The ankyrin-like protein AnkB interacts with CatB, affects 1

catalase activity, and enhances resistance of Xanthomonas 2

oryzae pv. oryzae and Xanthomonas oryzae pv. oryzicola to 3

phenazine-1-carboxylic acid 4

Xiayan Pan, Shu Xu, Jian Wu, Yabing Duan, Zhitian Zhen, Jianxin Wang, Xiushi 5

Song and Mingguo Zhou 6

CORRESPONDENT FOOTNOTE 7

College of Plant Protection, State & Local Joint Engineering Research Center of 8

Green Pesticide Invention and Application, Nanjing Agricultural University, Nanjing, 9

210095, China. 10

Present Address: Nanjing Agricultural University, Nanjing 210095, China 11

Phone: 086-25-84395641; Fax: 086-25-84395641; 12

Corresponding author: Mingguo Zhou, E-mail: mgzhou@njau.edu.cn 13

Keywords: ankB, catB, catalase activity, Xanthomonas oryzae pv. oryzae, 14

Xanthomonas oryzae pv. oryzicola, phenazine-1-carboxylic acid, oxidative stress 15

ABSTRACT 16

Xanthomonas oryzae pv. oryzae (Xoo), which causes rice bacterial leaf blight, and 17

Xanthomonas oryzae pv. oryzicola (Xoc), which causes rice bacterial leaf streak, are 18

important plant-pathogenic bacteria. A member of adaptor proteins family, ankyrin 19

protein, was largely investigated in humans, but rarely in plant-pathogenic bacteria. In 20

this study, a novel ankyrin-like protein, AnkB, was identified in Xoo and Xoc. The 21

expression of ankB was significantly up-regulated when these bacteria were treated 22

AEM Accepted Manuscript Posted Online 27 November 2017Appl. Environ. Microbiol. doi:10.1128/AEM.02145-17Copyright © 2017 American Society for Microbiology. All Rights Reserved.

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

with phenazine-1-carboxylic acid (PCA). ankB is located 58 bp downstream of the 23

gene catB (which encodes a catalase) in both bacteria, and the gene expression of 24

catB and catalase activity were reduced following ankB deletion in Xoo and Xoc. 25

Furthermore, we demonstrated that AnkB directly interacts with CatB by 26

Gluthathione-S-transferase (GST) pull-down assays. Deletion of ankB increased Xoo 27

and Xoc sensitivity to H2O2 and PCA, decreased bacterial biofilm formation, 28

swimming ability and EPS production, and also reduced virulence on rice. Together 29

our results indicate that the ankyrin-like protein AnkB has important and conserved 30

roles in antioxidant systems and pathogenicity in Xoo and Xoc. 31

IMPORTANCE 32

This study demonstrates that ankyrin protein AnkB directly interacted with catalase 33

CatB in Xanthomonas oryzae pv. oryzae and Xanthomonas oryzae pv. oryzicola. 34

Ankyrin protein AnkB can affect the gene expression of catB, catalase activity and 35

sensitivity to H2O2. In Xanthomonas spp., the location of genes ankB and catB, and 36

the amino acid sequence of AnkB are highly conserved. It’s suggested that, in 37

prokaryotes, AnkB plays a conserved role in the defense against oxidative stress. 38

INTRODUCTION 39

Rice bacterial leaf blight caused by Xanthomonas oryzae pv. oryzae (Xoo) and rice 40

bacterial leaf streak caused by Xanthomonas oryzae pv. oryzicola (Xoc) are important 41

diseases of rice worldwide (1, 2). These diseases, which can reduce yields by 75 % or 42

more (3, 4, 5), can be controlled by phenazine-1-carboxylic acid (PCA), an antibiotic 43

produced by not only Pseudomonas spp., but also plant-associated bacteria, such as 44

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Burkholderia, Pectobacterium, Brevibacterium, Streptomyces and others (6, 7, 8, 9, 45

10). In vitro anti-bacterial activity of PCA against Xoo and Xoc has been documented, 46

and PCA has recently been used to control rice bacterial leaf streak in South China 47

fields (11, 12, 13). In addition to being toxic to bacteria, PCA is also toxic to 48

eukaryotes, as it causes the accumulation of reactive oxide species (ROS). The 49

mechanism underlying the toxicity of PCA to bacteria is incompletely understood (12, 50

14). The current study concerns the involvement of an ankyrin-like protein in the 51

responses of Xoo and Xoc to PCA. 52

Ankyrins belong to the family of adaptor proteins that anchor the cytoskeleton to the 53

plasma membrane and thereby provide cellular stability in eukaryotic cells (15, 16). 54

Ankyrins, have three domains: an N-terminal membrane-binding domain, a central 55

spectrin-binding domain, and a C-terminal regulatory domain (17, 18). Ankyrins are 56

widespread in eukaryotes but are uncommon in prokaryotes (19). Most research 57

concerning ankyrins has been conducted in humans because a variety of human 58

diseases are related to the dysfunction of ankyrin proteins (20). Functional analysis 59

confirmed that ankyrins have a regulatory or structural role rather than an enzymatic 60

one (21). Ankyrins in plants are involved in defense responses to reactive oxygen 61

species (ROS) and in regulating the hypersensitive reaction (HR) (22). 62

Overexpression of the ankyrin repeat-containing protein OsBIANK1 in Arabidopsis 63

decreases ROS levels after infection by Botrytis cinerea (23). Ankyrins are also 64

necessary for regulating cell motility, adhesion, and the maintenance of specialized 65

membrane domains, ion channels, and transporters (20, 24, 25). They are also 66

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

involved in intra-cellular signaling, such as regulating the transcription factor NF-κB 67

to influence gene expression (26). Together, these studies demonstrate that ankyrins 68

have a variety of functions. 69

In bacteria, genes encoding predicted ankyrin-like proteins are often located in close 70

proximity to genes encoding proteins involved in responses to oxidative stress (27, 28, 71

29). The Cj1386 gene encoding an ankyrin-containing protein is located downstream 72

from katA (which encodes a catalase) and is involved in the same detoxification 73

pathway as catalase in Campylobacter jejuni (30). In Pseudomonas aeruginosa, the 74

ankyrin AnkB is required for the detoxification of H2O2 by catalase (KatB) (29). In 75

our previous study, CatB was the key protein for total catalase activity and reduced 76

bactericidal effects of PCA on Xoo and Xoc (31). Similarly, the gene encoding the 77

ankyrin protein AnkB is also located downstream from the gene encoding CatB 78

(catalase) in these two strains. The ankyrins and their functions in the 79

plant-pathogenic bacteria have not been characterized. In addition, there are no 80

reports concerning interactions between ankyrins and catalases in any other species. 81

Therefore, investigation is warranted to resolve whether AnkB is required for catalase 82

activity in Xoo and Xoc in response to PCA, and, if it does, whether the two proteins 83

directly interact. 84

In this study, we cloned the gene ankB, which encodes an ankyrin-like protein in Xoo 85

and Xoc, and investigated the role of AnkB when the two bacteria are under oxidative 86

stress. Our study also revealed the relationship between AnkB and CatB and the 87

functions of AnkB involved in protecting cells from PCA and regulating the virulence 88

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

of both bacteria. 89

MATERIALS AND METHODS 90

Strains, plasmids, bactericides, and media. All strains and plasmids used in this 91

study are listed in Table 1. ZJ173 and RS105, the wild-type strain of Xoo and Xoc 92

used in this study, respectively, are commonly used in China (12). Xoo and Xoc strains 93

were grown at 28°C in nutrient broth (NB) medium consisting of 1 μg/mL yeast 94

extract, 3 μg/mL beef extract, 5 μg/mL polypeptone, and 10 μg/mL sucrose. NA 95

medium contained the same components plus 12 μg/mL agar powder. Minimal (MMX) 96

medium at pH 7.0 contained 0.2 μg/mL MgSO4•7H2O, 5 μg/mL glucose, 2 μg/mL 97

(NH4)2SO4, 4 μg/mL K2HPO4, 6 μg/mL KH2PO4, and 1 μg/mL trisodium citrate. E. 98

coli strains were grown at 37°C. E. coli DH5α (Vazyme), which was used in vector 99

construction, was cultured in LB medium containing 50 μg/mL kanamycin. E. coli 100

Rosetta (TIANGEN Biotech, Beijing, China) was used in protein expression and was 101

cultured in LB medium containing 100 μg/mL ampicillin, 20 µg/ml gentamicin, and 102

50 μg/mL of kanamycin. Phenazine-1-carboxylic acid (98% PCA) was provided by 103

Shanghai Nongle Biological Products Co., Ltd. (China) and was dissolved in acetone 104

as a stock solution. 105

Determination of gene expression of ankB and catB in Xoo and Xoc. Gene 106

expression of ankB and catB in ZJ173 and RS105 was detected with real-time PCR. 107

Before doing the qRT-PCR experiment, we did a pre-experiment with a concentration 108

gradient of PCA and selected the concentration at which the gene expression changed 109

most obviously but growth was not inhibited. For ZJ173 it was 4 μg/mL and for 110

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

RS105 it was 32 μg/mL (as well as the following experiments performed in this study). 111

To perform qRT-PCR, all tested strains were grown to early logarithmic phase at an 112

OD600 of 0.2 (2×108 cfu/mL) in NB medium at 28°C with shaking at 175 rpm. A 113

25-mL culture was then treated with 100 μL of different concentrations of PCA. After 114

incubating for approximately 4 h when the OD600 ≈ 0.5 (5×108 cfu/mL), the cultures 115

were harvested by centrifugation (12,000×g for 2 min at 4°C). Total RNA was 116

extracted with the RNAprep pure cell / bacteria kit (TIANGEN Biotech, Beijing, 117

China) and reverse transcribed into cDNA with the HiScript II Q RT SuperMix for 118

qPCR (+gDNA wiper) Kit (Vazyme, Nanjing, China) according to the instruction 119

manual. qRT-PCR was conducted using SYBR qPCR Master mix (Vazyme, Nanjing, 120

China) with a CFX ConnectTM

Real-Time System (BIO-RAD, California, USA). Gene 121

expression of ankB and catB in XOO0418 (ankB), XOO0417 (catB), XOC_4324 122

(ankB), and XOC_4325 (catB) was assessed, and 16S rRNA was used as the internal 123

control. The primers are listed in Table 1. Three biological replicates were conducted 124

in this experiment, each repeated three times. 125

Generation of ankB deletion mutants in Xoo and Xoc. We used a non-marker 126

homologous recombination method (32) to generate the deletion mutants in order to 127

investigate the functions of AnkB in Xoo and Xoc. The suicide vector pk18mobsacB 128

was used in this study (33). The whole genome sequences of KACC 10331 and 129

BLS256 were used as reference sequences for ZJ173 and RS105, respectively. The 130

genomic DNAs of ZJ173 and RS105 were used as the templates to amplify the 131

upstream and downstream fragments of ankB. The primers for all upstream and 132

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

downstream fragments are listed in Table 1. ZJ173 and RS105 competent cells were 133

transformed with the recombinant plasmids listed in Table 1 using an electroporation 134

method (34), and the cells were subsequently screened on NAN plates (NA medium 135

without sucrose) containing 20 μg/mL kanamycin. Single colonies were picked and 136

added to 25 mL of NBN medium (NB medium without sucrose). After 7-9 h 137

incubation at 28°C, 120 μL of the suspension was spread on NAS plates (NA medium 138

containing 100 μg/mL sucrose). The constructs were subsequently confirmed by PCR 139

and qRT-PCR using the primers listed in Table 1. The confirmed mutants were used in 140

further studies. Complemented mutants were constructed using plasmid pUFR034. 141

The whole sequences of ankB (including predicted promoters) were amplified from 142

genomic DNA of ZJ173 and RS105 with the primers listed in Table 1. The prediction 143

of promoter sequences and electroporation methods were previously described (35). 144

Determination of growth rate in NB medium 145

All tested strains were cultured to an OD600 of 1.0 (109 cfu/mL) in NB medium at 146

28 °C with shaking at 175 rpm. Bacterial cells were then collected by centrifugation 147

(4,000 × g for 2 min) from 2 mL of culture. The cells were re-suspended in 2-mL of 148

fresh NB medium. A 2-mL volume of cell resuspension of the Xoo wild-type strain 149

ZJ173 and its ankB mutant was added to 100 mL of NB medium. A 1.2-mL volume of 150

cell resuspension of Xoc wild-type strain RS105 and its ankB mutant was added to 151

100 mL of NB medium. The cultures were then grown at 28 °C with shaking at 175 152

rpm. The OD600 values were determined using an Eppendorf BioPhotometer Plus 153

every 2 h during 12 h of incubation. 154

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Determination of catalase activity. All tested strains were cultured to an OD600 of 155

0.5 (5×108 cfu/mL) in NB medium at 28 °C with shaking at 175 rpm. Bacterial cells 156

were then collected from 2 mL of culture by centrifugation (8,000 × g for 2 min at 157

4°C), and were re-suspended in 200 μL of Western and IP Cell Lysis Liquid 158

(Beyotime, China). The supernatant was collected by centrifugation (8,000 × g for 2 159

min at 4°C) after 30 min of incubation. The protein concentrations were determined 160

with the BCA Protein Concentration Determination Kit (Beyotime, China). Total 161

catalase activities were then determined with the Catalase Test Kit (Beyotime, China). 162

Each sample was assayed three times, and three independent experiments were carried 163

out. The results were analyzed with SPSS 20.0 (independent-sample t-tests). 164

Expression and purification of proteins. The full-length of ankB and catB of Xoo 165

ZJ173 and Xoc RS105 were amplified by primers (Table S1). catB was ligated into 166

vector pGEX-2TK for GST-tagged protein expression, and ankB was ligated into 167

vector pET-28a for His-tagged protein expression. All recombinant vectors were used 168

to transform the E. coli Rosetta strain, and cells were collected by centrifugation 169

(5000 × g for 15 min at 4°C) after induction for 12-16 h in LB medium containing 0.1 170

mM IPTG. The cells were re-suspended in 15 mL of 1×extraction buffer (50 mM Tris, 171

100 mM NaCl, 1 mM EDTA, and 1 mM DTT) and were subjected to ultrasonication 172

after addition of 40 μL of lysozyme. The precipitate was removed by centrifugation 173

(10000 × g for 60 min at 4°C), and the supernatant was stored at -80°C. 174

GST pull-down assay and western blotting. The GST-labeled proteins were 175

incubated with Glutathione Sepharose beads (Beyotime, China). The proteins retained 176

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

by the Glutathione Sepharose beads were mixed with 900 μL of His6-tagged proteins. 177

Bound proteins were analyzed by SDS-PAGE and detected by western analysis using 178

a previously reported method (36). Briefly, proteins were transferred to a PVDF 179

membrane that had been soaked in methanol for 3-5 minutes. The membrane was then 180

placed in 5% skim milk for 1 h before primary anti-GST (1:8000, Sigma-Aldrich) or 181

anti-His (1:5000, Sigma-Aldrich) antibodies were added to probe the resulting blots. 182

The preparation was kept at room temperature for 90 min. Then added second 183

antibodies HRP-conjugated goat anti-rabbit (1:10000, Sigma-Aldrich) or anti-mouse 184

(1:10000, Sigma-Aldrich) and incubated at room temperature for 60 min to detect the 185

blots. Finally, the resulting blots were developed using the ECL Substrate Kit 186

(Thermo Scientific, USA). 187

Determination of H2O2 sensitivity. All tested strains were cultured to an OD600 of 1.0 188

(109 cfu/mL) in NB medium, and suspensions were diluted 3-fold and 9-fold in NB 189

medium. NA plates containing 0, 0.05, 0.1, or 0.2 mM H2O2 were also prepared. A 190

5-µL volume of the undiluted or diluted cultures was spotted onto NA plates (in 191

triplicate), and the plates were kept for 48 h at 28 °C (31). H2O2 sensitivity was 192

assessed based on colony growth. This experiment was repeated three times. 193

Determination of PCA sensitivity. All tested strains were grown to an OD600 of 1.0 194

(109 cfu/mL) at 28 °C with shaking at 175 rpm in NB medium, and the bacterial 195

suspensions were adjusted to an OD600 of 0.2 with fresh NB medium. A 120-μL 196

volume of the diluted bacterial suspension was then added to 25 mL of fresh NB 197

medium containing PCA at 0, 0.025, 0.05, 0.1, 0.2, 0.4, or 0.8 μg/mL for the Xoo 198

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

suspension or containing PCA at 0, 1, 2, 4, 8, 16, or 32 μg/mL for the Xoc suspension; 199

the final acetone concentration was 0.4% v/v in all cases. Three replicates for each 200

PCA concentration were used for each strain. Bacterial cultures were grown at 28 °C 201

with shaking at 175 rpm for 36 h for Xoo and for 24 h for Xoc. For each strain, the 202

average OD600 values were used to calculate the PCA concentration that resulted in 203

50% inhibition of bacterial cell growth (EC50). The EC50 values were calculated with 204

the Data Processing System (DPS) computer program (Hangzhou Reifeng 205

Information Technology Ltd., Hangzhou, China). Each sample was assayed three 206

times, and the experiment was repeated three times. 207

Biofilm formation, swimming ability and EPS production assays. For biofilm 208

formation, bacterial strains were grown in NB medium at 28°C with shaking at 175 209

rpm until an OD600 of 0.6 (6×108 cfu/mL) was attained. A 50-μL volume of each 210

culture was transferred to a glass tube containing 2 mL of fresh NB medium, and the 211

tubes were kept at 28°C. The cultures were removed after 5 d for Xoo and 3 d for Xoc. 212

Two mL of 1% (w/v) crystal violet was added to each tube, and the tubes were 213

incubated for 15 min at room temperature. The unbound dye was removed by washing 214

with water, and the tubes were air dried and then photographed. For quantification, 215

the bound dyes were dissolved in ethanol, and the OD590 of the samples was measured. 216

Each strain was assayed three time, and the experiment was repeated three times. 217

To assay swimming ability, bacterial strains were grown in NB medium at 28°C 218

with shaking (175 rpm) until an OD600 of 1.0 (109 cfu/mL) was attained. Cells were 219

collected by centrifugation and were re-suspended in water. A 2-µL volume of each 220

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

suspension was added to swim plates (peptone 0.3 g/L; yeast extract 0.3 g/L; agar 2.5 221

g/L) (37), and the plates were kept at 28°C. The swimming ability zone as indicated 222

by colony morphology was measured after 3 d for Xoo and after 2 d for Xoc. For EPS 223

production, a 500-µL volume of each cell suspension was added to 25-mL of fresh 224

NB medium and then cultured for 5 d at 28°C in shaking flasks (175 rpm). The 225

culture densities of all test strains were normalized because the initial concentration of 226

bacteria was equal and the growth rate in NB medium was also the same. The 227

bacterial cells were harvested by centrifugation (8000 rpm, 10 min), and a 3-fold 228

volume of 95 % ethanol was added to the supernatant. The supernatant was stored 229

overnight and then centrifuged (8000 rpm, 10 min) again (38). The pellet, which 230

consisted of EPS, was dried at 60°C to a constant weight (39). Carbohydrates were 231

not quantified in media controls since the volume of NB medium was the same 232

(25-mL) for every test strain. Each EPS assay was replicated three times, and the 233

experiments were repeated three times. 234

Pathogenicity assay. The susceptible rice cultivar IR24 was used for pathogenicity 235

assays, and was conducted in a lighted growth chamber at 25 °C. The rice cultivar 236

was inoculated with bacterial suspensions as previously described (40) with slight 237

modification. In brief, bacterial strains were incubated in NB medium at 28 °C with 238

shaking at 175 rpm until an OD600 of 1.0 (109 cfu/mL) was attained. Rice leaves (6 239

weeks old for Xoo and 8 weeks old for Xoc) were inoculated by cutting the leaves 240

with sterile scissors dipped in bacterial suspension or by piercing the leaves with 241

sterile needles dipped in bacterial suspension. Five plants and three leaves per plant 242

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

were inoculated for each strain. Lesion lengths were measured 10 d after inoculation. 243

This experiment was performed two times. 244

RESULTS 245

ankB expression is up-regulated in Xoo and Xoc by exogenous PCA. RNA-seq 246

showed that the expression of ankB was strongly increased in Xoo ZJ173 in response 247

to treatment with 4 μg/mL PCA (data not shown). The highest PCA concentration was 248

determined to be 4 μg/mL for ZJ173 and 32 μg/mL for RS105, which were the 249

amounts that didn’t slow culture growth. The qRT-PCR experiment was repeated to 250

verify the results. The results revealed that the expression of ankB in Xoo ZJ173 was 251

3.5-, 7.5-, and 11.4-fold up-regulated in response to PCA at 1, 2, and 4 μg/mL PCA, 252

respectively (Fig. 1A). Similarly, the expression of ankB in Xoc RS105 was 3.6-, 3.1- 253

and 8.1-fold up-regulated in response to PCA at 8, 16, and 32 μg/mL PCA, 254

respectively (Fig. 1B). 255

Sequence analysis, deletion, and complementation of ankB in Xoo and Xoc. ankB 256

in Xoo (XOO0418) and ankB in Xoc (XOC_4324) (gene names are according to the 257

annotations of Xoo KACC 10331 and Xoc BLS256, respectively) are previously 258

uncharacterized genes that encode ankyrin-like proteins. The ankB nucleotide 259

sequences in these two strains are 576 bp long and encode 191 amino acids, which 260

include ankyrin repeats. ankB is located 58 bp downstream of catB (which encodes a 261

catalase) in both strains (Fig. 1C) (http://www.genome.jp/kegg/). According to NCBI 262

database, the sequence from 69 bp to 175 bp of ankB of Xoo KACC 10331 is an ANK 263

superfamily domain. The link is as follows: 264

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

(https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi?INPUT_TYPE=precalc&SE265

QUENCE=58424635). By analyzing the sequence alignment in ANK superfamily 266

domains, we found that the ankyrin repeat domains are highly conserved in 267

Xanthomonas (Fig. 1D). 268

To investigate the role of ankB in Xoo and Xoc, we generated targeted deletion 269

mutants of ZJ173 and RS105 by a non-marker homologous recombination method. 270

Deletion strains ΔZ/ankB of Xoo ZJ173 and ΔR/ankB of Xoc RS105 were verified by 271

PCR using ZankB-1F/2R and RankB-1F/2R primers in Table 1, respectively. 272

qRT-PCR analysis showed that ankB expression was absent in the deletion mutants 273

(Fig. 2). The ΔZ/ankB mutant and the ΔR/ankB mutant were complemented with 274

plasmids pUFRZCB and pUFRRCB, which are derivatives of pUFR034 carrying the 275

open reading frames of ankB and their predicted promoters in ZJ173 or RS105, 276

respectively. The promoters were 123 bp upstream of the start codon of the ankB 277

coding sequence in both Xoo and Xoc. Complementation of the mutants was 278

confirmed by PCR (Fig. S1C). 279

ankB is necessary for expression of catB and for total catalase activity in Xoo and 280

Xoc under no stress or PCA-stress. To investigate the importance of ankB in 281

affecting expression of the catalase gene catB, we analyzed the expression of catB in 282

the ankB deletion mutants. The gene expression of catB in Xoo and Xoc was 283

significantly reduced in ΔZ/ankB and ΔR/ankB but was restored in the complemented 284

strains (Fig. 2A, B). In addition, catalase activity was significantly lower in ΔZ/ankB 285

when compared to the wild-type strain ZJ173 (Fig. 2C). Catalase activity was also 286

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

significantly lower in ΔR/ankB compared to the wild-type strain RS105 (Fig. 2D). As 287

expected, catalase activities did not significantly differ between the complemented 288

mutants ΔZ/ankB (ankB) and ΔR/ankB (ankB) and their corresponding wild-type 289

strains. 290

To further confirm that AnkB affects CatB activity, qRT-PCR was used to 291

investigate the expression of catB in response to PCA-stress in ankB deletion mutants 292

of Xoo and Xoc. The results demonstrated that the gene expression of catB was 293

significantly induced after treatment with PCA at 4μg/mL for Xoo and at 32μg/mL for 294

Xoc (Fig. 3A,B). However, the up-regulation of catB was much lower in the deletion 295

mutants ΔZ/ankB and ΔR/ankB than in the wild-type strains (Fig. 3B). Catalase 296

activities in ΔZ/ankB and ΔR/ankB were also significantly reduced by PCA (Fig. 3C). 297

AnkB directly interacts with CatB and enhances the resistance of Xoo and Xoc to 298

H2O2 and PCA. Having established that AnkB likely functions as an interacting 299

protein of CatB, we then used GST pull-down to verify our speculation. AnkB-His 300

was detected when CatB-GST was present in the mixture in both Xoo and Xoc, 301

indicating that AnkB can directly interact with CatB in vitro (Fig. 4A). 302

To further investigate the role of ankB in the detoxification of exogenous ROS, a 303

H2O2 growth-inhibition assay was carried out with ΔZ/ankB and ΔR/ankB. As 304

expected, ΔZ/ankB and ΔR/ankB were more susceptible to H2O2 than their wild-type 305

strains (Fig. 4B). Susceptibility to H2O2 did not significantly differ, however, between 306

the complemented strains and wild-type strains. In a PCA growth-inhibition assay, we 307

found that the sensitivity to PCA was much higher in ΔZ/ankB and ΔR/ankB than in 308

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

the wild-type strains and complemented strains (Table 2). 309

ankB is essential for Xoo and Xoc biofilm formation, swimming motility, EPS 310

production and virulence on rice. Since ankyrin protein AnkB was related to 311

oxidative stress which influenced most of biological processes of cells, we evaluated 312

the roles of AnkB in biofilm formation, swimming motility, EPS production and 313

virulence on rice. A biofilm formation assay showed that the mass of biofilm formed 314

was 55% lower for the ΔZ/ankB and ΔZ/catB strains than for the wild-type strain 315

ZJ173. Similarly, biofilm formation was significantly lower for strains ΔR/ankB and 316

ΔR/catB than for the wild-type strain RS105 (Fig. 5A). In the swimming ability assay, 317

strains ΔZ/ankB and ΔZ/catB formed a smaller colony with a less diffuse surface than 318

the wild-type strain ZJ173 on the semi-solid NA plate. Colony diameter and 319

morphology also indicated that the ability to swim was reduced for strain ΔR/ankB 320

and ΔR/catB relative to the wild-type strain RS105 (Fig. 5B). In the EPS production 321

assay, strains ΔZ/ankB and ΔZ/catB produced a lower amount of EPS (1.09 and 0.67 322

mg/mL, respectively) than the wild-type strain ZJ173 (1.75 mg/mL) in NB medium. 323

EPS production also decreased in strains ΔR/ankB and ΔR/catB (0.53 and 0.46 mg/mL, 324

respectively) compared with the wild-type strain RS105 (1.30 mg/mL) (Fig. 5C). 325

These decreases in biofilm formation, swimming motility, and EPS production were 326

all rescued in the complemented strains ΔZ/ankB (ankB) and ΔR/ankB (ankB) (Fig. 5) 327

To assess the importance of ankB for Xoo and Xoc virulence on rice, we inoculated 328

the susceptible rice cultivar IR24 with Xoo ZJ173, ΔZ/ankB, ΔZ/ankB/ (ankB), Xoc 329

RS105, ΔR/ankB, and ΔR/ankB/ (ankB). Lesion length was much shorter for strains 330

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

ΔZ/ankB and ΔR/ankB (1.8 ± 0.4 and 1.3 ± 0.2 cm) than for strains ZJ173 and RS105 331

(5.5 ± 0.4 and 4.3 ± 0.3 cm), respectively (Fig. 6). Lesion length was more than 90% 332

restored in the ankB complemented strains. 333

Discussion 334

Previous studies demonstrated that ankyrins have essential regulatory and structural 335

functions in eukaryotes and viruses (20, 41, 42, 43, 44). However, the functions of 336

ankyrins are largely unknown in prokaryotes. Our study revealed that ankB encoding 337

an ankyrin AnkB in Xoo and Xoc affects the gene expression of catB and catalase 338

activity. Moreover, AnkB directly interacts with CatB and enhances resistance to 339

H2O2 and PCA. Our study also revealed that AnkB participates in Xoo and Xoc 340

biofilm formation, swimming ability, EPS production and pathogenicity. 341

Earlier studies revealed that PCA functions as a redox-active compound that generates 342

ROS not only in Xoo, but also in Vibrio anguillarum and Phellinus noxius (12, 31, 45, 343

46, 47, 48). The enhanced ROS production can lead to altered electrical charge and to 344

DNA or membrane damage in cells (49, 50). Catalase is one of the most important 345

enzymatic mechanisms to detoxify excessive levels of ROS (51). We previously 346

reported that the expression of the catalase encoding genes catB and katE in Xoo and 347

Xoc increased dramatically in response to PCA treatment (31). In this study, the gene 348

expression of ankB in Xoo and Xoc was also significantly increased when bacteria 349

were treated with PCA, indicating that the protein encoded by ankB (AnkB) may be 350

important for bacterial resistance to PCA (Fig. 1A, B). In Pseudomonas aeruginosa, 351

AnkB stabilizes KatB, and the location of ankB is 57 bp downstream of katB. 352

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Intriguingly, that location of these genes is similar (ankB is 58 bp downstream of catB) 353

in Xoo and Xoc, suggesting that ankyrin protein AnkB is closely linked to catalase 354

CatB in Xoo and Xoc. The alignment analysis showed that the amino acid sequence of 355

the ANK superfamily is highly conserved in Xanthomonas spp. (Fig. 1D), suggesting 356

that the function of ankyrins is relatively conserved. 357

The growth rate experiment showed that the growth rates of the deletion mutants did 358

not differ from those of the wild-type strains in NB medium (Fig. 1E). Therefore, we 359

used the NB medium in the experiments to sure that the differences exhibited by the 360

ankB deletion mutants were not caused by growth defects. We found that catB gene 361

expression and catalase activities were significantly decreased in the ankB deletion 362

mutants of Xoo and Xoc (Fig. 2), indicating that ankyrin protein AnkB is important for 363

gene expression of catB and for catalase activity in Xoo and Xoc. In line with our 364

findings and as noted earlier, AnkB is required for catalase (KatB) activity in 365

Pseudomonas aeruginosa (29). Furthermore, the expression of catB in ankB deletion 366

mutants of Xoo and Xoc was partly activated in response to PCA, and catalase 367

activities in both deletion mutants were significantly inhibited by PCA (Fig. 3). 368

Combined with a previous report that PCA acts as a redox-active compound and leads 369

to ROS accumulation in Xoo (12), the current results further demonstrate that ankyrin 370

protein AnkB alters catalase function under oxidative stress. In view of these results, 371

we hypothesized that AnkB interacts with CatB to ensure full catalase activity in 372

response to PCA. Consistent with our hypothesis, a GST pull-down assay showed that 373

AnkB directly interacts with CatB in Xoo and Xoc (Fig. 4A). Because CatB helped 374

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

protect Xoo and Xoc under H2O2 and PCA stress (52), we investigated the 375

anti-oxidation activity in the ankB deletion mutants of Xoo and Xoc under H2O2 and 376

PCA stress. We found that the ankB deletion mutants were more sensitive to H2O2 and 377

PCA than the wild-type strains (Fig. 4B, Table. 2), indicating that AnkB is essential 378

for protecting Xoo and Xoc against H2O2 and PCA. These results further suggested 379

that catalase protection of cells against oxidizing agents in Xoo and Xoc partly 380

depends on ankyrin protein AnkB. 381

Recent studies found that oxidative stress in Campylobacter jejuni and KatG (catalase) 382

in Xanthomonas citri subsp. citri are important in biofilm formation (53, 54). In 383

antioxidase ahpC mutant of Vibrio parahaemolyticus, the ability to swim in a 384

semi-solid medium was decreased (55). It also was reported that EPS had an 385

important role in protecting cells against ROS in plant-pathogenic bacteria (56). 386

Consistent with these previous studies, our results clearly indicated that catalase and 387

ankyrin protein are necessary for biofilm formation, swimming ability and EPS 388

production by Xoo and Xoc because these phenotypes were reduced in catB and ankB 389

gene deletion mutants of Xoo ZJ173 and Xoc RS105 (Fig. 5). Many studies showed 390

that ROS and their detoxifying enzymes are involved in plant defense (57, 58, 59, 60). 391

Catalases were required for plant pathogenesis in Pseudomonas syringae and 392

Xanthomonas campestris pv. campestris (61, 62). In our study, virulence was lower 393

for strains ΔZ/ankB and ΔR/ankB than for their wild-type strains (Fig. 7). Given that 394

catB deletion mutants of Xoo and Xoc had reduced virulence (31, 52), we speculate 395

that the reduced catalase activity in ankB deletion mutants reduces the ability of the 396

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

bacteria to detoxify ROS and therefore reduces virulence. Although the results have 397

revealed that catB and ankB are involved in biofilm formation, swimming ability, EPS 398

production and pathogenicity, the phenotypes were less severe for the ankB mutants 399

than for the catB mutants. This may be attributed to the possibility that the ankyrin 400

AnkB only indirectly affects physiological functions by affecting the function of 401

catalase CatB. 402

In summary, our study demonstrates a direct interaction between the ankyrin AnkB 403

and the catalase CatB. It further provides evidence that deletion of ankB results in 404

lower gene expression of catB and catalase activity, which in turn increases PCA 405

sensitivity in Xoo and Xoc. AnkB is also important for biofilm formation, swimming 406

ability, EPS production and virulence in Xoo and Xoc. 407

408

FUNDING INFORMATION 409

This research was supported by the Special Fund for Agro-scientific Research in the 410

Public Interest (201303023) and a grant (no. 2013-6) from the Innovation Team 411

Program for Jiangsu Universities. 412

413

REFERENCES 414

1. Ou SH. 1984. Exploring tropical rice diseases: a reminiscence. Annu. Rev. Phytopathol. 22: 1-11. 415

2. Nino-Liu DO, Ronald PC, Bogdanove AJ. 2006. Xanthomonas oryzae pathovars: model pathogens 416

of a model crop. Mol Plant Pathol 7: 303-324. 417

3. Xie G, Sun S, Chen J, Zhu X, Chen J, Ye Y, Feng Z, Liang, M. 1990. Studies on rice seed 418

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

inspection of Xanthomonas campestris pv. oryzicola: immunoradiometric assay. Chinese J 419

Rice Sci 4: 127–132. 420

4. Reddy APK, Mackenzie DR, Rouse DI, Rao AV. 1979. Relationship of bacterial leaf 421

blight severity to grain yield of rice. Phytopathology 69: 967–969. 422

5. Salzberg SL, Sommer DD, Schatz MC, Phillippy AM, Rabinowicz PD, Tsuge S, Furutani A, 423

Ochiai H, Delcher AL, Kelley D, Madupu R, Puiu D, Radune D, Shumway M, Trapnell C, 424

Aparna G, Jha G, Pandey A, Patil PB, Ishihara H, Meyer DF, Szurek B, Verdier V, 425

Koebnik R, Dow JM, Ryan RP, Hirata H, Tsuyumu S, WonLee S, Seo YS, Sriariyanum 426

M, Ronald PC, Sonti RV, VanSluys MA, Leach JE, White FF, Bogdanove AJ. 2008. 427

Genome sequence and rapid evolution of the rice pathogen Xanthomonas oryzae pv. oryzae 428

PXO99A. BMC Genomics 9: doi: 10.1186/1471-2164-9-204. 429

6. Jaaffar AKM, Parejko JA, Paulitz TC, Weller DM, Thomashow LS. 2017. Sensitivity of 430

Rhizoctonia isolates to phenazine-1-carboxylic acid and biological control by 431

phenazine-producing Pseudomonas spp. Phytopathology 107: 692-703. 432

7. Sun S, Chen B, Jin ZJ, Zhou L, Fang YL, Thawai C, Rampioni G, He YW. 2017. 433

Characterization of the multiple molecular mechanisms underlying RsaL control of 434

phenazine-1-carboxylic acid biosynthesis in the rhizosphere bacterium Pseudomonas 435

aeruginosa PA1201. Mol Microbiol 104: 931-947. 436

8. Thomashow LS, Weller DM, Bonsall RF, Pierson LS. 1990. Production of the antibiotic 437

phenazine-1-carboxylic Acid by fluorescent Pseudomonas species in the rhizosphere of wheat. 438

Appl Environ Microb 56: 908-912. 439

9. Mavrodi DV, Peever TL, Mavrodi OV, Parejko JA, Raaijmakers JM, Lemanceau P, Mazurier 440

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

S, Heide L, Blankenfeldt W, Weller DM, Thomashow LS. 2010 Diversity and evolution of 441

the phenazine biosynthesis pathway. Appl Environ Microb 76: 866-879. 442

10. Saleh O, Gust B, Boll B, Fiedler HP, HeideL. 2009 Aromatic prenylation in phenazine 443

biosynthesis: dihydrophenazine-1-carboxylate dimethylallyltransferase from Streptomyces 444

anulatus. Journal Of Biological Chemistry 284: 14439-14447. 445

11. Du X, Li Y, Zhou Q, Xu Y. 2015. Regulation of gene expression in Pseudomonas aeruginosa M18 446

by phenazine-1-carboxylic acid. Appl Microbiol Biot 99: 813-825. 447

12. Xu S, Pan XY, Luo JY, Wu J, Zhou ZH, Liang XY, He YW, Zhou MG. 2015. Effects of 448

phenazine-1-carboxylic acid on the biology of the plant-pathogenic bacterium Xanthomonas 449

oryzae pv. oryzae. Pestic Biochem Phys 117: 39-46. 450

13. Zhou LH, Han Y, Yang J, Li M, Ji GH. 2014. The sensitive baseline of Xanthomonas oxyzae pv. 451

oryzicola in southwest China to pheazino-1-carboxylic acid and zinc thiazole. J Anhui Univ 452

38: 97-102. 453

14. Wang Y, Newman, DK. 2008. Redox reactions of phenazine antibiotics with ferric (hydr) oxides 454

and molecular oxygen. Environ Sci Technol 42: 2380-2386. 455

15. Peters LL, John KM, Lu FM, Eicher EM, Higgins A, Yialamas M, Turtzo LC, Otsuka AJ, 456

Lux SE. 1995. Ank3 (epithelial ankyrin), a widely distributed new member of the ankyrin 457

gene family and the major ankyrin in kidney, is expressed in alternatively spliced forms, 458

including forms that lack the repeat domain. J Cell Biol 130: 313-330. 459

16. Lambert S, Bennett V. 1993. From anemia to cerebellar dysfunction. A review of the ankyrin gene 460

family. FEBS J 211: 1-6. 461

17. Bennett V. 1992. Ankyrins. Adaptors between diverse plasma membrane proteins and the 462

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

cytoplasm. J Biol Chem 267: 8703-8706. 463

18. Kordeli E, Lambert S, Bennett V. 1995. AnkyrinG. A new ankyrin gene with neural-specific 464

isoforms localized at the axonal initial segment and node of Ranvier. J Biol Chem 270: 465

2352-2359. 466

19. Herbert MH, Squire CJ, Mercer AA. 2015. Poxviral ankyrin proteins. Viruses-Basel 7: 709-738. 467

20. Cunha SR, Mohler PJ. 2009. Ankyrin protein networks in membrane formation and stabilization. 468

J Cell Mol Med 13: 4364-4376. 469

21. Li J, Mahajan A, Tsai MD. 2006. Ankyrin repeat: a unique motif mediating protein-protein 470

interactions. Biochemistry 45: 15168-15178. 471

22. Vo KTX, Kim CY, Chandran AKN, Jung KH, An G, Jeon JS. 2015. Molecular insights into the 472

function of ankyrin proteins in plants. J Plant Biol 58: 271-284. 473

23. Li DY, Wang FR, Liu B, Zhang YF, Huang L, Zhang HJ, Song FM. 2013. Ectopic expression of 474

rice OsBIANK1, encoding an ankyrin repeat-containing protein, in Arabidopsis confers 475

enhanced disease resistance to Botrytis cinerea and Pseudomonas syringae. J Phytopathol 161: 476

27-34. 477

24. De-Matteis MA, Morrow JS. 1998. The role of ankyrin and spectrin in membrane transport and 478

domain formation. Curr Opin Cell Biol 10: 542-549. 479

25. Wang T, Abou-Ouf H, Hegazy SA, Alshalalfa M, Stoletov K, Lewis J, Donnelly B, Bisar TA. 480

2016. Ankyrin G expression is associated with androgen receptor stability, invasiveness, and 481

lethal outcome in prostate cancer patients. J Mol Med 94: 1411-1422. 482

26. Huxford T, Ghosh G. 2009. A structural guide to proteins of the NF-kappaB signaling module. 483

CSH Perspect Biol 1: a000075. 484

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

27. Dolata MM, Van-Beeumen JJ, Ambler RP, Meyer TE, Cusanovich MA. 1993. Nucleotide 485

sequence of the heme subunit of flavocytochrome c from the purple phototrophic bacterium, 486

Chromatium vinosum. J Biol Chem 268: 14426-14431. 487

28. Klotz MG, Anderson AJ. 1995. Sequence of a gene encoding periplasmic Pseudomonas syringae 488

ankyrin. Gene 164: 187-188. 489

29. Howell ML, Alsabbagh E, Ma JF, Ochsner UA, Klotz MG, Beveridge TJ, Blumenthal KM, 490

Niederhoffer EC, Morris RE, Needham D, Dean GE, Wani MA, Hassett DJ. 2000. AnkB, 491

a periplasmic ankyrin-like protein in Pseudomonas aeruginosa, is required for optimal 492

catalase B (KatB) activity and resistance to hydrogen peroxide. J Bacteriol 182: 4545-4556. 493

30. Flint A, Sun YQ, Stintzi A. 2012. Cj1386 is an ankyrin-containing protein involved in heme 494

trafficking to catalase in Campylobacter jejuni. J Bacteriol 194: 334-345. 495

31. Pan XY, Wu J, Xu S, Duan YB, Zhou MG. 2017. CatB is critical for total catalase activity and 496

reduces bactericidal effects of phenazine-1-carboxylic acid on Xanthomonas oryzae pv. oryzae 497

and X. oryzae pv. oryzicola. Phytopathology 107: 163-172. 498

32. Zhao YC, Qian GL, Yin FQ, Fan JQ, Zhai ZW, Liu CH, Hu BS, Liu FQ. 2011. Proteomic 499

analysis of the regulatory function of DSF-dependent quorum sensing in Xanthomonas oryzae 500

pv. oryzicola. Microb Pathogenesis 50: 48-55. 501

33. Schäfer A, Tauch A, Jäger W, Kalinoski J, Thierbach G, Pühler A. 1994. Small mobilizable 502

multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: 503

selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 504

145:69–73. 505

34. Yu XY, Liang XY, Liu KX, Dong WX, Wang JX, Zhou MG. 2015. The thiG gene is required for 506

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

full virulence of Xanthomonas oryzae pv. oryzae by preventing cell aggregation. PloS One 10: 507

e0134237. 508

35. Qian GL, Liu CH, Wu GC, Yin FQ, Zhao YC, Zhou YJ, Zhang YB, Song ZW, Fan JQ, Hu BS, 509

Liu FQ. 2013. AsnB, regulated by diffusible signal factor and global regulator Clp, is 510

involved in aspartate metabolism, resistance to oxidative stress and virulence in Xanthomonas 511

oryzae pv. oryzicola. Mol Plant Pathol 14: 145-157. 512

36. Zhu M, Jiang L, Bai BH, Zhao WY, Chen XJ, Li J, Liu Y, Chen ZQ, Wang BT, Wang CL, Wu 513

Q, Shen QH, Dinesh-Kumar, SP, Tao XR. 2017. The Intracellular Immune Receptor Sw-5b 514

Confers Broad-spectrum Resistance to Tospoviruses through Recognition of a Conserved 515

21-amino-acid Viral Effector Epitope. Plant Cell. 29: doi:10.1105/tpc.17.00180. 516

37. González JF, Myers MP, Venturi V. 2013. The inter-kingdom solo OryR regulator of 517

Xanthomonas oryzae is important for motility. Mol Plant Pathol, 14: 211-221. 518

38. Sunish Kumar R, Sakthivel N. 2001. Exopolysaccharides of Xanthomonas pathovar strains that 519

infect rice and wheat crops. Appl Microbio Bio, 55: 782-786. 520

39. Yang F, Tian F, Li X, Fan S, Chen H, Wu M, Yang CH, He, CY. 2014. The degenerate 521

EAL-GGDEF domain protein Filp functions as a cyclic di-GMP receptor and specifically 522

interacts with the PilZ-domain protein PXO_02715 to regulate virulence in Xanthomonas 523

oryzae pv. oryzae. Mol Plant Microbe In, 27: 578-589. 524

40. Yang B, Bogdanove A. 2013. Inoculation and virulence assay for bacterial blight and bacterial leaf 525

streak of rice. Methods Mol Biol 956: 249-55. 526

41. Mosavi LK, Cammett TJ, Desrosiers DC, Peng ZY. 2004. The ankyrin repeat as molecular 527

architecture for protein recognition. Protein Sci 13: 1435-1448. 528

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

42. Gaudet R. 2008. A primer on ankyrin repeat function in TRP channels and beyond. Mol Biosyst 4: 529

372-379. 530

43. Chen DY, Fabrizio JA, Wilkins SE, Dave KA, Gorman JJ, Gleadle JM, Fleming SM, Peet DJ, 531

Mercer AA. 2017. Ankyrin repeat proteins of orf virus influence the cellular hypoxia response 532

pathway. J Virol 91: e01430-16. 533

44. Li Y, Meng X, Xiang Y, Deng J. 2010. Structure function studies of vaccinia virus host range 534

protein k1 reveal a novel functional surface for ankyrin repeat proteins. J Virol 84: 3331-3338. 535

45. Thomashow LS, Weller DM, Bonsall RF, Pierson LS. 1990. Production of the antibiotic 536

phenazine-1-carboxylic acid by fluorescent pseudomonas species in the rhizosphere of wheat. 537

Appl Environ Microb 56: 908-912. 538

46. Charyulu EM, Sekaran G, Rajakumar GS, Gnanamani A. 2009. Antimicrobial activity of 539

secondary metabolite from marine isolate, Pseudomonas sp. against Gram positive and 540

negative bacteria including MRSA. Indian J Exp Biol 47: 964-968. 541

47. Zhang L, Tian X, Kuang S, Liu G, Zhang C, Sun C. 2017. Antagonistic activity and mode of 542

action of phenazine-1-carboxylic acid, produced by marine bacterium Pseudomonas 543

aeruginosa PA31x, against Vibrio anguillarum in vitro and in a zebrafish in vivo Model. Front 544

Microbiol 8: 289. 545

48. Huang H, Sun L, Bi K, Zhong G, Hu M. 2016. The effect of phenazine-1-carboxylic acid on the 546

morphological, physiological, and molecular characteristics of Phellinus noxius. Molecules 21: 547

doi:10.3390/molecules21050613. 548

49. Yakes FM, Van-Houten B. 1997. Mitochondrial DNA damage is more extensive and persists 549

longer than nuclear DNA damage in human cells following oxidative stress. P Natl Acade Sci 550

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

U S A 94: 514-519. 551

50. Mittler R. 2002. Oxidative stress, antioxidants and stress tolerance. Trends plant sci 7: 405-410. 552

51. Blokhina O, Virolainen E, Fagerstedt KV. 2003. Antioxidants, oxidative damage and oxygen 553

deprivation stress: a review. Ann Bot-london 91: 179-194. 554

52. Yu C, Wang N, Wu M, Tian F, Chen H, Yang F, Yuan X, Yang CH, He CY. 2016. 555

OxyR-regulated catalase CatB promotes the virulence in rice via detoxifying hydrogen 556

peroxide in Xanthomonas oryzae pv. oryzae. BMC Microbiol 16: 269. 557

53. Oh E, Kim JC, Jeon B. 2016. Stimulation of biofilm formation by oxidative stress in 558

Campylobacter jejuni under aerobic conditions. Virulence 7: 846-851. 559

54. Tondo ML, Delprato ML, Kraiselburd I, Fernández-Zenoff MV, Farías ME, Orellano EG. 560

2016. KatG, the bifunctional catalase of Xanthomonas citri subsp. citri, responds to hydrogen 561

peroxide and contributes to epiphytic survival on citrus leaves. PloS One 11: e0151657. 562

55. Wang HW, Chung CH, Ma TY, Wong HC. 2013. Roles of alkyl hydroperoxide reductase subunit 563

C (AhpC) in viable but nonculturable Vibrio parahaemolyticus. Appl Environ Microb 79: 564

3734-3743. 565

56. Kiraly Z, ElZahaby HM, Klement Z. 1997. Role of extracellular polysaccharide (EPS) slime of 566

plant pathogenic bacteria in protecting cells to reactive oxygen species. J Phytopathol 145: 567

59-68. 568

57. Zhang J, Zhou JM. 2010. Plant immunity triggered by microbial molecular signatures. Mol Plant 569

3: 783-793. 570

58. Augusto AC, Miguel F, Mendonca S, Pedrazzoli JJ, Gurgueira SA. 2007. Oxidative stress 571

expression status associated to Helicobacter pylori virulence in gastric diseases. Clin Biochem 572

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

40: 615-622. 573

59. Giménez-Ibánez S, Hann DR, Ntoukakis V, Petutschnig E, Lipka V, Rathjen JP. 2009. 574

AvrPtoB targets the LysM receptor kinase CERK1 to promote bacterial virulence on plants. 575

Curr Biol 19: 423-429. 576

60. Ding M, Kwok LY, Schluter D, Clayton C, Soldati D. 2004. The antioxidant systems in 577

Toxoplasma gondii and the role of cytosolic catalase in defence against oxidative injury. Mol 578

Microbiol 51: 47-61. 579

61. Guo M, Block A, Bryan CD, Becker DF, Alfano JR. 2012. Pseudomonas syringae catalases are 580

collectively required for plant pathogenesis. J Bacteriol 194: 5054-5064. 581

62. Jittawuttipoka T, Buranajitpakorn S, Vattanaviboon P, Mongkolsuk S. 2009. The 582

catalase-peroxidase KatG is required for virulence of Xanthomonas campestris pv. campestris 583

in a host plant by providing protection against low levels of H2O2. J Bacteriol 191: 7372-7377. 584

585

Table 1. Strains, plasmids, and primers used in this study. 586

Strains, Plasmids, and

primers

Characteristics Source

Strains

Escherichia coli DH5α φ80 lacZ△M15, △(lacZYA-argF)U169. recA1 Vazyme, Nanjing, China

ZJ173 RifR, wild-type strain of Xanthomonas oryzae pv. oryzae Xu et al. (2015)

ΔZ/ankB RifR, deletion of ankB in wild-type strain ZJ173 This study

ΔZ/ankB(ankB) RifR, KmR, complemented strain of ΔZ/ankB This study

ΔZ/catB RifR, deletion of catB in wild-type strain ZJ173 Pan et al. (2017)

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

ΔZ/catB(catB) RifR, KmR, complemented strain of ΔZ/catkB Pan et al. (2017)

RS105 RifR, wild-type strain of Xanthomonas oryzae pv. oryzicola Xu et al. (2015)

ΔR/ankB RifR, deletion of ankB in wild-type strain RS105 This study

ΔR/ankB(ankB) RifR, KmR, complemented strain of ΔR/ankB This study

ΔR/catB RifR, deletion of catB in wild-type strain RS105 Pan et al. (2017)

ΔR/catB(catB) RifR, KmR, complemented strain of ΔR/ankB Pan et al. (2017)

Plasmids

pK18mobsacB KmR, allelic exchange suicide vector, sacB oriT(RP4) Schäfer et al. (1994)

pK18ZAB KmR, a 1839-bp fusion fragment of ZankB-1, ZankB-2gene ligated in pK18mobsacB This study

pK18RAB KmR, a 1796-bp fusion fragment of RankB-1, RankB-2gene ligated in pK18mobsacB This study

pUFR034 lncW, NmR, KmR, Mob+, Mob(p), lacZ alpa, PK2 replicon, cosmid Yu et al. (2015)

pUFRZCB KmR, a 755-bp fusion fragment of ZankB-H gene in ZJ173 ligated in pUFR034 This study

pUFRRCB KmR, a 755-bp fusion fragment of RankB-H gene in RS105 ligated in pUFR034 This study

pGEX-2TK AmpR, CmR, Tac, expression of GST fusion protein Kamitani et al. (1997)

pGEX-ZcatB KmR, a 1524-bp fusion fragment of ZcatB gene in ZJ173 ligated in pGEX-2TK This study

pGEX-RcatB KmR, a 1524-bp fusion fragment of RankB gene in RS105 ligated in pGEX-2TK This study

pET-28a KmR, T7, expression of His6 fusion protein Stockinger et al. (1997)

pET-ZcatB KmR, a 576-bp fusion fragment of ZankB gene in ZJ173 ligated in pET-28a This study

pET-RcatB KmR, a 576-bp fusion fragment of RankB gene in RS105 ligated in pET-28a This study

Primers

ZankB-1F 5′- CGGGATCCAAGAATCTCGATCCCAAAC -3′ This study

ZankB-1R 5′- CGGAATTCAGACAGGCTGCCAAGC-3′ This study

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

ZankB-2F 5′- CGGAATTCGCATGCTGCTCTTGCTTG -3′ This study

ZankB-2R 5′- GCTCTAGAGGGTTACGGACACCCACA-3′ This study

RankB-1F 5′- CGGGATCCGAATCTCGATCCCAAACA-3′ This study

RankB-1R 5′- CGGAATTCGAATCTCCCGGACTCAA-3′ This study

RankB-2F 5′- CGGAATTCGCATGCTGCTCTTGCTTG-3′ This study

RankB-2R 5′- GCTCTAGAGGTTACGGACACCCACA-3′ This study

Z/RankBH-F 5′- GGGGTACCAAGCAAGCACCGGATGCT -3′ This study

Z/RankBH-R 5′- CGGGATCCTCAGCGCGCCGGGGCGGT -3′ This study

GST-Z/RcatB-F 5′- CGGGATCCATGCGCCCTGGATCTCTC -3′ This study

GST-Z/RcatB-R 5′- TCCCCCGGGTCAGTCCTGCAGGCTGGA -3′ This study

His-Z/RankB-F 5′- CGGGATCCATGCGCACCCTCTTGTTT -3′ This study

His-Z/RankB-R 5′- CCGCTCGAGTCAGCGCGCCGGGGCGGT -3′ This study

Z16S rRNA-F 5′-GGCGAGCACAATGGCATT-3′ Xu et al. (2011)

Z16S rRNA-R 5′-CCATCCTTCTGCGGGATGT-3′ Xu et al. (2011)

R16S rRNA-F 5′-AATGGGCGCAAGCCTGATC-3′ Zhao et al. (2011)

R16S rRNA-R 5′-AACCACCACCTACGCACGC-3′ Zhao et al. (2011)

qZcatB-F 5′-CGCCCAATCCGTTCTGA-3′ Pan et al. (2017)

qZcatB-R 5′-CGGTGAACTCGCCTTTGA-3′ Pan et al. (2017)

qZankB-F 5′-GTGAAGGTCGCCAAGACAT-3′ This study

qZankB-R 5′-CCAGGATCAACGCGGTATAG-3′ This study

qRcatB-F 5′-CAGGGCCGTATCTTCTCTTATG-3′ Pan et al. (2017)

qRcatB-R 5′-ATCCTGGTTGCCGTTGTT-3′ Pan et al. (2017)

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

qRankB-F 5′-CACACCCGAGCAGATCAAG-3′ This study

qRankB-R 5′-CGTAGTGCGAGCGAATGAA-3′ This study

587

Table 2. Sensitivity of Xanthomonas oryzae pv. oryzae and Xanthomonas oryzae pv. 588

oryzicola strains to phenazine-1-carboxylic acidA. 589

Strain EC50 (μg/ml)

ZJ173 0.18±0.016 a

ΔZ/ankB 0.132±0.0349 b

ΔZ/ankB/(ankB) 0.162±0.0158 a

RS105 13.11±0.19 a

ΔR/ankB 7.89±1.32 b

ΔR/ankB/(ankB) 11.032±1.111 a

AValues are means + SE of three experiments. Means followed by the same letter are 590

not significantly different (P > 0.05). 591

592

Fig. 1 For A) and B), relative expression levels of ankB in Xanthomonas oryzae pv. 593

oryzae (strain ZJ173) and Xanthomonas oryzae pv. oryzicola (strain RS105) when 594

stimulated with PCA by RT-PCR. The tested strains were grown in NB medium to an 595

OD600 of 0.2, and PCA was added to a final concentration of 1, 2, and 4 μg/mL for 596

ZJ173, and to final concentration of 8, 16, and 32 μg/mL for RS105. The amount of 597

RNA in acetone was used as the control and was set at 1.0. Values are means ± SD 598

from three technical replicates. Similar results were obtained from three biological 599

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

replicates. * P value <0.05 (Student’s t-test). For C), GenBank number is given 600

according to KEGG. The red line represents the locations of primers in real-time 601

RT-PCR. “→” represents the forward primer and “←” represents reverse primer of 602

qRT-PCR. The arrows in purple and blue represent the starting and end positions of 603

deletion of ankB, respectively. For D) the strains were Xanthomonas oryzae pv. 604

oryzae (strain KACC 10331), Xanthomonas oryzae pv. oryzicola (strain BLS256), 605

Xanthomonas axonopodis pv. vasculorum, Xanthomonas citri pv. citri (strain 306), 606

Xanthomonas campestris pv. campestris (strain ATCC 33913), Xanthomonas 607

campestris pv. raphani (strain 756C) and Xanthomonas citri subsp. citri (strain 608

MN11). Amino acid sites that differ are in colored font on a white background. For E) 609

growth rate of wild-type strains, ankB deletion mutants, and their complemented 610

mutants of Xanthomonas oryzae pv. oryzae ZJ173 and Xanthomonas oryzae pv. 611

oryzicola RS105 in a nutrient-rich medium (NB) as indicated by OD600 (optical 612

density at 600 nm). 613

Fig. 2 Gene expression of ankB and catB in A) Xanthomonas oryzae pv. oryzae ZJ173 614

and B) Xanthomonas oryzae pv. oryzicola RS015 and their ankB deletion and 615

complemented mutants, and C and D) their total catalase activity. The tested strains 616

were grown in NB medium. For A and B), gene expression was detected by real-time 617

RT-PCR. Relative mRNA levels of ankB and catB in ZJ173 and RS105 were set at 1. 618

Values are means ± SD of three biological replicates. * P value <0.05 (t-test). For C 619

and D), total catalase activity was measured from total protein extract. Values are 620

means ± SD of three biological replicates. * P value <0.05 (t-test). 621

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Fig. 3 Gene expression of A) ankB and B) catB in Xanthomonas oryzae pv. oryzae 622

ZJ173 and Xanthomonas oryzae pv. oryzicola RS015 and their ankB deletion and 623

complemented mutants when treated with 4 and 32μg/mL PCA, respectively, and C), 624

total catalase activity of ankB deletion mutants in ZJ173 and RS105 when treated with 625

4 and 32μg/mL PCA, respectively. In all cases, strains were grown and treated in NB 626

medium; Values are means ± SD of three biological replicates, and * P value <0.05 627

(t-test). For A), expression was assessed by real-time RT-PCR. Relative mRNA levels 628

of ankB and catB in ZJ173 and RS105 when treated with acetone were set at 1. For C), 629

total catalase activity was measured from total protein extract. 630

Fig. 4 For A), interaction between AnkB and CatB is indicated by a GST pull-down 631

assay. The purified GST-CatB was incubated with AnkB-His6 and pulled down with 632

GST beads. GST-CatB pulled down a significant amount of AnkB-His6 (the bands 633

marked with “*”) by immunoblot using anti-His antibody. The digits represented the 634

molecule size of protein marker. For B), H2O2 sensitivity of Xanthomonas oryzae pv. 635

oryzae ZJ173, Xanthomonas oryzae pv. oryzicola RS015, and their ankB deletion and 636

complemented mutants on NB medium plates. The 1-, 3-, and 9-fold-dilutions (1×, 3637

× and 9×) of the bacterial suspension were added to NB medium containing 0, 0.05, 638

0.1 or 0.2 mM H2O2. 639

Fig 5 Biofilm formation, swimming ability and EPS production of tested strains. A) 640

Biofilm formation, B) Swimming ability and C) EPS production of Xanthomonas 641

oryzae pv. oryzae ZJ173, Xanthomonas oryzae pv. oryzicola RS015, and their ankB 642

deletion and complemented mutants. Representative biological phenotypes were 643

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

photographed. Values are means+ SD of three biological replicates, which has similar 644

results. * P value <0.01 (Student’s t-test). 645

Fig. 6 Pathogenicity of A) Xanthomonas oryzae pv. oryzae (Xoo) strains and B) 646

Xanthomonas oryzae pv. oryzicola (Xoc) strains in rice IR24. The bar charts show 647

lesion lengths. Three replicates were used for each treatment, and the experiment was 648

repeated two times. Values are the means + SD of three replicates. 649

650

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from

on August 17, 2020 by guest

http://aem.asm

.org/D

ownloaded from