The Case of the Missing Strawberries: RFLP Analysis

Heidi SleisterAssoc. Professor of BiologyDrake University

1344 27th StreetDes Moines, Iowa 50311

Heidi.Sleister@Drake.edu

Microsoft Clipart picture of strawberries

• Problem:

– Strawberries are missing from the school garden.

– A search led to 5 people with strawberries.

– Do any of these strawberries match the strawberries

from the garden?

Case Background

Heidi Sleister

Chromosomes are made of DNA and are found in the nucleus of a cell

Insert a picture which shows the relationship of DNA, chromosomes, and a cell.

Heidi Sleister

Insert a picture which shows the structure of DNA (double helix, paired nitrogenous bases (G-C, A-T)).

DNA has a double-stranded helical structure

Heidi Sleister

• Experimental Strategy:

– Isolate DNA from strawberries

– Use RFLP analysis to compare garden strawberry plant

DNA to the “suspect” strawberries.

Solving the Case

Heidi Sleister

• Disease diagnosis• Genetic mapping• Forensic science• Genetically modified organisms• Paternity testing• Personal identification• Plant breeding• Characterization of genetic diversity• Species identification

Applications of RFLP Analysis

Heidi Sleister

Restriction endonucleases cut specific sequences of DNA and produce DNA fragments

ACCATAAGAATTCAATCCTGGTATTCTTAAGTTAGG

EcoRI restriction site

TGGTATTCTTAAACCATAAG AATTCAATCC

GTTAGGFragment 1 Fragment 2

Heidi Sleister

Different sizes of DNA fragments can be distinguished by gel electrophoresis

Insert picture of gel electrophoresis chamber and gel.

Heidi Sleister

Restriction fragment length polymorphisms (RFLPs)

-------GAATTC-------------------

-------CTTAAG-------------------

-------GACTTC-------------------

-------CTGAAG-------------------

EcoRI site

No EcoRI site

Allele 1

Allele 2

Fragment A1-1 Fragment A1-2

Fragment A2-1 M

arke

r

All

ele

1

All

ele

2

Fragment A2-1

Fragment A1-2

Fragment A1-1

Allele 1 and Allele 2 differ by only a single basepair which is located within the EcoRI restriction site.

Gel electrophoresis of allele 1 and allele 2 DNAs digested with EcoRI.

Heidi Sleister