table of contents - wpro · table of contents ver. 4.5. 1. general course information background...

Table of Contents Ver. 4.5

1. General Course Information

Background and Objectives 2. Real-time PCR Background

Introduction to rRT-PCR Poliovirus Genome and PCR Targets Degenerate Primers and Probes Biosearch Technology Dyes and Quenchers Dye Compatibility Chart

Materials and Equipment Reagents

rRT-PCR Worksheet Sample Preparation Laboratory Practices to Prevent rRT-PCR Product Carryover 3. Poliovirus Diagnostic ITD rRT-PCR Protocol and Experiments

Poliovirus Diagnostic rRT-PCR protocol PCR Experiment 1: ITD rRT-PCR

4. Sabin VDPV rRT-PCR Screening Protocol and Experiments VDPV rRT-PCR Screening protocol PCR Experiment 2: Sabin VDPV rRT-PCR

5. Testing Unknown Samples PCR Experiment 3: Unknowns ITD PCR Experiment 4: Unknowns VDPV

6. References Research Reference Papers

Useful rRT-PCR Related Web Sites 7. Visual Guide Operation of ABI 7500 Real Time machine

Operation of Stratagene MX3000P Real Time machine 8. Appendix ITD and VDPV Result Interpretation Sheets Real Time PCR ITD Work Sheet Example Real Time PCR VDPV Work Sheet Example Real Time Master Reporting Sheet Example

Use of trade names and commercial sources is for identification only and does not constitute endorsement by the Public Health Service or by the U.S. Department of Health and Human Services.

This manual was created by the Polio Molecular Diagnostic Development Lab within CDC/NCIRD/DVD/PPLB

Poliovirus rRT-PCR 2011 Training Manual

2 Expanded Programme on Immunisation

1. General Course Information Background and Objectives: The current WHO recommended methods for the intratypic differentiation (ITD) f or p olioviruses a re E LISA, n ucleic a cid p robe hy bridization, P CR-RFLP, an d di agnostic P CR, using specific ap proved procedures. Two independent m ethods should b e u sed, o r on e m ethod m ay be u sed with partial genomic sequencing to confirm the results. In the WHO Poliovirus Laboratory N etwork, R egional R eference La boratories r eport I TD r esults. However, ITD may also be p erformed i n N ational P oliovirus L aboratories that have been specifically accredited to do so. ITD of poliovirus isolates by t he N ational Laboratories m ay more ra pidly alert t he e radication program t o t he i ntroduction o f w ild v irus into po lio-free ar eas. All L20B positive cell cultures must be referred to an accredited ITD laboratory. For a laboratory to be accredited to perform any o f the specific ITD methods, the staff must receive proper training. The o bjective o f this training i s t o e nable p ersonnel to i dentify an d characterize poliovirus isolates using a real-time RT-PCR method. Principle:

The poliovirus diagnostic real-time RT PCR is performed on L20B positive cell cultures t hat ar e s uspected t o c ontain poliovirus. The viral RNA (vRNA) is converted t o complementary D NA ( cDNA) u sing r everse transcriptase. The cDNA is amplified in a PCR reaction using Taq polymerase. The PCR products are detected and identified by hybridization with specific Taqman® probes. Both the cDNA synthesis and the PCR reaction use multiple s ets of o ligonucleotide pr imers that are t agged w ith probes with d ifferent specificities. This combination of primers and probes will result in the serotype identification and intratypic differentiation of poliovirus isolates.



2. PCR Background and Protocol Introduction to RT-PCR:

How Real-Time PCR Works

RT-PCR Basics

PCR

vRNA AMV Reverse transcriptase 42°C, 45min

Reverse primer

cDNA synthesis

Forward primer

Taq polymerase

Denaturation 95°C, 24 sec

2nd strand synthesis

Annealing 44°C, 30

sec

40 cycles

Product analysis

Primer extension 60°C, 24 sec



¤Although we don’t need to run acrylamide gels to identify the amplicons using Real-time RT-PCR, the amplicons can still be analyzed on an acrylamide gel for trouble-shooting purposes. The amplicon sizes are shown for this reason.

Poliovirus Genome & PCR Targets

VP4 VP2 VP3 VP1 2A 2B 2C 3A 3B 3C 3D 3'NTR 5'NTR

PanEV

Choosing degenerate primers: Pan PV primers (T)Y S R F D M V Y Q I M Y V

5 ’ - CITAITCIMGITTYGAYATG - 3 ’… … 3 ’ - CAIATRGTYTAITACATRYA - 5 ’

PanPV * PV1* PV2* PV3* Sabins * degenerate primers

Primers Amino Acid Motifs Size¤ PanEV 145 PanPV TYSRFDM / VYQIMYV 100 PV1 RDTTHI / QMLESMI 70 PV2 LRDTTHI / E VVE 79 PV3 NPSIGYT / DANDQ G 140 Sabin 1 97 Sabin 2 71 Sabin 3 53

M L

A G G

N S I T V

G N S I T V

I V



Degenerate Primers and Probes: Degeneracy: The presence in the genetic code of more than one codon that may encode a single amino acid and lead to its insertion into a growing peptide chain. **Degenerate pr imers ar e d esigned by t argeting am ino ac ids and us ing c odon degeneracy to account for nucleotide sequence variation in sites that encode the same amino ac id motif. T hese pr imers are degenerate us ually in t he t hird position ( also referred t o as t he “ wobble” position) an d w ill i dentify am ino acid m otifs for eac h poliovirus s erotype. Nucleotide bas e a nalogs m ay be us ed to r educe deg eneracy. Inosine “dI” is a n ex ample of a b ase analog t hat w ill bas e-pair with al l f our nor mal bases, while “dP” is a pyrimidine base analog that can substitute for pyrimidine residues C and T, and will bind to purine residues A and G. **Enteroviruses (specifically polioviruses) have a high polymerase error rate. This error rate is on the order of 10-4 errors per nucleotide synthesized; meaning that 1 in 10,000 nucleotides inserted by the polymerase is in error. Although some insertions are lethal and nev er r ecognized w ithin t he v iral g enome, ot hers ( particularly t hose that d o not change the amino acid) will accumulate, resulting in amino acid degeneracy. Therefore, degenerate primers are designed to compensate for this occurrence. **Polio primers PV1 serotype, PV2 serotype, PV3 serotype and PanPV are degenerate, inosine-containing pr imers & pr obes. T hese pr imers are cycled un der di fferent temperature an d r amping par ameters t han n ormal P CR c onditions. T he P anEV an d Sabin assays can also be ran under the same degenerate conditions, even though they do not contain inosine. Denaturation is at 95ºC; however the annealing temperature is lowered t o 44 ºC b ecause o f the l ower T m (melting t emperature) of t he pr imers containing Inosine (dI). The extension temperature is also lowered, to 60ºC, to prevent melting of the primer-template complex before extension can occur. Another important aspect o f the d egenerate c ycling c ondition i s t he s lower r amping t ime b etween the annealing and ex tension temperatures. T his ramp time is increased to 45 seconds so that the primer is not melted away from the template prior to extension. Some brands of real-time m achines c an not c hange their ramp s peeds, s o w e ad d an ex tra s tep between t he an neal and ex tension t emperatures ( such as with t he S tratagene MX3000P) to slow down the cycling. However, with the ABI 7500, we can use a ramp speed of 25% normal (0.4ºC/s), which s lows down the cycling. E ven non-degenerate cycling conditions can be too fast with non-inosine containing pr imers and we need to slow t his c ycling r ate dow n as w ell. This i s w hy an ex tra s tep ( 57oC f or 10s ec) was added between the anneal and extension temperatures for the non-degenerate thermal profile.



Biosearch Technology Dyes and Quenchers

Dye Compatibility Chart



Materials and Equipment: Autoclave Balance Biological Safety Cabinet (one for reagents and another for sample preparation) Consumables

• Microcentrifuge tubes, 1.5 ml, low adsorption • Micropipette tips, aerosol-resistant, 20 µl and 200 µl capacity • Paraffin film or flexible 96-well microtiter plates • 8-well PCR strips, 0.2 ml per well, and optical caps to specific to your real-time

machine • Vinyl exam gloves, talc-free

Freezer, -20°C Heat resistant tape Ice bucket and ice Laboratory coat Microcentrifuge tube racks Microcentrifuge with 8-well strip adaptor Micropipettes, 20 µl and 200 µl capacity Real-time PCR machine 8-well strip PCR racks Refrigerator, 4°C Vortex mixer Reagents: Roche Applied Science

• Protector RNase Inhibitor 40 U/µL • Taq DNA Polymerase 5 U/µL • Transcriptor RT 20 U/µL (or AMV RT 25 U/µL)

CDC Poliovirus Diagnostic rRT-PCR kit CDC VDPV rRT-PCR Screening kit



rRT-PCR Reagent Worksheet

REAGENT SOURCE CAT.#

REAG # LOT # or REQ. #

EXP. DATE

PREP. DATE

PanEV primers A CDC PanPV primers A CDC PV1 primers +A CDC PV2 primers +A CDC PV3 primers +A CDC SAB primers +A CDC PV1 +C CDC PV2 +C CDC PV3 +C CDC SAB +C CDC Dnase/Rnase free dH20 CDC Buffer B 1mL CDC 1M DTT CDC RNase Inhibitor 40U/µL AMV Reverse Transcriptase

25U/µL

Taq DNA Polymerase 5U/µL



Sample Preparation:

• Take 50 µl virus tissue culture and place into a tube and spin it (bench top micro centrifuge at 5,000 rpm or full speed (max rpm 6,400) of Tube-Strip PicoFuge) at room temperature for 2 minutes.

• Once the samples have been spun, they can be stored at –20°C and re-used if needed. You must re-spin the sample after stored at –20°C.

• Take 0.5 µl of T.C. supernatant (or 1µl of Control RNA) for each sample and add into the appropriate reaction strip/plate well.

• rRT-PCR does NOT require a 95°C heat step. One µl of T.C. extracted RNA can be used, but it’s not generally required.

Laboratory Practices to Prevent PCR Product Carryover:

• Use a separate room or containment unit (biological safety cabinet equipped with UV light) for pre- and post-PCR procedures.

• Prepare and aliquot reagents in an area that is free of cloned cDNA and PCR amplified products.

• Add non-sample components to the reaction tubes before adding the nucleic acid sample.

• Aliquot reagents and store to minimize the number of repeated samplings. • Always use aerosol-resistant pipette tips. • Change gloves frequently (talc-free). • Uncap tubes carefully one at a time to prevent aerosols. • Minimize sample handling. • Cap each tube after the addition of RNA before proceeding to the next sample. • Use a well characterized Positive control sample that amplifies consistently (viral

or kit RNA). • Include multiple reagent controls with each amplification. It should contain all of

the necessary components for PCR except the template RNA. • Avoid opening the reaction tubes containing PCR amplified products.



3. Poliovirus Diagnostic ITD rRT-PCR Protocol and Experiments: Kit components The kit is supplied in one box containing six vials of primers and probes in Buffer A (Serotype 1, Serotype 2, Serotype 3, Pan-Poliovirus, Pan-Enterovirus, Sabin Multiplex), two vials of Buffer B (to which DTT and enzymes should be added prior to the first use) and one vial of DTT. The additional contents are the appropriate positive controls for each primer set and one copy of this package insert. Additional required reagent and enzymes, not supplied with the kit, are Protector RNase inhibitor, Transcriptor Reverse Transcriptase, and Taq DNA polymerase from Roche Applied Science. The listed products were used in the development and evaluation of this kit and do not constitute a specific product endorsement. Enzyme availability from manufacturers may vary with each laboratory. Therefore, it is the responsibility of each laboratory to find appropriate substitutes when necessary. Real-time RT-PCR Reactions

1) Fill out PCR worksheet with name, date, primers, samples, and sample order, as well as thermocycler and program identifiers.

a) Name wells using thermocycler software for samples and controls (positive and reagent).

b) One positive control: non-infectious control RNA supplied with Polio rRT-PCR kit. c) One reagent control: Buffer A + B with no template.

2) Thaw virus isolates and PCR reagents at room temperature. 3) Making Buffer B + enzyme mix: The first time a vial of Buffer B 1mL is used, add

2.8 µl 1 M DTT, 27.6 µl 40 U/µl RNase inhibitor, 18.0 µl 20 U/µl Transcriptor RT (or 14.4 µl 25 U/µl AMV RT), and 54.8 µl 5 U/µl Taq polymerase (CAUTION, do not use error correcting Taq polymerases like Pfu and Pwo, they will not work with inosine primers) and mix. The enzyme mix should be stable for 6 months at 4°C. Once the enzymes have been added, mark “+E” on the cap with an indelible marker. For long term storage (>6 months), aliquot & freeze Buffer B +E at -20C.

4) Making reaction solution: For each primer set, mix 19 µl Buffer A (vortex to resuspend probe before use) and 5 µl Buffer B +E; dispense 24 µl reaction solution into each well. For testing large sample numbers, create a master mix of Buffers A + B (see table), and dispense 24 µl of the A + B master mix per reaction well. (We recommend to use the first well on your 8-well strip for making A + B master mix since some commercial eppendorf tubes may bind the probe).

Sample number Buffer A µl Buffer B µl

40 152 8

35 133 7

30 114 6

25 95 5

20 76 4

15 57 3

10 38 2

5 19 1



5) Sample preparation: Take 50 µl virus cell culture and place into a tube and centrifuge (bench top micro centrifuge at 5,000 rpm or full speed (max rpm 6,400) of Tube-Strip PicoFuge) at room temperature for 2 minutes. (Once the samples have been spun, they can be stored at –20°C and re-used if needed. You need to re-spin the sample after being stored at –20°C).

6) Take 0.5 µl of cell culture supernatant (or 1µl of Control RNA) for each sample and add into the appropriate reaction strip/plate well. rRT-PCR does NOT require a 95°C heat step. One µl of extracted RNA can be used, but is generally not required.

7) Place strips in real-time thermocycler and run cycle as shown below. If using a thermocycler with a rapid ramp speed, program the ramp from 44°C to 60°C for 45 sec (note for the ABI 7500, you can use 25% ramp speed between the anneal and extension temperatures for all assays). Thermocyclers with regular ramp speeds can use the default ramp time; Stratagene Mx3000P and similar machines do not have adjustable ramp capabilities. An additional intermediate step between the lower and higher temperature in the PCR cycle compensates for the inability to adjust the ramp time between anneal and extension):

a) RT reaction, 42°C, 45 min. b) Inactivate RT, 95°C, 3 min. c) PCR cycles (all primers sets):

Using a Stratagene MX3000P (or equivalent): 95°C for 24 sec, 44°C for 24 sec, 52°C for 30 sec, 60°C for 24 sec for 40 cycles Using an ABI 7500 (or equivalent): 95°C for 24 sec, 44°C for 30 sec, then a 25% ramp speed to 60°C for 24 sec, for 40 cycles

The endpoint fluorescent data is collected at the end of the anneal step. d) Select the appropriate dye filter to correspond with the assay being used.

Interpretation

You must first check the negative and positive control data to validate your assay before reading data from samples. The cycle threshold value (Ct) is the cycle number where a PCR product is seen via fluorescence. The results are interpreted by looking for a Ct value of between 10-28. These Ct values are calculated automatically by the Stratagene (or ABI 7500) software. However, you may have to manually adjust the baseline Ct threshold to reflect your actual negative controls (this is especially true with the ABI 7500 software). The Ct value cutoff is 30, with values less than 30 as positive and values more than 30 as negative. You are actually looking for a nice logarithmic curve as shown in the examples below. Samples with Ct values from 28-32 should be re-analyzed using extracted RNA for those samples. Samples which have a Ct value <30 but have a flat fluorescence profile, or a profile that rises just barely rise above the X axis are most likely negative, but should be repeated, using extracted RNA.



Below is an example with an ABI 7500.

ITD Assay Results Interpretation PE PP PV1 PV2 PV3 SAB 1 SAB 2 SAB 3 RESULT COMMENTS - - - - - - - - Negative Report NEV

+ - - - - - - - NPEV Report NPEV

+ + - - - - - - Possible Polio Refer for Sequencing

+ + + - - - - - PV1-NSL Refer for Sequencing

+ + - + - - - - PV2-NSL Refer for Sequencing

+ + - - + - - - PV3-NSL Refer for Sequencing

+ + + - - + - - PV1-SABIN Run VDPV1 assay

+ + - + - - + - PV2-SABIN Run VDPV2 assay

+ + - - + - - + PV3-SABIN Run VDPV3 assay

8/14/2008 PV PV1 PV2 PV3 2

PV3

PVPV2

PV1



Troubleshooting-Common Errors Problem Possible causes All reactions negative, including positive control

Component missing, wrong thermocycler profile used or bad reagent.

No Ct value(i.e. negative) with positive control; some sample reactions positive

Control RNA degraded or not added.

Positive Ct values with one or more Sabin pairs, but corresponding Serotype pairs and/or PanPV are negative

Ensure that serotype PCR was performed with 44°C annealing temperature. Ensure that ramp time for 44°C to 60°C step is approximately 40-45 seconds (~0.4 °C/sec.).

Failure to select the correct dye filter for an assay

Re-run the assay with the correct dye filter (ABI 7500 will record all dyes regardless, select filter and reanalyze results).

No fluorescence data collected

Bubbles in the well (or on the cap) Inhibition of rRT-PCR due to cell debris in the sample or too much clarified cell culture used

Positive reaction (Ct value) with PanPV primers, but all serotype pairs are negative Or negative Ct value with PanPV, but positive for a serotype Or if results are negative (discordant) after repeating at least one time

The isolate should be referred to a Specialized Reference Laboratory for identification.

Specific Examples PE PP PV1 PV2 PV3 SAB 1 SAB 2 SAB 3 COMMENTS

+ - + + + - - - Any Serotype positive result without Pan-PV, repeat Pan-PV portion of assay.

+ + - - - - - - Any Pan-PV positive result without any Serotypes or Sabin positives, repeat entire assay.

+ + + - - + + + Any Sabin positive result without any Serotype positives, repeat missing serotypes.

+ + - + + - + - Possible NSL/Sabin mixture. Run VDPV2 assay and refer isolate for NSL sequencing.



Real-time PCR Primers/Probes Specificity

Primer or probe (Polarity)

Primer or probe sequence (5′→3′)

Pan-Enterovirus

PCR-1 (A) PCR-2 (S) PanEV Probe (S)

GCGATTGTCACCATWAGCAGYCA GGCCCCTGAATGCGGCTAATCC FAM-CCGACTACTTTGGGWGTCCGTGT-BHQ1

*Pan-Poliovirus

panPV/PCR-1 (A) panPV/PCR-2 (S) panPV Probe21A (A)

AYRTACATIATYTGRTAIAC CITAITCIMGITTYGAYATG FAM-TGRTTNARIGCRTGICCRTTRTT-BHQ1

*Serotype 1 seroPV1A (A) seroPV1,2S (S) seroPV1 Probe16A (A)

ATCATIYTPTCIARPATYTG TGCGIGAYACIACICAYAT FAM-TGICCYAVICCYTGIGMIADYGC-BHQ1

*Serotype 2 seroPV2A (A) seroPV1,2S (S) seroPV2 Probe5S (S)

AYICCYTCIACIRCICCYTC TGCGIGAYACIACICAYAT FAM-CARGARGCIATGCCICARGGIATNGG-BHQ1

*Serotype 3 seroPV3A (A) seroPV3S (S) seroPV3 Probe11S (S)

CCCCIAIPTGRTCRTTIKPRTC AAYCCITCIRTITTYTAYAC FAM-CCRTAYGTNGGITTRGCVAAYGC-BHQ1

Sabin 1 Sab1/PCR-1 (A) Sab1/PCR-2 (S) Sab1/Probe (A)

CCACTGGCTTCAGTGTTT AGGTCAGATGCTTGAAAGC CY5-TTGCCGCCCCCACCGTTTCACGGA-BHQ3

Sabin 2 Sab2/PCR-1 (A) Sab2/PCR-2 (S) Sab2/Probe (S)

CGGCTTTGTGTCAGGCA CCGTTGAAGGGATTACTAAA FAM-ATTGGTTCCCCCGACTTCCACCAAT-BHQ1

Sabin 3 Sab3/PCR-1 (A) Sab3/PCR-2 (S) Sab3/Probe (S)

TTAGTATCAGGTAAGCTATC AGGGCGCCCTAACTTT ROX-TCACTCCCGAAGCAACAG-BHQ2

Degenerate primers: K = G and T; M = A and C; R = A and G; Y = C and T; I = Degenerate base analog, Inosine; P = Degenerate base analog for (TC). * Use degenerate PCR conditions with these primer sets. PCR Positive Control RNA Positive controls should be reconstituted before initial usage. Briefly spin the tubes to concentrate the lyophilized pellet before resuspension. Each lyophilized control should be reconstituted in 100µL dH2O to yield a working solution of 20pg/µL. After addition of dH2O, place in -20ºC overnight to allow proper rehydration of the RNA pellet. [Vortex and centrifuge] This solution should then be aliquoted into 2 x 50µL volumes and stored at -20°C for future usage. Aliquoting will reduce risk of cross-contamination and the RNA hydrolyzing. Any one of the three serotype PV controls may be used for the PanPV and PanEV control during testing. Please do not repeatedly use the same serotype PV control RNA for every PanPV or PanEV test run, so you do not run out of that specific serotype PV control RNA.



rRT-PCR Experiment #1 ITD rRT-PCR: Working in pairs, each group will perform and analyze 30 rRT-PCR reactions. All primer sets use degenerate PCR conditions. Primer set Sample PanPV Reagent Control PanPV Positive Control PanPV Sample 1 PanPV Sample 2 PanPV Sample 3 PV1 Reagent Control PV1 Positive Control PV1 Sample 1 PV1 Sample 2 PV1 Sample 3 PV2 Reagent Control PV2 Positive Control PV2 Sample 1 PV2 Sample 2 PV2 Sample 3 PV3 Reagent Control PV3 Positive Control PV3 Sample 1 PV3 Sample 2 PV3 Sample 3 PanEV Reagent Control PanEV Positive Control PanEV Sample 1 PanEV Sample 2 PanEV Sample 3 Sabin Reagent Control Sabin Positive Control Sabin Sample 1 Sabin Sample 2 Sabin Sample 3 **For PanEV use PV1 Positive Control RNA as the positive control. For Sabin use the Sabin Positive Control RNA.



Picture(s) and/or data of real-time run:



4. VDPV rRT-PCR Screening Protocol and Experiments: Kit components The kit is supplied in one box. The box contains three vials of primers and probes in Buffer A (Sab1 VDPV, Sab2 VDPV, Sab3 VDPV) and appropriate positive controls for each primer set. The box also contains one vial of Buffer B (to which DTT and enzymes should be added prior to the first use), one vial of DTT, and one copy of this package insert. Additional required reagent and enzymes, not supplied with the kit, are Protector RNase inhibitor, Transcriptor Reverse Transcriptase, and Taq DNA polymerase from Roche Applied Science. The listed products were used in the development and evaluation of this kit and do not constitute a specific product endorsement. Enzyme availability from manufacturers may vary with each laboratory. Therefore, it is the responsibility of each laboratory to find appropriate substitutes when necessary. Real-time RT-PCR Reactions

1) Fill out PCR worksheet with name, date, primers, samples, and sample order, as well as thermocycler and program identifiers. a) Name wells using thermocycler software for samples and controls (positive

and reagent). b) One positive control: non-infectious control RNA supplied with Polio rRT-PCR

kit. c) One reagent control: Buffer A + B with no template.

2) Thaw virus isolates and PCR reagents at room temperature. 3) Making Buffer B + enzyme mix: The first time a vial of Buffer B 1mL is used, add

2.8 µl 1 M DTT, 27.6 µl 40 U/µl RNase inhibitor, 18.0 µl 20 U/µl Transcriptor RT (14.4 µl 25 U/µl AMV RT), and 54.8 µl 5 U/µl Taq polymerase (CAUTION, do not use error correcting Taq polymerases like Pfu and Pwo, they will not work with inosine primers) and mix. The enzyme mix should be stable for 6 months at 4°C. Once the enzymes have been added, mark “+E” on the cap with an indelible marker. For long term storage (>6 months), aliquot & freeze Buffer B +E at -20C.

4) Making reaction solution: For each primer set, mix 19 µl Buffer A (vortex to resuspend probe before use) and 5 µl Buffer B +E; dispense 24 µl reaction solution into each well. For testing large sample numbers, create a master mix of Buffers A + B (e.g. 8 samples x 19 µl Buffer A = 152 µl; 8 x 5 µl Buffer B = 40 µl), and dispense 24 µl of the A + B master mix per reaction well.

5) Sample preparation: Take 50 µl virus cell culture and place into a tube and centrifuge (bench top micro centrifuge at 5,000 rpm or full speed (max rpm 6,400) of Tube-Strip PicoFuge) at room temperature for 2 minutes. (Once the samples have been spun, they can be stored at –20°C and re-used with re-spin if needed).

6) Take 0.5 µl of cell culture supernatant (or 1µl of Control RNA) for each sample and add into the appropriate reaction strip/plate well. rRT-PCR does NOT require a 95°C heat step. One µl of extracted RNA can be used, but is not generally required.



7) Place strips in real-time thermocycler and run cycles as shown below. If using a thermocycler with a rapid ramp speed, program the ramp from 44ºC to 60ºC for 45 sec (note for the ABI 7500, you can use 25% ramp speed between the anneal and extension temperatures). Thermocyclers with regular ramp speeds can use the default ramp time; Stratagene Mx3000P and similar machines do not have adjustable ramp capabilities. An additional intermediate step between the lower and higher temperature in the PCR cycle compensates for the inability to adjust the ramp time between anneal and extension.

a) RT reaction, 42°C, 45 min. b) Inactivate RT, 95°C, 3 min. c) PCR cycles: Using a Stratagene MX3000P (or equivalent): 95°C for 24 sec, 50°C for 24 sec, 57°C for 10 sec, 65°C for 24 sec for 40 cycles. Using an ABI 7500 (or equivalent): 95°C for 24 sec, 50°C for 30 sec, then a 25% ramp speed to 65°C for 24 sec, for 40 cycles. The end point fluorescent data is collected at the end of the anneal step.

d) Select the appropriate dye filter to correspond with the assay being used. Interpretation

You must first check the negative and positive control data to validate your assay before reading data from samples. The results are interpreted by looking for a cycle threshold value (Ct) of between 10-28. These Ct values are calculated automatically by the Stratagene (or ABI 7500) software. However, you may have to manually adjust the baseline Ct threshold to reflect your actual negative controls (this is especially true with the ABI 7500 software). The Ct value cutoff is 30, with values less than 30 as positive and values more than 30 as negative. You are actually looking for a nice logarithmic curve as shown in the examples below. Samples with Ct values from 28-32 should be re-analyzed using extracted RNA for those samples. Samples which have a Ct value <30 but have a flat fluorescence profile, or a profile that just barely rises above the X axis are most likely negative, but should be repeated, using extracted RNA for those samples. Below is an example using an ABI 7500.

8/18/2008 VDPVs 10&15pm VP1 10pm 3D

8-15-082

S2VDPV assay

VP1

3D



Interpretation of VDPV Results

VP1 RESULT Positive SL (Report)

Negative NSL (Report and Refer for Sequencing)

Troubleshooting - Common Errors

Problem Possible Causes All reactions negative, including positive control

Component missing, wrong thermocycler profile used or bad reagent.

No Ct value( i.e. negative) with positive control; some sample reactions positive

Control RNA degraded or not added.

Failure to select the correct dye filter for an assay

Re-run the assay with the correct dye filter (ABI 7500 will record all dyes regardless. Select filter and reanalyze results).

No fluorescence data collected

Bubbles in the well Inhibition of rRT-PCR due to cell debris in the sample or too much clarified cell culture used



Sabin VDPV Real-time Primer specificity

Primer & Probe sequences 5’-3’

S1 VDPV VP1 (target aa #99)

Sense CATGCGTGGCCATTATA Anti-Sense CAAATTCCATATCAAATCTA VP1 Probe FAM-CACCAAGAATAAGGATAAGC-BHQ1

S1 VDPV 3D Sense GACACTAAGGAAATGCAAAAACTGC Anti-Sense ATCGCACCCTACTGCTGA 3D Probe ROX-TCAGTGGCAATGAGAATGGCTTTTGGG-BHQ2

S2 VDPV VP1 (target aa #143)

Sense GACATGGAGTTCACTTTTG Anti-Sense CTCCGGGTGGTATATAC VP1 Probe FAM-CATTGATGCAAATAAC-BHQ1

S2 VDPV 3D Sense AGGAAATGCGGAGACTCTTA Anti-Sense GGATCACAACCAACTGCACT 3D Probe ROX-CTTACCGCTTGTAACATATGT-BHQ2

S3 VDPV VP1 (target aa #285-290)

Sense CATTTACATGAAACCCAAAC Anti-Sense TGGTCAAACCTTTCTCAGA VP1 Probe FAM-TAGGAACAACTTGGAC-BHQ1

S3 VDPV 3D Sense CACCAAAGAAATGCAAAGACTTT Anti-Sense GGATCGCATCCAACTGCACT 3D Probe ROX-CCTACCATTAGTGACATATGT-BHQ2



rRT-PCR Experiment #2 Sabin VDPV rRT-PCR: Working in pairs, each group will perform and analyze 15 rRT-PCR reactions. The VDPV assays use normal, non-degenerate, RT-PCR profiles. Primer set Sample S1 VDPV Reagent Control S1 VDPV Positive Control S1 VDPV Sample 1 S1 VDPV Sample 2 S1 VDPV Sample 3 S2 VDPV Reagent Control S2 VDPV Positive Control S2 VDPV Sample 1 S2 VDPV Sample 2 S2 VDPV Sample 3 S3 VDPV Reagent Control S3 VDPV Positive Control S3 VDPV Sample 1 S3 VDPV Sample 2 S3 VDPV Sample 3 **For S 1 VDPV use P V1 Positive Co ntrol RNA , S2 VDPV u se PV2 Positive C ontrol RNA, S3 VDPV use PV3 Positive Control RNA.



Picture (s) and/or data of real-time run:



5. Testing Unknown Samples

rRT-PCR Experiment #3 Unknowns ITD: Working in pairs, each group will analyze 5 “Unknowns,” using all primer sets and appropriate controls.

Primer set Sample PanEV Reagent Control PanEV Positive Control PanEV Sample 1 PanEV Sample 2 PanEV Sample 3 PanEV Sample 4 PanEV Sample 5 Sabin Reagent Control Sabin Sabin - Positive Control Sabin Sample 1 Sabin Sample 2 Sabin Sample 3 Sabin Sample 4 Sabin Sample 5

Primer set Sample Pan-PV Reagent Control Pan-PV Positive Control Pan-PV Sample 1 Pan-PV Sample 2 Pan-PV Sample 3 Pan-PV Sample 4 Pan-PV Sample 5 PV1 Reagent Control PV1 Positive Control PV1 Sample 1 PV1 Sample 2 PV1 Sample 3 PV1 Sample 4 PV1 Sample 5 PV2 Reagent Control PV2 Positive Control PV2 Sample 1 PV2 Sample 2 PV2 Sample 3 PV2 Sample 4 PV2 Sample 5 PV3 Reagent Control PV3 Positive Control PV3 Sample 1 PV3 Sample 2 PV3 Sample 3 PV3 Sample 4 PV3 Sample 5



rRT-PCR Experiment #4 Unknowns VDPV: Working in pairs, each group will analyze 5 “Unknowns,” testing only the SL positive samples from experiment 3 using the respective primer sets and appropriate controls. Primer set Sample S1 VDPV Reagent control S1 VDPV Positive control S1 VDPV Sample 1 S1 VDPV Sample 2 S1 VDPV Sample 3 S1 VDPV Sample 4 S1 VDPV Sample 5 S2 VDPV Reagent control S2 VDPV Positive control S2 VDPV Sample 1 S2 VDPV Sample 2 S2 VDPV Sample 3 S2 VDPV Sample 4 S2 VDPV Sample 5 S3 VDPV Reagent control S3 VDPV Positive control S3 VDPV Sample 1 S3 VDPV Sample 2 S3 VDPV Sample 3 S3 VDPV Sample 4 S3 VDPV Sample 5



6. References: Research References: 1. Kilpatrick, D. R., B. Nottay, C. F. Yang, S. J. Yang, M. N. Mulders, B. P. Holloway, M. A.

Pallansch, and O. M. Kew. 1996. Group-specific identification of polioviruses by PCR using primers containing mixed-base or deoxyinosine residue at positions of codon degeneracy. J. Clin. Microbiol. 34:2990-6.

2. Kilpatrick, D. R., B. Nottay, C. F. Yang, S. J. Yang, E. Da Silva, S. Penaranda, M. Pallansch, and O. Kew. 1998. Serotype-specific identification of polioviruses by PCR using primers containing mixed-base or deoxyinosine residues at positions of codon degeneracy. J. Clin. Microbiol. 36:352-7.

3. Yang, C.-F., L. De, B.P. Holloway, M.A. Pallansch, and O.M. Kew. 1991. Detection and identification of vaccine-related polioviruses by the polymerase chain reaction. Virus Res. 20:159-179.

4. Yang, C.-F., L. De, S.-J. Yang, J. Ruiz Gómez, J. Ramiro Cruz, B. P. Holloway, M. A. Pallansch, and O. M. Kew. 1992. Genotype-specific in vitro amplification of sequences of the wild type 3 polioviruses from Mexico and Guatemala. Virus Res. 24:277-296.

5. Expanded Programme on Immunisation. 2000. Molecular characterization of polioviruses (laboratory manual). World Health Organization, Geneva.

6. Kilpatrick, D. R., K. Ching, J. Iber, R. Campagnoli, C. J. Freeman, N. Mishrik, H. Liu, M. A. Pallansch, and O. M. Kew. 2004. Multiplex PCR Method for Identifying Recombinant Vaccine-related Polioviruses. J. Clin. Microbiol. 42:4313-4315.

7. Kilpatrick, D. R., C. F. Yang, K. Ching, A. Vincent, J. Iber, R. Campagnoli, M. Mandelbaum, L. De, S-J. Yang, A. Nix, and O. M. Kew. 2009. Rapid Group, Serotype, and Vaccine Strain-Specific Identification of Poliovirus Isolates by Real-Time Reverse Transcription-PCR Using Degenerate Primers and Probes Containing Deoxyinosine Residues. J. Clin. Microbiol. 47(6):1939-1941.

8. Kilpatrick, D.R., C.-F. Yang, K. Ching, J. Iber, Q. Chen, S.-J. Yang, L. De, A.J. Williams, M. Mandelbaum, and O. M. Kew. A Multiplex Real-time PCR Assay for Identifying Vaccine-Derived Polioviruses (VDPVs). Manuscript in preparation.

9. Bustin, S .A and N olan, T. 2004. P itfalls o f Q uantitative R eal-time Re verse-Transcription Polymerase Chain Reaction. J. Biomolecular Techniques 15:155-166.



Useful rRT-PCR Related Web Sites: This list contains useful information from research institutions and vendors of PCR-related products, as well as links to other useful molecular biology sites. Applied Biosystems:

http://home.appliedbiosystems.com/

Bio-Rad: http://www.biorad.com/B2B/BioRad/product/br_category.jsp?BV_SessionID=@@@@0397822276.1220462565@@@@&BV_EngineID=cccgadefdhgdjhfcfngcfkmdhkkdflm.0&divName=Life+Science+Research&categoryPath=Catalogs%2fLife+Science+Research%2fAmplification+%7c+PCR%2fReal-Time+PCR+Detection+Systems&loggedIn=false&lang=English&country=HQ&catLevel=4&catOID=-32437&isPA=false&serviceLevel=Lit+Request

Biosearch Technologies: Dye compatibility chart for different real-time machines:

http://www.biosearchtech.com/images/hottopics/multiplex/DyeCompatibilityChart.pdf

Cold Spring Harbor Laboratory: http://www.cshl.org/ Center for Cancer Research Nanobiology Program (CCRNP): http://www.ccrnp.ncifcrf.gov/ Northwestern University: http://www.biochem.northwestern.edu/holmgren/Glossary/index.html Promega Corp.: http://www.promega.com/ Protocol Online: http://www.protocol-online.org/prot/Molecular_Biology/PCR/index.html Roche Molecular Biochemicals:

http://www.roche-applied-science.com/ Stratagene/Agilent: MX3000P & MX3005P real-time machines

http://www.stratagene.com/manuals/Mx3000P_and_Mx3005P_User_Guide.pdf

http://www.pebio.com/pc/�

http://www.biorad.com/B2B/BioRad/product/br_category.jsp?BV_SessionID=@@@@0397822276.1220462565@@@@&BV_EngineID=cccgadefdhgdjhfcfngcfkmdhkkdflm.0&divName=Life+Science+Research&categoryPath=Catalogs%2fLife+Science+Research%2fAmplification+%7c+PCR%2fReal-Time+PCR+Detection+Systems&loggedIn=false&lang=English&country=HQ&catLevel=4&catOID=-32437&isPA=false&serviceLevel=Lit+Request�






http://www.biosearchtech.com/images/hottopics/multiplex/DyeCompatibilityChart�

http://www.cshl.org/�

http://www.promega.com/�

http://www.roche-applied-science.com/�



7. Visual Guide: Operation of ABI 7500 for real time RT-PCR (rRT-PCR)

Advanced Setup (Software Version 2.0 or 2.01) Click on the “Advanced Setup” box.



Experiment Profile: Type the PCR number and name of experiment in “Experiment Name”. Click on: 7500(96 Well)

Quantitation-Standard curve TaqMan Reagents Standard (~2 hours to complete a run).

Plate Setup: Click on “Plate Setup” to view this screen



Define Targets and Samples Define Target: For the initial use, click on “Target 1” and name the first target that is specific to the experiment. After naming the target, the “Reporter” must be selected for the target. Select color for the Reporter Save the target by c licking on t he “Save T arget” button. T his a llows you to r ecall t hese t argets f or f urther experiments. Click on the “Add New Target” button to add another target. Type the next target in and save again. The screen below is an example of PanEV, PanPV, PV1, PV2, PV3, and Sabin to be used in this experiment.

FAM – PanEV, PanPV, PV1, PV2, PV3, Sabin 2, (VDPV1-VP1, VDPV2-VP1, VDPV3-VP1) Cy5 – Sabin 1 ROX – Sabin 3, (VDPV1-3D, VDPV2-3D, VDPV3-3D)

Define Sample: Specimen names may also be entered for the specific experiment by clicking in “Add New Sample” and defining each specimen ID. (Example: 2009075511)



Assign Targets and Sample Click on “Assign Targets and Samples” Click on “Select the dye to use as the passive reference” and select “None”.

Select wells for the specific run by either selecting the whole column or individual wells by holding the “Ctrl” button on the keyboard and selecting the wells with the mouse in the “View Plate Layout” view.



Select the specific wells that you want to assign a target to. The example below shows PanEV assigned to column 1, wells A, B, C, D, and E. To do this, press the “Ctrl” button on your keyboard and selecting with the mouse the wells you wish to assign a target. Check “Assign” for PanEV, and sample ID 2009705511 to Well A1.

Once the target has been selected, you must identify your “Negative Control”. This is done by selecting the well that is designated as the “Negative Control” and clicking on “N” under Task.



Once the target has been selected, you must identify your “Positive Control”. This is done by selecting the well that is designated as the “Positive Control” and clicking on “S” under Task.

The process is repeated for selecting other wells and targets (See Page 30, Screen 2). Once all wells, targets and samples have been assigned, a Run Method must be generated. Run Methods: Click on “Run Method” to view this screen.



There are two options for setting up the thermal program. The first is the “Graphical View” as seen above, or the “Tabular View” as seen below.

For training purposes, the “Graphical View” will be used to “Set Thermal Cycler Protocol”. Set Thermal Cycler Protocol: “Graphical View”, set the “Reaction Volume Per Well” to 25µl. Set “Number of Cycles” to 40.



Another step must be added to the protocol for annealing at Cycling Stage. Click “Add Step” and select “Before”.

The following screen will appear showing another step added at the end of the cycling stage:

Once another step has been added, Degenerate conditions may now be programmed for the run. The conditions m ay ei ther be set by c licking on t he temperature and t yping the change, or by dragging the temperature line to the appropriate temperature desired for holding stage or cycling stage.



Degenerate conditions for PanPV, PV1, PV2, PV3, PanEV, and Sabin 1, 2, 3. Holding Stage, RT reaction, 42oC - 45min. Holding Stage, Denature, 95oC - 3min. Cycling Stage, 40 cycles Cycling Stage, Step 1, Denature, 95oC - 24sec. Cycling Stage, Step 2, Anneal, 44oC - 30sec. Ramp rate 25% between anneal and extension Cycling Stage, Step 3, Extension, 60oC - 24sec. Data Collection, Cycling Stage, Step 2

Non-Degenerate conditions for VDPV1, VDPV2, VDPV3.

Holding Stage, RT reaction, 42oC - 45min. Holding Stage, Denature, 95oC - 3min. Cycling Stage, 40 cycles Cycling Stage, Step 1, Denature, 95oC - 24sec. Cycling Stage, Step 2, Anneal, 50oC - 30sec. Ramp rate 25% between anneal and extension Cycling Stage, Step 3, Extension, 65oC - 24sec. Data Collection, Cycling Stage, Step 2



Once the Degenerate and/or Non-Degenerate conditions are set, you may save your settings by clicking “Save Run Method”. Type in the name you wish to save, (Degenerate Conditions, Non-Degenerate Conditions), (Degen. PP,P1,P2,P3,PE,Sabin, Non-Degen. VDPV1,2,3). Click “Save”. This allows you to recall this method for further experiment .

Start Run: Click the green “Start Run” button.

The next screen will ask you to save your run to a file. Determine where the data will be stored and name the file with the same name as the original Experiment Name.



Finish Run: When the run has finished, the “Estimated Time Remaining:” will read 00:00:00. At this time, click the red “X” button in the upper right hand corner. Or click file then save.

A box will appear on screen to tell you that your file has been changed, and asking you “Do you want to save you changes before closing?” Click the “Yes” button to save your file.

Take your sample out of the machine and discard. “Turn off” machine!



Analyze Experiment: Click “Analyze Experiment” button.

Find the file that needs analysis and open.



Analysis: Once you have opened your run file, a screen will appear like below: (This is an example of PanPV and SeroP1).

In the Graph Type drop down, select “Linear”, your screen will change to the following:



Select Amplification Plot to view the result: From the Plot drop down, select “Well”, then individual well will show different color in same column.

From the Plot drop down, select “Well”, then all well will show same color in same row



From the Plot drop down, select “Well”, all Targets will show same color in same well (Example Sabine 1, 2, 3 multiplex)

From the Plot drop down, select “Target”, all Targets will shown different color in same well (Example Sabine 1,2,3 multiplex)



From the Target drop down, select the target you wish to analyze. Only the selected Target will show. Example show Sabin2 from the Sabin 1, 2, 3 multiplex well)

From the Target drop down, select the target you wish to analyze. Hold down the “Ctrl” button on the keyboard and select a multiplex well to analyze (Example show two well were selected.



Analyze data Note: Select positive and negative control to validate your experiment first (Example PV1)

Select positive and negative control to validate your experiment first (Example VDPV)

Positive

Negative



Manually Adjust Data View: Change Y Axis (If the amplification curve is too low or Y Axis is too high in your Plot)

Click box

Screen will show a Box as below

Click Y Axis then screen will show a box as below. Check off the “Auto-adjust range” box.

Enter the new Minimum and Maximum Values. Most time only the Maximum Value need be change



Click OK and a new graph will appear with the changes like below:

Manual Baseline adjustment If the amplification curves are not on the same ground or the Ct value is less than 15 (you may get an undetermined Ct value, even with a positive fluorescence because the auto baseline is set from 3-15), Baseline can be manually adjusted to get better view of results. Typically, set baseline from 3 for (Start) and 10 for (End) work well. Click Analysis Setting button to open the manual adjustment settings.



This is the screen that will appear. Highlight the Target which needs to be change of the baseline. Check off the “Use Default Settings” box, the “Automatic Threshold” box, and the “Automatic Baseline” box. Change the “End Cycle” number to 10. Click the “Apply Analysis Settings” box.

This will be the new screen that you will see. The graph will contain all of the plots for the same target that is selected.



Select the Positive and Negative Control for the specific target to see the new graph.

Alternate way to change the baseline: Select Edit Default Settings and check off Use Default Setting as above, Check the Baseline start well, two triages and two squalls will appear. Move the triages to adjust the baseline value



The graph will change to as below.

Change Threshold: Check Threshold box, then the Threshold baseline will show on graph. You can move the line to adjust its place.



Move Threshold bar to the place just above the negative control sample curve

Report Data: From the Export drop down, select “Send to PowerPoint”.

A box will appear on the screen. Check off “Standard Curves”. Click “Create Slides”.

Negative



PowerPoint File:

Send the Amplification Plot to the printer and store with the worksheets in a bound folder.



Alternate way to analyze result: Multicomponent Plot Compare the data plot of your samples value against the negative control data plot. A positive sample will be easily seen as a line with a curve above the negative data plot.

Raw Data Plot Move the bar in the Show Cycle box. Compare the raw data plot of your samples value against the negative control raw data plot. A positive sample will be easily seen as a line move to above that of the negative raw data plot throw cycle increase. Graph show 0 cycle point result.

Control

Sample



Graph shown 40 cycles point result

The filters are:

Multiple Plot view

• Cy3® dye • Texas Red® dye • NED™ dye • VIC® dye • SYBR® Green dye

Cy5® dye • ROX™ dye • TAMRA™ dye • JOE™ dye • FAM™ dye

Dye

5 4 3 2 1 Filter

Sample

Control



Operation of MX3000P for rRT-PCR Open MxPRO software Select Quantitative PCR (Multiple Standards)

Initial Gain Settings Instrument Filter set gain setting Cy5 FAM ROX X2 X2 X2



Save as Lab defaults Thermal Profile set up 2 or 3 Segments

Non-Degenerate rRT-PCR Thermal Profile



Add steps if needed Click line Plateau with ramp Set time and temperature Change cycle 40 cycles Save Thermal Profile

Storage to a place (When you set up another run, you can import the profile from here)

Degenerate rRT-PCR Thermal Profile



Plate setup: Select wells

Select Well type unknown



Collect Fluorescence Data by selecting the individual dyes for the run.

CY5: Sabin1 FAM: PanPV, PanEV, Sabin2, SeroPV1, SeroPV2, SeroPV3,

Sabin1-2-3VDPV-VP1 ROX: Sabin3, Sabin1-2-3VDPV-3D



Thermal Profile setup: Import:

Non-degenerate rRT-PCR= Sabin VDPV 1, 2, 3 Degenerate rRT-PCR= PanPV, Serotype PV1, PV2, PV3, PanEV, Sabin

Run: Check turn off lamp at end of run Run Select storage location and name run



Data analysis: Open your run file Click select than Analysis or directly go to Analysis Import Well Names form your sample list (you prepared before your run and saved in your file)

Select well

Select dye or use default

Click Result Adjust (move) the baseline so it’s just above the negative template control (NTC) sample.



Amplification plot

Text report

Well Name Assay Well Type

Threshold (dR)

Ct (dR)

A1 PVPos1-SeroP3New FAM Unknown 1088.245 16.37

B1 PVPos2-SeroP3New FAM Unknown 1088.245 18.66

C1 PVPos3-SeroP3New FAM Unknown 1088.245 18.4

D1 PVPos4-SeroP3New FAM Unknown 1088.245 18.88

E1 PVPos5-SeroP3New FAM Unknown 1088.245 16.99

F1 PVPos6-SeroP3New FAM Unknown 1088.245 18.26

G1 PVPos7-SeroP3New FAM Unknown 1088.245 19.24

H1 Neg-PanPVEV FAM Unknown 1088.245 No Ct

Negative template i.e. NTC



Consolidated result

Export result to PowerPoint or Excel Combine amplification graph and Ct value to decide whether the sample is positive or negative

Record result on you report sheet (Computer file folder, CD as back up file storage, and export to PowerPoint to print out a hard copy)

Reaction setup: For each assay you need include: One Positive control and One Reagent control (i.e. Negative control)



8. Appendix: ITD and VDPV Results Interpretation Tables

ITD Assay Results Interpretation

PE PP PV1 PV2 PV3 SAB 1 SAB 2 SAB 3 RESULT COMMENTS - - - - - - - - Negative Report NEV

+ - - - - - - - NPEV Report NPEV

+ + - - - - - - Possible Polio Refer for Sequencing

+ + + - - - - - PV1-NSL Refer for Sequencing

+ + - + - - - - PV2-NSL Refer for Sequencing

+ + - - + - - - PV3-NSL Refer for Sequencing

+ + + - - + - - PV1-SABIN Run VDPV1 assay

+ + - + - - + - PV2-SABIN Run VDPV2 assay

+ + - - + - - + PV3-SABIN Run VDPV3 assay

VDPV Assay Results Interpretation

VP1 RESULT Positive SL (Report)

Negative NSL (Report and Refer for Sequencing)



rRT-PCR ITD Work Sheet Example



rRT-PCR VDPV Work Sheet Example



rRT-PCR Master Reporting Sheet Example

table of contents - wpro · table of contents ver. 4.5. 1. general course information background...

Documents