APPLIED AND ENVIRONMENTAL MICROBIOLOGY, June 2010, p. 3869–3877 Vol. 76, No. 120099-2240/10/$12.00 doi:10.1128/AEM.03083-09Copyright © 2010, American Society for Microbiology. All Rights Reserved.

TDP–L-Megosamine Biosynthesis Pathway Elucidation andMegalomicin A Production in Escherichia coli�

Mariana Useglio,1‡ Salvador Peiru,1‡ Eduardo Rodríguez,1* Guillermo R. Labadie,2John R. Carney,3# and Hugo Gramajo1

Microbiology Division, IBR (Instituto de Biología Molecular y Celular de Rosario), Consejo Nacional de Investigaciones Científicas yTecnicas, Facultad de Ciencias Bioquímicas y Farmaceuticas, Universidad Nacional de Rosario, Suipacha 531, S2002LRK Rosario,

Argentina1; IQUIOS (Instituto de Química Organica de Síntesis, Departamento de Química Organica), Facultad deCiencias Bioquímicas y Farmaceuticas, Universidad Nacional de Rosario, Suipacha 531, S2002LRK Rosario,

Argentina2; and Kosan Biosciences, Inc., 3832 Bay Center Place, Hayward, California 945453

Received 21 December 2009/Accepted 16 April 2010

In vivo reconstitution of the TDP–L-megosamine pathway from the megalomicin gene cluster of Micromono-spora megalomicea was accomplished by the heterologous expression of its biosynthetic genes in Escherichia coli.Mass spectrometric analysis of the TDP-sugar intermediates produced from operons containing different setsof genes showed that the production of TDP–L-megosamine from TDP–4-keto-6-deoxy-D-glucose requires onlyfive biosynthetic steps, catalyzed by MegBVI, MegDII, MegDIII, MegDIV, and MegDV. Bioconversion studiesdemonstrated that the sugar transferase MegDI, along with the helper protein MegDVI, catalyzes the transferof L-megosamine to either erythromycin C or erythromycin D, suggesting two possible routes for the productionof megalomicin A. Analysis in vivo of the hydroxylation step by MegK indicated that erythromycin C is theintermediate of megalomicin A biosynthesis.

Most of the deoxy sugars found in natural products belong tothe 6-deoxyhexose (6DOH) family (21). Since many of these6DOHs are essential for the bioactivity of natural compounds,extensive efforts have been made to investigate the relevantgenetics, enzymology, and mechanistic features of the biosyn-thetic pathways leading to these sugars. The amino sugar L-megosamine is found within a family of macrolide compoundsproduced by the actinomycete Micromonospora megalomicea,named megalomicins A (MegA) (structure 1), B, C1, and C2(Fig. 1A) (27). These compounds consist of a 14-memberedmacrolactone ring carrying three deoxy sugar residues, L-my-carose, D-desosamine, and L-megosamine. The megalomicincongeners differ from each other in the specific acetyl or pro-pionyl groups attached at the 3��� or 4��� hydroxyls of themycarose moiety. These macrolides were originally discoveredas antibacterial agents which inhibit protein synthesis throughselective binding to the bacterial 50S ribosomal subunit in amode similar to that of erythromycins and other macrolides(25). Due to the similarities with erythromycin in terms ofstructure, antibacterial activity, and pharmacological proper-ties, megalomicins did not receive much attention until antivi-ral and antiparasitic activities of these compounds were re-ported (1, 3). These studies demonstrated that megalomicinsinterfere with protein trafficking, resulting in an anomalous

protein glycosylation (4, 5) that affects the maturation of en-veloped viruses, including herpes simplex virus, Semliki Forestvirus, vesicular stomatitis virus, and more importantly the hu-man immunodeficiency virus type 1 (HIV-1) (1, 22). In HIVreplication, inhibition of gp160 protein processing to gp120and gp41 resulted in noninfectious virions (22). In addition,megalomicins also showed antiparasitic activity against the epi-mastigote stage of Trypanosoma cruzi, Leishmania spp., andPlasmodium falciparum, although in this case the mechanismof action still remains unclear (3).

The main structural difference between megalomicins anderythromycins is the presence of the L-megosamine sugarmoiety at C-6 (Fig. 1A). Since erythromycin does not exhibitantiparasitic and antiviral activities, the presence of thisadditional amino sugar in megalomicins could be associatedwith the differential properties of these compounds (1, 3).Due to the potential pharmacological relevance of megalo-micins and the lack of a detailed characterization of theL-megosamine biosynthetic pathway from the megalomicin(meg) gene cluster, an in-depth metabolic route study wasdeemed warranted.

Analysis of the overall organization of the meg gene clusterrevealed that L-megosamine biosynthesis genes are grouped to-gether within this gene cluster (Fig. 1B) (25). This was demon-strated by the heterologous expression of a 12-kb DNA fragmentthat included the putative megosamine biosynthesis genes in theerythromycin producer strain Saccharopolyspora erythraea, whichallowed the production of megalomicins in this host (25). Sixbiosynthetic steps were proposed for the biosynthesis of TDP–L-megosamine (L-Meg) (structure 2) from the intermediate TDP–4-keto-6-deoxy-D-glucose (TKDG) (structure 3). Neither the bio-synthesis pathway nor the enzymes involved in each catalytic stephave been confirmed.

Herein, the investigation focused on the biosynthesis of L-Meg

* Corresponding author. Mailing address: Microbiology Division,IBR, Consejo Nacional de Investigaciones Científicas y Tecnicas, Fac-ultad de Ciencias Bioquímicas y Farmaceuticas, Universidad Nacionalde Rosario, Suipacha 531, S2002LRK Rosario, Argentina. Phone: 54-341-4351235, ext. 117. Fax: 54-341-4390465. E-mail: erodriguez@ibr.gov.ar.

‡ These authors contributed equally to this work.# Present address: Solazyme, Inc., 561 Eccles Avenue, South San

Francisco, CA 94080.� Published ahead of print on 23 April 2010.

3869

on Novem

ber 20, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

from M. megalomicea by the heterologous expression of meggenes in Escherichia coli. The sequence of enzymatic reactionsimplicated in this pathway was confirmed by analyzing the TDP-sugar intermediates generated from the expression of operonscontaining different sets of genes. This methodology allowed thevalidation of a new pathway for the biosynthesis of L-Meg fromthe precursor TKDG through the use of five enzymatic steps.Bioconversion experiments furthermore demonstrated that the

attachment of L-megosamine to the macrolide intermediate re-quired both a specific glycosyltransferase and a helper protein.

MATERIALS AND METHODS

Bacterial strains, plasmids, and growth media. The bacterial strains andplasmids used in this study are shown in Table 1. Luria-Bertani (LB) medium wasused for the growth of E. coli strains. The following antibiotics were added to themedium when necessary: kanamycin (50 �g/ml) and chloramphenicol (20 �g/ml).

FIG. 1. (A) Structures of megalomicins and erythromycins. (B) Genetic organization of the meg gene cluster from M. megalomicea. A 12-kbfragment, including putative L-megosamine biosynthesis genes, is indicated.

TABLE 1. Strains and plasmids used in this study

Strain or plasmid Relevant genotype or descriptiona Source orreference

StrainsDH5� lacZ�M15 recA1 PromegaLB19b K207-3 �rmlC wecDE vioAB wzx acrAB 18

PlasmidspET24b E. coli expression vector, ColE1 ori, kan NovagenpLB29 megBVI in pET28a, kan 17pLB 132 megK in pET28a, kan 17pKOS506-72B megCIV-megCV-megDII-megDIIII-megCIII-ermE in PCDF1b, str 20pM1 megBVI- megDII-megDIII in pET28a, kan This workpM3 megDVI in pET28a, kan This workpM9 megBVI-megDII-megDIII-megDIVmegDVI-megDV-megDI in pET28a, kan This workpM19 megBVI-megDII in pET28a kan This workpM20 megBVI-megDII-megDIII-megDIV in pET28a, kan This workpM21 megBVI-megDII-megDIII-megDIV-megDV in pET28a, kan This workpM22 megBVI-megDII-megDIII-megDIV-megBIV in pET28a, kan This workpM30 megBVI-megDII-megDIII-megDIV-megDV-megDVI-ermE in pET28a, kan This workpM31 megBVI-megDII-megDIII-megDIV-megDV-megDI-ermE in pET28a, kan This workpM32 megBVI-megDII-megDIII-megDIV-megBIV-megDI-megCII-ermE in pET28a, kan This workpM34 megBVI-megDII-megDIII-megDIV-megDV-megCIII-megDVI-ermE in pET28a, kan This workpGro7 pBAD groES-groEL in pACYC184, cat Takara

a Abbreviations: kan, kanamycin resistance gene; str, streptomycin resistance gene; cat, chloramphenicol acetyltransferase gene.

3870 USEGLIO ET AL. APPL. ENVIRON. MICROBIOL.

on Novem

ber 20, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

DNA manipulation. DNA restriction enzymes were used as recommended bythe manufacturer (New England Biolabs). Standard protocols were used for therecombinant DNA techniques (21a). DNA fragments were purified from agarosegels using GFX PCR DNA and gel band purification kits (GE Healthcare).Plasmids were prepared using a QIAprep Spin Miniprep kit (Qiagen). DeepVent DNA polymerase was used in all PCRs according to the supplier’s instruc-tions (New England Biolabs).

Plasmid constructions. Three specific genes from the L-megosamine biosyn-thetic pathway were amplified by PCR using M. megalomicea genomic DNA asa template. Each PCR product was cloned into pCR-BluntII-TOPO (Invitrogen)and sequenced to confirm that it was free of errors. The 5� primers used weredesigned to have an NdeI site overlapping the translational initiation codon,changing GTG start codons to ATG when required. The 3� primers containedEcoRI and SpeI sites downstream of the stop codon. The following oligonucle-otides were used to clone the different meg genes: 5� GCATATGGTGGTGCTCGGCGCGTCGGGTTTC 3� (upper) and 5� CGAATTCACTAGTCAGGAGGGCTCGGACGGGGCGGC 3� (lower) for megDV; 5� ACATATGCGCGTCGTGTTTTCATCGATGGC 3� (upper) and 5� TGAATTCACTAGTCATCGCGGCAGGTGCGGCTCGGC 3� (lower) for megDI; and 5� TCATATGGCAGTTGGCGATCGAAGGCGGCT 3� (upper) and 5� TGAATTCACTAGTCTACAGCTCGACCGGGCAACGGCT 3� (lower) for megDVI. PCRs were carriedout using a DNA thermal cycler 480 (Perkin-Elmer) with the following cyclingparameters: 30 cycles of 30 s at 94°C, 30 s at 56°C, and 80 s at 72°C. The PCRproducts were digested with NdeI and EcoRI and cloned into identical sites ofthe pET24b or pET28a vector in order to express proteins with their natural Ntermini or as His tag fusions, respectively.

Megosamine operons were constructed by recursive ligation of XbaI/HindIIIfragments carrying downstream meg genes into the SpeI and HindIII sites ofvectors carrying one or more of the upstream genes of the operon being con-structed. Ligation of the XbaI and SpeI sites inserted a 43-bp sequence with anappropriately positioned ribosome binding site and destroyed both sites to allowthe next round of ligation. The process was repeated in a recursive fashion untilthe entire operon containing all genes in tandem was constructed. Plasmidscontaining the different sets of genes are shown in Table 1.

To incorporate the erythromycin resistance gene, ermE, into megosamineoperons, an XbaI/EcoRI DNA fragment from the vector pKOS342-96 wascloned into the acceptor megosamine operons digested with SpeI/EcoRI to givethe final plasmids listed in Table 1.

TDP-sugar analysis of cell extracts. E. coli strains were grown at 37°C in shakeflasks in LB medium and in the presence of the corresponding antibiotics forplasmid maintenance if required. Overnight cultures were diluted 1:100 in freshmedium and grown to an optical density at 600 nm (OD600) of 0.6 before theaddition of 2 mg/ml L-arabinose and 0.5 mM isopropyl-�-D-thiogalactopyrano-side (IPTG) when needed. Induction was allowed to proceed for 24 h at 23°C.The cells were harvested, resuspended in 20 mM Tris buffer (pH 7.6), anddisrupted by sonication. After centrifugation at 15,000 � g for 20 min, thesupernatants were analyzed by liquid chromatography-tandem mass spectrome-try (LC/MS/MS) for detection of TDP-sugars, as described previously (20).

Bioconversion experiments. E. coli strains harboring pGro7 and the differentexpression plasmids were cultured overnight at 37°C in LB with appropriateantibiotics and then subcultured by 1:100 dilutions in the same medium andgrown to an OD600 of 0.6. Chaperones and sugar gene expression were inducedby addition of 2 mg/ml L-arabinose and 0.5 mM IPTG, respectively, and cultureswere supplemented with 20 mg/ml of 3-�-mycarosyl-erythronolide B, erythromy-cin C, or erythromycin D and incubated at 23°C for 72 h. Cultures were clarifiedby centrifugation at 5,000 � g for 10 min, their pH values were adjusted to 9.5,and they were extracted with an equal volume of ethyl acetate. The organic layerwas separated and concentrated under vacuum, and the presence of bioconver-sion products was further analyzed by thin-layer chromatography (TLC) in asolvent system consisting of ethyl acetate, ethanol, and ammonia in a ratio of80:15:5.

Thin-layer chomatography. All bioconversions were monitored by TLC per-formed on silica gel 60 F254 precoated aluminum sheets (Merck), visualized by a254-nm UV lamp, and stained with an ethanolic solution of para-anisaldehyde.

Product purification. Compounds were purified by column flash chromatog-raphy using silica gel 60 (230 to 400 mesh; Merck) by isocratic elution with asolvent system consisting of hexane, ethyl acetate, and triethylamine in a ratio of10:10:1.

NMR experiments. Nuclear magnetic resonance (NMR) spectra were ac-quired at 300 MHz for 1H and at 75 MHz for 13C on samples dissolved on CDCl3with tetramethylsilane (TMS) for 1H and chloroform d for 13C as the internalreference.

LC-HRMS. Liquid chromatography high-resolution mass spectrometry (LC-HRMS) was recorded at UMYMFOR (University of Buenos Aires) on a BrukermicrOTOF-Q II mass spectrometer.

RESULTS

Analysis of TDP–L-megosamine biosynthesis pathway. Likemost 6DOHs, L-Meg is proposed to be synthesized from glu-cose-1-phosphate via the common intermediate TKDG (Fig.2A). This intermediate is also the biosynthetic precursor ofboth TDP–L-mycarose (L-Myc) (structure 4) and TDP–D-des-osamine (D-Des) (structure 5), and its synthesis in M. megalo-micea is catalyzed by the enzymes MegL and MegM (17).Based on previous knowledge of the biosynthesis of L-Myc andD-Des (17, 19, 20) and on the amino acid sequence similarity ofthe putative meg biosynthesis enzymes to other well-character-ized 6DOH biosynthetic proteins, the following pathway isproposed for the biosynthesis of L-Meg in M. megalomiceafrom the common intermediate TKDG (Fig. 2B). This biosyn-thetic route for L-Meg presents several differences from thatpreviously suggested by Volchegursky and coworkers (25).

The proposed biosynthetic route of L-Meg involves a 2,3-dehydratation of TKDG, followed by a 3-transamination, in asequence of reactions catalyzed by MegBVI and MegDII, re-spectively. MegBVI is the only 2,3-dehydratase present in themeg cluster, and it was demonstrated that this enzyme is in-volved in the C-2 deoxygenation step during the biosynthesis ofL-Myc, generating the intermediate TDP–2,6-dideoxy-3,4-diketo-D-glucose (structure 6) (19) (Fig. 2A). On the otherhand, MegDII is a 3-aminotransferase that catalyzes the trans-fer of an amino group to TDP–3-keto-4,6-dideoxy-D-glucose(structure 7) during the biosynthesis of D-Des (20) (Fig. 2A).MegDII also shares a high protein sequence similarity to EvaBfrom Amycolatopsis orientalis (80% similar and 70% identical),which is a 3-aminotransferase that converts TDP–2,6-dideoxy-3,4-diketo-D-glucose into TDP–3-amino-2,3,6-trideoxy-4-keto-D-glucose (structure 8) during the biosynthesis of TDP–L-epiv-ancosamine in this strain (8). Based on these observations, a2,3-dehydratation/3-transamination sequential mechanism cat-alyzed by MegBVI/MegDII is proposed to be similar to thatdescribed for EvaA/EvaB.

After the transamination mediated by MegDII, the nextbiosynthetic step proposed is an N,N dimethylation of TDP–3-amino-2,3,6-trideoxy-4-keto-D-glucose catalyzed by Meg-DIII, the only protein encoded in the meg gene cluster withsignificant similarity to N-methyltransferases. This enzyme hasalso been demonstrated to be involved in the biosynthesis ofD-Des, although using a different substrate (17) (Fig. 2A).

The final steps proposed for the biosynthesis of L-Meg in-volve a 5-epimerization reaction, followed by a 4-ketoreduc-tion (Fig. 2B). This epimerization step is believed to be cata-lyzed by MegDIV, the only 5-epimerase present in the megcluster, which also participates in the biosynthesis of L-Myc(Fig. 2A) (17). Two proteins sharing similarity to 4-ketoreduc-tases, MegBIV and MegDV, were also found to be encoded inthe meg gene cluster. Since MegBIV was previously demon-strated to take part in the biosynthesis of L-Myc (Fig. 2A) (17)and megDV is located in the megosamine “island” of the megcluster (Fig. 1B), the final reductive step in the biosynthesis ofL-Meg is expected to be mediated by MegDV.

VOL. 76, 2010 PRODUCTION OF MEGALOMICIN A IN ESCHERICHIA COLI 3871

on Novem

ber 20, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

In vivo characterization of TDP–L-megosamine pathway. Inorder to validate the proposed pathway for the biosynthesis ofL-Meg, several T7-derived expression vectors were constructedto contain the genes required for each biosynthetic step.megDI, megDV, and megDVI were then amplified and clonedfrom the meg gene cluster of M. megalomicea. These genes andthe previously characterized genes megBVI, megDII, megDIII,and megBIV (17) were assembled in different combinations togenerate alternative operons for the analysis of each biosyn-thesis step and transformed into the E. coli strain LB19b (18).This strain is a BL21(DE3) derivative strain that contains sev-eral modifications resulting in increased intracellular levels ofthe precursor TKDG. In this way, the L-Meg biosynthesis in-termediates accumulated by the expression of each operonwere analyzed by LC/MS/MS as previously described (20).

The first step proposed for the generation of L-Meg fromTKDG, catalyzed by MegBVI, is common to the L-Myc path-way and was already analyzed in a previous work (19). In thatstudy, the expression of MegBVI in E. coli resulted in the

consumption of TKDG, with no apparent production of adetectable TDP-sugar, a phenomenon explained by the spon-taneous decomposition of the expected TDP–2,6-dideoxy-3,4-diketo-D-glucose into maltol (7, 10). Therefore, to demonstratethe proposed dehydratation/transamination sequential stepscatalyzed by MegBVI/MegDII during L-Meg biosynthesis, thecoexpression of these proteins was analyzed using plasmidpM19 in LB19b (Table 1). The LC/MS/MS analyses of cellextracts obtained from these cultures did not show the pres-ence of any new TDP-sugar (Table 2). The absence of anydetectable intermediate could be due to the spontaneous de-composition of TDP–2,6-dideoxy-3,4-diketo-D-glucose, whichcould shift the equilibrium of the reversible transaminationreaction catalyzed by MegDII, leading to the net consumptionof the expected intermediate TDP–3-amino-2,3,6-trideoxy-4-keto-D-glucose (Fig. 2B). This degradation has been previouslyobserved in the in vitro characterization of the TDP–L-epivan-cosamine biosynthesis pathway using EvaB (8).

Additionally, the LC/MS/MS analysis of cell extract obtained

FIG. 2. (A) Schematic representation of the validated biosynthesis pathways of D-Des (structure 5) (20) and L-Myc (structure 4) (19) andreaction steps for the biosynthesis of L-Meg (structure 2), as previously proposed by Volchegursky and coworkers (25). (B) Reformulatedbiosynthesis pathway of L-Meg (structure 2) from TKDG (structure 3) (see the text for details). The enzymes involved during biosynthesis areshown. MegBIIb was originally named MegDVII (25). Glu-1-P, glucose-1-phosphate.

3872 USEGLIO ET AL. APPL. ENVIRON. MICROBIOL.

on Novem

ber 20, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

from cultures coexpressing MegBVI, MegDII, and MegDIII(plasmid pM1) showed the presence of an intermediate with aparent/daughter pair of m/z 556/321 (Table 2 and Fig. 3A).These data correspond to the expected intermediate TDP–3-N,N-dimethylamino-2,3,6-trideoxy-4-keto-D-glucose (structure9), thus confirming the three enzymatic steps proposed. Theaddition of the 5-epimerase encoded by megDIV in this operon(plasmid pM20) showed the presence of a compound with thesame parent/daughter ion pair and retention time as TDP–3-N,N-dimethylamino-2,3,6-trideoxy-4-keto-D-glucose. This re-sult indicates that both D and L epimers have the same reten-tion time under the high-pressure liquid chromatography(HPLC) condition assayed.

The final step proposed for the L-Meg biosynthesis route isthe reduction of TDP–3-N,N-dimethylamino-2,3,6-trideoxy-4-keto-L-glucose (structure 10) by MegDV. Although it was pre-viously demonstrated that MegBIV is involved in the biosyn-thesis of L-Myc (19), the participation of either MegDV orMegBIV as 4-ketoreductases in L-Meg biosynthesis still needsto be addressed. For this purpose, two different expressionvectors were constructed (pM21 and pM22), adding eithermegDV or megBIV to pM1, respectively. The expression ofeach plasmid was tested within the LB19b strain, and theproduction of L-Meg was evaluated by LC/MS/MS. Analysis ofcell extracts obtained from cells expressing pM21 showed thepresence of a TDP-sugar with a parent/daughter pair of m/z558/321, consistent with the expected mass for L-Meg (Fig. 3B).This TDP-sugar was not detected in cultures expressing pM22(data not shown), indicating that MegBIV acts specifically onthe L-Myc route and MegDV on the L-Meg pathway.

Overall, these results confirm our predicted scheme of re-actions for the biosynthesis of L-Meg and the meg genes in-volved.

Production of megalomicin A in E. coli. Once L-Meg is syn-thesized, the sugar moiety has to be attached to its macrolidesubstrate by a dedicated glycosyltransferase in order to gener-ate megalomicin (Fig. 4). Three putative glycosyltransferaseswere previously identified in the megalomicin gene cluster,megBV, megCIII, and megDI (25). MegBV is the glycosyltrans-ferase required for the attachment of L-Myc to erythronolide B(17), and MegCIII is the desosaminyltransferase that, togetherwith the helper protein MegCII, catalyzes the transfer of D-Desto 3-�-mycarosyl-erythronolide B (MEB) (20). These data sug-gest that MegDI should be the glycosyltransferase that at-taches L-Meg to the macrolide. Moreover, the presence ofmegDVI, located immediately upstream of megDI (Fig. 1B),which encodes a protein with homology to TDP–amino-sugar

transferase helper proteins (Table 2), suggests that MegDVIcould function as the helper protein of MegDI for the attach-ment of L-Meg. The requirement of an auxiliary protein hasbeen found in several TDP–amino-sugar transferase systems,although the exact function of this family of proteins remainsunclear (6, 11, 15, 16, 30).

The activities of these proteins were assayed through biocon-version experiments in cultures of strain LB19b harboring plas-mids containing the complete L-Meg biosynthesis genes plusmegDI (pM31), megDVI (pM30), or both megDI and megDVI(pM9) (Table 1). Based on the previously proposed megalomicinbiosynthesis pathway, the expected macrolide substrate for themegosaminyltransferase is erythromycin C (EryC) (structure 11)(Fig. 4) (25). Bioconversion experiments were then performed inshake flasks, supplementing the different cultures with 20 mg/literof EryC after the induction of the meg genes. Cultures wereincubated at 23°C for 72 h, and the fermentation broths wereanalyzed by TLC, MS/MS (Fig. 5A), and 1H NMR (13, 24). Theseanalyses confirmed the production of MegA only when MegDIwas expressed together with MegDVI, confirming the predictedrole of MegDI as L-megosamine transferase and MegDVI as itshelper protein.

To test the substrate specificity of each component of the

FIG. 3. LC/MS/MS analysis of TDP-sugars from cell extracts ofstrain LB19b expressing different biosynthesis operons: pM1 (A), re-sulting in the accumulation of TDP–3-N,N-dimethylamino-2,3,6-trideoxy-4-keto-D-glucose (structure 9), or pM21 (B), resulting in theaccumulation of L-Meg (structure 2).

TABLE 2. Analysis of masses expected for each set ofproteins expressed

Plasmid used Expectedcompound Parent/daughter (m/z) Detectiona

pLB132 6 527/321 NDpM19 8 528/321 NDpM1 9 556/321 DpM20 10 556/321 DpM21 2 558/321 DpM22 2 558/321 ND

a D, detected; ND, not detected.

VOL. 76, 2010 PRODUCTION OF MEGALOMICIN A IN ESCHERICHIA COLI 3873

on Novem

ber 20, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

two pairs of amino-sugar transferases (MegDI/MegDVI andMegCIII/MegCII) present in the meg cluster, bioconversionexperiments were carried out, combining the expression ofthese protein pairs, or combinations of their components, withdifferent sugar donors and macrolide acceptors. Replacementof megDVI with megCII in the megosamine operon (pM32)allowed the transfer of L-megosamine to EryC, producingMegA in bioconversion experiments with an efficiency similarto that when using pM9. Similarly, desosaminylation of MEBwas observed when megCII was replaced by megDVI in thedesosamine operon (plasmid pKOS506-72B plus pM3). How-ever, despite the high amino acid sequence similarity withinMegDI and MegCIII (77% similar and 65% identical) (Table2), replacement of megCIII with megDI in the desosamine

operon or megDI with megCIII in the megosamine operon didnot result in any bioconversion product (Table 3). These re-sults confirm that the auxiliary proteins do not contribute tothe specificity of the glycosyltransferase, although their pres-ence is essential for the reaction, as previously shown withother helper proteins (6, 11, 15, 16, 30).

Final steps in megalomicin A biosynthesis and generation ofa new megalomicin analog. Although it was demonstratedthat EryC is a macrolide acceptor for the megosaminyltrans-ferase pair MegDI/MegDVI, there is no experimental evi-dence that the attachment of D-desosamine or the C-12oxidation mediated by MegK occurs before the attachmentof the L-megosamine residue during megalomicin synthesis(Fig. 4). To assess whether this glycosylation step could also

FIG. 4. Schematic representation of two alternative biosynthesis pathways for the conversion of EryD (structure 12) into MegA (structure 1).

FIG. 5. MS/MS analysis of MegA and 12dMegA. (A) MegA, calculated for C44H81N2O15 (M�H�) � 877.56315, in agreement with previouslyreported data (14). (B) 12dMegA, calculated for C44H80NaN2O14 (M�Na�) � 883.55018.

3874 USEGLIO ET AL. APPL. ENVIRON. MICROBIOL.

on Novem

ber 20, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

take place with MEB or erythromycin D (EryD) (structure12) as substrates, bioconversion experiments were carriedout by supplementing culture broths of strain LB19b carry-ing the plasmid pM9 with 20 mg/liter of MEB or EryD.Cultures were incubated at 23°C for 72 h, and fermentationbroths were analyzed by TLC and MS/MS. These analysesshowed that only EryD is megosaminylated by MegDI/MegDVI, and this glycosylation results in the production ofa novel megalomicin analog, 12-deoxy-megalomicin A(12dMegA) (structure 13) (Fig. 5B). High-resolution MS/MSanalysis of pure 12dMegA gave a molecular ion of 861.56987,which is in agreement with a molecular formula ofC44H81N2O14 (M�H), which has a calculated mass of861.56878. This result indicates some degree of flexibilityof MegDI/MegDVI toward the aglycon substrate.

If the synthesis of megalomicin takes place through the at-tachment of L-megosamine prior to C-12 hydroxylation, theP450 hydroxylase MegK should also be flexible toward themacrolide substrate (Fig. 4, pathway B). In previous work, itwas demonstrated that MegK catalyzes the hydroxylation ofEryD in vivo (17). To evaluate if this enzyme can also catalyzethe conversion of 12dMegA into MegA, bioconversion exper-iments were performed with strain LB19b expressing MegKfrom plasmid pM132. Cultures were supplemented with 20mg/liter of 12dMegA after the induction of megK expressionand incubated at 23°C for 72 h. No detectable amounts ofMegA could be observed in culture extracts analyzed by TLCand MS/MS, indicating that no hydroxylation of 12dMegAtook place under the experimental conditions assayed (datanot shown). This result confirms that megosaminylation takesplace after MegK hydroxylates EryD during the final steps ofmegalomicin biosynthesis (Fig. 4, pathway A).

DISCUSSION

The characterization of deoxy sugar biosynthetic pathways isan essential task for the development of novel therapeuticdrugs through the modification of their glycosylation pattern.The present work elucidates the enzymatic steps and the en-zymes required for the biosynthesis of the deoxy sugar L-Megand its transfer to the acceptor macrolide, a crucial step in thesynthesis of the antibacterial, antiviral, and antiparasiticpolyketides megalomicins. Additionally, the biosynthesis path-way of L-Meg is reformulated on the basis of more-recent datareported for the biosynthesis of L-Myc and D-Des for M. mega-lomicea (17, 19, 20). Several reaction steps were experimentallyestablished and modified with respect to those previously sug-gested by Volchegursky and coworkers (25). The enzymes in-volved in L-Meg biosynthesis were mostly reassigned or, in the

case of MegBIIb (originally named MegDVII), finally ex-cluded. Validation of this new L-Meg biosynthetic pathway wasaccomplished through its reconstitution in the heterologoushost E. coli.

By comparing the gene organization of the left arm of themeg and ery clusters, Volchegursky and coworkers suggestedthat a megosamine biosynthesis “island” was formed via aninsertion of the megY and megD genes into an existing eryth-romycin or common ancestral gene cluster (Fig. 1B) (25). As aresult, several genes in the megosamine “island” might encodeproteins with redundant activities in relation to others presentin the cluster. This work proved that only the ketoreductaseMegDV and the glycosyltransferase MegDI are exclusivelydedicated to L-megosamine biosynthesis.

Current and previous studies (17, 19, 20) confirm that fourenzymes of the L-Meg route, MegDII, MegDIII, MegDIV, andMegBVI, also participate in one of the two other TDP-sugarpathways involved in the biosynthesis of megalomicins. Re-markably, these enzymes (with the exception of MegBVI) rec-ognize different sugar substrates in each pathway (Fig. 2),indicating an inherent tolerance for the sugar substrate. Therelaxed substrate specificity of these TDP-sugar enzymesshould facilitate combinatorial biosynthesis and provide sev-eral new models for exploring the structural basis of substraterecognition.

MegDII is a pyridoxal 5�-phosphate-dependent aminotrans-ferase that belongs to the subgroup DegT/DbrJ/EryC1/StrSof the aminotransferase family. This enzyme acts on two dif-ferent TDP–3-keto-sugar substrates. During L-Meg biosynthe-sis, MegDII utilizes 2,6-dideoxyhexose as a substrate (Fig. 2B),while it uses a 2,4,6-trideoxyhexose substrate during D-Desbiosynthesis (Fig. 2A) (20). Previous phylogenetic analysis us-ing amino acid sequence alignments of this subgroup of theaminotransferase family allowed the classification of this sub-family of proteins into three subgroups based on the positionof the amino receptor (12, 26). One subgroup of enzymes actson NDP–3-keto sugars (VI�), another on NDP–4-keto sugars(VI�), and the last one on a scyllo-inosose substrate (VI) (12).Figure 6 shows a new phylogenetic tree, where newly charac-terized SAT enzymes were included. The phylogenetic analysisof the VI� subgroup reveals two distinct branches in this sub-group. This subdivision is also supported by the different cat-alytic roles of these enzymes, where one branch utilizes NDP–3-keto-2,4,6-trideoxy sugar substrates (i.e., EvaB and DnrJ)while the other uses NDP–3-keto-2,6-dideoxy or NDP–3-keto-6-deoxy sugar substrates (i.e., EryCI, DesV, and TylB). Al-though MegDII clearly has a common ancestor from the NDP–3-keto-2,4,6-trideoxy subgroup, it has evolved to additionallycatalyze the transamination reaction using an NDP–3-keto-2,6-dideoxy sugar. This is the first in vivo report of a relaxedspecificity of this subgroup of SATs toward its amino acceptor.

MegDIII is an S-adenosylmethionine-dependent N,N-di-methyltransferase acting on two different substrates duringmegalomicin biosynthesis. The in vivo experiments conductedduring this investigation demonstrated that MegDIII catalyzesthe N,N dimethylation of TDP–3-amino-2,3,6-trideoxy-4-keto-D-glucose in L-Meg biosynthesis, while it uses TDP–3-amino-2,3,4,6-tetradeoxy-D-glucose for the biosynthesis of D-Des (20).So far, two methyltransferases have been biochemically char-acterized, DesVI from the pikromycin gene cluster of Strepto-

TABLE 3. Production of EryD or MegA using differentcombinations of glycosyltransferases and helper proteins

Substrates

Protein expressed

MegDI MegCIII

MegDVI MegCII MegDVI MegCII

D-Des � MEB EryD EryDL-Meg � EryC MegA MegA NDa

a ND, not detected.

VOL. 76, 2010 PRODUCTION OF MEGALOMICIN A IN ESCHERICHIA COLI 3875

on Novem

ber 20, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

myces venezuelae and TylM1 from the tylosin gene cluster ofStreptomyces fradiae (9). In vitro and in vivo studies revealedthat these enzymes also exhibit some tolerance for their sugarsubstrates, where TylM1 was able to N,N dimethylate theDesVI substrate and vice versa.

The 5�epimerase step catalyzed by MegDIV is anotherinteresting example of bifunctional enzymes encoded in themeg cluster. During L-Meg biosynthesis, this enzymeepimerizes TDP–3-N,N-dimethylamino-2,3,6-trideoxy-4-ke-to-D-glucose (Fig. 2), while it was previously demonstratedthat MegDIV is also responsible for the 5� epimerization of

TDP–3-methyl-4-keto-2,6-dideoxy-D-glucose in the L-Mycpathway (17).

Finally, this work conclusively determined that the attachmentof L-megosamine to its macrolide substrate is mediated by theglycosyltransferase pair MegDI/MegDVI. Similar glycosyltrans-ferase/auxiliary protein systems have already been described forseveral amino sugars, including the desosaminyltransferase pairMegCIII/MegCII, encoded in the meg cluster (6, 15, 20, 30).Bioconversion experiments confirmed EryC as its substrate dur-ing the biosynthesis of MegA. However, the MegDI/MegDVIpair was also capable of incorporating L-megosamine to EryD

FIG. 6. Phylogenetic tree of SAT family. Multiple alignments were performed using the Clustal W software program, and the tree wasconstructed using the MEGA 4 software program (23). Proteins (GenBank accession numbers) are as follows: VioA (AAD44154), AknZ(AAF73462), ArnB (AAM92146), AngB (AAG33854), CanA (CAC22113), Cj1121c (CAL35238), Cj1294 (AAT12282), DesV (AAC68680), DnrJ(B43306), EryCI (S06725), LmbS (CAA55764), MegDII (CAC3737809), Per (O07849), RfbE (CAA42137), StrS (CAA68523), SpcS2(AAD28492), StrS Sgl (CAA07383), StsC (CAA70012), TbmB (Q2MF17), TylB (S49052), WecE (AAC76796), WxcK (AAK53470), Med20(BAC79028), NbmG (AAM88356), KijD2 (ACB46490), EvaB (CAA11782), AclZ (BAB72037), TcaB8 (ACB37737), QdtB (AAR85519), OleN1(AAD55456), OleN2 (AAD55458), SpnR (AAG23279), DesI (AAC68684), EryCIV (YP_001102983), MegCIV (World patent WO2004/003169),PseC (NP_207164), PglE (YP_001000799), and ColD (NP_419828).

3876 USEGLIO ET AL. APPL. ENVIRON. MICROBIOL.

on Novem

ber 20, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

to produce a novel polyketide, 12dMegA. This substrate tol-erance is an important feature for the development of novelmegalomicin analogs, and it has already been successfully usedto generate new megosamine-containing macrolide derivativesthrough bioconversion experiments in E. coli (S. Peiru, unpub-lished results).

Although MegDI/MegDVI is able to megosaminylate bothEryC and EryD, opening the possibility of two alternativemegalomicin biosynthesis routes (Fig. 4), no hydroxylation of12dMegA by the P450 hydroxylase MegK was observed underthe conditions tested. Because neither 12dMegA nor any acylderivative of this compound could be detected in culturebroths obtained from the natural producer M. megalomicea(27), further investigation needs to be done to shed light onthese results.

Since 6DOHs are vital components of biologically activeglycoconjugates defining properties like solubility, efficacy, andspecificity (28), several in vivo and in vitro strategies, referredto as glycodiversification, have been established for the devel-opment of new therapeutic agents by modifying and/or ex-changing the sugar structures to enhance or alter the biologicalactivities of their parent molecules (2). However, the success ofthese approaches eventually depends on the tolerance of thebiosynthetic enzymes acting on unusual substrates, especiallythe glycosyltransferases, which are the enzymes responsible forthe addition of the sugar moieties to a scaffold (29). Enzymesfrom the meg cluster are a unique example of enzymes exhib-iting an important degree of natural substrate tolerance. Thebroad substrate specificity of these enzymes could make thema new tool for glycodiversification approaches toward the gen-eration of novel chemotherapeutic agents.

ACKNOWLEDGMENTS

This work was supported by ANPCyT grants 2006-01978 (to E.Rodrıguez) and 15-31969 (to H. Gramajo and E. Rodrıguez) and bygrant PIP 6436 from CONICET (to H. Gramajo).

REFERENCES

1. Alarcon, B., M. E. Gonzalez, and L. Carrasco. 1988. Megalomycin C, amacrolide antibiotic that blocks protein glycosylation and shows antiviralactivity. FEBS Lett. 231:207–211.

2. Blanchard, S., and J. S. Thorson. 2006. Enzymatic tools for engineeringnatural product glycosylation. Curr. Opin. Chem. Biol. 10:263–271.

3. Bonay, P., I. Duran-Chica, M. Fresno, B. Alarcon, and A. Alcina. 1998.Antiparasitic effects of the intra-Golgi transport inhibitor megalomicin. An-timicrob. Agents Chemother. 42:2668–2673.

4. Bonay, P., M. Fresno, and B. Alarcon. 1997. Megalomicin disrupts lysosomalfunctions. J. Cell Sci. 110(Pt. 16):1839–1849.

5. Bonay, P., S. Munro, M. Fresno, and B. Alarcon. 1996. Intra-Golgi transportinhibition by megalomicin. J. Biol. Chem. 271:3719–3726.

6. Borisova, S. A., L. Zhao, I. C. Melancon, C. L. Kao, and H. W. Liu. 2004.Characterization of the glycosyltransferase activity of desVII: analysis of andimplications for the biosynthesis of macrolide antibiotics. J. Am. Chem. Soc.126:6534–6535.

7. Chen, H., G. Agnihotri, Z. Guo, N. L. S. Que, X. H. Chen, and H.-w. Liu.1999. Biosynthesis of mycarose: isolation and characterization of enzymesinvolved in the C-2 deoxygenation. J. Am. Chem. Soc. 121:8124–8125.

8. Chen, H., M. G. Thomas, B. K. Hubbard, H. C. Losey, C. T. Walsh, andM. D. Burkart. 2000. Deoxysugars in glycopeptide antibiotics: enzymaticsynthesis of TDP-L-epivancosamine in chloroeremomycin biosynthesis.Proc. Natl. Acad. Sci. U. S. A. 97:11942–11947.

9. Chen, H., H. Yamase, K. Murakami, C. W. Chang, L. Zhao, Z. Zhao, andH. W. Liu. 2002. Expression, purification, and characterization of two N,N-dimethyltransferases, tylM1 and desVI, involved in the biosynthesis ofmycaminose and desosamine. Biochemistry 41:9165–9183.

10. Draeger, G., S.-H. Park, and H. G. Floss. 1999. Mechanism of the 2-deox-ygenation step in the biosynthesis of the deoxyhexose moieties of the anti-biotics granaticin and oleandomycin. J. Am. Chem. Soc. 121:2611–2612.

11. Hong, J. S., S. J. Park, N. Parajuli, S. R. Park, H. S. Koh, W. S. Jung, C. Y.Choi, and Y. J. Yoon. 2007. Functional analysis of desVIII homologuesinvolved in glycosylation of macrolide antibiotics by interspecies complemen-tation. Gene 386:123–130.

12. Hwang, B. Y., H. J. Lee, Y. H. Yang, H. S. Joo, and B. G. Kim. 2004.Characterization and investigation of substrate specificity of the sugar ami-notransferase WecE from E. coli K12. Chem. Biol. 11:915–925.

13. Jaret, R. S., A. K. Mallams, and H. Reimann. 1973. The megalomicins. IV.The structures of megalomicins A, B, C1, and C2. J. Chem. Soc. Perkin 113:1374–1388.

14. Jaret, R. S., A. K. Mallams, and H. F. Vernay. 1973. The megalomicins. V.Mass spectral studies. J. Chem. Soc. Perkin 1 13:1389–1400.

15. Lu, W., C. Leimkuhler, G. J. Gatto, Jr., R. G. Kruger, M. Oberthur, D.Kahne, and C. T. Walsh. 2005. AknT is an activating protein for the glyco-syltransferase AknS in L-aminodeoxysugar transfer to the aglycone of aclaci-nomycin A. Chem. Biol. 12:527–534.

16. Melancon, C. E., III, H. Takahashi, and H. W. Liu. 2004. Characterization oftylM3/tylM2 and mydC/mycB pairs required for efficient glycosyltransfer inmacrolide antibiotic biosynthesis. J. Am. Chem. Soc. 126:16726–16727.

17. Peiru, S., H. G. Menzella, E. Rodriguez, J. Carney, and H. Gramajo. 2005.Production of the potent antibacterial polyketide erythromycin C in Esche-richia coli. Appl. Environ. Microbiol. 71:2539–2547.

18. Peiru, S., E. Rodriguez, H. Menzella, J. Carney, and H. Gramajo. 2008.Metabolically engineered Escherichia coli for efficient production of glyco-sylated natural products. Microb. Biotechnol. 1:476–486.

19. Peiru, S., E. Rodriguez, C. Q. Tran, J. R. Carney, and H. Gramajo. 2007.Characterization of the heterodimeric MegBIIa:MegBIIb aldo-keto reduc-tase involved in the biosynthesis of L-mycarose from Micromonospora mega-lomicea. Biochemistry 46:8100–8109.

20. Rodriguez, E., S. Peiru, J. R. Carney, and H. Gramajo. 2006. In vivo char-acterization of the dTDP-D-desosamine pathway of the megalomicin genecluster from Micromonospora megalomicea. Microbiology 152:667–673.

21. Salas, J. A., and C. Mendez. 2007. Engineering the glycosylation of naturalproducts in actinomycetes. Trends Microbiol. 15:219–232.

21a.Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, NY.

22. San Jose, E., M. A. Munoz-Fernandez, and B. Alarcon. 1997. Megalomicininhibits HIV-1 replication and interferes with gp160 processing. Virology239:303–314.

23. Tamura, K., J. Dudley, M. Nei, and S. Kumar. 2007. MEGA4: MolecularEvolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol.Evol. 24:1596–1599.

24. Ton That, T., G. Lukacs, S. Omura, P. Bartner, D. L. Boxler, R. Brambilla,A. K. Mallams, J. B. Morton, and P. Reichert. 1978. Megalomicins. 6.Tertiary glycosidic macrolide antibiotics. A structural revision by carbon-13nuclear magnetic resonance and x-ray crystallography. J. Am. Chem. Soc.100:663–666.

25. Volchegursky, Y., Z. Hu, L. Katz, and R. McDaniel. 2000. Biosynthesis of theanti-parasitic agent megalomicin: transformation of erythromycin to mega-lomicin in Saccharopolyspora erythraea. Mol. Microbiol. 37:752–762.

26. Wang, Y., Y. Xu, A. V. Perepelov, Y. Qi, Y. A. Knirel, L. Wang, and L. Feng.2007. Biochemical characterization of dTDP-D-Qui4N and dTDP-D-Qui4NAc biosynthetic pathways in Shigella dysenteriae type 7 and Esche-richia coli O7. J. Bacteriol. 189:8626–8635.

27. Weinstein, M. J., G. H. Wagman, J. A. Marquez, R. T. Testa, E. Oden, andJ. A. Waitz. 1969. Megalomicin, a new macrolide antibiotic complex pro-duced by Micromonospora. J. Antibiot. (Tokyo) 22:253–258.

28. Weymouth-Wilson, A. C. 1997. The role of carbohydrates in biologicallyactive natural products. Nat. Prod. Rep. 14:99–110.

29. Williams, G. J., R. W. Gantt, and J. S. Thorson. 2008. The impact of enzymeengineering upon natural product glycodiversification. Curr. Opin. Chem.Biol. 12:556–564.

30. Yuan, Y., H. S. Chung, C. Leimkuhler, C. T. Walsh, D. Kahne, and S.Walker. 2005. In vitro reconstitution of EryCIII activity for the preparationof unnatural macrolides. J. Am. Chem. Soc. 127:14128–14129.

VOL. 76, 2010 PRODUCTION OF MEGALOMICIN A IN ESCHERICHIA COLI 3877

on Novem

ber 20, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from