the 454 and ion pgm at the genomics core facility
DESCRIPTION
The 454 and Ion PGM at the Genomics Core Facility. Dr. Deborah Grove, Director for Genetic Analysis Genomics Core Facility Huck Institutes of the Life Sciences Penn State University. Services DNA Sequencing Illumina, 454 and Ion PGM Next Gen Sequencing Microarray - PowerPoint PPT PresentationTRANSCRIPT
![Page 1: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/1.jpg)
The 454 and Ion PGM at the Genomics Core Facility
Dr. Deborah Grove, Director for Genetic Analysis
Genomics Core Facility Huck Institutes of the Life Sciences
Penn State University
![Page 2: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/2.jpg)
Services•DNA Sequencing•Illumina, 454 and Ion PGM Next Gen Sequencing•Microarray•Genotyping – VNTRs, SNPs, Open Array•qPCR by Real-Time•DNA Synthesis•DNA Extraction and Storage of DNA from Buccal Swabs
![Page 3: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/3.jpg)
Sequencing at PSU Over the Years
Method ManualGel
Bases per Day
1200
![Page 4: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/4.jpg)
Cycle Sequencing Reaction
![Page 5: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/5.jpg)
Sequencing at PSU Over the Years
Method ManualGel
377 Gel
Bases per Day
1200 20,000
![Page 6: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/6.jpg)
Sequencing at PSU Over the Years
Method ManualGel
377 Gel 3100 –16Capillary
Bases per Day
1200? 20,000 100,000
![Page 7: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/7.jpg)
Sequencing at PSU Over the Years
Method ManualGel
377 Gel 3100 –16Capillary
3730--96Capillary
Bases per Day
1200? 20,000 100,000 0.5 to 1 million
![Page 8: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/8.jpg)
Sequencing at PSU Over the Years
Method ManualGel
377 Gel 3100 –16Capillary
3730--96Capillary
SOLiDNext-Gen
Bases per Day
1200? 20,000 100,000 0.5 to 1 million
1 to 2 Billion
![Page 9: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/9.jpg)
Next-Generation Sequencers:Massively Parallel Platforms
• Roche 454FLX+ v2.8 – 500 million bases per run, 800 to 1000 bases
• Ion PGM 318 chip – 2 to 4 billion bases per run, 400 base length
• (Ion Proton)
![Page 10: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/10.jpg)
Roche 454 – Next Generation Sequencer
• Pyrosequencing
• FLX+ v2.8 has 800 to 1000 bp read
• 160 million bases per
full slide
454 FLX +
![Page 11: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/11.jpg)
454 Titanium Sequencing Applications
• Transcriptome RNA
• Whole Genome -- Paired-End (3kb, 8kb,
20kb) 15 to 30 ugs dsDNA
• Whole Genome – Shotgun
500 ngs dsDNA
• Amplicon/Metagenomics 5 ngs
![Page 12: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/12.jpg)
DNA Fragmentation by nebulization
Fragment End Repair
AMPure Bead Clean up
Adaptor-Ligation
Small Fragment Removal
Library Quality Assessment and Quantification
![Page 13: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/13.jpg)
![Page 14: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/14.jpg)
![Page 15: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/15.jpg)
Primer Sets for Metagenomics
•16s Bacteria
•ITS for Fungus
•18s set for Fungus and other Eukaryotes, targeting Protists
•Archaea targeting both Crenarchaeota and Euryarchaeota
![Page 16: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/16.jpg)
Amplicon Preparation
27F_M6CGTATCGCCTCCCTCGCGCCATCAGATATCGCGAGAGAGTTTGATCMTGGCTCAG 907R_M6TATGCGCCTTGCCAGCCCGCTCAGCCCCGTCAATTCMTTTGAGTTT
![Page 17: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/17.jpg)
16S Variable Regions
27F_M6CGTATCGCCTCCCTCGCGCCATCAGATATCGCGAGAGAGTTTGATCMTGGCTCAG 907R_M6TATGCGCCTTGCCAGCCCGCTCAGCCCCGTCAATTCMTTTGAGTTT
![Page 18: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/18.jpg)
Amplicons
27F518R907R
![Page 19: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/19.jpg)
![Page 20: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/20.jpg)
•One Bead
•One DNA library
•NTPs, Taq etc.
![Page 21: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/21.jpg)
![Page 22: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/22.jpg)
![Page 23: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/23.jpg)
![Page 24: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/24.jpg)
![Page 25: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/25.jpg)
![Page 26: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/26.jpg)
![Page 27: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/27.jpg)
![Page 28: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/28.jpg)
![Page 29: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/29.jpg)
Ion PGM aka Ion Torrent
![Page 30: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/30.jpg)
314 CHIP 316 CHIP
![Page 31: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/31.jpg)
Approximate Cost from Genome Library thru Sequencing
314 Chip 160 million bases, 400,000 reads
318 Chip 3 billion bases, 6 to 8 million reads
$1500 to $2000
![Page 32: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/32.jpg)
Coverage
Full Plate = 1 million reads, 300 million bases
½ plate = 500,000 reads, 150 million bases
1 Quad = 200,000 reads, 60 million bases
![Page 33: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/33.jpg)
Coverage
![Page 34: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/34.jpg)
Full Plate = 1 million reads, 300 million bases
½ plate = 500,000 reads, 150 million bases
1 Quad = 200,000 reads, 60 million bases
http://www.youtube.com/embed/yVf2295JqUg
![Page 35: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/35.jpg)
Coverage
Full Plate = 1 million reads, 300 million bases
½ plate = 500,000 reads, 150 million bases
1 Quad = 200,000 reads, 60 million bases
![Page 36: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/36.jpg)
Full Plate = 1 million reads, 300 million bases
½ plate = 500,000 reads, 150 million bases
1 Quad = 200,000 reads, 60 million bases
![Page 37: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/37.jpg)
Full Plate = 1 million reads, 300 million bases
½ plate = 500,000 reads, 150 million bases
1 Quad = 200,000 reads, 60 million bases
![Page 38: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/38.jpg)
Applications
• Bacterial and Viral Genomes
•Amplicons
•Ampliseq Panels for SNP variants
![Page 39: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/39.jpg)
Ampliseq Cancer Panel
•Only 10 ngs or less
•FFPE tissues
•Single Cells
•Libraries take 3.5 hours
•2800 hot spots
![Page 40: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/40.jpg)
Ampliseq Custom Panels
Use Ion AmpliSeq Designer
![Page 41: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/41.jpg)
![Page 42: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/42.jpg)
P1 Chip 80 million reads, 10 to 15 billion bp
PII Chip 300 million reads, 500 to 800 billion bp
314 Chip 160 million bases, 400,000 reads
318 Chip 3 billion bases, 6 to 8 million reads
![Page 43: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/43.jpg)
Pac Bio
•No amplification required
•Single molecule
•Several thousand base reads (4 to 20 kb)
• Least GC-biased sequencing
•Run time 30 minutes
![Page 44: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/44.jpg)
•Genomes: Finish Genomes and improve assembly with extra long reads (4000bp average and up to 20,000)
• Genomic Complexity: Allow haplotype expansion, full length transcripts and splice variants, repeat expansions, minor variants •Epigenome: Detects base modifications using kinetics
Applications
![Page 45: The 454 and Ion PGM at the Genomics Core Facility](https://reader035.vdocuments.us/reader035/viewer/2022062500/5681594b550346895dc68771/html5/thumbnails/45.jpg)
Thanks to:
The Huck Institutes of the Life SciencesLloyd and Dorothy Huck
And the others in the lab…