PLASMI~ 4, 148-154 (1980)

Terminal Nucleotide Sequences of Tn551, a Transposon Specifying Erythromycin Resistance in Staphylococcus aureus:

Homology with Tn3

SALEEM A. KHAN ANDRICHARD P. NOVICK

Department of Plasmid Biology, The Public Health Research Institute of the City of New York, Inc., 4.55 First Avenue, New York, New York 10016

Received January 14, 1980

The erythromycin resistance determinant of Staphylococcus aweus plasmid ~I258 re- sides on a 5.3 kb transposon, Tn551. We have determined DNA sequences surrounding the junctions between the transposon and the flanking DNA in the wild-type plasmid, in an insertion into a second plasmid, and in two transposon-related deletions. The ends of the transposon consist of an inverted repeat of 40 base pans flanked by a direct repeat of 5, thus placing the transposon in the same class as Tn3, IS2, TnSOl, 78, and bacteriophage Mu. Interestingly, we find that the terminal sequences of the 40 base pairs inverted repeat are very similar to the ends of Tn3, a transposon which one would not have expected to show any relation to Tn551. This result suggests common ancestry for Tn3 and Tn551. The inverted repeat sequence of Tn551 also contains (with one additional inserted base) the internal hepta- nucleotide sequence which has been found to be common to most of the transposable ele- ments that generate 5-base pair direct repeat sequences.

Transposons are DNA elements capable of moving between sites in the chromo- somes and plasmids of prokaryotic or- ganisms (Cohen, 1976; Kleckner, 1977). Transposition of these elements is rec- independent and promotes local rearrange- ments such as deletions and inversions (Kleckner, 1977; Reif and Saedler, 1975; Ross ez al., 1979). A number of transposons have so far been identified in E. coli. There are two structural features of the known transposable elements that are striking: the presence of terminal inverted repeat se- quences and the duplication in the direct orientation of a short sequence at the inser- tion site. On the basis of the latter, trans- posons can be divided into several cate- gories; one common type generates 5-base pair (bp)’ direct repeats another, nine (Rosenberg et al., 1978; Reed et al., 1979; Ohtsubo et al., 1979; Allet, 1979; Calos et al., 1978; Grindley, 1978; Johnsrud et al.,

1978; Kleckner, 1979). The inverted repeat sequences present at the termini are evi- dently required for the process of transposi- tion and are retained in successive trans- position events whereas it is clear that the direct repeat sequences are derived from the target site, are not retained, and have no role in the transposition of the elements to new sites (Johnsrud et al., 1978; Ohtsubo et al., 1979; Kleckner, 1979; Reed et al., 1979).

Tn551 is a Staphylococcus aureus trans- poson, occurring naturally on plasmid ~1258 and capable of ret-independent insertion into nonhomologous sites in the host chro- mosome or other plasmids (Pattee et al., 1977; Novick et al., 1979a). This transposon is similar to E. coli transposons in causing insertional inactivation and local rearrange- ments; it may differ from Tn3 and other E. coli transposons in frequently undergoing apparently precise excision (Novick et al.,

’ Abbreviations used: BRL, Bethesda Research 1979a). Laboratory; kb, kilobase; bp, base pair. In order to compare the structure of this

0147-619X/80/050148-07$02.00/O Copyright 0 1980 by Academic Press. Inc. All rights of reproduction in any form reserved.

148

Tn551 JUNCTION SEQUENCES 149

TABLE 1

S. aureus STRAINSAND PLASMIDS

Strain

RN453

RN2467

RN2489

RN647

RN2736

Plasmid

pRN3038

pRN3 174

pRN3 184

~16187

pRN4122

Plasmid genotype

~12.58 blaI443

pI258A95 [mer + asi]

~1258 bla1443 Al 14[ermB]

Naturally occurring

~16187 RllS[EcoD::TnSSl]

Source or derivation

Novick and Richmond (1965)

Spontaneous deletion, Novick et al. (1979a)

w-induced deletion of ermB from pRN3038, Novick (1967)

Peyru et al. (1969), Novick et al. (1979b)

Silent insertion of Tn551 into EcoRI fragment D, Novick et al. (1979b)

Staphylococcal transposon with similar elements in other organisms, we have de- termined the DNA sequences of the trans- poson termini. These results have shown that Tn551 is structurally similar to Tn3; its natural location on ~1258 is the consequence of an insertion; it undergoes precise exci- sion and appears to generate end-specific deletions.

MATERIALS AND METHODS

Strains and culture conditions. S. aureus strains and plasmids used were isolated in this laboratory and are listed in Table 1. Bacterial strains were stored in CY broth at -75°C and were subcultured on agar plates for the preparation of inocula. Cultures were grown aerobically in CY broth (Novick, 1963) at 37°C.

Materials. Restriction enzymes used were purchased from either New England Biolabs or Bethesda Research Laboratory (BRL). Bacterial alkaline phosphatase was purchased from BRL. T4 polynucleotide kinase was a gift from Z. Humayun. [y- 32P]ATP was purchased from New England Nuclear (specific activity - 3000 Wmmol).

Isolation of plasmid DNA. Plasmid DNA was isolated by dye buoyant density cen- trifugation of cleared lysates (Clewell and Helinski, 1969; Novick et al., 1979b).

Restriction endonuclease analysis and gel electrophoresis. Plasmid DNA was digested with restriction endonucleases in 6

mM Tris-HCl (pH 7.5), 6 mM MgC&, and 6 mM 2-mercaptoethanol at 37°C for 2-4 h. Restriction mixtures for Sal1 also contained 150 mM NaCl. Restriction fragments were separated by either 5 or 7% polyacrylamide slab gels with Tris-borate-EDTA buffer, pH 8.3 (Greene et al., 1974). DNA frag- ments were recovered from gels after elec- trophoresis as described (Humayun et al., 1977).

5’ Labeling of restriction fragments. 5’ Ends of restriction fragments were labeled by dephosphorylation with bacterial al- kaline phosphatase followed by rephos- phorylation with [y-32P]ATP by T4 poly- nucleotide kinase (Humayun et al., 1977). The labeled fragments were phenol ex- tracted and digested with appropriate re- striction enzymes and the 5’-end-labeled fragments were purified by gel electrophore- sis. For mapping of 32P-labeled restriction fragments, small aliquots of the labeled fragments were taken, digested with various restriction enzymes, and the fragments were again separated by gel electrophoresis. Autoradiography (Smith and Birnstiel, 1976) of the gel was used to locate the labeled secondary fragments.

DNA sequence determination. DNA se- quencing reactions were done essentially as described by Maxam and Gilbert (1977). Dimethysulfate and piperidine were used for the G reactions; dimethylsulfate and HCl for A; pyridinium acetate for A + G; hydrazine for C + T reactions; and hy-

150 KHAN AND NOVICK

drazine in the presence of 5 M NaCl for C reactions. Final cleavage products were dis- solved in 80% formamide, 50 mM Tris- borate, pH 8.3, 1 mM EDTA, 0.1% xylene cyanol, and 0.1% bromophenol blue. Products were analyzed on 40 X 0.15cm, 25% acrylamide-7 M urea gels (for the first 20-30 nucleotides) and on 40 X 0.4-mm, 8% acrylamide-7 M urea gels for sequences up to 200-250 nucleotides.

RESULTS

Restriction Maps

The previously determined physical- genetic map of ~I258 (Novick et al., 1979b) was expanded in the TnSSl-containing re- gion. Detailed restriction maps of this re- gion were prepared for the wild-type plas- mid, for a derivative plasmid, pI258A95, with an extensive deletion terminating near the counterclockwise end of the transposon, and for a second derivative, pI258A114, with a deletion apparently encompassing the transposon itself (Novick et al., 1979a,b). Restriction sites close to the Tn551 ends were located as lying either inside or out- side the transposon by comparing the re- striction digests of ~1258 with a Tn551 insertion into ~16187 (pRN4122). These studies showed that the transposon contains HpaI and BglII sites near the junctions (Novick et al., 1979a,b). The junction near the HpaI site is referred to as J, and the one near the BglII site as JR. ~1258 has a Sal1 site close to the Tn551 HpaI site (460 bp away in the counter clockwise direction) but outside the transposon.

pI258A114 is one member of a set of PI258 derivatives that have apparently identical 5.2-kb deletions affecting erythromycin re- sistance. These have all lost both the terminal HpaI and BglII sites and are re- garded as presumptive precise excisions of the transposon (Novick et al., 1979a). The site from which the deleted DNA seg- ment has been lost is contained within a 392-bp SalI-HhaI cofragment. The identi-

fication of this fragment permitted the mapping by 32P end labeling (Smith and Birnstiel, 1976) of the transposon junction fragments as shown in Fig. 1.

Sequence Determinations

Different restriction fragments were ob- tained and sequenced so as to get a number of overlapping sequences. Each experiment was done twice and in the case of the region of the plasmid containing the left junction (Jr,), both strands were sequenced inde- pendently. The sequences of both strands matched completely in this case. Regions of DNA which were sequenced are shown in Fig. 1. Figure 2 shows parts of the se- quences deduced from sequencing gels.

As shown in Fig. 2, both the parent plasmid pRN3038 and the deletion pI258A95 (pRN3174) contain an inverted repeat se- quence of 40 bp. In addition, they have a duplicated 5-bp sequence in the direct orientation at the ends of Tn551 (ATAAA). The inverted repeats at the two ends of Tn551 are homologous except that AAA in JL is replaced by GGG in JR (positions 36-38). We next determined the sequence of one junction (JL) of the transposon with the target DNA in a previously mapped Tn551 insertion into another plasmid (pRN4122) (Novick et al., 1979a). The re- sult, also presented in Fig. 2, was that the flanking sequence was different from that found in ~I258 and its derivatives, suggest- ing that the 5-bp repeat is generated at the target site by insertion of the transposon.

We note that pRN3174, a spontane- ous, possibly transposon-induced deletion (Novick et al., 1979b) contains the 5-bp direct repeats in addition to the inverted repeats. In this case the extensive deletion terminates precisely at the end of the direct repeat sequence. As is shown in Fig. 2, ~I25881 14, carrying a uv-induced deletion of ermB, has lost the whole transposon and also one of the direct repeat sequences. Thus the uv-induced deletion constitutes a precise excision of the transposon.

Tn551 JUNCTION SEQUENCES 151

> > RN4122

JL

P

I I I ----TTTT-n?----l-

FIG. 1. Restriction endonuclease cleavage maps of TnSSl-containing regions. Cleavage sites were de- termined by comparative restriction enzyme digests. Detailed mapping was done by cleavage of 3ZP- labeled purified restriction fragments by the method of Smith and Bimstiel (1976). In pRN3038, pRN4122, and pRN3 174 positive coordinates refer to base pairs from JL or JR outside the transposon; negative coordinates refer to base pairs from JL or JR inside the transposon. In pRN3184 coordinates refer to distance in base pairs clockwise from the Sal I site. Arrows show the extent and direction of sequence determination.

DISCUSSION

As noted, the transposable elements so far described (in gram-negative organisms) seem to be classifiable on the length of the inverted repeat sequence of the transposon itself and the length of the directly repeated oligonucleotide sequence generated at the target site by the insertion event. The results presented here show that Tn551 fits very clearly into the class typified by the TnA group of E. coli transposons in that it has inverted repeats of 40 nucleotides (Tn3

has 38) and generates direct repeats of 5, as does Tn3. Perhaps even more striking is the comparison of the inverted repeats of Tn551 with those of Tn3 (Table 2). As seen, the inverted repeats can be aligned so that 14 of the first 18 base pairs of this sequence are identical for the two transposons, including a sequence of four G’s at the start. This match is obviously much too close to be coincidental. There is also a limited end homology of the Tn551 repeat sequence with insertion element y6 (Reed et al., 1979) and a 200-nucleotide-long transposon-

152 KHAN AND NOVICK

Tn551 JUNCTION SEQUENCES 153

TABLE 2

INVERTED REPEAT SEQUENCES OF A FEW Tn ELEMENTS GENERATING FIVE-BASE PAIR DIRECT REPEATS

Element 5’ End sequence Reference

Tn551 (J,,) 5’ GGGGTCCGAGCGCACGAGAAATTTGTATCGATAAGAAATA This paper Tn551 (JR) 5’ GGGGTCCGACCGCACCAGAAATT-TGTATCGATAAGGGGTA This paper Tn3 5’ GGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAG Ohtsubo et al. (1979) ys 5’ GGGGTTTGAGGGCCAATGGAACGAAAACGTACGTT Reed et al. (1979) pSClO1 (J,,) 5’ GGGGTTTGAGGTCCAACCGTACGAAAACGTACGGTAAG Ravetch et al. (1979) pSClO1 (JR) 5’ GGGGTCTGAGGGCCAATGGAACGAAAACGTACGTTAGT Ravetch et al. (1979) Tn501 GGGGGAACCGCAGAATTCGGAAAAAATCGTACGCTAAG J. Grinsted, personal

communication

like sequence on plasmid pSClO1 (Ravetch et al., 1979). A heptanucleotide sequence, ACGAAAA, has been found to be present in Mu phage and in most of the Tn elements that generate 5-bp direct repeats. A similar sequence with a G insertion (ACGAGAAA) is also present in Tn551. This heptanucleo- tide is evidently a common feature of the Tn elements that give rise to 5-bp direct re- peats. We note, however, that Tn501, a transposon from E. coli that carries re- sistance to mercury compounds and is related functionally to Tn3 (J. Grinsted, personal communication) does not appear to be as closely related to Tn3 as Tn55 1.

The end similarity between Tn551 and Tn3 strongly suggests common ancestry for these two elements and raises the interest- ing questions of how an apparently similar transposon system has come to carry erythromycin resistance in one organism and penicillin resistance in another.

As seen with pRN3 184, Tn55 1 can undergo precise excision. This deletion-bearing plas- mid was isolated in an experiment involv- ing uv irradiation of a transducing phage lysate followed by selection for the cad- mium resistance determinant of the plasmid (~1258). Of 2500 transductants, 10 were erythromycin sensitive while in a control with unirradiated phage, none of 2300 Cd’ transductants were Ems (Novick, 1967). Seven of the Em” plasmids, including pRN3184, were examined by restriction endonuclease digestion and all had ap- parently identical deletions involving Tn551 (Novick et al., 1979a). Thus it appears

that precise excisions of this transposon can be induced by uv irradiation. By analogy with the results of Farabaugh et al. (1978), it would appear that such precise excision has nothing to do with the process of trans- position; instead it is probably a reflection of the propensity of DNA segments bounded by short direct repeats to undergo deletion, which one might expect to be enhanced by uv irradiation.

The extensive deletion (spontaneous) of plasmid pRN3 174 terminates precisely at the distal end of the direct repeat flanking JL. It is therefore not typical of IS- and transposon-induced adjacent deletions since these terminate precisely at the end of the inserted element itself, eliminating the directly repeated oligonucleotide (reviewed in Starlinger (1980)). Thus it seems unlikely that the deletion in question is transposon induced, despite the remarkable location of its terminus. However, since only one isolate of this type has been encountered, we shall reserve judgment.

The finding that Tn551 is bounded by a 5- bp direct repeat in its site on ~1258, the plasmid where it was found in its natural state, suggests that the transposon did not evolve in connection with this plasmid but arrived there by a naturally occurring trans- position. Whether we will ever know its true origin is doubtful; we note, however, that sequences homologous to Tn551 have been detected in streptococci and pneumococci (Weisblum et al., 1979), suggesting the natural occurrence of interspecific trans- position.

1.54 KHAN AND NOVICK

Future experiments using complementa- tations affecting penicillinase formation in Sfaphylo-

tion by Tn551 of a defective Tn3 and ef- coccus aureus. J. Gen. Microbial. 33, 121-136.

forts to identify a similar transposase NOVICK, R. P. (1967). Penicillinase plasmids of

activity recognizing both Tn551 and Tn3 Staphylococcus aureus. Fed Proc. 26, 29-38.

ends should reveal the extent to which base NOVICK, R. P., EDELMAN, I., SCHWESINGER. M. D.,

GRUSS, A. D., SWANSON, E. C., AND PATTEE, sequence homology is reflected in functional overlap between these two transposons.

P. A. (1979a). Genetic translocation in Sraphylococ- cus aureus. Proc. Nar. Acad. Sci. USA 16, 400-404.

ACKNOWLEDGMENTS NOVICK, R. P., MURPHY, E., GRYCZAN, T. J., BARON,

E., AND EDELMAN, I. (1979b). Penicillinase plasmids of Staphy/ococcus aureus: Restriction-deletion

This work was supported by Grants GM14372 (NIH) and PCM77-25476 (NSF) to RPN.

REFERENCES

ALLET, B. (1979). Mu insertion duplicates a 5 base pair sequence at the host inserted site. Cell 16, 123-129.

insertion element ISl. Cell 13, 411-418. CLEWELL, D. B., AND HELINSKI, D. R. (1969). Super-

CALOS, M. P., JOHNSRUD, L., AND MILLER, J. H.

coiled circular DNA-protein complex in Esche-

(1978). DNA sequence at the integration sites of the

maps. Plasmid 2, 109- 129. NOVICK, R. P., AND RICHMOND, M. H. (1965). Nature

and interactions of the genetic elements governing penicillinase synthesis in Staphylococcus aureus. J. Bacterial. 90, 467-480.

tions of integrated plasmids and related elements in Staphylococcus aureus. Plasmid 1, 38-S 1.

PEYRU, G., WEXLER, L. F., AND NOVICK, R. P. (1969).

OHTSUBO, H., OHMORI, H., AND OHTSUBO, E. (1979). Nucleotide-sequence analysis of the Tn3 (Ap): implications for insertion and deletion. Cold Spring Harbor Symp. Quanr. Biol. 43, 1269-1277.

PATTEE, P. A., THOMPSON, N. W., HAUBRICH, D., AND NOVICK, R. P. (1977). Chromosomal map loca-

richia co/i: purification and induced conversion to an open circular DNA form. Proc. Nat. Acad. Sci. USA 62, 1159-1166.

COHEN, S. (1976). Transposable genetic elements and plasmid evolution. Nafure (London) 263, 731-738.

FARABAUGH, P. J., SCHMEISSNER, U., HOFER, M., AND MILLER, J. H. (1978). Genetic studies of the lac repressor VII on the molecular nature of spon- taneous hotspots in the IacI gene of Escherichia co/i. J. MO/. Biol. 126, 847-863.

GREENE, P. J., BETLACH, M. C., GOODMAN, H. M., AND BOYER, H. W. (1974). The EcoRI restriction endonuclease. In “Methods in Molecular Biology- DNA Replication and Biosynthesis” (R. B. Wickner, ed.), Vol. 7, pp. 87-111. Dekker, New York.

GRINDLEY, N. D. F. (1978). IS1 insertion generates duplication of a nine base pair sequence at its target site. Cell 13, 419-426.

HUMAYUN, Z., JEFFREY, A., AND P~ASHNE, M. (1977). Completed DNA sequences and organization of repressor-binding sites in the operators of phage Lambda. J. MO/. Biol. 112, 265-277.

JOHNSRUD, L., CALOS, M. P., AND MILLER, J. H. (1978). The transposon Tn9 generates a 9 bp repeated sequence during integration. CeN 15, 1209-1219.

KLECKNER, N. (1977). Translocatable elements in pro- karyotes. Cell 11, 11-23.

KLECKNER, N. (1979). DNA sequence analysis ofTnl0 insertions: origin and role of 9bp flanking repeti- tions during TnlO translocation. Cell 16, 71 l-720.

MAXAM, A., AND GILBERT, W. (1977). A new method for sequencing DNA. Proc. Nat. Acad. Sci. USA 14, 560-564.

NOVICK, R. P. (1963) Analysis by transduction of mu-

Naturally-occurring penicillinase plasmids in Staphylococcus aureus. J. Bacterial. 98, 215-221.

RAVETCH, J. V., OHSUMI, M., MODEL, P., VOVIS, G. F., FISCHHOFF, D., AND ZINDER, N. D. (1979). Organization of a hybrid between phage fl and plas- mid pSClO1. Proc. Nai. Acad. Sci. USA 76, 2195- 2198.

REED,R. R., YOUNG,R. A., STEITZ, J. A.,GRINDLEY, N. D. F., AND GUYER, M. S. (1979). Transposi- tion of the Escherichia co/i insertion element y generates a five-base-pair repeat. Proc. Nai. Acad. Sci. USA 76, 4882-4886.

REIF, H. J., AND SAEDLER, H. (1975). IS1 is involved in deletion formation in the gal region of E. coli K12. Mol. Gen. Genet. 137, 17-28.

ROSENBERG, G. M., COURT, D., SHIMATAKE, H., BRADY, C., AND WULFF, D. L. (1978). The relation- ship between function and DNA sequence in an intercistronic regulatory region in phage A. Nature (London) 272, 414-423.

Ross, D., SWAN, J., AND KLECKNER, N. (1979). Physical structures of TnlO-promoted deletions and inversions: role of 1400 base-pair inverted repeti- tions. Cell 16, 721-731.

SMITH, H. O., AND BIRNSTIEL, M. L. (1976). A simple method for DNA restriction site mapping. Nucl. Acids Res. 3, 2387-2398.

STARLINGER, P. (1980). IS elements and transposons. Plasmid 3, 241-259.

WEISBLUM, B., HOLDER, S. B., AND HALLING, S. M. (1979). Deoxyribonucleic acid sequence common to staphylococcal and streptococcal plasmids which specify erythromycin resistance. J. Bacreriol. 138, 990-998.