targeting super-enhancer associated oncogenes in … · 2020-04-03 · many oncogenes, including...

CLINICAL CANCER RESEARCH | TRANSLATIONAL CANCER MECHANISMS AND THERAPY

Targeting Super-Enhancer–Associated Oncogenes inOsteosarcoma with THZ2, a Covalent CDK7 Inhibitor A CJiajun Zhang1, Weihai Liu1, Changye Zou1, Zhiqiang Zhao1,2, Yuanying Lai3, Zhi Shi4, Xianbiao Xie1,2,Gang Huang1,2, Yongqian Wang1,2, Xuelin Zhang1, Zepei Fan1, Qiao Su5, Junqiang Yin1,2, andJingnan Shen1,2

ABSTRACT◥

Purpose: Malignancy of cancer cells depends on the active tran-scription of tumor-associated genes. Recently, unique clusters oftranscriptional enhancers, termed super-enhancers, have beenreported to drive the expression of genes that define cell identity. Inthis study, we characterized specific super-enhancer–associated genesof osteosarcoma, and explored their potential therapeutic value.

Experimental Design: Super-enhancer regions were characterizedthrough chromatin immunoprecipitation sequencing (ChIP-seq). RT-qPCR was used to detect the mRNA level of CDK7 in patient speci-mens and confirm the regulation of sensitive oncogenes by THZ2. Thephosphorylation of the initiation-associated sites of RNA polymeraseII (RNAPII) C-terminal repeat domain (CTD) was measured usingWestern blotting. Microarray expression analysis was conducted toexplore transcriptional changes after THZ2 treatment. A variety ofin vitro and in vivo assayswere performed to assess the effects ofCDK7knockdown and THZ2 treatment in osteosarcoma.

Results: Super-enhancers were associated with oncogenictranscripts and key genes encoding cell-type–specific transcrip-tion factors in osteosarcoma. Knockdown of transcription factorCDK7 reduced phosphorylation of the RNAPII CTD, andsuppressed the growth and metastasis of osteosarcoma. A newspecific CDK7 inhibitor, THZ2, suppressed cancer biology byinhibition of transcriptional activity. Compared with typicalenhancers, osteosarcoma super-enhancer–associated oncogeneswere particular vulnerable to this transcriptional disruption.THZ2 exhibited a powerful anti-osteosarcoma effect in vitroand in vivo.

Conclusions: Super-enhancer–associated genes contribute tothemalignant potential of osteosarcoma, and selectively targetingsuper-enhancer–associated oncogenes with the specific CDK7inhibitor THZ2 might be a promising therapeutic strategy forpatients with osteosarcoma.

IntroductionOsteosarcoma is the most common primary malignant bone

tumor, and the second leading cause of cancer-related death inchildren and adolescents (1). Rapid tumor progression and earlymetastasis account for medical therapy failure and death in patientswith osteosarcoma. Currently, the 5-year survival rate has beenincreased to 60% to 70% with the use of neoadjuvant chemotherapy,but the rate is only 20% for patients with metastatic disease (2).Therapeutic outcomes remain unsatisfactory mainly because ofdelayed diagnosis, distant metastasis, and chemoresistance. Inaddition, standard adjuvant/neoadjuvant chemotherapy has no

significant antineoplastic effect in a portion of patients with oste-osarcoma (3). Furthermore, there have been no advances in over-coming chemoresistance in the past two decades (4). Much of theproblem is due to a lack of understanding of the mechanisms whichdrive the malignant properties of osteosarcoma. Thus, it is impor-tant to elucidate the pathogenesis of osteosarcoma and developmore effective treatment regimens.

Studies have shown that most cancer cells have a higher overalltranscriptional output than nonmalignant cells, allowing for moreopportunities to engage oncogenic pathways (5). The malignantproperties of tumors such as rapid proliferation, invasion, and metas-tasis require continually active transcription. Enhancers, cis-actingregulatory elements localized distal to promoters and transcriptionstart sites, play important roles in cell identity by controlling cell-type–specific patterns of gene expression, and there can be tens of thousandsactive in any one cell type (6–8). Studies have shown that theupregulated expression of tumor cell oncogenes is always associatedwith large clusters of transcriptional enhancers in close genomicproximity, which have been termed super-enhancers, and that tran-scription of oncogenes is particularly sensitive to the disruption ofsuper-enhancers (9–12).

Super-enhancers have been identified in many cell types, andrelations between super-enhancers, gene regulation, and disease havebeen identified (13, 14). Studies have shown that the transcription ofmany oncogenes, including MYC (15), STAT3 (9, 13), EGFR (10),and TAL1 (16), are related to super-enhancer activity. Some super-enhancer–associated oncogenes such as PAK4 (12) and INSM1 (11)have been identified as novel therapeutic targets. Furthermore, theexpression of most super-enhancer–associated genes can be blockedby selective inhibition of their super-enhancers.

Because the association between tumorigenesis and super-enhancers was reported in 2013 (9), studies have shown that super-

1Department of Musculoskeletal Oncology, The First Affiliated Hospital of SunYat-sen University, Guangzhou, China. 2Guangdong Provincial Key Laboratoryof Orthopedics and Traumatology, The First Affiliated Hospital of Sun Yat-senUniversity, Guangzhou, China. 3Department of Pharmacology, Medical College,Jinan University, Guangzhou, China. 4Department of Cell Biology & Institute ofBiomedicine, College of Life Science and Technology, Jinan University, Guangz-hou, China. 5Department of Animal Experiment Center, The First AffiliatedHospital of Sun Yat-sen University, Guangzhou, China.

Note: Supplementary data for this article are available at Clinical CancerResearch Online (http://clincancerres.aacrjournals.org/).

J. Zhang, W. Liu, C. Zou, and Z. Zhao contributed equally to this article.

Corresponding Authors: Jingnan Shen, The First Affiliated Hospital of Sun Yat-sen University, Zhongshan 2 Road, Guangzhou 510080, China. Phone:86 020 87335039; Fax: 86 20 87332150; E-mail: [email protected];Junqiang Yin, [email protected]; and Qiao Su, [email protected]

Clin Cancer Res 2020;XX:XX–XX

doi: 10.1158/1078-0432.CCR-19-1418

�2020 American Association for Cancer Research.

AACRJournals.org | OF1

Cancer Research. on October 30, 2020. © 2020 American Association forclincancerres.aacrjournals.org Downloaded from

Published OnlineFirst January 14, 2020; DOI: 10.1158/1078-0432.CCR-19-1418

http://crossmark.crossref.org/dialog/?doi=10.1158/1078-0432.CCR-19-1418&domain=pdf&date_stamp=2020-4-1http://crossmark.crossref.org/dialog/?doi=10.1158/1078-0432.CCR-19-1418&domain=pdf&date_stamp=2020-4-1http://clincancerres.aacrjournals.org/

enhancers play a role in many cancers, including breast (17, 18),colon (13, 17), lung (9, 11), brain (19), liver (20, 21), prostate (13), andpancreatic (22) cancer, as well as various types of leukemia (13, 23–25).However, the role of super-enhancers in osteosarcoma is largelyunknown.

Super-enhancers are occupied by an unusually large portion of theenhancer-associated RNA polymerase II (RNAPII), cofactors, andchromatin regulators. Genes that are dependent on the high tran-scriptional activity of super-enhancers are exquisitely susceptible toalterations of transcription (9, 26). CDK7 is a cyclin-dependent kinase(CDK) and a subunit of the multiprotein basal transcription factorTFIIH. It has been implicated in the regulation of cell-cycle progres-sion and regulation of transcription, where it phosphorylates the C-terminal domain (CTD) of RNAPII (27, 28). Recent studies haveshown that super-enhancer–associated genes are particularly sensitiveto small perturbations in RNAPII-mediated transcription and CDK7kinase function (29). A newly developed molecular inhibitor, THZ2,can completely inhibit the phosphorylation of the intracellular CDK7substrate RNAPII CTD at Ser-2, -5, and -7 through irreversiblecovalent binding to CDK7 (10). It has been reported that THZ2 cansuppress the growth of triple-negative breast cancer (30) and gastriccancer (31). However, the anticancer effect of THZ2 in other cancers isstill unknown.

In this study, we delineated the super-enhancer landscape inosteosarcoma cells on the basis of H3K27ac signal intensity bychromatin immunoprecipitation sequencing (ChIP-seq; ref. 13). Onthe basis of the sensitivity of super-enhancer–associated genes totranscriptional disruption and the high expression of CDK7 in oste-osarcoma specimens frompatients, we explored the anti-osteosarcomaeffects of CDK7 inhibition by short hairpin RNA (shRNA) and THZ2.Microarray expression analyseswere performed to detect transcriptionalterations after treatment with THZ2, and it was found that THZ2selectively suppressed super-enhancer–associated genes which areenriched in processes important to cancer biology. A variety ofin vitro and in vivo cellular assay were preformed to assess theantitumor effects of THZ2.

Materials and MethodsHuman cell lines

Human osteosarcoma cell lines SJSA-1, U2-OS, HOS, G-292,MNNG/HOS, 143B and MG-63, the osteoblast cell line hFOB1.19,and HEK-293T cells were obtained fromATCC. U2OS/MTX300 cells,amethotrexate-resistant derivative of theU2-OS human osteosarcomacell line, were kindly provided by Dr. M. Serra (Instituti OrtopediciRizzoli, Bologna, Italy). The ZOS and ZOS-M cell lines, derived from aprimary osteosarcoma tumor and metastasis, respectively, have beendescribed previously (32). All of the cells used were authenticatedbefore experiments, and were cultured according to instructions fromATCC.

Compounds and reagentsTHZ2, a novel covalent inhibitor of CDK7, was a gift fromProfessor

Zhi Shi (National Engineering Research Center of Genetic Medicine,Jinan University, Guangzhou, China; 510632). Antibodies againstH2K27ac (#ab4729), b-actin (#ab8227), Cyclin D1 (#ab134175), andtotal/cleaved-PARP (#ab191217) were purchased from Abcam. Anti-bodies against RNAPII (#A300-653A), RNAPII-CTD-SER2 (#A300-654A), and RNAPII-CTD-SER5 (#A304-408A) were purchased fromBethyl Laboratories. Antibodies against RNAPII-CTD-SER7 (#04-1570-I) were purchased from Millipore. Antibodies against CDK7(#2916T) and P21 (#2947P) were purchased from Cell SignalingTechnology.

Chromatin immunoprecipitation and sequencing data analysisThe ChIP assays were performed according to the manufacturer's

instructions (Millipore). In brief, U2-OS and SJSA-1 cells were cul-tured at 37�C in 5%CO2, andwere cross-linked with 1% formaldehydeat room temperature for 10minutes followed by neutralization withglycine. Cells were resuspended, lysed in lysis buffer, and sonicated onice to shear most DNA to 200 to 750 bp. Magnetic beads were boundwith 10 mg of the indicated antibody (anti-H3K27ac, #ab4729;Abcam). For immunoprecipitation, sonicated chromatin solutionswere incubated at 4�C overnight with magnetic beads bound withantibody to enrich for DNA fragments bound by the indicatedantibody. Beads were washed three times with sonication buffer, andtwo times with low stringency wash buffer. DNA was eluted in elutionbuffer. RNA and protein were digested using RNase A (#70856;Millipore) and Proteinase K, respectively, and DNA was purified withphenol chloroform extraction and ethanol precipitation.

Illumina sequencing libraries were generated, and data were pro-cessed as described by Lin and colleagues (5). In brief, libraries weregenerated for ChIP samples following theNEBNextUltraDNALibraryPrep Kit for Illumina protocol. The reads that passed the prefilteringstep were aligned with Bowtie2 v2.2.5 software to the human genome(hg19). MACS2 was used to identify enriched regions as enhancerswith a threshold Q-value

Microarray sample preparation and analysisTotal RNA was extracted from U2-OS or SJSA-1 cells treated

with DMSO (control) and different doses of THZ2, respectively,using TRizol reagent (Invitrogen) according to manufacturer'sinstructions. An Affymetrix GeneChip PrimeView Human GeneExpression Array was used for the microarray analysis. Thehybridization data were analyzed using Affymetrix GeneChipCommand Console Software. Microarray data were normalizedusing the robust multiarray average (RMA) method, and expres-sion values were calculated with the Affy Suite of the Biocon-ductor Package (http://www.bioconductor.org), using quantilenormalization of the RMA method (each calculation performedat the individual probe level). Fold-changes were calculated bysubtracting average log2 DMSO signal from average log2 THZ2treatment signal. Active transcripts of each cell were defined asaverage log2(expression) > log2(100) in the corresponding DMSOsample.

Gene set enrichment analysisGene set enrichment analysis (GSEA) was performed using GSEA

standalone desktop software (http://www.broadinstitute.org/gsea) todetermine whether the set of super-enhancer–associated genes wassensitive to THZ2. All super-enhancer–associated genes of each cellline were used as gene sets, respectively, and the correspondingexpression values of the samples treated with different concentrationsof THZ2 were used as the expression data set.

Cell transfectionLentiviral shRNAs andmatching scrambled control constructs were

purchased from Genecopoeia. Four shRNA sequences were designedfor each gene and cloned into an expression plasmid. The targetingsequences of the best shRNA (CDK7 shRNA #1: CATACAAGGCT-TATTCTTA; #2: GGCTTATTCTTATTTAATCCA) were selected forfurther experiments. The stable cell lines were transfected withrecombinant lentiviruses in the presence of 8 mg/mL polybreneaccording to the manufacturer's instructions, and then selected withpuromycin. Puromycin (1 mg/mL) was used to treat cells for 2 daysfor selection, which eliminated all cells in an uninfected controlgroup. Samples of protein were taken for Western blotting assays at1 week after selection.

Cell viability assayOsteosarcoma cells were plated in 96-well plates at a density of 2,000

cells/well. A total of 1,000 cells were plated per well for time–responseassay. They were treated with different concentrations of THZ2, ortransfected with 100 nmol/L targeting shRNA. After the indicatedtimes, 20 mL ofMTT (5 mg/mL) was added to each well, and the plateswere incubated at 37�C for 4 hours. Then, themediumwas replaced by150mLDMSOandmixed thoroughly. The absorbancewas determinedat 490 nm using a microplate reader. The assay was performed intriplicate.

Clone formation assayOsteosarcoma cells or cells transfected with plasmids were plated in

triplicate at 500 cells/well in six-well plates with 2mLDMEM contain-ing 10%FBS. In theTHZ2 experiment, plated cells were incubatedwithDMSO or THZ2 for 48 hours. Colonies containing >50 cells werecounted after 10 days by staining with crystal violet. Data werepresented as mean � SD from three independent experiments intriplicate wells.

In vitro migration and invasion assaysCell migration and invasion assays were performed using Transwell

cell culture chambers with 8-mm microporous filters that wereprecoated and pre-uncoated with extracellular matrix coating (BDBiosciences), respectively, according to the manufacturer's instruc-tions. For the experiments, 200 mL of osteosarcoma cell suspensions(5 � 104 cells/mL) in serum-free DMEM were seeded in the upperchambers in 24-well plates and 500 mL of DMEM containing 10% FBSwas added to the bottom chamber. After 24 hours, the cells in the upperchamber were removed, and the cells on the lower surface of the filterwere fixed, stained, and the number in five random fields was countedunder a light microscope. Data were presented as mean � SD fromthree independent experiments in triplicate chambers.

Mouse xenograftAnimal experiments were approved by the Institutional Review

Board of The First Affiliated Hospital of Sun Yat-sen University, andwere performed according to established guidelines for the Use andCare of Laboratory Animals. Female nude mice, 4 to 6 weeks old, werepurchased from Shanghai SLAC Laboratory Animal Co. Ltd. After themice were anesthetized with isoflurane, wild-type or plasmids trans-fected SJSA-1 cells were inserted to the proximal tibia through thecortex of the anterior tuberosity using a 30-gauge needle. In total, 20mLof the cell suspension was slowly injected in the upper hole.

For study of THZ2, the mice were randomly separated into twogroups after about 2 weeks when a tumor volume of approximately200 mm3 was reached. The mice were treated with 10% DMSO inD5W (5% dextrose in water) or 10 mg/kg THZ2 in vehicle twicedaily by intraperitoneal injection. The mice were monitored every3 days for a total of 3 weeks. As the tumors grew as almost sphericalellipsoids, the size of tumors was measured in two perpendiculardimensions (D1, D2). The body weight of the mice was alsorecorded. The tumor volume was calculated using the formulaV ¼ 4/3p [1/4 (D1 þ D2)]2, as described previously (33). Themice were killed, and the lungs were harvested, fixed in formalin,and stained with hematoxylin and eosin (H&E). The number ofmetastatic nodules in the lungs was counted.

Western blottingWestern blotting was performed as described previously (34). In

brief, cells were lysed in RIPA buffer containing protease inhibitor andphosphatase inhibitor cocktails (Roche), and the cell debris wereremoved by centrifugation (12,000 � g, 10 minutes). Equal amountsof protein were boiled for 10 minutes, resolved by SDS-PAGE, andtransferred to a polyvinylidene difluoride membrane (Millipore).Membranes were blocked in 5% nonfat dry milk with TBST for 1 hourat room temperature, and then incubated with primary antibodyovernight at 4�C. After washing three times with TBST, the mem-branes were incubated with corresponding secondary antibodies.Immunoreactive proteins were then visualized using ECL detectionreagents (Millipore).

RNA extraction and RT-qPCRTotal cellular RNA was extracted using TRizol reagent (Invitrogen)

according to the manufacturer's instructions. Reverse-transcriptionwas performed using a PrimeScript RT Reagent Kit (Takara). qPCRwas performed using SYBR Premix (Takara) on a Real-Time PCRSystem (ABIViiATM7Dx). All reactions including the no RT and notemplate control were carried out in a 20 mL reaction volume andperformed in triplicate. The protocol included denaturing for 30

Targeting Super-Enhancer–Associated Genes in Osteosarcoma

AACRJournals.org Clin Cancer Res; 2020 OF3



http://www.bioconductor.orghttp://www.broadinstitute.org/gseahttp://clincancerres.aacrjournals.org/

seconds at 95�C, 40 cycles of two-step PCR including denaturing for5 seconds at 95�C and annealing for 34 seconds at 60�C, with anadditional 15-second detection step at 95�C, followed by a meltingprofile from 60�C to 95�C at a rate of 0.5�C per 10 seconds. Primersequences were provided by PrimerBank (http://pga.mgh.harvard.edu/primerbank/). The relative amount of target gene mRNA wasnormalized to that of GAPDH.

The reverse-transcription and qPCR of the miRNA was performedusing a Mir-X miRNA First-Strand Synthesis Kit (Takara). Theprotocol included denaturing for 10 seconds at 95�C, 40 cycles oftwo-step PCR including denaturing for 5 seconds at 95�C and anneal-ing for 20 seconds at 60�C, with an additional 60-second detection stepat 95�C, followed by a melting profile from 55�C to 95�C at a rate of0.5�C per 10 seconds. MIR21 primer sequences were designed andprovided by Generay Co. Ltd. The RT-qPCR primer sequences usedare shown in Supplementary Table S3. Results of the validation of thespecificity and efficiency of all primers are provided in SupplementaryFig. S5.

Patients and clinical databaseTo determine the specific expressions of the studied genes in

different tissues, 35 pairs of osteosarcoma and para-carcinoma tissuesfrom 35 patients treated at The First Affiliated Hospital of Sun Yat-senUniversity, Guangzhou, between March 1, 2003, and December 31,2018, were retrospectively examined. Histologic type was confirmedprior to our experiments by pathologists from the Clinical PathologyDepartment of the hospital. This retrospective analysis of anonymousdata was approved by the Institutional Review Board of The FirstAffiliated Hospital of Sun Yat-sen University and conducted inaccordance with Declaration of Helsinki.

Statistical analysisAll data were derived from at least three independent experiments,

and the results were expressed asmean� SD. Student t test or one-wayANOVA was used to analyze differences between groups. A value ofP < 0.05 was considered to indicate a statistically significant difference.Statistical analyses were performed with SPSS version 20.0 software(SPSS Inc.).

Data availabilityChIP-seq and gene expression microarray data are deposited in

GEO: GSE134605.

ResultsCharacterization of super-enhancers in osteosarcoma cells

Super-enhancers in osteosarcoma cells were identified throughChIP-seq against the H3K27ac modification (26). We identified 308super-enhancer–associated genes in the U2-OS cell line, and 1,526in the SJSA-1 cell line (Fig. 1A; Supplementary Table S1). Com-pared with typical enhancers based on the ChIP-seq data set, super-enhancers were specifically enriched with the H3K27ac signal indistance and density (Fig. 1B). Interestingly, we observed a numberof top-ranking super-enhancer–associated genes that have beenproven to be associated with osteosarcoma oncogenic transcripts inprevious studies, such as MYC (35), PIM1 (36), TCF7L2 (37), andHMOX1 (38). In addition to coding RNAs, these super-enhancershave been reported to drive the expression of long noncoding RNAssuch as MALAT1 (39), and miRNAs such as MIR663B (40) andMIR21 (41), which have been reported to contribute to osteosar-coma malignancy. In addition, some genes encoding lineage-

specific transcription factors which regulate skeletal development,such as GLI2 (42), LIF (43), MDM2 (44), RUNX2 (45), andEGFR (46), were found to be associated with super-enhancers(Fig. 1A and C).

Gene ontology (GO) analysis was performed to explore thefunctional enrichment of the identified super-enhancer–associatedgenes. We found that many genes were significantly involved in (i)regulation of RNAPII and transcriptional factor-related transcrip-tion, (ii) skeletal system and cell development, and (iii) tumor-related functions including cell proliferation, apoptotic processes,and cell migration (Fig. 1D; Supplementary Table S1). The super-enhancers were also associated with genes enriched in skeletaldiseases, cancers, and related essential signaling pathways (Supple-mentary Figs. S1A and S1B; Supplementary Table S1). These resultsindicated that the super-enhancer–associated genes in osteosarcomacells were hyperactive, and may promote the development andmalignancy of osteosarcoma.

CDK7was upregulated in osteosarcoma and plays an oncogenicrole in osteosarcoma cells

Super-enhancers are able to drive high-level expression of associ-ated transcripts, and are vulnerable to perturbation of transcriptionalactivity through bound transcription factors and coactivators (26). Ithas been reported that super-enhancer–associated genes encode geneproducts involved in regulation of RNAPII-mediated transcription,and many transcription factors are important for cancer states andmight represent candidate oncogenes (11). CDK7 is a component ofthe general transcription factor IIH, which regulates RNAPII initiationand elongation (47). Compared with normal tissue, the expression ofCDK7 was significantly higher in tumor tissues from 35 patients withosteosarcoma (Fig. 2A). We retrieved the expression data of CDK7from the GEO database (GSE36001), and found that the expression ofCDK7 in osteosarcoma tissues is higher than in normal bone (Fig. 2B).

To explore the role of CDK7 in osteosarcoma, we depleted CDK7expression in U2-OS and SJSA-1 cells by shRNA-mediated knock-down. Decreased phosphorylation of initiation-associated serine 5(S5) and serine 7 (S7), and of elongation-associated serine 2 (S2) of theRNAPII CTD, which are regulated by CDK7, were observed in bothcell lines (Fig. 2C). The MTT, colony formation, and Transwell assaysdemonstrated a significant decrease in osteosarcoma cell growth,migration, and invasion, respectively, after knockdown of CDK7(Fig. 2D–F).

To further confirm the antitumor potential of downregulatingCDK7, we established an osteosarcoma orthotropic animal model byinjecting stable knockdown SJSA-1 cells or control in nude mice. Theresults indicated that tumor volume and weight were dramaticallydecreased in the CDK7 knockdown groups compared with the controlgroup (Fig. 2G and H; Supplementary Fig. S2A). In addition, oste-osarcoma xenograft metastasis to the lungs was also decreased afterCDK7 knockdown (Supplementary Fig. S2B).

These observations indicate that suppressing the phosphorylationof RNAPII CTD by targeting CDK7 has promising anti-osteosarcomaeffects.

Selective suppression of super-enhancer–associated genes bythe specific CDK7 inhibitor, THZ2

On the basis of the biological process enrichments of super-enhancer–associated genes and the experimental results thus far,we hypothesized that suppressing CDK7 activity could inhibit themalignant properties of osteosarcoma through targeting the super-enhancer–associated genes involved in osteosarcoma pathogenesis.

Zhang et al.

Clin Cancer Res; 2020 CLINICAL CANCER RESEARCHOF4



http://pga.mgh.harvard.edu/primerbank/http://pga.mgh.harvard.edu/primerbank/http://pga.mgh.harvard.edu/primerbank/http://clincancerres.aacrjournals.org/

To explore the correlations between CDK7 and super-enhancer–associated genes, and find an innovative and effective drug againstosteosarcoma, we used THZ2, a new CDK7 inhibitor (10, 12), tosuppress the CDK7 activity of osteosarcoma cells. A dose-

dependent decrease in phosphorylation at S2, S5, and S7 withincreasing THZ2 concentration was observed in U2-OS and SJSA-1cell lines (Fig. 3A). Gene expression profiling was then performedto investigate THZ2-induced transcription alterations, and identify

Figure 1.

Super-enhancers in osteosarcoma cells are associated with oncogenic and lineage-specific genes. A, Enhancers ranked by increasing H3K27Ac ChIP-seq signal(length � density, input normalized) in their stitched regions. B, The mean density of the H3K27ac signal in typical enhancers and super-enhancers of theosteosarcoma cell lines.C,ChIP-seq binding profiles at representative super-enhancer–associated gene loci in both cell lines.D, Selected GO functional categories ofthe osteosarcoma super-enhancer–associated genes.





http://clincancerres.aacrjournals.org/

the subsets of sensitive genes in these two osteosarcoma cell lines.Cells were treated with 25, 100, and 400 nmol/L THZ2 for 6 hours(Fig. 3B; Supplementary Table S2). We observed there were a smallnumber of sensitive genes that began to be downregulated at aconcentration of 100 nmol/L in both cell lines (Fig. 3C). GOanalysis showed many subsets of the sensitive genes were involvedin transcriptional regulation, cell-cycle regulation, apoptotic pro-cesses, and other critical cellular functions with respect to osteosar-coma (Fig. 3D). The sensitive genes identified are also involved inskeletal diseases, musculoskeletal diseases, cancers, and a number ofpathways in various cancers, similar to that of the super-enhancer–associated genes we identified (Supplementary Figs. S3A and S3B).

We sought to explore whether super-enhancer–associated genes,including oncogenes, are disproportionately suppressed by CDK7

inhibition. We observed that an abundance of super-enhancer–associated transcripts were preferentially downregulated upon THZ2treatment as compared with that of typical-enhancers (Fig. 3E). GSEAof all active transcripts after treatment with 100 nmol/L THZ2 showedthat these THZ2-sensitive geneswere significantly enriched in the genesets associated with super-enhancers (Fig. 3F). Notably, many super-enhancer–associated genes, which have been reported to be involved inthe malignant potential of osteosarcoma, such as MYC (35),RUNX2 (45),MDM2 (44), SRSF3 (48), and TCF7L2 (49), were amongthe top 10% sensitive to THZ2 treatment (Fig. 3G). The downregula-tion of these critical osteosarcoma-related genes was confirmed on theRNA level by qPCR (Fig. 3H).

These results suggested that super-enhancer–associated genes,especially osteosarcoma-related genes, were particularly vulnerable to

Figure 2.

CDK7 inhibition suppressed growth of osteosarcoma in vitro and in vivo. A, Comparative quantification of CDK7 mRNA in paired primary osteosarcoma tissues andno-tumor tissues from 35 patients. Data represent mean � SD. B, CDK7 mRNA expression of normal bone and osteosarcoma tissues from data sets GSE36001downloaded from gene expression omnibus (GEO). Data representmean� SD.C, Immunoblotting analyses of RNAPII, RNAPII CTDphosphorylation (S2, S5, and S7),and CDK7 in U2-OS and SJSA-1 cells stably transfected with shRNA targeting CDK7. D, MTT assay and (E) colony formation assay were used to evaluate the cellgrowth of U2-OS and SJSA-1. The suppression of CDK7 dramatically inhibited the growth of osteosarcoma cells. Data represent mean � SD. F, The suppression ofCDK7 significantly reduced themigration/invasion ability of the osteosarcoma cells by Transwell assay.Data representmean�SD.G,Tumor growth curves ofmice inwhich CDK7 knockdown and control-SJSA-1 cells implanted in the proximal tibia. Data represent mean � SD. H, Photographs of resected tumors from control andknockdown groups excised on day 35 (� , P < 0.05; �� , P < 0.01; ��, P < 0.001).

Zhang et al.





inhibition of CDK7, and THZ2 might be a potential anti-osteosarcoma agent through selective targeting super-enhancer–associated oncogenes.

THZ2 suppresses proliferation and metastatic potential inosteosarcoma cells

To investigate the effect of THZ2 on osteosarcoma cells, dose–response experiments showed that all 10 osteosarcoma cell lineswere highly sensitive to THZ2, with IC50 values in the range of 57.6to 719.4 nmol/L, which is much lower than that of a human

osteoblast cell line (hFOB1.19) of 2210.4 nmol/L (Fig. 4A). Atconcentrations as low as 25, 50, or 100 nmol/L, THZ2 potentlyreduced cell viability of U2-OS and SJSA-1 in a time-dependentmanner, but not hFOB 1.19 (Fig. 4B). To further corroborate theantiproliferative effect of THZ2, a colony-formation assay wasperformed which showed that THZ2 decreased colony formationfrom transplanted osteosarcoma cells (Fig. 4C).

Metastasis and invasion are also key processes during tumordevelopment and progression. Experiments using the osteosarcomacell lines U2-OS, SJSA-1, 143B, and MG-63 showed that THZ2

Figure 3.

Super-enhancer–associated genes in osteosarcoma cells are particularly sensitive to THZ2 treatment. A, Immunoblotting analyses of RNAPII, RNAPII CTDphosphorylation (S2, S5, and S7), and CDK7 in U2-OS and SJSA-1 cells treated either with THZ2 or DMSO at the indicated concentrations for 6 hours. B, Heatmapshowing the change of global active transcripts in U2-OS and SJSA-1 cells following treatment with 25, 100, and 400 nmol/L THZ2 for 6 hours. C, Scatter plotdisplaying the log2-fold change of all active genes altered by 100 nmol/L THZ2.D, EnrichedGO functional categories of transcriptswere reduced over two-fold in U2-OS and SJSA-1 cells following treatment with 100 nmol/L THZ2 for 6 hours. E, Box plots showing log2-fold changes of transcripts associated with the total pool of allenhancers (ALL), typical-enhancers (TE), and super-enhancers (SE) upon treatment with 100 nmol/L THZ2 for 6 hours. Data represent mean� SD. F,GSEA showingthe super-enhancer–associated transcript signature enriched in 100 nmol/L THZ2-treated cells versus DMSO-treated cells. G, Venn diagram showing overlapbetween super-enhancer–associated genes identified with ChIP-seq, and ranking among the top 10% of THZ2-sensitive active transcripts in two osteosarcoma celllines, respectively. The genes reported to be involved inmalignant properties of osteosarcomawere listed.H,qPCR to detect expression of indicated gene transcriptsin DMSO-treated and 100 nmol/L THZ2-treated U2-OS and SJSA-1 cells, respectively. Data represent mean � SD (� , P < 0.05; ��, P < 0.01; ��, P < 0.001).






reduced the migratory and invasive properties of osteosarcoma cells(Fig. 4D). These results demonstrated that THZ2 has powerfulinhibitory effects on the growth, migration, and invasion of osteosar-coma in vitro.

THZ2 inhibits cell-cycle progression and induces apoptosis inosteosarcoma cells

To examine whether THZ2 affects cell-cycle distribution, humanosteosarcoma cell lines were treated with THZ2 (100 nmol/L for24 hours), followed by flow cytometry analysis. G2–M phase arrestwas observed in U2-OS, SJSA-1, 143B, andMG-63 cells (Fig. 5A). Thepercentage of U2-OS, SJSA-1, 143B, and MG-63 cells in G2–Mincreased by 10.2%, 20.6%, 8.1%, and 20.1%, respectively, and thepercentage of cells in G0–G1 decreased by 12.7%, 9.1%, 6.9%, and12.0%, respectively (Fig. 5A).

Immunoblotting was performed to determine the effects of THZ2on the expression of Cyclin D1, which is related to G0–G1 to S-phasetransition, and expression of P21, which is a potent inhibitor of cell-cycle progression. The results showed that treatment of U2-OS cellswith THZ2 resulted in a reduction of Cyclin D1 expression and anincrease of P21 expression in a dose-dependent and time-dependentmanner (Fig. 5C and D). Annexin V/PI staining showed thepercentage of apoptotic cells increased markedly in all tested celllines after THZ2 treatment (Fig. 5B). The number of apoptotic cellsin the U2-OS, SJSA-1, 143B, and MG-63 cell lines increased by18.1%, 24.3%, 12.2%, and 3.7%, respectively, with a THZ2 concen-tration of 100 nmol/L (Fig. 5B).

As a marker of apoptosis, total and cleaved PARP was detected byWestern blotting and the results showed that protein expression wasincreased after exposure to THZ2 (Fig. 5C and D). Taken together,these results indicated that THZ2 can affect cell-cycle progression andinduce apoptosis.

THZ2 exhibits a powerful antitumor effect againstosteosarcoma xenografts in nude mice

On the basis of in vitro data, we explored the anti-osteosarcomaactivity of THZ2 using an osteosarcoma orthotropic animal model.Mice bearing SJSA-1 cells were randomly separated into two groups(vehicle and THZ2), and received either vehicle or THZ2 (10 mg/kg)twice daily. The tumor growth curves showed a significant antitumoreffect of THZ2, as compared with the control (Fig. 6A).

Tumor-bearing mice were killed on day 21. Examination revealedtumor swelling in the lower legs. Radiographic features characteristicof human primary osteosarcoma, including central osteolysis withspecular new bone formation and extension into surrounding softtissues, were more apparent in the vehicle group compared with theTHZ2 treatment group (Fig. 6B and C). A lower tumor weight wasobserved in the THZ2 group (Fig. 6D).

IHC and TUNEL assay examination of tumor samples showed thatTHZ2 dramatically inhibited cell proliferation and promoted cellapoptosis (Fig. 6E). In addition, the number of observable lungmetastatic nodules was lower in the THZ2 treatment group(Fig. 6F and G). Importantly, no significant difference in mouse bodyweight was observed between the vehicle group and the THZ2 group(Fig. 6H), and no obvious pathological changes were observed in theheart, kidney, liver, lung, and spleen in the THZ2 group as determinedby H&E staining (Supplementary Fig. S4). Collectively, these resultsrevealed that THZ2 possesses potent antitumor properties againsthuman osteosarcoma cells in vivo.

DiscussionDespite advances in the diagnosis and treatment of osteosarcoma,

the prognosis remains poor (50, 51). The effectiveness of standardchemotherapy is hampered by the development of chemoresistance in

Figure 4.

THZ2 impedes the proliferation and metastasis of osteosarcoma in vitro. A, Dose–response curves of 10 osteosarcoma cell lines and 1 osteoblast cell line (hFOB1.19)after treatment with THZ2 for 48 hours. Cell viability was assessed with the MTT assay. IC50 data are presented as mean with 95% confidence interval. B, Time–response curves of U2-OS, SJSA-1, and hFOB 1.19 upon treatment with THZ2 at concentrations as low as 25, 50, and 100 nmol/L. Data represent mean� SD. C, THZ2impaired colony formation of osteosarcomacells. The colony formation ability of osteosarcoma cells (U2-OS, SJSA-1, 143B, andMG-63)was examinedafter treatmentwith various concentrations THZ2 for 10 days. The quantification of cell growth in the right panel is presented as mean � SD. D, THZ2 inhibits the migrationand invasion ability of osteosarcoma cells. The indicated cells were treated with THZ2 (100 nmol/L) or vehicle. Data represent mean � SD (� , P < 0.05; �� , P < 0.01;�� , P < 0.001).

Zhang et al.





a large portion of patients (4). A limited understanding of thepathogenesis of osteosarcoma has impeded improvement in the out-comes of patients in the last four decades.

Super-enhancers, large clusters of enhancers that are enriched insize and binding of the mediator complex, have been characterizedin various cancer cells and have been reported to promote theexpression of genes that define cell identity (9, 14, 52). Recentstudies have suggested that a number of different cancer cell typesgenerate super-enhancers at oncogenes, and the acquisition ofspecific super-enhancers near oncogenes contributes to tumorigen-esis (11, 13, 26). However, there have been no studies examiningsuper-enhancers in osteosarcoma. In this study, we characterized

the super-enhancer landscape of osteosarcoma for the first time andidentified the associated transcripts. We found that super-enhanc-er–associated transcripts are important for the regulation ofRNAPII-mediated transcriptional activity, as well as cellular pro-cesses representing “cancer hallmarks” (53) and lineage-specificprocesses, such as skeletal system development. A number ofosteosarcoma oncogenes, including both coding and non-codingRNAs, such as GLI2 (54), TCF7L2 (37), MYC (35), MDM2 (55),MALAT1 (39), and MIR21 (41) are associated with super-enhan-cers. On the basis of our findings, we speculate that super-enhanc-er–associated genes play an important role in the malignancy andcell identity of osteosarcoma.

Figure 5.

The effect of THZ2 on cell-cycle progression and apoptosis in osteosarcoma cells. A, Flow cytometry was used to detect and analyze cell-cycle distribution ofosteosarcoma cells treated with vehicle or 100 nmol/L THZ2 for 24 hours. The length of each cell-cycle phase was calculated. Data represent mean� SD. B,AnnexinV/PI staining assay were used to detect the apoptosis rate of osteosarcoma cells treated with vehicle or 100 nmol/L THZ2 for 24 hours. The proportion of apoptoticcells was calculated. Data represent mean� SD. C and D,Western blot analyses were performed using the indicated antibodies, including total/cleaved PARP, P21,and Cyclin D1. THZ2 affects the protein levels of the apoptosis marker cleaved PARP and cell-cycle–related genes P21 and Cyclin D1 in dose/time-dependent manner(� , P < 0.05; �� , P < 0.01; �� , P < 0.001).






Super-enhancers are occupied by a large portion of the RNAPII,cofactors, and chromatin regulators, which can explain how theycontribute to high-level transcription of associated genes (13).Recent studies have found that super-enhancers are sensitive toperturbations of transcriptional activity through certain boundtranscription factors and coactivators, as well as associatedgenes (9, 26). CDK7 is a CDK and a subunit of the multiproteinbasal transcription factor TFIIH, which regulates transcriptioninitiation and elongation by phosphorylating the CTD of the largestsubunit (RPB1) of RNAPII (56). On the basis of the high expressionof CDK7 in human osteosarcoma tissues, and suppression of themalignant properties of osteosarcoma cells after CDK7 knockdown,we reasoned that targeting CDK7 might be a potential treatment

strategy for osteosarcoma through suppressing super-enhancer–associated oncogenes.

THZ1 is a selective CDK7 inhibitor that covalently binds to CDK7and suppresses its kinase activity, and has a very high level of selectivitybecause of modification of a unique cysteine residue (29). Althoughrecent studies have showed that THZ1 has the potential of promisinganticancer activity in various malignancies, its translational signifi-cance and application are limited to the short half-life (30). THZ2 is anewly developed analog of THZ1 with a five-fold increase of half-life,and has been reported to suppress the growth of triple-negative breastcancer and gastric cancer (29, 31). However, the effect of THZ2 inother cancers, including osteosarcoma, is still unknown. To identify apotential drug against osteosarcoma and confirm the relations between

Figure 6.

THZ2 suppress the growth and lung metastatic potential in orthotopic mice model. A, Tumor growth curves of mice treated with either vehicle or THZ2 for 21 days(twice daily, 10mg/kg, i.p.). Data representmean� SD.B, Themice bearing induced tibial osteosarcomaupon vehicle (top) or THZ2 (bottom) treatment are shown inthe RGB images and the X-ray images of the whole body. C, Photographs and (D) weights of resected tumors from both vehicle and THZ2 treatment groups. Datarepresentmean� SD.E,H&E and IHC staining of Ki67, and TUNEL assay in tumor tissue sections. Each imagewas taken at amagnification of 400�.F,Representativeimages of lung sections after H&E staining. Each image was taken at amagnification of 40� and 100�.G, Statistical results for the number of visible lungmetastaticnodules. Data represent mean� SD. H, The body weight of mice over the treatment time. Data represent the mean� SD (ns, not significant; � , P < 0.05; �� , P < 0.01;�� , P < 0.001).

Zhang et al.





the activity of CDK7 and the expression of super-enhancer–associatedgenes in osteosarcoma, we used THZ2 in our investigations.

Microarray expression analysis was used to detected alterations oftotal transcripts in osteosarcoma cells treated with various concentra-tions of THZ2. We observed that a cluster of genes was particularlysensitive to THZ2 treatment, and was also enriched in cancer-relatedbiological processes and pathways, such as apoptosis, cell migration,PI3K-Akt signaling, and MAPK signaling, etc. Notably, they weresimilar to the processes in which super-enhancer–associated genes areinvolved. On the basis of these interesting results, we explored therelation between the THZ2-sensitive genes and super-enhancers weidentified, and found that THZ2 could selectively suppress super-enhancer–associated genes. Notably, a large number of well-definedoncogenes associatedwith identified super-enhancers were found to bepresent in the subset most sensitive to THZ2. These results indicatedthat oncogenes associated with super-enhancers in osteosarcoma areparticularly vulnerable to THZ2.

Moreover, we identified some seldom reported transcripts in oste-osarcoma associated with super-enhancers that were also sensitive toTHZ2, such as CEP55 and LACTB (Supplementary Table S1 and S2).The identification and analysis of super-enhancer–associated genes inour study provides an important molecular foundation to understandthe pathogenesis of osteosarcoma, and a catalogue of genes which maybe valuable for further research.

To explore the anti-osteosarcoma potential of THZ2, we exam-ined changes of malignant features in vitro and in vivo after THZ2treatment. Our results showed that THZ2 suppressed the prolifer-ation of osteosarcoma cells in time- and dose-dependent manners,and exhibited less cytotoxicity in the human osteoblast cell linehFOB1.19. Osteosarcoma has a strong tendency to metastasize, andpulmonary metastasis is the main cause of medical failure and deathin patients with osteosarcoma. The effect of THZ2 on the metastaticpotential of osteosarcoma cells was examined using the Transwellassay. The results showed that THZ2 markedly suppressed themigration and invasion ability of osteosarcoma cells. In addition,we also found that THZ2 induced G2–M cell-cycle arrest andapoptotic cell death in osteosarcoma cells. Furthermore, an ortho-topic murine model was established to assess the antitumor poten-tial of THZ2 in vivo. THZ2 potently suppressed tumor growth innude mice, and fewer lung metastatic nodules were found in micetreated with THZ2 as compared with those not treated. Notably, no

severe side effects or pathologic changes in important organs wereobserved in mice treated with THZ2. Taken together, our resultsindicate that THZ2 has a powerful antitumor activity againstosteosarcoma in vitro and in vivo, and may have clinical value forthe treatment of patients with osteosarcoma.

In summary, our results showed significant correlations betweensuper-enhancers and the malignant potential of osteosarcoma, andindicated that targeting super-enhancer–associated genes with aCDK7 inhibitor such as THZ2 may be a promising treatment forosteosarcoma patients. Moreover, our data provide an importantmolecular foundation towards understanding the pathogenesis ofosteosarcoma modified by epigenetic patterns.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors’ ContributionsConception and design: J. Zhang, J. Yin, J. ShenDevelopment of methodology: J. Zhang, W. Liu, J. YinAcquisition of data (provided animals, acquired and managed patients, providedfacilities, etc.): J. Zhang, Z. Zhao, Y. Lai, X. ZhangAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): J. Zhang, X. Xie, Y. Wang, Z. FanWriting, review, and/or revision of the manuscript: J. Zhang, Z. Zhao, G. HuangAdministrative, technical, or material support (i.e., reporting or organizing data,constructing databases): C. Zou, Z. Shi, J. YinStudy supervision: Q. Su, J. Yin, J. Shen

AcknowledgmentsThis work was supported by grants from National Natural Science Foundation of

China (nos. 81972507 and 81772861), Natural Science Foundation of GuangdongProvince (nos. 2016A030313227, 2018A030313077, and 2018A030313689), theScience & Technology Planning Project of Guangzhou City (nos. 201707010007,and 201904010440), Scientific ResearchCultivating Project of Sun Yat-sen University(nos. 80000-18827202 and 80000-18823701), the Fundamental Research Funds forthe Central Universities (no. 19ykzd10), and Scientific Research 3� 3 Project of SunYat-sen University (no. Y70215).

The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.

Received April 30, 2019; revised August 24, 2019; accepted January 10, 2020;published first January 14, 2020.

References1. Isakoff MS, Bielack SS, Meltzer P, Gorlick R. Osteosarcoma: current treatment

and a collaborative pathway to success. J Clin Oncol 2015;33:3029–35.2. Schwartz CL, Gorlick R, Teot L, KrailoM, Chen Z, Goorin A, et al. Multiple drug

resistance in osteogenic sarcoma: INT0133 from the children's oncology group.J Clin Oncol 2007;25:2057–62.

3. Laschi M, Bernardini G, Geminiani M, Ghezzi L, Amato L, Braconi D, et al.Establishment of four new human primary cell cultures from chemo-naiveItalian osteosarcoma patients. J Cell Physiol 2015;230:2718–27.

4. Susa M, Iyer AK, Ryu K, Choy E, Hornicek FJ, Mankin H, et al. Inhibition ofABCB1 (MDR1) expression by an siRNA nanoparticulate delivery system toovercome drug resistance in osteosarcoma. PLoS One 2010;5:e10764.

5. Lin CY, Loven J, Rahl PB, Paranal RM, Burge CB, Bradner JE, et al. Transcrip-tional amplification in tumor cells with elevated c-Myc. Cell 2012;151:56–67.

6. Thurman RE, Rynes E, Humbert R, Vierstra J, Maurano MT, Haugen E, et al.The accessible chromatin landscape of the human genome. Nature 2012;489:75–82.

7. Jin F, Li Y, Dixon JR, Selvaraj S, Ye Z, Lee AY, et al. A high-resolution map ofthe three-dimensional chromatin interactome in human cells. Nature 2013;503:290–4.

8. ENCODE Project Consortium. An integrated encyclopedia of DNA elements inthe human genome. Nature 2012;489:57–74.

9. Loven J, Hoke HA, Lin CY, Lau A, Orlando DA, Vakoc CR, et al. Selectiveinhibition of tumor oncogenes by disruption of super-enhancers. Cell 2013;153:320–34.

10. Wang Y, Zhang T, Kwiatkowski N, Abraham BJ, Lee TI, Xie S, et al. CDK7-dependent transcriptional addiction in triple-negative breast cancer. Cell 2015;163:174–86.

11. Christensen CL, Kwiatkowski N, AbrahamBJ, Carretero J, Al-Shahrour F, ZhangT, et al. Targeting transcriptional addictions in small cell lung cancer with acovalent CDK7 inhibitor. Cancer Cell 2014;26:909–22.

12. Jiang YY, Lin DC, Mayakonda A, Hazawa M, Ding LW, Chien WW, et al.Targeting super-enhancer-associated oncogenes in oesophageal squamous cellcarcinoma. Gut 2016;66:1358–68.

13. Hnisz D, Abraham BJ, Lee TI, Lau A, Saint-Andre V, Sigova AA, et al. Super-enhancers in the control of cell identity and disease. Cell 2013;155:934–47.

14. Niederriter AR, Varshney A, Parker SC, Martin DM. Super enhancers incancers, complex disease, and developmental disorders. Genes 2015;6:1183–200.






15. Togel L, Nightingale R, Chueh AC, JayachandranA, TranH, Phesse T, et al. Dualtargeting of bromodomain and extraterminal domain proteins, and WNT orMAPK signaling, inhibits c-MYC expression and proliferation of colorectalcancer cells. Mol Cancer Ther 2016;15:1217–26.

16. MansourMR, Abraham BJ, Anders L, Berezovskaya A, Gutierrez A, Durbin AD,et al. Oncogene regulation. an oncogenic super-enhancer formed throughsomatic mutation of a noncoding intergenic element. Science 2014;346:1373–7.

17. Hnisz D, Schuijers J, Lin CY, Weintraub AS, Abraham BJ, Lee TI, et al.Convergence of developmental and oncogenic signaling pathways at transcrip-tional super-enhancers. Mol Cell 2015;58:362–70.

18. Glodzik D, Morganella S, Davies H, Simpson PT. A somatic-mutational processrecurrently duplicates germline susceptibility loci and tissue-specific super-enhancers in breast cancers. Nat Genet 2017;49:341–8.

19. Nagaraja S, Vitanza NA, Woo PJ, Taylor KR, Liu F, Zhang L, et al. Transcrip-tional dependencies in diffuse intrinsic pontine glioma. Cancer Cell 2017;31:635–52.e6.

20. Han J, Meng J, Chen S, Wang X, Yin S, Zhang Q, et al. YY1 complex promotesquaking expression via super-enhancer binding during EMT of hepatocellularcarcinoma. Cancer Res 2019;79:1451–64.

21. Peng L, Jiang B, YuanX,QiuY, Peng J,HuangY, et al. Super-enhancer-associatedlong noncoding RNAHCCL5 is activated by ZEB1 and promotes themalignancyof hepatocellular carcinoma. Cancer Res 2019;79:572–84.

22. Evan GI, Hah N, Littlewood TD, Sodir NM, Campos T, Downes M, et al. Re-engineering the pancreas tumor microenvironment: a "regenerative program"hacked. Clin Cancer Res 2017;23:1647–55.

23. Pelish HE, Liau BB, Nitulescu II, Tangpeerachaikul A, Poss ZC, Da Silva DH,et al. Mediator kinase inhibition further activates super-enhancer-associatedgenes in AML. Nature 2015;526:273–6.

24. Dawson MA, Gudgin EJ, Horton SJ, Giotopoulos G, Meduri E, Robson S, et al.Recurrent mutations, including NPM1c, activate a BRD4-dependent core tran-scriptional program in acute myeloid leukemia. Leukemia 2014;28:311–20.

25. Groschel S, Sanders MA, Hoogenboezem R, de Wit E, Bouwman BA, ErpelinckC, et al. A single oncogenic enhancer rearrangement causes concomitant EVI1and GATA2 deregulation in leukemia. Cell 2014;157:369–81.

26. WhyteWA,OrlandoDA,HniszD,AbrahamBJ, LinCY,KageyMH, et al.Mastertranscription factors and mediator establish super-enhancers at key cell identitygenes. Cell 2013;153:307–19.

27. Akhtar MS, Heidemann M, Tietjen JR, Zhang DW, Chapman RD, Eick D, et al.TFIIH kinase places bivalent marks on the carboxy-terminal domain of RNApolymerase II. Mol Cell 2009;34:387–93.

28. Drapkin R, Le Roy G, Cho H, Akoulitchev S, Reinberg D. Human cyclin-dependent kinase-activating kinase exists in three distinct complexes. PNAS1996;93:6488–93.

29. Kwiatkowski N, Zhang T, Rahl PB, Abraham BJ, Reddy J, Ficarro SB, et al.Targeting transcription regulation in cancer with a covalent CDK7 inhibitor.Nature 2014;511:616–20.

30. Li B, Ni Chonghaile T, Fan Y, Madden SF, Klinger R, O'Connor AE, et al.Therapeutic rationale to target highly expressed CDK7 conferring poor out-comes in triple-negative breast cancer. Cancer Res 2017;77:3834–45.

31. Huang JR, Qin WM, Wang K, Fu DR, Zhang WJ, Jiang QW, et al. Cyclin-dependent kinase 7 inhibitor THZ2 inhibits the growth of human gastric cancerin vitro and in vivo. Am J Transl Res 2018;10:3664–76.

32. Zou CY, Wang J, Shen JN, Huang G, Jin S, Yin JQ, et al. Establishment andcharacteristics of two syngeneic human osteosarcoma cell lines from primarytumor and skip metastases. Acta Pharmacol Sin 2008;29:325–32.

33. Berlin O, Samid D, Donthineni-Rao R, Akeson W, Amiel D, Woods VL Jr.Development of a novel spontaneous metastasis model of human osteosarcomatransplanted orthotopically into boneof athymicmice.CancerRes 1993;53:4890–5.

34. Yin JQ, Wen L, Wu LC, Gao ZH, Huang G,Wang J, et al. The glycogen synthasekinase-3beta/nuclear factor-kappa B pathway is involved in cinobufagin-induced apoptosis in cultured osteosarcoma cells. Toxicol Lett 2013;218:129–36.

35. Shimizu T, IshikawaT, Sugihara E, Kuninaka S,Miyamoto T,Mabuchi Y, et al. c-MYC overexpression with loss of Ink4a/Arf transforms bone marrow stromalcells into osteosarcoma accompanied by loss of adipogenesis. Oncogene 2010;29:5687–99.

36. Mou S, Wang G, Ding D, Yu D, Pei Y, Teng S, et al. Expression and function ofPIM kinases in osteosarcoma. Int J Oncol 2016;49:2116–26.

37. Chen K, Fallen S, Abaan HO, Hayran M, Gonzalez C, Wodajo F, et al. Wnt10binduces chemotaxis of osteosarcoma and correlates with reduced survival.Pediatr Blood Cancer 2008;51:349–55.

38. Koyani CN, Kitz K, Rossmann C, Bernhart E, Huber E, Trummer C, et al.Activation of the MAPK/Akt/Nrf2-Egr1/HO-1-GCLc axis protects MG-63osteosarcoma cells against 15d-PGJ2-mediated cell death. Biochem Pharmacol2016;104:29–41.

39. Luo W, He H, Xiao W, Liu Q, Deng Z, Lu Y, et al. MALAT1 promotesosteosarcoma development by targeting TGFA via MIR376A. Oncotarget2016;7:54733–43.

40. Shu Y, YeW, Gu YL, Sun P. Blockade of miR-663b inhibits cell proliferation andinduces apoptosis in osteosarcoma via regulating TP73 expression. Bratisl LekListy 2018;119:41–6.

41. Lv C, Hao Y, Tu G. MicroRNA-21 promotes proliferation, invasion andsuppresses apoptosis in human osteosarcoma line MG63 through PTEN/Aktpathway. Tumour Biol 2016;37:9333–42.

42. Joeng KS, Long F. The Gli2 transcriptional activator is a crucial effector for Ihhsignaling in osteoblast development and cartilage vascularization. Development2009;136:4177–85.

43. Poulton IJ, McGregor NE, Pompolo S, Walker EC, Sims NA. Contrastingroles of leukemia inhibitory factor in murine bone development and remo-deling involve region-specific changes in vascularization. J Bone Miner Res2012;27:586–95.

44. Lengner CJ, SteinmanHA, Gagnon J, Smith TW, Henderson JE, KreamBE, et al.Osteoblast differentiation and skeletal development are regulated byMdm2-p53signaling. J Cell Biol 2006;172:909–21.

45. Komori T. Roles of Runx2 in skeletal development. Adv ExpMed Biol 2017;962:83–93.

46. Tahaei SE, Couasnay G, Ma Y, Paria N, Gu J, Lemoine BF, et al. The reducedosteogenic potential of Nf1-deficient osteoprogenitors is EGFR-independent.Bone 2018;106:103–11.

47. Larochelle S, Amat R, Glover-Cutter K, SansoM, Zhang C, Allen JJ, et al. Cyclin-dependent kinase control of the initiation-to-elongation switch of RNA poly-merase II. Nat Struct Mol Biol 2012;19:1108–15.

48. Ajiro M, Jia R, Yang Y, Zhu J, Zheng ZM. A genome landscape of SRSF3-regulated splicing events and gene expression in human osteosarcoma U2OScells. Nucleic Acids Res 2016;44:1854–70.

49. Roose J, Clevers H. TCF transcription factors: molecular switches in carcino-genesis. Biochim Biophys Acta 1999;1424:M23–37.

50. Faisham WI, Mat Saad AZ, Alsaigh LN, Nor Azman MZ, Kamarul Imran M,Biswal BM, et al. Prognostic factors and survival rate of osteosarcoma: a single-institution study. Asia Pac J Clin Oncol 2017;13:e104–e10.

51. HeH, Ni J, Huang J.Molecular mechanisms of chemoresistance in osteosarcoma(review). Oncol Lett 2014;7:1352–62.

52. Pott S, Lieb JD. What are super-enhancers? Nat Genet 2015;47:8–12.53. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell 2011;

144:646–74.54. Nagao-Kitamoto H, Nagata M, Nagano S, Kitamoto S, Ishidou Y, Yamamoto T,

et al. GLI2 is a novel therapeutic target for metastasis of osteosarcoma. Int JCancer 2015;136:1276–84.

55. YingM, Zhang L, ZhouQ, Shao X, Cao J, ZhangN, et al. The E3 ubiquitin proteinligase MDM2 dictates all-trans retinoic acid-induced osteoblastic differentiationof osteosarcoma cells by modulating the degradation of RARalpha. Oncogene2016;35:4358–67.

56. Malumbres M. Cyclin-dependent kinases. Genome Biol 2014;15:122.


Zhang et al.



http://Am J Transl Reshttp://Cancer Reshttp://J Bone Miner Reshttp://Asia Pac J Clin Oncolhttp://clincancerres.aacrjournals.org/

Published OnlineFirst January 14, 2020.Clin Cancer Res Jiajun Zhang, Weihai Liu, Changye Zou, et al. Osteosarcoma with THZ2, a Covalent CDK7 Inhibitor

Associated Oncogenes in−Targeting Super-Enhancer

Updated version

10.1158/1078-0432.CCR-19-1418doi:

Access the most recent version of this article at:

Material

Supplementary

http://clincancerres.aacrjournals.org/content/suppl/2020/01/14/1078-0432.CCR-19-1418.DC1Access the most recent supplemental material at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. (CCC)Click on "Request Permissions" which will take you to the Copyright Clearance Center's

.http://clincancerres.aacrjournals.org/content/early/2020/04/03/1078-0432.CCR-19-1418To request permission to re-use all or part of this article, use this link



http://clincancerres.aacrjournals.org/lookup/doi/10.1158/1078-0432.CCR-19-1418http://clincancerres.aacrjournals.org/content/suppl/2020/01/14/1078-0432.CCR-19-1418.DC1http://clincancerres.aacrjournals.org/cgi/alertsmailto:[email protected]://clincancerres.aacrjournals.org/content/early/2020/04/03/1078-0432.CCR-19-1418http://clincancerres.aacrjournals.org/

/ColorImageDict > /JPEG2000ColorACSImageDict > /JPEG2000ColorImageDict > /AntiAliasGrayImages false /CropGrayImages false /GrayImageMinResolution 200 /GrayImageMinResolutionPolicy /Warning /DownsampleGrayImages true /GrayImageDownsampleType /Bicubic /GrayImageResolution 300 /GrayImageDepth -1 /GrayImageMinDownsampleDepth 2 /GrayImageDownsampleThreshold 1.50000 /EncodeGrayImages true /GrayImageFilter /DCTEncode /AutoFilterGrayImages true /GrayImageAutoFilterStrategy /JPEG /GrayACSImageDict > /GrayImageDict > /JPEG2000GrayACSImageDict > /JPEG2000GrayImageDict > /AntiAliasMonoImages false /CropMonoImages false /MonoImageMinResolution 600 /MonoImageMinResolutionPolicy /Warning /DownsampleMonoImages true /MonoImageDownsampleType /Bicubic /MonoImageResolution 900 /MonoImageDepth -1 /MonoImageDownsampleThreshold 1.50000 /EncodeMonoImages true /MonoImageFilter /CCITTFaxEncode /MonoImageDict > /AllowPSXObjects false /CheckCompliance [ /None ] /PDFX1aCheck false /PDFX3Check false /PDFXCompliantPDFOnly false /PDFXNoTrimBoxError true /PDFXTrimBoxToMediaBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ] /PDFXSetBleedBoxToMediaBox true /PDFXBleedBoxToTrimBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ] /PDFXOutputIntentProfile (None) /PDFXOutputConditionIdentifier () /PDFXOutputCondition () /PDFXRegistryName () /PDFXTrapped /False

/CreateJDFFile false /Description > /Namespace [ (Adobe) (Common) (1.0) ] /OtherNamespaces [ > /FormElements false /GenerateStructure false /IncludeBookmarks false /IncludeHyperlinks false /IncludeInteractive false /IncludeLayers false /IncludeProfiles false /MarksOffset 18 /MarksWeight 0.250000 /MultimediaHandling /UseObjectSettings /Namespace [ (Adobe) (CreativeSuite) (2.0) ] /PDFXOutputIntentProfileSelector /NA /PageMarksFile /RomanDefault /PreserveEditing true /UntaggedCMYKHandling /LeaveUntagged /UntaggedRGBHandling /LeaveUntagged /UseDocumentBleed false >> > ]>> setdistillerparams> setpagedevice

targeting super-enhancer associated oncogenes in … · 2020-04-03 · many oncogenes, including...

Documents