yi, J.; Park, K.; Chung, K. H.; Ryu, D. Y.; Choi, J., Ecotoxicity of silver nanoparticles on the soil nematode Caenorhabditis elegans using functional ecotoxicogenomics. Environ Sci Technol 2009, 43, (10), 3933-3940.

143. Tyne, W.; Lofts, S.; Spurgeon, D. J.; Jurkschat, K.; Svendsen, C., A new medium for Caenorhabditis elegans toxicology and nanotoxicology studies designed to better reflect natural soil solution conditions. Environmental toxicology and chemistry / SETAC 2013, 32, (8), 1711-7.

144. Yang, X. Mechanisms of silver nanoparticle toxicity in laboratory suspensions and complex environmental media in Caenorhabditis elegans. Duke, Duke Univeristy, 2014.

145. Yang, X.; Jiang, C.; Hsu-Kim, H.; Badireddy, A.; Dykstra, M.; Wiesner, M.; Hinton, D. E.; Meyer, J. N., Silver nanoparticle behavior, uptake, and toxicity in Caenorhabditis elegans: effects of natural organic matter. Environmental science & technology 2014, 48, (6), 3486-3495.

146. Hunt, P. R.; Keltner, Z.; Gao, X.; Oldenburg, S. J.; Bushana, P.; Olejnik, N.; Sprando, R. L., Bioactivity of nanosilver in Caenorhabditis elegans: Effects of size, coat, and shape. Toxicology Reports 2014, 1, 923-944.

147. Kim, S. W.; Nam, S. H.; An, Y. J., Interaction of silver nanoparticles with biological surfaces of Caenorhabditis elegans. Ecotoxicology and environmental safety 2012, 77, 64-70.

148. Gupta, S.; Kushwah, T.; Vishwakarma, A.; Yadav, S., Optimization of ZnO-NPs to Investigate Their Safe Application by Assessing Their Effect on Soil Nematode Caenorhabditis elegans. Nanoscale Research Letters 2015, 10, (1), 1-9.

149. Polak, N.; Read, D. S.; Jurkschat, K.; Matzke, M.; Kelly, F. J.; Spurgeon, D. J.; Stuerzenbaum, S. R., Metalloproteins and phytochelatin synthase may confer

137

protection against zinc oxide nanoparticle induced toxicity in Caenorhabditis elegans. Comparative Biochemistry and Physiology C-Toxicology & Pharmacology 2014, 160, 75-85.

150. Ma, H.; Bertsch, P. M.; Glenn, T. C.; Kabengi, N. J.; Williams, P. L., Toxicity of manufactured zinc oxide nanoparticles in the nematode Caenorhabditis elegans. Environmental Toxicology and Chemistry 2009, 28, (6), 1324-1330.

151. Hongbo, M., Use of nematode Caenorhabditis elegans to evaluate bioavailability and toxicity of transition metals and manufactured zinc oxide nanoparticles. University of Georgia: USA, 2009.

152. Unrine, J.; Bertsch, P.; Hunyadi, S., Bioavailability, Trophic Transfer, and Toxicity of Manufactured Metal and Metal Oxide Nanoparticles in Terrestrial Environments. In Nanoscience and Nanotechnology, John Wiley & Sons, Inc.: 2008; pp 345-366.

153. Luoma, S., Silver nanotechnologies and the environment: old problems or new challenges? Project on Emerging Nanotechnologies, Woodrow Wilson International Centre for Scholars and PEW Charitable Trusts 2008, PEN 15.

154. Yang, X.; Gondikas, A. P.; Marinakos, S. M.; Auffan, M.; Liu, J.; Hsu-Kim, H.; Meyer, J. N., Mechanism of silver nanoparticle toxicity is dependent on dissolved silver and surface coating in Caenorhabditis elegans. Environ Sci Technol 2012, 46, (2), 1119-27.

155. Wiesner, M. R.; Lowry, G. V.; Jones, K. L.; Hochella, M. F., Jr.; Di Giulio, R. T.; Casman, E.; Bernhardt, E. S., Decreasing uncertainties in assessing environmental exposure, risk, and ecological implications of nanomaterials. Environ Sci Technol 2009, 43, (17), 6458-62.

156. Wang, H.; Wick, R. L.; Xing, B., Toxicity of nanoparticulate and bulk ZnO, Al2O3 and TiO2 to the nematode Caenorhabditis elegans. Environmental Pollution 2009, 157, (4), 1171-1177.

157. Choi, J.; Tsyusko, O. V.; Unrine, J. M.; Chatterjee, N.; Ahn, J.-M.; Yang, X.; Thornton, B. L.; Ryde, I. T.; Starnes, D.; Meyer, J. N., A micro-sized model for the in vivo study of nanoparticle toxicity: what has Caenorhabditis elegans taught us? Environmental Chemistry 2014, 11, (3), 227-246.

158. Zhao, Y.; Wu, Q.; Li, Y.; Wang, D., Translocation, transfer, and in vivo safety evaluation of engineered nanomaterials in the non-mammalian alternative toxicity assay model of nematode Caenorhabditis elegans. Rsc Advances 2013, 3, (17), 5741-5757.

159. Roh, J.-Y.; Lee, J.; Choi, J., Assessment of stress-related gene expression in the heavy metal-exposed nematode Caenorhabditis elegans: A potential biomarker for metal-induced toxicity monitoring and environmental risk assessment. Environmental Toxicology and Chemistry 2006, 25, (11), 2946-2956.

160. Kurz, C. L.; Shapira, M.; Chen, K.; Baillie, D. L.; Tan, M.-W., Caenorhabditis elegans pgp-5 is involved in resistance to bacterial infection and heavy metal and its regulation requires TIR-1 and a p38 map kinase cascade. Biochemical and Biophysical Research Communications 2007, 363, (2), 438-443.

161. Cui, Y.; McBride, S.; Boyd, W.; Alper, S.; Freedman, J., Toxicogenomic analysis of Caenorhabditis elegans reveals novel genes and pathways involved in the resistance to cadmium toxicity. Genome Biology 2007, 8, (6), R122.

138

162. Menzel, R.; Yeo, H. L.; Rienau, S.; Li, S.; Steinberg, C. E.; Stürzenbaum, S. R., Cytochrome P450s and short-chain dehydrogenases mediate the toxicogenomic response of PCB52 in the nematode Caenorhabditis elegans. Journal of molecular biology 2007, 370, (1), 1-13.

163. Rocheleau, S.; Arbour, M.; Elias, M.; Sunahara, G. I.; Masson, L., Toxicogenomic effects of nano- and bulk-TiO2 particles in the soil nematode Caenorhabditis elegans. Nanotoxicology 2015, 9, (4), 502-12.

164. Roh, J. Y.; Park, Y. K.; Park, K.; Choi, J., Ecotoxicological investigation of CeO(2) and TiO(2) nanoparticles on the soil nematode Caenorhabditis elegans using gene expression, growth, fertility, and survival as endpoints. Environmental toxicology and pharmacology 2010, 29, (2), 167-72.

165. Starnes D., L., S., Unrine, J., Starnes, C., Oostveen, E., Lowry, G., Bertsch, P., and Tsyusko, O. , Distinct transcriptomic responses of Caenorhabditis elegans to pristine and sulfidized silver nanoparticles. . Journal of Environmental Pollution 2016, In Press.

166. Tsyusko, O. V.; Unrine, J. M.; Spurgeon, D.; Blalock, E.; Starnes, D.; Tseng, M.; Joice, G.; Bertsch, P. M., Toxicogenomic responses of the model organism Caenorhabditis elegans to gold nanoparticles. Environ Sci Technol 2012, 46, (7), 4115-24.

167. Ahn, J.-M.; Eom, H.-J.; Yang, X.; Meyer, J. N.; Choi, J., Comparative toxicity of silver nanoparticles on oxidative stress and DNA damage in the nematode, Caenorhabditis elegans. Chemosphere 2014, 108, 343-352.

168. Hendren, C. O.; Mesnard, X.; Droge, J.; Wiesner, M. R., Estimating production data for five engineered nanomaterials as a basis for exposure assessment. Environ Sci Technol 2011, 45, (7), 2562-9.

169. Chen, X.; Schluesener, H. J., Nanosilver: a nanoproduct in medical application. Toxicology letters 2008, 176, (1), 1-12.

170. Schlich, K.; Klawonn, T.; Terytze, K.; Hund-Rinke, K., Hazard assessment of a silver nanoparticle in soil applied via sewage sludge. Env. Sci. Eur. 2013, 25, (1), 17.

171. Reidy, B.; Haase, A.; Luch, A.; Dawson, K. A.; Lynch, I., Mechanisms of Silver Nanoparticle Release, Transformation and Toxicity: A Critical Review of Current Knowledge and Recommendations for Future Studies and Applications. Materials 2013, 6, (6), 2295-2350.

172. Lombi, E.; Donner, E.; Taheri, S.; Tavakkoli, E.; Jamting, A. K.; McClure, S.; Naidu, R.; Miller, B. W.; Scheckel, K. G.; Vasilev, K., Transformation of four silver/silver chloride nanoparticles during anaerobic treatment of wastewater and post-processing of sewage sludge. Environ Pollut 2013, 176, (0), 193-7.

173. Kaegi, R.; Voegelin, A.; Ort, C.; Sinnet, B.; Thalmann, B.; Krismer, J.; Hagendorfer, H.; Elumelu, M.; Mueller, E., Fate and transformation of silver nanoparticles in urban wastewater systems. Water Res 2013, 47, (12), 3866-77.

174. Xiu, Z. M.; Zhang, Q. B.; Puppala, H. L.; Colvin, V. L.; Alvarez, P. J., Negligible particle-specific antibacterial activity of silver nanoparticles. Nano Lett 2012, 12, (8), 4271-5.

175. Yin, L.; Cheng, Y.; Espinasse, B.; Colman, B. P.; Auffan, M.; Wiesner, M.; Rose, J.; Liu, J.; Bernhardt, E. S., More than the ions: the effects of silver nanoparticles on Lolium multiflorum. Environ Sci Technol 2011, 45, (6), 2360-7.

139

176. Reinsch, B. C.; Levard, C.; Li, Z.; Ma, R.; Wise, A.; Gregory, K. B.; Brown, G. E., Jr.; Lowry, G. V., Sulfidation of silver nanoparticles decreases Escherichia coli growth inhibition. Environ Sci Technol 2012, 46, (13), 6992-7000.

177. Fabrega, J.; Fawcett, S. R.; Renshaw, J. C.; Lead, J. R., Silver nanoparticle impact on bacterial growth: effect of pH, concentration, and organic matter. Environ Sci Technol 2009, 43, (19), 7285-90.

178. Gorth, D. J.; Rand, D. M.; Webster, T. J., Silver nanoparticle toxicity in Drosophila: size does matter. Int J Nanomedicine 2011, 6, 343-50.

179. Miao, A. J.; Schwehr, K. A.; Xu, C.; Zhang, S. J.; Luo, Z.; Quigg, A.; Santschi, P. H., The algal toxicity of silver engineered nanoparticles and detoxification by exopolymeric substances. Environ Pollut 2009, 157, (11), 3034-41.

180. Schlich, K.; Klawonn, T.; Terytze, K.; Hund-Rinke, K., Effects of silver nanoparticles and silver nitrate in the earthworm reproduction test. Environmental toxicology and chemistry / SETAC 2013, 32, (1), 181-8.

181. Zhang, H.; He, X.; Zhang, Z.; Zhang, P.; Li, Y.; Ma, Y.; Kuang, Y.; Zhao, Y.; Chai, Z., Nano-CeO2 exhibits adverse effects at environmental relevant concentrations. Environ Sci Technol 2011, 45, (8), 3725-30.

182. Ma, H.; Bertsch, P. M.; Glenn, T. C.; Kabengi, N. J.; Williams, P. L., Toxicity of manufactured zinc oxide nanoparticles in the nematode Caenorhabditis elegans. Environmental toxicology and chemistry / SETAC 2009, 28, (6), 1324-30.

183. Choi, J.; Tsyusko, O.; Unrine, J.; Chatterjee, N.; Ahn, J.-M.; Yang, X.; Thornton, L.; Ryde, I.; Starnes, D.; Meyer, J., A micro-sized model for the in vivo studies of nanoparticle toxicity: What has Caenorhabditis elegans taught us? Envir. Chem. 2014, 11, (3), 227-246.

184. Lim, D.; Roh, J. Y.; Eom, H. J.; Choi, J. Y.; Hyun, J.; Choi, J., Oxidative stress-related PMK-1 P38 MAPK activation as a mechanism for toxicity of silver nanoparticles to reproduction in the nematode Caenorhabditis elegans. Environmental toxicology and chemistry / SETAC 2012, 31, (3), 585-92.

185. Cheng, Y.; Yin, L.; Lin, S.; Wiesner, M.; Bernhardt, E.; Liu, J., Toxicity Reduction of Polymer-Stabilized Silver Nanoparticles by Sunlight. J. Phys. Chem. C 2011, 115, (11), 4425-4432.

186. Levard, C.; Yang, X.; Meyer, J.; Lowry, G., Response to Comment on “Sulfidation of Silver Nanoparticles: Natural Antidote to Their Toxicity”. Environ Sci Technol 2014, 48, (10), 6051-6052.

187. Croteau, M. N.; Dybowska, A. D.; Luoma, S. N.; Misra, S. K.; Valsami-Jones, E., Isotopically modified silver nanoparticles to assess nanosilver bioavailability and toxicity at environmentally relevant exposures. Environ Chem 2014, 11, (3), 247-256.

188. Liu, J.; Pennell, K. G.; Hurt, R. H., Kinetics and mechanisms of nanosilver oxysulfidation. Environ Sci Technol 2011, 45, (17), 7345-53.

189. Cox, G. N.; Staprans, S.; Edgar, R. S., The cuticle of Caenorhabditis elegans. II. Stage-specific changes in ultrastructure and protein composition during postembryonic development. Developmental biology 1981, 86, (2), 456-70.

190. Yang, X.; Jiang, C.; Hsu-Kim, H.; Badireddy, A. R.; Dykstra, M.; Wiesner, M.; Hinton, D. E.; Meyer, J. N., Silver nanoparticle behavior, uptake, and toxicity in

140

Caenorhabditis elegans: effects of natural organic matter. Environ Sci Technol 2014, 48, (6), 3486-95.

191. Levard, C.; Mitra, S.; Yang, T.; Jew, A. D.; Badireddy, A. R.; Lowry, G. V.; Brown, G. E., Jr., Effect of chloride on the dissolution rate of silver nanoparticles and toxicity to E. coli. Environ Sci Technol 2013, 47, (11), 5738-45.

192. Ma, R.; Levard, C.; Marinakos, S. M.; Cheng, Y.; Liu, J.; Michel, F. M.; Brown, G. E.; Lowry, G. V., Size-controlled dissolution of organic-coated silver nanoparticles. Environ Sci Technol 2012, 46, (2), 752-9.

193. Zhang, W.; Yao, Y.; Sullivan, N.; Chen, Y., Modeling the primary size effects of citrate-coated silver nanoparticles on their ion release kinetics. Environ Sci Technol 2011, 45, (10), 4422-8.

194. Marimuthu, S.; Rahuman, A. A.; Rajakumar, G.; Santhoshkumar, T.; Kirthi, A. V.; Jayaseelan, C.; Bagavan, A.; Zahir, A. A.; Elango, G.; Kamaraj, C., Evaluation of green synthesized silver nanoparticles against parasites. Parasitology research 2011, 108, (6), 1541-9.

195. Santhoshkumar, T.; Rahuman, A. A.; Rajakumar, G.; Marimuthu, S.; Bagavan, A.; Jayaseelan, C.; Zahir, A. A.; Elango, G.; Kamaraj, C., Synthesis of silver nanoparticles using Nelumbo nucifera leaf extract and its larvicidal activity against malaria and filariasis vectors. Parasitology research 2011, 108, (3), 693-702.

196. Lowry, G. V.; Espinasse, B. P.; Badireddy, A. R.; Richardson, C. J.; Reinsch, B. C.; Bryant, L. D.; Bone, A. J.; Deonarine, A.; Chae, S.; Therezien, M.; Colman, B. P.; Hsu-Kim, H.; Bernhardt, E. S.; Matson, C. W.; Wiesner, M. R., Long-term transformation and fate of manufactured ag nanoparticles in a simulated large scale freshwater emergent wetland. Environ Sci Technol 2012, 46, (13), 7027-36.

197. Osório, I.; Igreja, R.; Franco, R.; Cortez, J., Incorporation of silver nanoparticles on textile materials by an aqueous procedure. Materials Letters 2012, 75, (0), 200-203.

198. Prabhu, S.; Poulose, E., Silver nanoparticles: mechanism of antimicrobial action, synthesis, medical applications, and toxicity effects. Int Nano Lett 2012, 2, (1), 1-10.

199. Perelaer, J.; de Gans, B. J.; Schubert, U. S., Ink-jet Printing and Microwave Sintering of Conductive Silver Tracks. Advanced Materials 2006, 18, (16), 2101-2104.

200. Hendren, C. O.; Badireddy, A. R.; Casman, E.; Wiesner, M. R., Modeling nanomaterial fate in wastewater treatment: Monte Carlo simulation of silver nanoparticles (nano-Ag). The Science of the total environment 2013, 449, 418-25.

201. Henglein, A., Colloidal Silver Nanoparticles:  Photochemical Preparation and Interaction with O2, CCl4, and Some Metal Ions. Chemistry of Materials 1998, 10, (1), 444-450.

202. Chun-Nam, L.; Chi-Ming, H.; Rong, C.; Qing-Yu, H.; Wing-Yiu, Y.; Hongzhe, S.; Paul, T.; Jen-Fu, C.; Chi-Ming, C., Silver nanoparticles: partial oxidation and antibacterial activities. Journal of Biological Inorganic Chemistry 2007, 12, (4), 527-534.

203. Liu, Y.; Majetich, S. A.; Tilton, R. D.; Sholl, D. S.; Lowry, G. V., TCE Dechlorination Rates, Pathways, and Efficiency of Nanoscale Iron Particles with Different Properties. Environmental Science & Technology 2005, 39, (5), 1338-1345.

141

204. Baalousha, M.; Le Coustumer, P.; Jones, I.; Lead, J. R., Characterisation of structural and surface speciation of representative commercially available cerium oxide nanoparticles. Environmental Chemistry 2010, 7, (4), 377-385.

205. Reinsch, B. C.; Levard, C.; Li, Z.; Ma, R.; Wise, A.; Gregory, K. B.; Brown, G. E.; Lowry, G. V., Sulfidation of silver nanoparticles decreases Escherichia coli growth inhibition. Environmental Science & Technology 2012, 46, (13), 6992-7000.

206. Maupas, E., Modes et formes de reproduction des nematodes. Archives de Zoologie expérimentale et générale 1901, 8, 463-624.

207. Cui, Y.; McBride, S. J.; Boyd, W. A.; Alper, S.; Freedman, J. H., Toxicogenomic analysis of Caenorhabditis elegans reveals novel genes and pathways involved in the resistance to cadmium toxicity. Genome biology 2006, 8, (6).

208. Menzel, R.; Swain, S. C.; Hoess, S.; Claus, E.; Menzel, S.; Steinberg, C. E.; Reifferscheid, G.; Sturzenbaum, S. R., Gene expression profiling to characterize sediment toxicity--a pilot study using Caenorhabditis elegans whole genome microarrays. BMC genomics 2009, 10, 160.

209. Viñuela, A.; Snoek, L. B.; Riksen, J. A. G.; Kammenga, J. E., Genome-wide gene expression enalysis in response to organophosphorus pesticide chlorpyrifos and diazinon in C. elegans. PLoS ONE 2010, 5, (8), e12145.

210. Wang, H.; Burgess, R. M.; Cantwell, M. G., Stability and aggregation of silver and titanium dioxide nanoparticles in seawater: Role of salinity and dissolved organic carbon. Environmental … 2014.

211. EPA, Clean Water Act analytical methods for measuring the Acute toxicity of effluents and receiving waters to freshwater and marine organisms. In Washington, D.C., 2015.

212. Irizarry, R. A.; Hobbs, B.; Collin, F.; Beazer-Barclay, Y. D.; Antonellis, K. J.; Scherf, U.; Speed, T. P., Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics (Oxford, England) 2003, 4, (2), 249-264.

213. Partek, Partek Genomics Suite 6.4. In Partek Inc.: St. Louis, MO, 2009. 214. Huang, D. W. a. W.; Sherman, B. T.; Lempicki, R. A., Systematic and integrative

analysis of large gene lists using DAVID bioinformatics resources. Nature protocols 2008, 4, (1), 44-57.

215. Fraser, A. G.; Kamath, R. S.; Zipperlen, P.; Martinez-Campos, M.; Sohrmann, M.; Ahringer, J., Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 2000, 408, (6810), 325-330.

216. Sondi, I.; Salopek-Sondi, B., Silver nanoparticles as antimicrobial agent: a case study on E. coli as a model for Gram-negative bacteria. Journal of colloid and interface science 2004.

217. Tvermoes, B. E.; Boyd, W. A.; Freedman, J. H., Molecular characterization of numr-1 and numr-2: genes that increase both resistance to metal-induced stress and lifespan in Caenorhabditis elegans. Journal of Cell Science 2010, 123, (12), 2124-2134.

218. Shukla, R.; Bansal, V.; Chaudhary, M.; Basu, A., Biocompatibility of gold nanoparticles and their endocytotic fate inside the cellular compartment: a microscopic overview. Langmuir 2005.

142

219. McCarthy, M. P.; Carroll, D. L.; Ringwood, A. H., Tissue specific responses of oysters, Crassostrea virginica, to silver nanoparticles. Aquatic toxicology 2013, 138–139, (0), 123-128.

220. Levy, M.; Luciani, N.; Alloyeau, D.; Elgrabli, D.; Deveaux, V.; Pechoux, C.; Chat, S.; Wang, G.; Vats, N.; Gendron, F.; Factor, C.; Lotersztajn, S.; Luciani, A.; Wilhelm, C.; Gazeau, F., Long term in vivo biotransformation of iron oxide nanoparticles. Biomaterials 2011, 32, (16), 3988-3999.

221. Britton, C.; McKerrow, J. H.; Johnstone, I. L., Regulation of the Caenorhabditis elegans gut cysteine protease gene cpr-1: requirement for GATA motifs. Journal of molecular biology 1998, 283, (1), 15-27.

222. JebaMercy, G.; Pandian, S.; Balamurugan, K., Changes in Caenorhabditis elegans life span and selective innate immune genes during Staphylococcus aureus infection. Folia Microbiol 2011, 56, (5), 373-380.

223. Tong, B.; Wan, B.; Wei, Z.; Wang, T.; Zhao, P.; Dou, Y.; Lv, Z.; Xia, Y.; Dai, Y., Role of cathepsin B in regulating migration and invasion of fibroblast-like synoviocytes into inflamed tissue from patients with rheumatoid arthritis. Clinical & Experimental Immunology 2014, 177, (3), 586-597.

224. Hook, G.; Yu, J.; Toneff, T.; Kindy, M.; Hook, V., Brain Pyroglutamate Amyloid-beta is Produced by Cathepsin B and is Reduced by the Cysteine Protease Inhibitor E64d, Representing a Potential Alzheimer's Disease Therapeutic. J. Alzheimers Dis. 2014, 41, (1), 129-149.

225. Irizarry, R. A.; Hobbs, B.; Collin, F.; Beazer‐Barclay, Y. D.; Antonellis, K. J.; Scherf, U.; Speed, T. P., Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics 2003, 4, (2), 249-264.

226. Reiner, D. J.; Newton, E. M.; Tian, H.; Thomas, J. H., Diverse behavioural defects caused by mutations in Caenorhabditis elegans unc-43 CaM Kinase II. Nature 1999, 402, (6758), 199-203.

227. Wang, Q.; Wadsworth, W. G., The C domain of netrin UNC-6 silences calcium/calmodulin-dependent protein kinase and diacylglycerol-dependent axon branching in Caenorhabditis elegans. The Journal of Neuroscience 2002, 22, (6), 2274-2282.

228. Reiner, D. J.; Weinshenker, D.; Thomas, J. H., Analysis of dominant mutations affecting muscle excitation in Caenorhabditis elegans. Genetics 1995, 141, (3), 961-76.

229. Adachi, R.; Kagawa, H., Genetic analysis of ryanodine receptor function in Caenorhabditis elegans based on unc-68 revertants. Mol Gen Genomics 2003, 269, (6), 797-806.

230. Nair, P. M. G.; Choi, J., Identification, characterization and expression profiles of Chironomus riparius glutathione S-transferase (GST) genes in response to cadmium and silver nanoparticles exposure. Aquatic toxicology 2011, 101, (3), 550-560.

231. Hasegawa, K.; Miwa, J., Genetic and cellular characterization of Caenorhabditis elegans mutants abnormal in the regulation of many phase II enzymes. PLoS ONE 2010, 5, (6), e11194.

232. Hasegawa, K.; Miwa, S.; Tsutsumiuchi, K.; Miwa, J., Allyl isothiocyanate that induces GST and UGT expression confers oxidative stress resistance on C. elegans, as demonstrated by nematode biosensor. PLoS ONE 2010, 5, (2), e9267.

143

233. Murphy, C. a. H., P., Insulin/insulin-like growth factor signaling in C. elegans. WormBook 2013.

234. Higgins, B.; Hirsh, D., Roller mutants of the nematode Caenorhabditis elegans. Molec. Gen. Genet. 1977, 150, (1), 63-72.

235. Burglin, T. a. K., P., Homologs of the Hh signaling network in C. elegans. WormBook, ed. 2006.

236. Levy, A. D.; Kramer, J. M., Identification, sequence and expression patterns of the Caenorhabditis elegans col-36 and col-40 collagen-encoding genes. Gene 1993, 137, (2), 281-285.

237. Merris, M.; Wang, T.; Soteropoulos, P.; Lenard, J., Differential gene expression of Caenorhabditis elegans grown on unmethylated sterols or 4α-methylsterols. Journal of Lipid Research 2007, 48, (5), 1159-1166.

238. Page, A., and Johnstone, I., The cuticle. WormBook, ed. 2007. 239. Zhong Lin, W., Zinc oxide nanostructures: growth, properties and applications.

Journal of Physics: Condensed Matter 2004, 16, (25), R829. 240. Piccinno, F.; Gottschalk, F.; Seeger, S.; Nowack, B., Industrial production quantities

and uses of ten engineered nanomaterials in Europe and the world. J Nanopart Res 2012, 14, (9), 1-11.

241. Ju-Nam, Y.; Lead, J. R., Manufactured nanoparticles: An overview of their chemistry, interactions and potential environmental implications. Science of The Total Environment 2008, 400, (1–3), 396-414.

242. Mueller, N. C.; Nowack, B., Exposure Modeling of Engineered Nanoparticles in the Environment. Environmental Science & Technology 2008, 42, (12), 4447-4453.

243. Lucid, J. D.; Fenton, O.; Healy, M. G., Estimation of maximum biosolids and meat and bone meal application to a low P index soil and a method to test for nutrient and metal losses. Water, Air, & Soil Pollution 2013, 224, (4), 1-12.

244. Martínez, C. E.; Bazilevskaya, K. A.; Lanzirotti, A., Zinc Coordination to Multiple Ligand Atoms in Organic-Rich Surface Soils. Environmental Science & Technology 2006, 40, (18), 5688-5695.

245. Xiaoshan, Z.; Jiangxin, W.; Xuezhi, Z.; Yung, C.; Yongsheng, C., The impact of ZnO nanoparticle aggregates on the embryonic development of zebrafish ( Danio rerio ). Nanotechnology 2009, 20, (19), 195103.

246. Landa, P.; Vankova, R.; Andrlova, J.; Hodek, J.; Marsik, P.; Storchova, H.; White, J. C.; Vanek, T., Nanoparticle-specific changes in Arabidopsis thaliana gene expression after exposure to ZnO, TiO2, and fullerene soot. Journal of Hazardous Materials 2012, 241-242, 55-62.

247. Chen, C.; Unrine, J. M.; Judy, J. D.; Lewis, R. W.; Guo, J.; McNear, D. H.; Tsyusko, O. V., Toxicogenomic Responses of the Model Legume Medicago truncatula to Aged Biosolids Containing a Mixture of Nanomaterials (TiO2, Ag, and ZnO) from a Pilot Wastewater Treatment Plant. Environmental Science & Technology 2015, 49, (14), 8759-8768.

248. Judy, J. D.; McNear, D. H.; Chen, C.; Lewis, R. W.; Tsyusko, O. V.; Bertsch, P. M.; Rao, W.; Stegemeier, J.; Lowry, G. V.; McGrath, S. P.; Durenkamp, M.; Unrine, J. M., Nanomaterials in Biosolids Inhibit Nodulation, Shift Microbial Community Composition, and Result in Increased Metal Uptake Relative to Bulk/Dissolved Metals. Environmental Science & Technology 2015, 49, (14), 8751-8758.

144

249. Rathnayake, S.; Unrine, J. M.; Judy, J.; Miller, A.-F.; Rao, W.; Bertsch, P. M., Multitechnique Investigation of the pH Dependence of Phosphate Induced Transformations of ZnO Nanoparticles. Environmental Science & Technology 2014, 48, (9), 4757-4764.

250. Ma, R.; Levard, C.; Michel, F. M.; Brown Jr, G. E.; Lowry, G. V., Sulfidation mechanism for zinc oxide nanoparticles and the effect of sulfidation on their solubility. Environmental science & technology 2013, 47, (6), 2527-2534.

251. Williams, P. L.; Dusenbery, D. B., Using the Nematode Caenorhabditis Elegans To Predict Mammalian Acute Lethality To Metallic Salts. Toxicology and Industrial Health 1988, 4, (4), 469-478.

252. Levard, C.; Yang, X.; Meyer, J. N.; Lowry, G. V., Response to Comment on “Sulfidation of Silver Nanoparticles: Natural Antidote to Their Toxicity”. Environmental Science & Technology 2014, 48, (10), 6051-6052.

253. El Badawy, A. M.; Silva, R. G.; Morris, B.; Scheckel, K. G.; Suidan, M. T.; Tolaymat, T. M., Surface Charge-Dependent Toxicity of Silver Nanoparticles. Environmental Science & Technology 2011, 45, (1), 283-287.

254. Dean, J. A., Lange's handbook of chemistry. 1985. 255. Khare, P.; Sonane, M.; Pandey, R.; Ali, S.; Gupta, K. C.; Satish, A., Adverse Effects

of TiO<sub xmlns="http://pub2web.metastore.ingenta.com/ns/">2</sub> and ZnO Nanoparticles in Soil Nematode, <i xmlns="http://pub2web.metastore.ingenta.com/ns/">Caenorhabditis elegans</i>. Journal of Biomedical Nanotechnology 2011, 7, (1), 116-117.

256. Poynton, H. C.; Lazorchak, J. M.; Impellitteri, C. A.; Blalock, B.; Smith, M. E.; Struewing, K.; Unrine, J.; Roose, D., Toxicity and Transcriptomic Analysis in Hyalella azteca Suggests Increased Exposure and Susceptibility of Epibenthic Organisms to Zinc Oxide Nanoparticles. Environmental Science & Technology 2013, 47, (16), 9453-9460.

257. Zhao, Z.; Sheps, J. A.; Ling, V.; Fang, L. L.; Baillie, D. L., Expression Analysis of ABC Transporters Reveals Differential Functions of Tandemly Duplicated Genes in Caenorhabditis elegans. Journal of Molecular Biology 2004, 344, (2), 409-417.

258. Wang, X.; Wang, J.; Gengyo-Ando, K.; Gu, L.; Sun, C.-L.; Yang, C.; Shi, Y.; Kobayashi, T.; Shi, Y.; Mitani, S.; Xie, X.-S.; Xue, D., C. elegans mitochondrial factor WAH-1 promotes phosphatidylserine externalization in apoptotic cells through phospholipid scramblase SCRM-1. Nat Cell Biol 2007, 9, (5), 541-549.

259. Pietsch, K.; Saul, N.; Swain, S. C.; Menzel, R.; Steinberg, C. E. W.; Stürzenbaum, S. R., Meta-Analysis of Global Transcriptomics Suggests that Conserved Genetic Pathways are Responsible for Quercetin and Tannic Acid Mediated Longevity in C. elegans. Frontiers in Genetics 2012, 3, 48.

260. Murphy, C. T.; McCarroll, S. A.; Bargmann, C. I.; Fraser, A.; Kamath, R. S.; Ahringer, J.; Li, H.; Kenyon, C., Genes that act downstream of DAF-16 to influence the lifespan of Caenorhabditis elegans. Nature 2003, 424, (6946), 277-283.

261. Hertweck, M.; Göbel, C.; Baumeister, R., C. elegans SGK-1 is the critical component in the Akt/PKB kinase complex to control stress response and life span. Developmental cell 2004, 6, (4), 577-588.

262. Finkel, T.; Holbrook, N. J., Oxidants, oxidative stress and the biology of ageing. Nature 2000, 408, (6809), 239-247.

145

263. Boudko, S. P.; Engel, J.; Bächinger, H. P., The crucial role of trimerization domains in collagen folding. The International Journal of Biochemistry & Cell Biology 2012, 44, (1), 21-32.

264. McGhee, J. D., The C. elegans intestine. Wormbook: 2007. 265. Cheng, Y.; Yin, L.; Lin, S.; Wiesner, M.; Bernhardt, E.; Liu, J., Toxicity Reduction

of Polymer-Stabilized Silver Nanoparticles by Sunlight. The Journal of Physical Chemistry C 2011, 115, (11), 4425-4432.

146

Vitae

Daniel Lee Starnes

Education

M.Sc. Biology, December 2009 Western Kentucky University, Bowling Green, KY Thesis: In planta “Green Engineering” of Variable Sizes and Exotic Shapes of Gold Nanoparticles: an Integrative Eco-Friendly Approach Advisor: Dr. Shivendra V. Sahi

B.Sc. Agriculture, Minor in Biology, May 2006 Western Kentucky University, Bowling Green, KY

Graduate of University Honors Program Honors Thesis: Use of Lolium multiflorum for Remediation of Phosphorus from Poultry Litter Contaminated Media

Honors/Awards

Best Overall Poster at 9th Annual International Conference on the Environmental Effects of Nanoparticles and Nanomaterials (2014)

Kentucky Academy of Science, Ecology and Environmental Science Graduate Presentation Division Winner (2013)

Nanotechnology Symposium Outstanding Research Paper Award (2010) Outstanding Graduate Student in Biology, Western Kentucky University (2009) Graduate Research Competition Award Kentucky Academy of Science (2009) Outstanding Graduate Research Presentation WKU Student Research Conference

(2009) Nanotechnology Symposium Outstanding Research Paper Award (2008) Kentucky Academy of Science, Agricultural Science Graduate Presentation Division

Winner (2008) Grants

Tracey Farmer Institute for Sustainability and the Environment Undergraduate Research Opportunity Grant, 2014, $500

Plant and Soil Science Departmental Travel Grant for Travel to International Conference for the Environmental Effects of Nanoparticles and Nanomaterials, Columbia, SC, 2014, $500

University of Kentucky Gradate School Travel Grant for Travel to International Conference for the Environmental Effects of Nanoparticles and Nanomaterials, Columbia, SC, 2014, $400

Plant and Soil Science Departmental Travel Grant for Travel to Society for Environmental Toxicology and Chemistry International Meeting, Nashville, TN, 2013, $500

147

Mentoring

Undergraduate student Stuart Lichtenberg (Summer 2014-Spring 2015), University of Kentucky Project: Assessing the toxicogenomic effect of Ag+

, pristine silver nanoparticles, and artificially aged silver nanoparticles using Caenorhabditis elegans by conducting toxicity screenings using mutant strains, RNAi technology, and morphological changes to the cuticle.

Undergraduate student Chris White (Fall 2008), Western Kentucky University Project: General training to conduct research in a plant biotechnology laboratory.

Refereed Publications

Starnes, D., Lichtenberg, S., Unrine, J., Starnes. C., Oostveen, E., Lowry, G., Bertsch, P., Tsyusko, O. Distinct transcriptomic responses of Caenorhabditis elegans to pristine and sulfidized silver nanoparticles. Environmental Pollution 213: 314-321 (2016).

Starnes, D., Unrine, J., Starnes, C., Collin, B., Oostveen, E., Ma, R., Lowry, G., Bertsch, P., and Tsyusko, O. Impact of sulfidation on the bioavailability and toxicity of silver nanoparticles to Caenorhabditis elegans. Environmental Pollution 196: 239-246 (2015).

Jain, A., Sinilal, B., Starnes, D., Sanagala, R., Krishnamurthy, S. and Sahi., S. Role of Fe-responsive genes in bioreduction and transport of ionic gold to roots of Arabidopsis thaliana during synthesis of gold nanoparticles. Plant Physiology and Biochemistry 84: 189-196 (2014).

Padmanabhan, P., Starnes, D., Sahi, S. Differential responses of Duo grass (Lolium x Festuca), a phosphorous hypeaccumulator to high phosphorous and poultry manure treatments. African journal of Biotechnology 12: 3191-3195 (2013).

Tsyusko, O., Unrine, J., Spurgeon, D., Starnes, D., Tseng, M., Joice, G., and Bertsch, P. Toxicogenomic responses of the model ecoreceptor Caenorhabditis elegans to gold nanoparticles. Environmental Science and Technology 46: 4115−4124 (2012).

Starnes, D., Jain, A., and Sahi, S. In-planta Engineering of Gold Nanoparticles of Desirable Geometries by Fine-tuning Growth Conditions: an Eco-friendly Approach. Environmental Science and Technology 44: 7110-7115 (2010).

Starnes, D., Priya, P., and Sahi, S. Effect of P Sources on growth, P accumulation and activities of phytase and acid phosphatases in two cultivars of annual ryegrass (Lolium multiflourm L.). Plant Physiol. Biochem. 46, 580-589 (2008).

Sharma, N., Starnes, D., and Sahi S. Phytoextraction of excess soil phosphorus. Environmental Pollution 146, 120-127 (2007).

Starnes, D. Use of Lolium multiflorum in the Remediation of Phosphorous from Poultry-Litter-Contaminated Media. Western Kentucky University Honors Program Thesis Database (2006).

Oral* and Poster Presentations

Starnes, D., Lichtenberg, S., Spears, A., Unrine, J., Bertsch, P., and Tsyusko, O. How aging of silver and zinc oxide nanoparticles impacts their toxicity in Caenorhabditis

148

elegans. Tracey Farmer Institute for Sustainability and the Environment, Lexington, KY, 12/01/2015

Starnes, D., Lichtenberg, S., Unrine, J., Starnes, C., Bertsch, P., and Tsyusko, O. How aging impacts the toxicogenomic response of Caenorhabditis elegans to silver nanoparticles. Tracey Farmer Institute for Sustainability and the Environment, Lexington, KY, 12/01/2014

Starnes, D., Lichtenberg, S., Unrine, J., Starnes, C., Oostveen, E., Collin, B., Bertsch, P., and Tsyusko, O. Toxicogenomic responses of Caenorhabditis elegans to pristine and aged sliver nanomaterials. Kentucky Academy of Science Annual Meeting, Lexington, KY 11/14/2014-11/16/2014*

Starnes, D., Lichtenberg, S., Unrine, J., Starnes, C., Oostveen, E., Collin, B., Ma, R., Lowry, G., Bertsch, P., and Tsyusko, O. Silver Nanoparticles get better with Age. 9th Annual International Conference on the Environmental Effects of Nanoparticles and Nanomaterials, Columbia, SC, 9/07/2014-9/11/2014*

Starnes, D., Oostveen, E., Starnes, C., Collin, B., Unrine, J., Bertsch, P., Tsyusko, O. Toxicogenomic responses of Caenorhabditis elegans to sliver nanomaterials. Society of Environmental Science and Toxicology North America, Nashville, TN, 11/17/2013-11/21/2013*

Starnes, D., Oostveen, E., Starnes, C., Collin, B., Unrine, J., Bertsch, P., Tsyusko, O. Toxicogenomic effects of Caenorhabditis elegans to sliver nanoparticles. Kentucky Academy of Science, Morehead, KY, 11/8/2013-11/9/2013*

Starnes, C., Starnes, D., Bush, H. Lost in Translation: Effective Statistical Communication in Translational Science. Joint Statistical Meetings, Montreal, Canada, 08/03/2013-08/08/2013

Starnes, D., Oostveen, E., Starnes, C., Unrine, J., Bertsch, P., Tsyusko, O. Toxicity of Silver Manufactured Nanomaterials on the Model Organism Caenorhabditis elegans. ASA, CSSA and SSSA International Annual Meetings, Cincinnati, OH. October 2012.

Starnes, D., Jain, A., Kancharla, J., Sahi, S. In planta “Green Engineering” of variable sizes and exotic shapes of Gold Nanoparticles: An integrative eco-friendly approach. Biochemistry and Biotechnology symposium South Association of Agricultural Scientist, Orlando, FL, 2010*

Starnes, D., Sahi, S. Plants can produce Nanoparticles. 39th Annual Student Research Conference, Bowling Green, KY, 2009*

Sahi, S., Starnes, D. Nanoparticle synthesis in alfalfa. Annual Meeting of Southern Association of Agricultural Scientists (American Society of Agronomy Southern Branch Meeting), Atlanta, GA, 2009

Starnes, D., Sahi, S. Plants can produce gold nanoparticles. Nanotechnology Symposium: Advances in Nanotechnology and Applications. Sullivan University, Louisville, KY, 2009*

Starnes, D., Sahi, S. Phytomining of gold and plant-mediated production of gold nanoparticles. KY Nanomat 2008, Louisville, KY, 2008*

Starnes, D., Sahi, S. Biological Synthesis of Gold Nanoparticles. 38th Annual Student Research Conference, Bowling Green, KY, 2008*

149

Sahi, S., Starnes, D., Paul, P., Padmandabhan, P., Sharma, N., Sajwan, K. Can crops be used to remediate excess phosphorus? Southern Association of Agricultural Scientist, 2007

Starnes, D., Sharma, N., Sahi, S. Use of Duo festulolium in the remediation of phosphorus-enriched soils. American Society of Agronomy (Southern Branch), Orlando, FL, 2006*

Starnes, D., Sharma, N., Sahi, S. Use of Lolium multiflourm in the remediation of chicken litter-contaminated media. Annual meeting of American Society of Agronomy (Southern Branch), San Antonio, TX, 2005*

Starnes, D., Sharma, N., Sahi, S. Development of Lolium multiflourm cell lines capable of high phosphate accumulation. 101st Annual Meeting of American Society of Agronomy (Southern Branch), Biloxi, MS, 2004

Sharma, N., Starnes, D., Sahi, S. In vitro cultivation of Sesbania drummondii cells exposed to heavy metal stress. 101st Annual Meeting of American Society of Agronomy (Southern Branch), Biloxi, MS, 2004