JOURNAL OF BACTERIOLOGY, Oct. 1991, p. 656846577 Vol. 173, No. 200021-9193/91/206568-10$02.00/0Copyright C) 1991, American Society for Microbiology

Temperature-Sensitive Mutations in the Bacteriophage Mu cRepressor Locate a 63-Amino-Acid DNA-Binding Domain

JODI L. VOGEL,lt ZHU JUAN LI,1 MARTHA M. HOWE,2 ARIANE TOUSSAINT,3AND N. PATRICK HIGGINS1*

Department ofBiochemistry, University ofAlabama at Birmingham, Birmingham, Alabama 352941; Department ofMicrobiology and Immunology, University of Tennessee, Memphis, Memphis, Tennessee 381632; and

Laboratoire de Genetique, Unite Transposition Bacterienne et Bacteries Phytopathogenes,Departement de Biologie Moleculaire, Universite Libre de Bruxelles,

B1640 Rhode Saint Genese, Belgium3

Received 17 January 1991/Accepted 20 May 1991

Phage Mu's c gene product is a cooperative regulatory protein that binds to a large, complex, tripartite184-bp operator. To probe the mechanism of repressor action, we isolated and characterized 13 phage mutantsthat cause Mu to undergo lytic development when cells are shifted from 30 to 42°C. This collection containedonly four mutations in the repressor gene, and all were clustered near the N terminus. The cts62 substitutionofR47-+Q caused weakened specific DNA recognition and altered cooperativity in vitro. A functional repressorwith only 63 amino acids of Mu repressor fused to a C-terminal fragment of I-galactosidase was constructed.This chimeric protein was an efficient repressor, as it bound specifically to Mu operator DNA in vitro and itsexpression conferred Mu immunity in vivo. A DNA looping model is proposed to explain regulation of thetripartite operator site and the highly cooperative nature of repressor binding.

The outcome of an infection with bacteriophage Mu iseither killing of the host cell or stable integration of phageDNA into the host chromosome and lysogenic growth of thebacterium. The decision that the virus must make to developalong one of these two pathways is complex (5, 28) and canbe altered by conditions such as the multiplicity of infectionand the genetic composition of the host cell (3, 4, 8, 27). Twoviral elements that are critically involved in the lysis-lysog-eny decision are the Mu c repressor and its operator sitelocated about 1 kb from the left end of viral DNA.The Mu operator is a large regulatory DNA sequence

containing convergent promoters and sites for binding bothphage-encoded and host-derived proteins. The two principalpromoters that regulate phage development in the lytic andlysogenic pathways are PE and PCM. PE is an early promoterand the control point of a polycistronic operon encodingtransposition and regulatory functions (20). The PcM pro-moter is the start point for a monocistronic transcript thatproceeds toward the left end of the phage genome andencodes the repressor (11, 18, 19). The PE and PcM promot-ers are regulated by the Mu repressor, which binds in acooperative manner to nearly 200 bp of operator DNA. TheMu regulatory region is organized into three blocks ofDNAsequence designated operator sites 01, 02, and 03 (18, 19).Each operator site contains two or more 14-bp repressorconsensus sites; there are 3, 4, and 2 consensus sequenceslocalized in operator sites 01, 02, and 03, respectively (Fig.1). An integration host factor binding site separates 01 and02.The Mu repressor is composed of 22,000-Da protomers

that oligomerize. At its N terminus, it contains significantstructural homology with the N-terminal domain of Mu

* Corresponding author.t Present address: Howard Hughes Medical Institute, University

of Chicago, Chicago, IL 60737.

transposase (13) (Fig. 1). Interactions between repressor andsupercoiled operator DNA have been modeled in vitro, andthe following regulatory pattern was observed. As repressorconcentrations were gradually increased, protection fromDNase I cleavage was found in 01 and 02 and PE transcrip-tion gradually stopped; a repressor concentration of 0.3,ug/ml inhibited PE transcription by 50%. Whereas PE tran-scription diminished gradually over a range of repressorconcentrations, PcM remained fully active. Then, abruptly,with the slight fractional change in protein concentrationfrom 0.8 to 1 ,g/ml, PcM transcription turned off (19).How do cooperative interactions occur among repressors

bound to nine separate sites on linear DNA? To begin toanswer this question, we surveyed a collection of tempera-ture-sensitive (ts) repressor mutants (cts) that were isolatedby a variety of mutagenic treatments. DNA sequence anal-ysis showed that only four mutations are present in thiscollection. Half of the mutations are due to an R47-*Qsubstitution, which includes the allele cts62. PurifiedRepcts62 showed diminished capacity for binding Mu oper-ator at 30°C, and as the temperatures increased, the DNA-binding activity decreased. All other cts mutations werelocated in the N-terminal quarter of the protein close tocts62.

Cooperative DNA-binding proteins must have a DNA-binding domain that works in conjunction with a segment ofprotein that supports protein-protein contact. To explorethis aspect of the Mu repressor, we constructed a chimericprotein, Rep63-,BGal, with the N-terminal headpiece of Murepressor fused to an enzymatically active C-terminal do-main of 3-galactosidase (IGal). Rep63-,BGal, which carriesonly 63 amino acids of Mu repressor, was tested in assaysdesigned to measure Mu immunity in vivo and binding to MuDNA in vitro. As a result of these studies, we propose aDNA looping model to explain the importance of cooper-ativity, the role of operator site 01, and to suggest how theMu repressor may function using either its own cooperativ-

6568

on January 27, 2021 by guesthttp://jb.asm

.org/D

ownloaded from

TEMPERATURE-SENSITIVE MUTATIONS IN A DNA-BINDING DOMAIN 6569

ner'lion' 03

Hindill.02

CIHF 01

.b- |eeeesree- 4T-_-,'-M;_@-@j''Z-;|__-;'''j-'; '';' ';;; - '':- ,- : ' - jjj,--...64 . 6......,;,~~~~~~~~~~~~~~~~~~~

-35 -10 -10 -35PcM --

cts45LI

S.D~~~~~~~~~~WSD. M K S N F I E K N N T E KS IWC- PQ E11AALATAAGGAG=TTAAATTTGAAAAGTAACTTTATAGAAAAGAATAATACTGA-GTCAA1ATT (;TGI;TTCGC; CGCC;C8AAG8AAATT864

cts7 cts25 cts621- -- ~ ~ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~D Q

M A A D:G. M G S V AH NRAT KD8Q.W..K...K 780ATGGCTGCTGATGGTATGCCTATCTGTTGCTCGT;TCACTATCGAGC"AAATGTTCAAGGCTGGACGAAGCGAAAAAAGGAA

A A A

I.GKG.GKAVEY9X.DV MSM-l-TK2ER EQV I A H L GGGTGTCAAGGGGGGGAAAGCTGTTGAATACGATGTGATGTCGATGCCCACCAAAGAACGAGAGCAAGTTATTGCGCACTTGGCG 696

'% ~~~2L S T P D T G A Q A N E K O D S S E L I N K L T T T L I

TTATCCACACCGGATACTGGTGCTCAAGCCAATGAGAAACAGGATTCTTCGGAACTGATAAACAAATTAACCACAACCTTAATc 612

N M I EL P D A R .A.;L .K.L.-t.S K G G L L W..MAATATCATTGAAGAGCTGGAACCAGATGAAGCACGCAAGGCACTGAAACTTTTAAGTAAAGGGGGGTTGTTGGCG TTAATGCCT 528* - * . S vSx-- .....~~~~~~~~~~~~~~~~...............s--*L V F N E Q K L Y S F I GF S Q.. O.MIM L D ALCTTGTATTTAATGAACAGAAACTTTACAGCTTTATAGGAITTTCACAGCAAAGTATTCAGACGTTGATGATGCTAGATGCATTA 444

P E E K R K E I L S K Y G I H E Q E S V V V P S 0 E P 0CCTCGAAGAAAAACGCAAAGACATTTTGTCAAACTATGGCATTCATGAACAGCAAAGTGTTGTAGTACCTTCACAGCGAACCACAG 360

E V K K AV*.*GAGGTAAAAAAAGCCGTATAACAACCATGAACCAGCTAAAACATACTTCACCTCACATAATCACACATGTAACATACCTALACG 276

FIG. 1. Structure of the Mu operator and c gene. The three repressor binding sites 01, 02, and 03 are indicated by stippled boxes.Repressor binding at 02 blocks the PE promoter -35 and -10 contacts (20). After 01 and 02 are filled, repressor binds to 03 and blocks thePCM -10 contact (19). A densely stippled box between 01 and 02 shows the binding site for integration host factor (19). Amino acid sequenceof repressor is given above the DNA sequence of the wild-type c gene. The repressor coding sequence starts within 01. Numbers showingbase pair coordinates relative to Mu attL are on the right, and amino acids that are conserved between the Rep and Mu transposase are inunbordered stippled boxes. The putative helix-turn-helix motif is boxed. ts (cts) repressor mutations are shown below the sequence, and thecorresponding amino acid substitutions are given above the protein sequence. The positions of oligonucleotides 1 and 2 that were used to fuse63 amino acids of repressor to ,BGal are shown as convergent arrows with a dash in oligonucleotide 1 indicating amino acids that were deletedfrom the N terminus. A potential leucine zipper dimerization sequence (Leu-135 to Leu-156) is underlined with a jagged line. Single-lettercodes for the amino acid residues are as follows: A, Ala; C, Cys; D, Asp; E, Glu; F, Phe; G, Gly; H, His; I, Ile; K, Lys; L, Leu; M, Met;N, Asn; P, Pro; Q, Gln; R, Arg; S, Ser; T, Thr; V, Val; and Y, Tyr.

ity element(s) or the tetrameric structure of a chimeric ,BGalfusion protein.

(This work forms part of a dissertation by J. L. Vogelsubmitted to the University of Alabama at Birmingham inpartial fulfillment of the requirements of a Ph.D.)

MATERIALS AND METHODS

Growth of bacteriophage, bacterial strains, and plasmids.Bacterial strains used are listed in Table 1. Mucts62pKn7701contains a 2.8-kb substitution of TnS DNA conferring kana-mycin resistance; the substitution replaces the Mu segmentfrom 4.4 to 7.2 kb from the c end of Mu (7). Bacteria weregrown in LB (10 g of NaCl, 10 g of tryptone, 5 g of yeastextract) or LB-MT (LB with 246 mg of MgSO4 - 7H20 and30 mg of thymine per liter). Titers of phage were determined

on a lawn of sensitive bacteria in LB-MT plus 0.8% agar onLB-MT plates. To induce lytic development, lysogens weregrown to a density of 2 x 108 to 4 x 108 cells per ml at 32°C;the temperature was then shifted to 42°C, and cells wereincubated until lysis.

Mutagenesis. Nitrosoguanidine (NTG) treatment was car-ried out on the Muc+ lysogens MH1201 or MH1205 grown inLB at 37°C to a density of 2 x 108 to 4 x 108 cells per ml. Thecells collected by centrifugation were resuspended at adensity of 2 x 108 cells per ml in 0.1 M citrate buffer, pH 5.5.NTG at 8 ,g/ml in 0.1 M citrate buffer, pH 5.5, was added.The cell-NTG mixtures were incubated at 30°C for 15 min,and 0.1 ml of cells was diluted into 1 ml of LB and grownovernight at 30°C. Ethyl methanesulfonate (EMS) mutagen-esis was carried out on the Muc+ lysogen MH1205 grown inLB to a density of 2 x 108 to 4 x 108 cells per ml at 32°C.

VOL. 173, 1991

on January 27, 2021 by guesthttp://jb.asm

.org/D

ownloaded from

6570 VOGEL ET AL.

TABLE 1. Strains

E. coli strain Description Source orreference

Q1 F- thr leu JhuA lac supE 30MH1201 Ql (Muc+) This studyMH1205 supE recA (Muc+) 33MH5350 Ql (Muctsl4) This studyMH5352 Ql (Mucts23) This studyMH5353 Ql (Mucts25) This studyMH5354 Ql (Mucts29) This studyMH5355 Ql (Mucts30) This studyMH5356 Ql (Mucts33) This studyMH5357 Ql (Mucts4l) This studyMH5358 Ql (Mucts45) This studyMH5359 Ql (Mucts48) This studyMH5360 Ql (Mucts6l) This studyMH5361 Ql (Mucts62) This studyNH537 594 (Mucts7l) L. DesmetNH538 594 (Mucts74) L. Desmet594 rpsL galK lacZ 1DH5a endAl hsdR17 (rK- MK+) supE44 BRLa

thi-l recAl gyrA96 relAlA(argF-lacZYA)U1694.80dlacZAM15 X-

N99 F- rpsL galK H. NashMC4100 F- araD l(argF-1acZYA)U169 6

rpsL relAl flbB deoC ptsF rbsRBL21 (DE3) F- hsdS gal (A lacUV5-T7 gene 1) 34

a BRL, Bethesda Research Laboratories.

Cells harvested by centrifugation were resuspended at adensity of 2 x 109 to 4 x 109 cells per ml in 0.05 M phosphatebuffer, pH 8.0, diluted fivefold into phosphate buffer con-taining EMS (final EMS concentration was 40 ,uIVml), andincubated at 34°C for 15 min. After a 100-fold dilution in0.85% saline, 0.1 ml of cells was added to 1 ml of LB andincubated overnight at 32°C. mutD mutagenesis was carriedout as described previously (30).

Overnight cultures of mutagenized cells were diluted100-fold into LB, incubated at 32°C until they reached adensity of 108 cells per ml, and incubated at 42°C for 20 min.After being harvested by centrifugation, cells were resus-pended in fresh LB, incubated at 42°C for 25 min, andtreated with chloroform; titers were determined on Ql at42°C on LB-MT plates. Clear plaques were picked and testedfor plaque morphology at 31 and 42°C. Putative mutantswere purified and retested by spotting on lawns of Ql at 30,34, 37, 40, and 42°C. Independent mutants were saved aslysogens in Ql.

Purification of DNA. Bacteriophage concentrated by poly-ethylene glycol-phase extractions (36) were resuspended inMu buffer (0.5 M NaCl, 20 mM Tris-Cl [pH 7.4], 2 mMCaCl2). Solutions made with 10 mM EDTA and 1% sodiumdodecyl sulfate were heated to 65°C for 15 min and wereextracted twice with phenol-chloroform (1:1) and once withchloroform. After precipitation with two volumes of ethanol,the DNA was resuspended in TE (10 mM Tris-Cl [pH 8.0], 1mM EDTA).

Plasmid construction. The repressor is encoded by theleftmost gene on the phage chromosome. Digestion of phageDNA with HindIII produces a fragment containing the left 1kb of phage DNA and 50 to 150 bp of variable host DNAattached to the left end. The 1-kb HindIll fragments of phageDNA were resolved from larger fragments on a 1% agarose

gel and isolated by placing a DEAE paper strip into a slot cut

TABLE 2. Plasmids

Plasmid Vector Mu insert Source orreference

pJV101 pUC18 attL-HindlII Muctsl4 This studypJV102 pUC18 attL-HindIII Mucts23 This studypJV104 pUC18 attL-HindIII Mucts29 This studypJV105 pUC18 attL-HindIII Mucts30 This studypJV106 pUC18 attL-HindIII Mucts33 This studypJV107 pUC18 attL-HindIII Mucts4l This studypJV109 pUC18 attL-HindIII Mucts48 This studypJV110 pUC18 attL-HindIII Mucts6l This studypJV200 pUC19 attL-HindIII Muc' This studypJV202 pUC19 attL-HindIII Mucts25 This studypJV203 pUC19 attL-HindIII Mucts45 This studypJV204 pUC19 attL-HindIII Mucts62 This studypJV210 pUC19 attL-HindIII Mucts7l This studypJV212 pUC19 attL-HindIII Mucts74 This studypJV300 pRS551 attL-HaeIII Muc+ This studypJV302 pRS551 attL-HaeIII Mucts25 This studypJV303 pRS551 attL-HaeIII Mucts45 This studypJV304 pRS551 attL-HaeIII Mucts62 This studypJV310 pRS551 attL-HaeIII Mucts7l This studypHKO9 pSP65 Sau3A-HaeIII 19pJL100 pDS100 Amino acids 1, 13-75 Muc+ This study

just in front of the desired band and electrophoresing theband onto the strip. DNA was eluted from the DEAE paperin 1 M NaCl at 65°C for 2 h, ethanol precipitated, resus-pended in TE, and ligated into either pUC18 or pUC19 thathad been digested with HindIlI and SmaI and treated withcalf intestine phosphatase. Transformation was carried outwith DH5a made competent by the CaCl2 method (21). Theresulting plasmids are listed in Table 2.A three-way ligation strategy was used to clone Mu

sequences from attL to position 1118 on the Mu mnap (17 bpinto the ner coding sequence) into the vector pRS551 (32) tomake a PE::lacZ operon fusion (Fig. 2B). In these con-structs, lac expression is regulated by the Mu repressor as anoperon fusion. The three-way ligation substrates were asfollows: (i) a HindIII and EcoRI fragment of Mu DNA fromthe pJV200 series of plasmids that includes 100 to 150 bp ofhost DNA that varies with each clone, the Mu attL site, andMu DNA extending to bp 1001; (ii) a HindIII and EcoRIfragment from the plasmid pHKO9 containing Mu sequencesfrom 1001 to 1118; and (iii) the vector pRS551 cut with EcoRIand treated with calf intestine phosphatase. Both Mu frag-ments were purified from agarose gels by the DEAE papermethod described above. Ligation products were introducedinto DH5a cells by selecting for ampicillin resistance. Re-striction analysis was performed to identify clones havingthe proper orientation. To move the cloned genes to aspecialized A transducing phage, the plasmids were intro-duced into N99 and infected with ARS45. The resultingphage were used to infect MC4100 (AlacZ), and lysogenswere selected on LB-MT plates containing 25 ,ug of kana-mycin per ml as described previously (32). 3Gal assays wereperformed as described previously (22).

Sequencing of the repressor mutants. Plasmid DNA iso-lated by an alkaline lysis method (2) was sequenced by usingthe chain termination method (31), and synthetic oligonucle-otides were made with an Applied Biosystems model 380ADNA synthesizer. Priming oligonucleotides had the follow-ing sequences: 5' CGAAGAATCCTGTTTTCT 3' (Mu 645 to661), 5' AGATGAAGCACGCAA 3' (Mu 588 to 574), 5'ACGTCTGAATACTTTGCTGTG 3' (Mu 464 to 484), and 5'

J. BACTERIOL.

on January 27, 2021 by guesthttp://jb.asm

.org/D

ownloaded from

TEMPERATURE-SENSITIVE MUTATIONS IN A DNA-BINDING DOMAIN 6571

C

PL Mu 63-mer_ Collagen

57

pJL100

(pDSlOO) lacZ I

FIG. 2. Plasmids used in repressor cloning and expression experiments. (A) For sequencing, each repressor mutation was cloned intopUC19 (or pUC18, the data for which are not shown) and these constructs were given the names pJV200 to -299. (B) For regulation studies,constructs were made with pRS551 and given the names pJV300 to -399. Recombination between pJV300 series plasmids with XRS45produced specialized transducing phage carrying kanamycin resistance, which were named after the plasmid construct (i.e., XJV300 to -399).In these constructs, Mu repressor expression is autoregulated from PcM, and lacZ expression is initiated at PE. (C) For construction ofRep63-f3Gal, plasmid pDS100 was used. The tripartite fusion protein, which contains a C-terminal domain of lacZ', is regulated by the c1857repressor gene.

TGTGAGGTGAAGTATGTT 3' (Mu 303 to 320). MiniprepDNA was denatured with alkali or by boiling after linearizingwith HindIII. Sequencing reactions were done with theSequenase kit from U.S. Biochemicals and resolved byelectrophoresis through a 6% sequencing gel of 50% (wt/vol)urea, 6% acrylamide, and 0.3% bisacrylamide. The gel wasfixed in 10% methanol and 10% acetic acid and dried undervacuum.

Polymerase chain reaction cloning. To clone the regionencoding the N-terminal DNA-binding domain of repressor,two oligonucleotides, designated 1 and 2 in Fig. 1, weresynthesized. Oligonucleotide 1 has the sequence 5'GGGATCCAATAAGGAGTTTAAATTTTGAAGTCAATTTGGTGTTCG, which includes a BamHI site near the 5' end, thenormal repressor ribosome-binding site (underlined), theinitiating TTG codon (boldface), and sequence encodingrepressor amino acids Lys-13 to Ser-18. Oligonucleotide 2,5'GGGATCCCGCAATAACTTGCTCTCGTTCTTT, in-cludes a BamHI site and sequence complementary to repres-sor DNA encoding amino acids Lys-68 to Ile-74. Theseoligonucleotides were used to amplify a fragment ofMu viralDNA. Next, this fragment was cleaved with BamHI andcloned into plasmid pDS100 to make a repressor-lacZ fusionwith functional PiGal activity (24). The correct sequence of thefusion protein was confirmed by DNA sequence analysis.RNA preparations. To isolate RNA from Mu lysogens,

overnight cultures were diluted 1:100 into fresh LB-MT andgrown at 32°C to a density of 5 x 108 cells per ml. A 10-mlsample was withdrawn (t = 0), and the cultures weretransferred to prewarmed flasks at 42°C. The cultures wereincubated at 42°C, and RNA was isolated from 10-ml sam-ples as described previously (19). Transcription of antisenseRNA and S1 nuclease mapping of PE mRNA were done aspreviously described (19).

Repressor purification and binding assays. The cts62 re-pressor gene was cloned into the phage T7 promoter plasmidpGEM (Promega Biotec). The cts62 protein was produced inBL21 (DE3), which contains a single chromosomal copy ofthe T7 polymerase gene placed under lacUV5 promotercontrol (34). Isopropyl-,-D-thiogalactopyranoside (IPTG)(0.4 mM) was added to 28 liters of cells grown at 32°C to an

A6. of 1.0, and incubation was continued for 3 h. Cellsharvested by centrifugation were resuspended in an equalvolume/weight of ice-cold solution composed of 50 mM

Tris-Cl and 25% sucrose, pH 8.0, and stored frozen at-70°C. From this stage forward, the purification ofRep fromwild-type and cts62-bearing clones was carried out by meth-ods described previously (18). For DNA binding measure-ments, the repressor was diluted in a buffer composed of 10mM Tris-Cl (pH 7.5), 10 mM MgCl2, 50 mM NaCl, 1 mMdithiothreitol, and 100 ,ug of bovine serum albumin per ml.The 63-amino-acid N-terminal repressor-lacZ fusion pro-

tein was purified by affinity chromatography on a p-ami-nophenyl-p-D-thiogalactosidyl succinyldiaminohexyl-Seph-arose column, as described previously (9).Repressor binding reaction mixtures containing 10 mM

Tris-Cl (pH 7.5), 10 mM MgCl2, 50 mM NaCl, 1 mMdithiothreitol, and 5.5 x 10-11 M 32P-labeled pHKO9 opera-tor fragment were incubated with purified Mu repressor for15 min. After addition of HindIll, incubation was continuedfor 1 h at temperatures varying from 30 to 42°C. DNAfragments were resolved by electrophoresis in a 7.5% acryl-amide gel after addition of a one-fifth volume of 15% Ficoll,0.25% bromophenol blue, and 0.25% xylene cyanol. Bandswere visualized by autoradiography.

Hill plots. The cooperativity associated with stable repres-sor binding to 02 was calculated by using transcription dataand data derived from repressor-mediated protection of asite in 02 from HindIII cleavage. The Hill equation was usedto estimate the cooperativity for repressor-operator binding.However, information obtained from this plot is ambiguous.The standard explanation of cooperativity reflects the solu-tion structure of the protein, which is usually studied whensmaller ligands are bound. However, for large protein-DNAcomplexes, an equally valid view is that the DNA can beheld in a specific conformation by binding protein ligands.The following is a derivation of the Hill equation:

D + nP <-* DPn

KA = (DPn)l(D)(P)nDtot = D + DPn

KA = (DPn)/(D,0, - DPn)(P)n

(P)nKA = (DPn)/(Dt., - DPn)nlog(P) + logKA = log(DPn)I(D,0, - DPn)

where n is the number of repressor binding sites thatstabilize a given DNA conformation, D is free DNA, KA is

A Mu attL Mu repressor B

VOL. 173, 1991

on January 27, 2021 by guesthttp://jb.asm

.org/D

ownloaded from

6572 VOGEL ET AL.

TABLE 3. Nucleotide and amino acid sequence changesin Mu repressor

Base Codon Amino acidpaire change change

ctsl4, -29, -33, -48, 790 CGA--CAA Arg-47--+Gln-61, -62

cts25, -30 802 GGC- GAC Gly-43--Aspcts23, -41, -45, -74 877 TCG--TTG Ser-18- Leucts7l 846 ATG-+ATA Met-28--Ile

I Position on Mu sequence (29).

the apparent association constant, P is the concentration ofprotein, DPn is the concentration of DNA bound to proteinin a specific structure, and D,0, is the total concentration ofDNA. The slope (n) of a plot of log(P) versus log(DPn)/(1J.,- DPn) gives the Hill constant, or cooperativity number.Although n does not necessarily have a precise meaning inthe Mu operator system, two possibilities are that n eitherrepresents the number of DNA sites interacting in a partic-ular DNA conformation or is related to the solution structureof repressor that is competent for productive DNA binding.

RESULTS

Sequences of mutant repressors. Muc+ lysogens weremutagenized with either EMS or NTG. Mutants were alsoisolated from mutD Escherichia coli. Phage released aftergrowth of cells at 42°C were plated at 42°C, and clear-plaquemutants were picked. Those that produced clear plaques at42°C and turbid plaques at 30°C were saved as presumptivects mutants. DNA containing the left end of Mu DNA to aHindIII site at bp 1001 was cloned into either pUC18 orpUC19 (Table 2), and the DNA sequence was determined.Table 3 shows the codon and amino acid changes for all 13mutants. Only four changes were found, all restricted to theN-terminal quarter of the protein (Fig. 1).

Induction patterns of mutant repressors. Two assays wereused to measure transcription in vivo. First, the repressorend of Mu DNA with wild-type operator sites was fused tothe lac operon in plasmid vector pRS551 (Fig. 2B). Thisplasmid was designed to recombine with specialized X trans-ducing phage that can integrate in single copy at attB in theE. coli chromosome (32). In this configuration, the Murepressor regulates lacZ expression instead of Mu earlyfunctions. When the wild-type repressor was present(XJV300), only 20 U of PGal was made at 30 or 42°C. On theother hand, cts25, cts45, cts62, and cts7l repressors gavelarge increases in lacZ expression after shift to 42°C (Table4). The induction of cts62 was most dramatic. PGal activity

TABLE 4. Thermoinducibility of cts repressorsa

lacZ expression after thermoinduction of MC4100 lysogensInductiontime (min) XJV300 XJV302 XJV303 XJV304 XJV310

(c+) (cts25) (cts45) (cts62) (cts7l)

0 22 30 110 34 415 19 52 145 99 4010 20 159 531 403 22320 26 555 1,959 1,734 1,075

a pGal assays were carred out as described by Miller (22). The values arethe averages of two assays, and the ranges between samples were less than15% of the reported values.

-Jt-'I,T.

_ __~

FIG. 3. PE transcription after thermoinduction of lysogens ofcts62 and cts45. MH5361 (cts62) and MH5358 (cts45) lysogensgrown to a density of 5 x 108 cells per ml at 32°C in LB were shiftedto 42°C for 2, 4, or 8 min. Mu-specific RNA was measured byhybridization to 32P-labeled antisense RNA as described in Materi-als and Methods. In lane M, in vitro PE transcripts were used inhybridization as a positive control and marker. The high-molecular-weight bands at the top of the gels are due to Si-resistant RNAaggregates and are present in all lanes irrespective of whether MuRNA is present. The big dot in lane 0 is an artifact.

increased 3-fold within 5 min of temperature shift and rose51-fold after 20 min. Both cts25 and cts7l were induced alittle more slowly than cts62. The repressor most differentfrom cts62 was cts45, which made 100 U of IGal at 32°C andtook a few minutes longer to induce (see below).

Induction of early mRNA in Mu lysogens was also exam-ined. In this assay, RNA isolated from cells at different timesafter shift to 42°C was hybridized to a radioactive antisenseRNA probe complementary to 90 nucleotides at the 5' end ofthe PE transcript. The RNA-RNA hybrids were digestedwith Si nuclease and run on sequencing gels. Controlexperiments with strains lysogenic for wild-type Mu (c+)showed no detectable PE transcription at 32°C or after shiftto 42°C for 30 min (data not shown). Early RNA was alsonondetectable at t = 0 in lysogens carrying the cts25 andcts7l prophage (data not shown). Results for cts45 and cts62are shown in Fig. 3. In agreement with previous data (19),Mucts62 lysogens had nondetectable levels of PE transcriptat a low temperature. Within 2 min of temperature shift, PEwas active and the transcription increased for 8 min (Fig. 3).However, cts45 lysogens grown at 32°C contained easilydetected early transcripts. Consistent with this observation,Mucts45 lysogens had higher phage titers at 32°C than theother Mucts lysogens and Mucts45 lysogenized less fre-quently (35a). Although basal early transcription was rela-tively high in Mucts45 lysogens, thermoinduction took about2 min longer than in Mucts62 lysogens (Fig. 3).

cts62 repressor is defectivre for DNA binding in vitro. Whenrepressor binds Mu operator DNA, a HindIlI restriction site

J. BACTERIOL.

on January 27, 2021 by guesthttp://jb.asm

.org/D

ownloaded from

TEMPERATURE-SENSITIVE MUTATIONS IN A DNA-BINDING DOMAIN 6573

(a) No Rep bound Ct 02 03

EcoRI Hindill Hindlil- 02Cut

(b) Rep bound 01 02 03

EcoRI Hindill Hindill02 Uncut

Reps 62 at 34CC Repc +at 34C

w -n O N3 wco 0i 0 0 0x : i i 3 i, i co

___dIk

0_ :~4I~~IpSS_O-02 Uncut

.~~~~~~~~~~~~~~~C_°2Cut

FIG. 4. HindIll protection assays for Repc+ and Repcts62 at34°C. Plasmid pHKO9 contains a single EcoRI site and two HindIllsites as shown at the top. Substrate was prepared by linearizing withEcoRI and filling in the ends with [a-32P]dATP by using Klenowfragment of DNA Poll. In the absence of repressor, HindIlI diges-tion produces three fragments; the smallest labeled fragment runs atthe position marked 02 Cut. When repressor binds, the cleavagewithin 02 iS prevented and only two cleavage products are formed,one running at the position marked 02 Uncut. The indicatedconcentrations of repressor were incubated with 5.5 x 10 " Mend-labeled DNA for 15 min at 34°C. HindlIl restriction endonucle-ase (0.4 U) was added, and incubation was continued for 1 h. Theproducts displayed on a 7.5% polyacrylamide gel were visualized byautoradiography.

within 02 is protected from cleavage (18). Plasmid pHKO9contains a Mu operator cloned into the polylinker of pSP65(19) (Fig. 4). One HindIlI site lies in the polylinker region,and one site is in 02. To measure the apparent dissociationconstants (apparent KD) of c+ and cts62 repressors, weexamined the HindIlI cleavage pattern of pHKO9 afterincubation with various amounts of repressor. In this assay,the concentration of repressor that protects half the mole-cules from HindlIl cleavage at 02 gives the apparent KD. At34°C, the apparent KD was 3 to 5 nM for c+ repressor and125 to 150 nM for cts62 repressor (Fig. 4). The same assaywas then used to measure the apparent KD at 30, 37, and42°C (Table 5). At 30°C, 20-fold more cts62 protein than c+protein was required to block HindIII restriction. The dif-ference in binding became more pronounced at a higher

TABLE 5. DNA-binding affinities of wild-type Rep and Repcts62measured at different temperatures in vitro

Apparent KD (nM) for bindingTemp (CC) of repressors of:

c+ cts62

30 2.5 5034 4.0 13037 7.0 25042 25.0 >300

log [repressor]

FIG. 5. Hill plots of HindIll protection and transcription assays

of repressor binding. (A) HindIll protection data used to comparebinding of Repc+ (circles) and Repcts62 (squares) at 30°C. Thedatum points represent the averages of duplicate measurements inwhich the range was less than 15% of the indicated value. The Hillnumber for c+ is 2 and for cts62 is 6. (B) Hill plots of transcriptiondata of Krause and Higgins (19). To use transcription data, we

assumed that RNA synthesis is inversely proportional to repressor-DNA complex formation. The open circles are data for PE, and theclosed triangles are data for PCM. Characters in parentheses indicatethe experimental repressor concentration at which binding becametoo low to measure in the HindIll or transcription assay.

temperature, and a binding constant for cts62 could not bereliably determined at 42°C. These data show that cts62repressor has reduced DNA-binding capacity at all temper-atures compared with c+ repressor. Our previous report thatthe cts62 repressor binds stably at 42°C is in error (18). Thewild-type repressor was actually purified and analyzed in theprior study; the mistake was a bookkeeping error regardingthe phage from which the original clone was isolated.A second important difference was that, at 300C, c+

repressor gave partial HindIII protection from 3 to 10 nM.Repcts62 protection was focused over a very narrow frac-tional change in protein concentrations from 100 to 150 nM,indicating high cooperativity in DNA binding. The Hillequation (16) was used to estimate the cooperativity forrepressor-operator binding. With the HindIII protectiondata, Hill plots gave a slope of 2 for c+ and a slope of 6 forcts62 when binding reactions were carried out at 30°C (Fig.5). Another way to measure repressor binding is from PE andPCM transcription data. To evaluate our previously publishedtranscription data (19), we assume that RNA synthesis isinversely proportional to repressor-DNA complex forma-tion. Again, the c+ repressor gave a slope of 2 for PEtranscription. However, the slope of the curve for PCMtranscription was much greater than 2 and too steep tomeasure (Fig. 5).

Induction of cts62 in single-copy and multicopy configura-tions. The regulation of a PE lacZ fusion by cts62 repressorwas measured for both pJV304 and XJV304. The basal levelof expression from plasmid pJV304, which is maintained at20 to 30 copies per cell, was fourfold higher than thesingle-copy construct. But, surprisingly, lacZ expressionrose to only 1,300 U in strains carrying pJV304, while 3,000U was produced in cells containing XJV304 (Table 6). Thisexperiment was repeated several times, and expression was

always higher for constructs in single-copy configurations.

0o-a,0U,U) Q)0.

<0z a0*

z0

0)0

0

-9

VOL. 173, 1991

on January 27, 2021 by guesthttp://jb.asm

.org/D

ownloaded from

6574 VOGEL ET AL.

TABLE 6. Thermoinducibility of Repcts62 when cloned in amulticopy plasmid or in a single-copy X prophage'

lacZ expression after thermoinductionInduction time of XJV304 and pJV304at 42°C (min)

XJV304 pJV304

0 28 1325 114 23510 496 72120 1,503 1,27630 3,203 1,273

a Assays were carried out as described for Table 4. The values are theaverages of duplicate samples for which the ranges were less than 10%o of thereported values.

Thus, even at 42°C, Repcts62 has partial activity when itreaches the level made by strains bearing multicopy clones.An alternative explanation is that Mu operator DNA adoptsa less repressible conformation when it is on multicopyplasmids compared with when it is in a single-copy state inthe chromosome.

Isolation of a DNA-binding domain. To test whether thedomain near the Cts mutations is the operator binding site,we cloned DNA encoding a 63-amino-acid fragment ofwild-type repressor into the vector of Moskaluk and Bastia(24), which makes a fusion protein with lacZ' at the Cterminus (Fig. 2C). Since it was desirable to have as small aprotein as possible, we eliminated amino acids 2 to 12because these residues showed no homology with the Mutransposase (Fig. 1). Expression of the fusion protein frompJL100 is regulated by the ts X c1857 repressor. We testedthe ability of this fusion protein to confer Mu immunity asassayed by reduction of lysogenization of an infecting phage.After growth at 32, 37, or 42°C, cells were infected withMucts62pKn7701, which confers resistance to kanamycin.At 32°C, cells harboring pJL100 displayed weak immunity (a10-fold reduction in lysogenization frequency), which in-creased dramatically at higher temperatures; in cells grownat 37 or 42°C carrying pJL100, the Mu lysogenization fre-quency was reduced 1,000-fold compared with the frequencyin cells containing the parental plasmid pDS100 (Table 7).

Since it was possible that this repressor fragment alteredlysogenic development by a mechanism other than throughbinding to Mu operator DNA, we purified the fusion proteinand tested its ability to bind the Mu operator at 32°C in vitroby using the HindIII protection assay (Fig. 6). The fusionprotein was roughly as efficient in vitro as Repcts62, bindingwith an apparent KD of 125 nm, although its in vivo activitymay be lower than that of Repcts62 (see below).

TABLE 7. Rep63-PGal confers Mu immunity in vivoa

Growth Lysogens per ml of infected culture:temp (°C) MC4100(pDS100) MC4100(pJL100)

32 5 x 106 2 x 10537 1 x 106 2 x 10342 2 x 106 1 X 103

a Exponential cultures containing the vector plasmid pDS100 or the Rep63-,BGal fusion plasmid pJL100 were grown for 3 h at 32, 37, or 42°C, infectedwith Mucts62pKn7701 phage, and incubated for 30 min at 32°C. Cells werewashed and resuspended in medium containing 20 mM ethylene glycol-bis(p-aminoethyl ether)-N,N,N',N'-tetraacetic acid (EGTA) to block phage adsorp-tion. After 2 h ofgrowth at 32°C, aliquots were plated on LB plates containing50 p.g of kanamycin per ml.

*a_afth-mdub

-o go_ am,

FIG. 6. Binding of Rep63-,3Gal to Mu operator DNA. HindlIlprotection assays were carried out as described in the legend for Fig.4. pHKO9 DNA labeled at the unique EcoRI site (19) is shown in thefirst lane; minor bands were due to relaxed cleavage specificity(Eco* activity) of the enzyme used to make this particular substrate.In the presence of 240 nM of Repc+ there was complete inhibition of02 HindIII cleavage (third lane). Prior to digestion with HindIII, theDNA samples in lanes a to e were incubated with Rep63-pGal at thefollowing concentrations: a, 8 nM; b, 13 nM; c, 25 nM; d, 125 nM;e, 250 nM.

DISCUSSIONA DNA-binding domain near the repressor N terminus. To

understand the mechanism of Mu Rep action, we isolated tsmutants after EMS, NTG, and mutD mutagenesis. All ge-netic changes producing a lysogenic ts phenotype were in thec gene. When these repressors were cloned next to a Muoperator regulating lacZ, each mutant modulated ts pGalexpression (Table 4). From 13 independent mutants, onlyfour amino acid substitutions clustered in the N-terminalquarter of the repressor were found, suggesting that we maybe close to saturating the c gene for GC-AT transitions thatimpart a ts phenotype.The change of R47-*Q accounted for nearly half of the ts

mutants. One of these alleles, cts62, has been incorporatedinto most of the widely used Mu and Mudlac derivatives(35). At 30°C in moderate salt buffer, the apparent KD forcts62 binding to Mu 02 DNA was 20-fold higher than that ofc+, and at higher temperatures the affinity differential be-came much more pronounced (Table 5). The simplest expla-nation is that Repcts62 has a weakened DNA-binding do-main. Support for the notion of a DNA-binding domain nearthe cts62 mutation was provided by construction of Rep63-PGal. This protein fusion, with only 63 amino acids of theN-terminal Mu repressor headpiece joined to a C-terminaldomain of PGal, conferred Mu immunity in vivo (Table 7).

Repressor motifs. We know where the DNA-binding do-main is, but we do not know how Rep binds DNA. There isan extensive conservation of sequence within the N-terminalsegments of Mu repressor and Mu transposase (13, 23);amino acids 35 to 55 in transposase match 12 of 21 positionswhen aligned with Rep residues 47 to 67. It is notable thatcts25, cts62, and cts45 mutations all alter conserved aminoacids (Fig. 1). The cts25 change from Gly-43-+Asp adds aside chain and a negative charge four amino acid residuesaway from the site of the cts62 mutation. Changes ofGly-+Asp were found in other ts mutations such as phage T4

J. BACTERIOL.

on January 27, 2021 by guesthttp://jb.asm

.org/D

ownloaded from

TEMPERATURE-SENSITIVE MUTATIONS IN A DNA-BINDING DOMAIN

A P.,

pAe E

-10 -35

IHF

P

-10 E

-10 -35

B

P-3E

-1 0 -35

CIHF IHF

c

FIG. 7. Loop-solenoid model for regulation of PE and PCM promoters. In the looping model for Mu operator function, three loops havedifferent transcriptional potentials. (A) Mu operator DNA is depicted as a loop, which is stabilized by integration host factor binding at theapex. This loop is competent for transcription from both promoters. DNA is phased so that a repressor dimer can bind at arrow 1, whichwould block HindIII and RNA polymerase access to PE. The 10.5-bp period of the helix is marked with dots, and consensus Rep-binding sitesare boxed. The directions of transcription from PE and PcM promoters are shown by arrows, and the initiating triplets for the ner protein andthe c repressor are marked by triangles with the point of the triangle along the DNA axis indicating the direction of translation. (B) In thisloop, repressor is bound to three sites in 01 and three sites in 02- Consensus sites occupied by a Rep protomer are shaded, and cross-linksare shown between dark shaded consensus sites by arrows 1 and 2. In this configuration, PE is off but PcM remains active. (C) Repressoroccupancy of nine consensus sites makes a solenoid with repressor cross-links at arrows 2 and 3. When operator DNA adopts the solenoidconformation, both PE and PcM promoters are inactive.

lysozyme (12), E. coli ribosomal protein L24 (26), phage P22tail spike endorhamnosidase (37), and in helix 3 of X repres-sor, in which it reduces repressor affinity for DNA binding(14, 25). But the ts changes are not within a protein motif thatwe can identify. It has been suggested that Mu repressor isrelated to the helix-turn-helix family of repressors (13), butRep fits this motif poorly at several important determinantsof structure in helix-turn-helix proteins. There is an extraamino acid in the turn between helices, and the recognitionhelix suggested for Rep has a helix-breaking proline (Fig. 1).The Mu consensus, which appears nine times in the operatorregion, can be written as CTTTTNNNWWW, where N canbe any nucleotide and W represents A or T. This is anunusual recognition site, so Mu Rep may have a novelDNA-binding mechanism.Whereas the C-terminal catalytically active portion of

IGal can supply Rep63 with the protein-protein interactionsneeded for repressing Mu transposition in vivo, we do notknow where the repressor domain that normally fulfills thisrole is. The central region is leucine rich, with a segmentfrom Leu-135 to Leu-156 that adheres to the rules forforming a coiled-coil dimerization domain with the L-zippermotif (17) (Fig. 1). This region could direct protomer-protomer interactions.

Cooperativity and looping. Why is the Mu operator solarge, and what is the role of repressor bound to O1? Onesuggestion is that 01 regulates a repressor promoter termedPc1 (11). Pc1 was proposed because an RNA transcript,which was presumed to initiate at bp 885, was detected invivo and repressor was thought to start with Met encoded byAUG at bp 863 (29). But Rep translation actually starts at a

TTG codon at bp 931, which means that there are 22 aminoacids more at the protein N terminus and Pc1 is actuallyinside the repressor gene. This extension was revealed bythe location of the cts45 mutation (Fig. 1) and by sequencingthe repressor protein (22a).We propose a model in which O1 provides sites for DNA

looping (Fig. 7). According to the model, two differentproteins stabilize a small DNA loop that limits rotation ofDNA along its central axis. Figure 7A shows a previouslyproposed loop stabilized by integration host factor bound atthe apex (15); in the absence of repressor, this loop iscompetent for transcription from both PE and PCM. The DNAhelix is phased so that repressor protomers can bind simul-taneously to O1 and 02 and form a cross-link at the arrow.The cross-linked loop is blocked for PE transcription, butPcM transcription is allowed. The reason Repcts62 cannotstabilize a loop with only a pair of Rep protomers is thatRepcts62 has diminished DNA-binding activity. But in addi-tion to the cross-loop interactions, cooperative interactionsbetween repressors bound next to each other along the DNAhelix are possible. Repressor consensus sites are spaced at15-bp intervals, so two adjacent repressor molecules appearon opposite faces of the DNA. Formation of two cross-linksbetween 01 and 02 (shown in Fig. 7B) can occur whenrepressors occupy six sites, three each in 01 and 02. Whenall seven sites in 01 and 02 are filled, a new arrangement ispossible with repressor bound at O3. A loop with nine sitesoccupied by repressors is blocked for transcription fromboth PE and PcM (Fig. 7C).Evidence for the model is suggested by a novel interpre-

tation of the Hill plots (Fig. 5). Classically, a Hill plot is used

VOL. 173, 1991 6575

on January 27, 2021 by guesthttp://jb.asm

.org/D

ownloaded from

6576 VOGEL ET AL. J. BACTERIOL.

to infer the solution structure of a protein by estimatingcooperativity of binding of a small ligand. Analysis ofoxygen binding to hemoglobin gives a Hill plot slope at themidpoint of the oxygen binding curve of between 3 and 4;this effect is commonly attributed to the fact that hemoglobinis a tetramer in solution. However, in Rep-DNA interac-tions, the Hill slope could indicate the number of sites inconformationally flexible operator that becomes locked intoone particular structure by Rep ligands (see Materials andMethods for a derivation of the Hill equation). Whereas wecannot prove which interpretation is correct, or even thateither is correct, the DNA site interpretation makes sense inour model.

Accordingly, the slope of 2 for Rep inhibition of HindIIIcleavage and for PE transcription (Fig. 5) indicates thatwild-type repressor can stabilize a loop by using only onesite in 01 and one in 02 (i.e., a repressor pair binding atpositions shown by arrow 1 in Fig. 7A). Repcts62 is dimin-ished in DNA-binding activity and so needs six sites tostabilize a loop, three repressors binding in 01 and three in02 (Fig. 7B). The very high cooperativity (>6) associatedwith inhibition of PCM transcription is caused by a differentorganization of sites with cross-links between 01 and 02 andbetween 01 and 03 (Fig. 7C). Two strong predictions of theloop model should be tested. If sites in 01 are eliminated orenfeebled, then (i) PcM transcription in a Mu lysogen shouldincrease because of the difficulty of forming a solenoid and(ii) cts62 repression Of PE should diminish.How good a repressor is Rep63-OGal? Although Rep63-

PGal had a lower affinity for operator DNA than the wild-type repressor, it bound Mu DNA specifically in vitro almostas well as Repcts62 (Fig. 6). When cells harbored pJL100and Rep63-3Gal was induced to high levels (1,400 U of ,3Galactivity) by growing cells at 42°C prior to Mu infection, thelysogenization frequency fell about 1,000-fold, indicatingthat the fusion protein conferred high-level immunity. How-ever, to assess how well Rep63-PGal works in vivo, it isnecessary to compare its abundance and immunity level withthat produced by a full-length repressor in a Mu lysogen.Although there is currently no direct way to make thiscomparison, we can make an estimate by using severaldifferent kinds of information.Mucts62pKn7701 normally lysogenizes E. coli in about 1%

of infected cells. The lysogenization frequency drops about1,000-fold when Mu infects a c' or cts62 lysogen at 32°Cbecause enough Rep is present to block early transcriptionfrom the incoming virus (3, 15a). From comparisons ofWestern blots (immunoblots) with known amounts of puri-fied repressor, we estimated that both c' and cts62 lysogenscontain 25 to 50 repressor protomers per bacterium (35a).The specific activity of pure Rep63-,Gal is approximately106 U/mg (38), which is comparable to that of pure lacZ PGal(22). For cells grown at 32°C, there was about 200 U offusion protein PGal activity, which corresponds to about 400protomers of Rep63-,3Gal per cell. If cells with 400 pro-tomers of Rep63-3Gal are less immune to Mu infection thancells with fewer than 50 protomers of Rep, the fusion proteinis less than one-tenth as effective in vivo at 32°C as Repcts62or Repc+.

Rep-host interactions. Of wild-type Rep, Repcts62, andRep63-PGal in vivo, Repcts62 seems to perform better thanpredicted by its in vitro biochemical activity. One reason fora better-than-predicted performance of Repcts62 in vivo maybe that interactions with host factors strengthen Mu repres-sion. The abundant chromosomal protein H-NS stabilizesMucts62 repression in vivo as well as in vitro (8), and the

mechanism of H-NS stabilization might involve interactionsbetween H-NS and a protein domain that was eliminatedfrom Rep63-PGal. Finally, there are two genetic reasons tothink that the repressor C terminus is important. (i) Deletionof 10 or 18 C-terminal amino acids from Repcts62 suppressesits ts phenotype in vivo (35b). (ii) A +2 frameshift mutationnear the C terminus turns Mu repressor into an antirepressor(10). Further genetic and biochemical studies are needed tolearn how Mu repressor interacts with host proteins and tounderstand why Rep and transposase share ancestry.

ACKNOWLEDGMENTS

This work was supported by grant GM33143 from the NationalInstitutes of Health. J.L.V. was supported by NIH training grantGM08111. Work in Rhode St Gentse was supported by the EECStimulation Program (ST2J-0048-1-B[CD]) and the Belgian Fonds dela Recherche Scientifique Medicale.

REFERENCES1. Appleyard, R. K. 1954. Segregation of lambda lysogenicity

during bacterial recombination in Escherichia coli K12. Genet-ics 39:429-439.

2. Birnboim, H. C., and J. Doly. 1979. A rapid alkaline extractionprocedure for screening recombinant plasmid DNA. NucleicAcids Res. 7:1513-1523.

3. Bourret, R. B., and M. S. Fox. 1988. Intermediates in bacterio-phage Mu lysogenization of Escherichia coli him hosts. J.Bacteriol. 170:1683-1690.

4. Bourret, R. B., and M. S. Fox. 1988. Lysogenization of Esche-richia coli him', himA, and himD hosts by bacteriophage Mu. J.Bacteriol. 170:1672-1682.

5. Campbell, A. 1961. Conditions for the existence of bacterio-phage. Evolution 15:153-165.

6. Casadaban, M. 1976. Transposition and fusion of the lac gene toselected promoters in E. coli using bacteriophage lambda andMu. J. Mol. Biol. 104:541-555.

7. Faelen, M. 1987. Useful Mu and mini-Mu derivatives, p. 309-316. In N. Symonds, A. Toussaint, P. van de Putte, and M. M.Howe (ed.), Phage Mu. Cold Spring Harbor Laboratory, ColdSpring Harbor, N.Y.

8. Falconi, M., J. Odle, D. Hillyard, C. Gulaerzi, and N. P. Higgins.1991. Mutations altering chromosomal protein H-NS inducephage Mu transposition. New Biol. 3:615-625.

9. Germino, J., J. G. Gray, H. Charbonneau, T. Vanaman, and D.Bastia. 1983. Use of gene fusions and protein-protein interactionin the isolation of a biologically active regulatory protein: thereplication initiator protein of plasmid R6K. Proc. Natl. Acad.Sci. USA 80:6848-6852.

10. Geuskens, V., J. L. Vogel, R. Grimaud, L. Desmet, N. P.Higgins, and A. Toussaint. 1991. Frameshift mutations in thebacteriophage Mu repressor gene can confer a trans-dominantvirulent phenotype to the phage. J. Bacteriol. 173:6578-6585.

11. Goosen, N., M. van Heuvel, G. F. Moolenaar, and P. van dePutte. 1984. Regulation ofMu transcription. II. The Escherichiacoli himD protein positively controls two repressor promotersand the early promoter of bacteriophage Mu. Gene 32:419-426.

12. Gray, T. M., and B. W. Matthews. 1987. Structural analysis ofthe temperature-sensitive mutant of bacteriophage T4 lyso-zyme, glycine 156-aspartic acid. J. Biol. Chem. 262:16858-16864.

13. Harshey, R. M., E. D. Getzoff, D. L. Baldwin, J. L. Miller, andG. Chaconas. 1985. Primary structure of the phage Mu trans-posase: homology to Mu repressor. Proc. Natl. Acad. Sci. USA82:7676-7680.

14. Hecht, M. H., H. C. M. Nelson, and R. T. Sauer. 1983.Mutations in lambda repressor's amino-terminal domain: impli-cations for protein stability and DNA binding. Proc. Natl. Acad.Sci. USA 80:2676-2680.

15. Higgins, N. P., D. A. Collier, M. W. Kilpatrick, and H. M.Krause. 1989. Supercoiling and integration host factor changethe DNA conformation and alter the flow of convergent tran-

on January 27, 2021 by guesthttp://jb.asm

.org/D

ownloaded from

VOL. 173, 1991 TEMPERATURE-SENSITIVE MUTATIONS IN A DNA-BINDING DOMAIN 6577

scription in phage Mu. J. Biol. Chem. 264:3035-3042.15a.Higgins, N. P., and J. Vogel. Unpublished data.16. Hill, A. V. 1910. The possible effects of aggregation of the

molecules of hemoglobin on its dissociation curves. J. Physiol.40:4-10.

17. Hu, J. C., E. K. O'Shea, P. S. Kim, and R. T. Sauer. 1990.Sequence requirements for coiled-coils: analysis with lambdarepressor-GCN4 leucine zipper fusions. Science 250:1400-1403.

18. Krause, H. M., and N. P. Higgins. 1984. On the Mu repressorand early DNA intermediates of transposition. Cold SpringHarbor Symp. Quant. Biol. 49:827-834.

19. Krause, H. M., and N. P. Higgins. 1986. Positive and negativeregulation of the Mu operator by Mu repressor and Escherichiacoli integration host factor. J. Biol. Chem. 261:3744-3752.

20. Krause, H. M., M. R. Rothweli, and N. P. Higgins. 1983. Theearly promoter of bacteriophage Mu: definition of the site oftranscript initiation. Nucleic Acids Res. 11:5483-5495.

21. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

22. Miller, J. H. 1972. Experiments in molecular genetics. ColdSpring Harbor Laboratory, Cold Spring Harbor, N.Y.

22a.Mizuuchi, K. Personal communication.23. Mizuuchi, M., R. A. Weisberg, and K. Mizuuchi. 1986. DNA

sequence of the control region of phage D108: the N-terminalamino acid sequence of repressor and transposase are similarboth in phage D108 and its relative, phage Mu. Nucleic AcidsRes. 14:3813-3825.

24. Moskaluk, C., and D. Bastia. 1988. DNA bending is induced inan enhancer by the DNA-binding domain of the bovine papillo-mavirus E2 protein. Proc. Natl. Acad. Sci. USA 85:1826-1830.

25. Nelson, H. C. M., M. H. Hecht, and R. T. Sauer. 1982.Mutations defining the operator-binding sites of bacteriophagelambda repressor. Cold Spring Harbor Symp. Quant. Biol.47:441-449.

26. Nishi, K., M. Muiller, and J. Schnier. 1987. Spontaneous mis-sense mutations in the rp/X gene for ribosomal protein L24 fromEscherichia coli. J. Bacteriol. 169:4854-4856.

27. Pato, M., M. M. Howe, and N. P. Higgins. 1990. A DNA gyrase

binding site at the center of the bacteriophage Mu genomerequired for efficient replicative transposition. Proc. Natl. Acad.Sci. USA 87:8716-8720.

28. Pato, M. L. 1989. Bacteriophage Mu, p. 23-52. In D. E. Bergand M. M. Howe (ed.), Mobile DNA. American Society forMicrobiology, Washington, D.C.

29. Priess, H., D. Kamp, R. Kahmann, B. Brauer, and H. Delius.1982. Nucleotide sequence of the immunity region of bacterio-phage Mu. Mol. Gen. Genet. 186:315-321.

30. Ross, W., S. H. Shore, and M. M. Howe. 1986. Mutants ofEscherichia coli defective for replicative transposition of bacte-riophage Mu. J. Bacteriol. 167:905-919.

31. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc-ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci.USA 74:5463-5467.

32. Simons, R. W., F. Houman, and N. Kleckner. 1987. Improvedsingle and multicopy lac-based cloning vectors for protein andoperon fusions. Gene 53:85-96.

33. Singer, E. R., and J. Well. 1968. Recombination in bacterio-phage 1. I. Mutants deficient in general recombination. J. Mol.Biol. 34:261-271.

34. Studier, F. W., and B. A. Moffatt. 1986. Use of bacteriophage T7RNA polymerase to direct selective high-level expression ofcloned genes. J. Mol. Biol. 189:113-130.

35. van Gisegem, F., A. Toussaint, and M. Casadaban. 1987. Mu asa genetic tool, p. 215-250. In N. Symonds, A. Toussaint, P. vande Putte, and M. M. Howe (ed.), Phage Mu. Cold Spring HarborLaboratory, Cold Spring Harbor, N.Y.

35a.Vogel, J. Unpublished data.35b.Vogel, J., P. Higgins, L. Desmet, V. Geuskens, and A. Toussaint.

Unpublished data.36. Yamamoto, K., and B. M. Alberts. 1970. Rapid bacteriophage

sedimentation in the presence of polyethylene glycol and itsapplication to large-scale virus purification. Virology 40:734-744.

37. Yu, M.-H., and J. King. 1984. Single amino acid substitutionsinfluencing the folding pathway of phage P22 tail spike en-dorhamnosidase. Proc. Natl. Acad. Sci. USA 81:6584-6588.

38. Zhu, J. L. Unpublished data.

on January 27, 2021 by guesthttp://jb.asm

.org/D

ownloaded from