supporting information (si) appendix

Supporting Information (SI) Appendix

Part 1. Impact of tissue preparation, LMD, and RNA amplification on array output. p. 2

Text S1: Detailed Experimental Design and Methods

Figure S1A: Correlation analysis indicates tissue preparation has minimal impact on

ATH1 array output.

Figure S1B: Correlation analysis indicates RNA degradation does not significantly

impact array output.

Figure S1C: Correlation analysis indicates two-round amplification does not

significantly impact array output.

Figure S1D: Independent biological replicates of LMD samples are highly correlated.

Figure S1E: Validation of LMD array expression by qPCR.

Table S1: Tissue preparation-associated genes

Part 2. Analysis of LMD and parallel whole leaf array data. p. 13

Table S2A: Known PM-impacted genes enriched in LMD dataset

Table S2B: Dataset of LMD and whole leaf genes with PM-altered expression

Table S2C: LMD PM MapMan Results and Bins

Table S2D: ics1 vs. WT LMD PM MapMan Results and Bins

Table S2E: Infection site-specific changes for redox and calcium categories

Table S2F: cis-acting regulatory element motif analysis

Part 3. Process network construction p. 149

3A. Photosynthesis

3B. Cold/dehydration response

Part 4. Powdery mildew infection of WT and myb3r4 mutants p. 173

Text S4: Detailed Experimental Design and Methods (supplement to manuscript)

Figure S4A. Uninfected 4 week old WT and myb3r4 plants

Figure S4B. myb3r4 mutants exhibit reduced visible PM growth and reproduction

Figure S4C. PM-infected WT and myb3r4 mutants do not exhibit cell death

Figure S4D. Endoreduplication occurs at site of PM infection not distal to infection

Figure S4E. Ploidy correlates with nuclear size.

Part 1. Impact of tissue preparation, LMD, and RNA amplification on array output.


Figure S1A: Correlation analysis indicates tissue preparation has minimal impact on

ATH1 array output.

Figure S1B: Correlation analysis indicates RNA degradation does not significantly


Figure S1C: Correlation analysis indicates two-round amplification does not

significantly impact array output.

Figure S1D: Independent biological replicates of LMD samples are highly correlated.

Figure S1E: Validation of LMD array expression by qPCR.

Table S1: Tissue preparation-associated genes


Arabidopsis thaliana ecotype Columbia-0 (Col-0) and ics1-2 (eds16-1) mutants in the Col-0

background were grown, evenly spaced in boxes containing Metro mix 200 (Scotts Sierra

Horticultural Products; Marysville, OH) in Percival AR66L growth chambers at 22ºC, 70% RH

and a 12 h photoperiod with photosynthetically active radiation = 180 !mol m-2

s-1

. At 4 weeks,

a subset of boxes were infected with conidia from 2 half-infected leaves (10-14 dpi) per box of

Golovinomyces orontii MGH isolate [1] using a settling tower and mesh screen as in [2] to

maximize reproducibility. Boxes containing G. orontii-infected plants were placed in a separate

Percival AR66L growth chamber under the same conditions as those used for uninfected

samples. Three to 4 fully expanded mature leaves were harvested at 5 dpi from infected and

uninfected plants for PM expression profiling analyses. For the parallel whole leaf samples,

fresh mature leaves (~100 mg) were collected in parallel with those for LMD.

Freshly harvested leaf tissue for LMD samples was dissected in 10mM Sørensen’s phosphate

buffer pH 7.2, microwave fixed, paraffin embedded and sectioned as in [3]. The Leica

Microsystems AS Laser Microdissection system was used for isolation of cells from 10 !m

prepared tissue sections using 40x XT objective, aperture 6, intensity 35, and speed 5. Batches

of 1250 cells (infected) or 2500 cells (uninfected) were collected in the cap of one PCR tube, with

2 infected cell batches pooled prior to RNA extraction. Total RNA extractions employed the

PicoPure kit (Arcturus Engineering) with Qiagen RNase-free DNase columns. Two-round

amplification of extracted mRNA utilized the Affymetrix two-cycle target labeling kit. Amplified

RNA from 3 batches of 2500 LMD-isolated cells was combined to obtain sufficient RNA for

microarray hybridization. Microarray hybridizations to Affymetrix ATH1 arrays and array

scanning were performed by the Functional Genomics Laboratory (UC Berkeley). Expression

values (log2) for two biological replicates per treatment type were extracted using robust multi-

array analysis with perfect match correction and quantile normalization as in [2]. Genes with "2

fold change in infected vs. uninfected samples were computed using one-way ANOVA (p<0.05)

with Partek Genomics suite and had a false discovery rate (q-value) ! 5%.

We performed parallel experiments to separately assess the impact of tissue preparation, RNA

amplification, and laser microdissection on gene expression (array output). Samples were

collected in parallel from the same experiment. Independent replicates were collected and

processed for all sample types. In total these samples included:

1. Laser microdissected samples (prepared tissue, laser microdissected, amplified RNA).

2. Whole leaf amplified sample (fresh tissue, amplified RNA). These samples are referred

to as “whole leaf” in the text as they are the most accurate whole leaf comparison. A 10

ng aliquot of RNA isolated from each of the whole leaf samples below is subject to two-

round amplification and microarray hybridization.

3. Whole leaf sample (fresh tissue). Fresh mature whole leaves (~100 mg sample) are

harvested and immediately frozen in liquid Nitrogen. RNA isolation, without 2-round

amplification, and microarray hybridization.

4. Whole leaf scrape sample (prepared tissue, amplified RNA). Whole leaf tissue was

prepared as for LMD. The prepared, sectioned, deparaffinized whole leaf samples were

then scraped from the PEN slides prior to laser microdissection. RNA isolation, two-

round amplification and microarray hybridization was performed.

References 1. Plotnikova, J.M., T.L. Reuber, and F.M. Ausubel, Powdery mildew pathogenesis of Arabidopsis

thaliana. Mycologia, 1998. 90: p. 1009-1016.

2. Chandran, D., et al., Temporal Global Expression Data Reveals Known and Novel Salicylate-

Impacted Processes and Regulators Mediating Powdery Mildew Growth and Reproduction on

Arabidopsis. Plant Physiology, 2009. 149: p. 1435-51.

3. Inada, N. and M.C. Wildermuth, Novel tissue preparation method and cell-specific marker for

laser microdissection of Arabidopsis mature leaf. Planta, 2005. 221(1): p. 9-16.

A

Figure S1A. Correlation analysis indicates tissue preparation has minimal impact (<0.5%)

on ATH1 array expression data.

Log2 expression correlation plots for (i) whole leaf scrape vs. whole leaf amplified, infected

samples, (ii) LMD vs. whole leaf amplified, infected samples and (iii) LMD vs. whole leaf

amplified, uninfected samples. r-value denotes Pearson’s correlation. A small subset of 107

genes (shown in red) were not correlated between prepared tissue samples (whole leaf scrape and

LMD amplified) and fresh tissue samples (whole leaf amplified). These genes exhibited a "10-

fold change in expression in whole leaf scrape vs. whole leaf-amplified samples. These same 107

genes also exhibited a "10-fold change in expression when laser microdissected samples were

compared with whole leaf amplified samples as would be expected if their expression difference

was due to the tissue preparation method. This was true when uninfected samples were

compared or when infected samples were compared, again indicating that the altered expression

of these genes was not associated with infection but with the preparation method. Tissue

preparation-associated genes are listed in SI Table S1.

SI Figure S1B. Correlation analysis indicates RNA degradation does not significantly


ATH1 array probesets were designed to be 3’ biased (within 600 bp of the 3’ end of the

transcript) to minimize the impact of processive degradation of mRNA from the 5’ end.

Standard RNA degradation plots generated using AffyRNAdeg in Bioconductor plot expression

values versus probes presented in order from 5’ to 3’ for each transcript. However, this plot does

not take into account the relative position of the probes in the transcript and their physical

distance from the 5’ end. For example, for shorter transcripts, individual probes might reside

near the 5’ end. In addition, updated annotations (e.g. TAIR9) indicate some of the ATH1

probesets are not within 600 bp of the 3’ end. Therefore, to globally assess whether RNA

degradation impacted our array output, we selected probesets for which all probes are “far” from

the 5’ end (i.e. within 0.70 fractional distance of the 5’ end) using current annotation.

Shown below is the distribution of probesets based on fractional distance from the 5’end for all

genes on array (i), and (ii) for 3’ biased probesets where the distance between all probes and the

5’end of the transcript was at least 70% of the coding sequence length. log2 expression

correlation plots to assess the impact of tissue preparation, RNA amplification, and LMD were

then obtained for all genes and 3’biased probesets as shown for whole leaf amplified (fresh

tissue, amplified) versus whole leaf scrape (prepared tissue, amplified) infected samples for all

genes (iii) or for 3’ biased probesets (iv). r-value denotes Pearson’s correlation. The r values for

all probesets versus 3’ biased probesets was not significantly different, indicating that RNA

degradation associated with tissue preparation does not negatively impact ATH1 expression data.

This was also the case for all other comparisons. Note that tissue-preparation associated genes

were removed before analysis (see SI Fig. S1A and SI Table S1).

B

SI Fig S1C. Correlation analysis indicates two-round amplification does not significantly

impact array expression data.

Log2 expression correlation plots for whole leaf versus whole leaf amplified, infected and UI

replicates for all genes in (i) and (iii), and for selected (2-fold change ratio in LMD I versus UI

samples, p# 0.05) genes in (ii) and (iv). r-value denotes Pearson’s correlation.

C

SI Fig. S1D. Independent biological replicates of LMD samples are highly correlated.

Expression correlation plots (log2) for LMD infected and uninfected samples for all genes on

array in (A) and (C), and for selected (2-fold change, p! 0.05) genes, in (B) and (D). r-values

denote Pearson’s correlations. In addition, quality assessments including residual plots, relative

log expression plots, and normalized unscaled standard error plots performed using Bioconductor

software indicated LMD data was of high quality.

D

SI Fig S1E. Validation of ATH1 array data by quantitative real time RT-PCR (qPCR). First

strand cDNA synthesis was performed with amplified RNA from infected and uninfected (UI)

LMD samples using Superscript III Reverse Transcriptase (Invitrogen). qPCR reactions were

performed using SYBR Premix Ex Taq (TaKaRa #RR041A) in an ABI 7300 instrument. (A)

qPCR and array expression data were highly correlated. For qPCR, normalized log2 expression

values for select genes from LMD infected and UI samples were extracted from Ct values using

DART-PCR (version 1.0) software. For ATH1 array, log2 normalized expression data was

obtained for the same genes using the gcrma program in Bioconductor. In each case, data was

normalized to UBQ5. Plot represents data from two replicate experiments. r-value denotes

Pearson’s correlation. Primers to amplify eleven genes were designed using Amplify

(http://engels.genetics.wisc.edu/amplify).

Primers for quantitative real time RT-PCR

Locus Gene Name Forward primer Reverse primer

At1g12360 Keule TGAGACATGCGTCAAGCG CTCGTGGAACCGAGGATTA

At1g66960 lupeol synthase GGAGATTTTCCTCAACAGGAACTA AGATCTGCGTGATGTATGAACG

At3g11280 MYB CAAAGACGCCAACGCAAG GGAACGGTTGAGATTGGC

At5g11510 MYB3R4 ATATTCTGTGGAACTCCATTCAGG CATCACTCCTATGCTCTCGTAGC

At3g52430 PAD4 GTTAAAGATCAAGGAAGGATTGGA AGAGATTGGTTTCCGAGCAG

At5g13320 PBS3 TCGCTGGCTTGTATAGGATGA CTTCGTTAGTTTTATCGGAATCG

At2g14610 PR1 GAAAACTTAGCCTGGGGTAGC TTCATTAGTATGGCTTCTCGTTCA

At3g57260 PR2 GAGTGTGGAAAACGCAAAGAC GACTGTCGATCTGGATGAAACA

At1g75040 PR5 AAGGTCATGGATCAGAACAATGTC GTGCTCGTTTCGTCGTCATAAG

At2g01650 PUX2 ATGAGTTTGTGAGCTCTGCTTTG CGGTCTGAACCTGATGAGC

At3g62250 UBQ5 GAAGACTTACACCAAGCCGAAG TTCTGGTAAACGTAGGTGAGTCC

Primers are shown 5' to 3'.

E

SI Table S1. Tissue preparation-associated genes. A total of 107 tissue preparation-

associated genes (<0.5% of total) were identified. These genes exhibited a !10-fold change

in expression due to tissue preparation (i.e. in parallel scrape (prepared tissue, amplified) vs.

whole leaf-amplified (fresh tissue, amplified) samples). These same 107 genes also

exhibited a !10-fold change in expression when laser microdissected (prepared tissue, laser

microdissected, amplified) were compared to whole leaf amplified samples (fresh tissue,

amplified) as would be expected if their expression difference was due to the tissue

preparation method. This was true when uninfected samples were compared or when

infected samples were compared, again indicating that the altered expression of these genes

was not associated with infection but with the preparation method. A majority of these

genes are known targets of early induced heat shock transcription factors (HSFs) and are

likely induced during the initial step of tissue preparation using our modified microwave

method. These genes were removed from all subsequent LMD data analysis. Targets of

HSFs are marked with an x. Target genes of

Locus Gene description

HS

FA

2 1

HS

FA

2 2

HS

FA

1a

/b 3

HS

FA

1a

/b 4

AT5G42380 calmodulin like 37 --- x --- x

AT4G29330 DERLIN-1 --- --- --- x

ATMG01220 unknown protein --- --- --- x

ATMG00060 unknown protein --- x --- x

AT4G27652 unknown protein --- --- --- x

AT2G07698 ATP synthase alpha chain, mitochondrial --- x --- ---

AT5G02490 HSP70-2 --- --- --- ---

AT2G07701 unknown protein --- x --- x

AT2G07712 pseudogene, similar to maturase-related protein --- x --- ---


AT5G25450 ubiquinol-cytochrome C reductase complex 14 kDa protein --- --- --- x

AT5G37670 15.7 kDa class I-related small heat shock protein-like x x --- x




AT2G07707 hydrogen ion transmembrane transporter --- --- --- x

AT2G07768 heme transporter --- x --- ---

AT2G07671 H+-transporting two sector ATPase --- --- --- x

1 HSF2A target genes are described in Nishizawa et al. (2006) Plant J, 48, 535-547.

2 HSFA2 targets are described in Schramm et al. (2006) Plant Mol Biol, 60:759-772.

3 HSF1a/b regulated genes detected at room temperature (Busch et al. (2005), Plant J, 41, 1-14).

4 HSF1a/b regulated genes detected under heat stress conditions (Busch et al.2005).

Target genes of


HS

FA

2 1

HS

FA

2 2

HS

FA

1a

/b 3

HS

FA

1a

/b 4

AT5G58770 dehydrodolichyl diphosphate synthase, putative --- --- --- x

AT1G66090 disease resistance protein (TIR-NBS class), putative --- --- --- ---

ATMG01350 unknown protein --- --- --- ---

AT2G07711 pseudogene, similar to NADH dehydrogenase subunit 5 --- x --- x

AT1G66500 zinc finger (C2H2-type) family protein --- x --- x

AT2G25140 casein lytic proteinase B4 --- --- --- x

AT2G07723 pseudogene; cytochrome c biogenesis orf452 --- x --- x


AT2G07687 cytochrome c oxidase subunit 3 --- x --- x

AT3G62260 protein phosphatase 2C, putative --- --- --- x

AT5G12030 HSP17.6A x x --- x

AT3G61190 BAP1 (Bon Association Protein 1) --- --- --- ---

AT2G07699 pseudogene, similar to ATPase subunit 6 --- x --- x

AT4G25340 FKBP-type peptidyl-prolyl cis-trans isomerase-related --- x --- x

AT2G07675 ribosomal protein S12, mitochondrial family protein --- --- --- x



AT3G24500 multiprotein bridging factor 1 --- --- x x



AT2G07727 cytochrome b; mitochondrial apocytochrome b --- --- --- x

AT1G07400 17.6 kDa class I heat shock protein --- --- x x

AT3G12050 Aha1 domain-containing protein --- --- --- x


AT1G52560 26.5 kDa class I small heat shock protein-like x x --- x

AT2G07681 cytochrome c biogenesis protein-related --- x --- x


AT3G09350 armadillo/beta-catenin repeat family protein --- --- x x

AT2G29500 17.6 kDa class I small heat shock protein x --- --- x

AT5G09590 Mitochondrial HSP70 2 --- --- --- x


AT1G01720 ATAF1 --- --- --- x

AT3G08970 ATERDJ3A; oxidoreductase --- --- --- x



3 HSF1a/b regulated genes detected at room temperature (Busch et al. (2005) Plant J, 41, 1-14).


Target genes of


HS

FA

2 1

HS

FA

2 2

HS

FA

1a

/b 3

HS

FA

1a

/b 4

AT1G30070 SGS domain-containing protein --- --- x x

AT3G46230 HSP17.4 --- x --- x

AT3G25230 rotamase FKBP 1 --- --- --- x


AT3G16050 A37; protein heterodimerization --- --- --- x


AT1G54050 17.4 kDa class III heat shock protein x --- --- x

AT1G01940 peptidyl-prolyl cis-trans isomerase cyclophilin-type family protein

--- x --- x

AT5G56030 HSP81-2 --- --- --- x

AT2G37710 RLK (Receptor Lectin Kinase) --- --- --- ---

AT2G07725 60S ribosomal protein L5 --- --- --- x

AT2G17660 nitrate-responsive NOI protein, putative --- x --- ---

AT1G53540 17.6 kDa class I small heat shock protein x x --- x

AT3G07770 ATP binding --- --- --- x


AT2G46240 BAG6 (BCL-2-associated athanogene 6) x --- x x

AT4G10250 HSP22.0 x x --- x

AT4G26780 AR192; adenyl-nucleotide exchange factor --- --- --- x

AT1G07350 transformer serine/arginine-rich ribonucleoprotein, putative --- --- --- x

AT1G62730 transferase --- --- --- x

AT4G27670 HSP21 x x --- x

AT4G12400 stress-inducible protein, putative x --- x x

AT5G59720 HSP18.2 x x --- x

AT4G24380 unknown protein --- --- --- ---

AT1G26800 zinc finger (C3HC4-type RING finger) family protein --- --- --- x

AT2G32120 HSP70T-2 x x --- x

ATMG00630 unknown protein --- --- --- ---

AT5G48570 peptidyl-prolyl cis-trans isomerase, putative --- --- x x

AT3G28210 PMZ; zinc ion binding --- --- --- x

AT1G03070 glutamate binding --- x --- x

AT2G47180 galactinol synthase 1 --- --- --- x





Target genes of


HS

FA

2 1

HS

FA

2 2

HS

FA

1a

/b 3

HS

FA

1a

/b 4

AT4G34410 Redox responsive transcription factor 1 --- --- --- x

AT3G13470 chaperonin, putative --- --- --- x

AT1G16030 HSP70B x x --- x

AT2G20560 DNAJ heat shock family protein --- --- x x

AT4G11280 ACC SYNTHASE 6 --- --- --- x

AT2G26150 HSFA2 --- x --- x

AT4G33660 no_match --- --- --- ---

AT5G52640 HSP90.1 --- --- x x

AT1G74310 HSP101 x --- x x

AT5G12020 HSP17.6II --- x --- x

AT5G51440 23.5 kDa mitochondrial small heat shock protein --- --- --- x

AT4G25200 HSP23.6-mito x x --- x



AT5G05410 DREB2A --- --- --- x

AT1G61340 F-box family protein --- x --- x


AT1G10090 unknown protein --- x --- ---

AT3G12580 HSP70 x --- x x

AT3G56090 FERRITIN 3 --- --- --- x

AT4G21320 heat-stress-associated 32 --- x --- x

AT1G17870 ethylene-dependent-gravitropism deficient x x --- x

AT5G12110 elongation factor 1B alpha-subunit 1 (eEF1Balpha1) --- --- --- x

AT5G62520 NAD+ ADP-ribosyltransferase --- x --- x

AT1G71000 heat shock binding protein --- --- --- x





Supporting Information (SI) Part 2. Analysis of LMD and parallel whole leaf array data

Table S2A: Known PM-impacted genes enriched in LMD dataset

Table S2B: Dataset of LMD and whole leaf genes with PM-altered expression

Table S2C: LMD PM MapMan Results and Bins

Table S2D: ics1 vs. WT LMD PM MapMan Results and Bins

Table S2E: Infection site-specific changes for redox and calcium categories

Table S2F: cis-acting RE motif analysis using TAIR Motif Finder and MDScan

SI Table S2A. Known PM-impacted genes enriched in LMD dataset

I/UI ratio 5 dpi

Locus Gene Function LMD Leaf

At3g50480 HR4 susceptible homolog of RPW8 28.8 3.0

At2g01650 PUX2 plant UBX-domain containing protein 2 8.2 1.9

Carbon acquisition

At3g19930 STP4 sugar transporter 4 13.2 1.7

At3g13790 !FRUCT1 cell wall invertase 16.5 3.8

At5g11110 SPS sucrose phosphate synthase 2.1 1.3

At3g18830 PLT5 polyol transporter 2.9 1.4

SNARE-mediated processes

At3g52400 SYP122 syntaxin 3.5 1.7

At3g11820 SYP121/PEN1 syntaxin 2.1 1.3

At5g61210 SNAP33 membrane localized t-SNARE 7.9 1.6

At1g04750 VAMP721 vesicle-associated membrane protein 2.9 1.5

At2g33120 VAMP722/SAR1 vesicle-associated membrane protein 5.8 1.6

Indole-3-glucosinolate synthesis and modification

At5g05730 ASA1 anthranilate synthase 54.1 3.8

At2g04400 IGPS indole-3-glycerol-phosphate synthase 32.3 7.6

At3g54640 TSA1 tryptophan synthase 10.8 4.9

At4g39950 CYP79B2 tryptophan monooxygenase 6.2 2.0

At4g31500 CYP83B1 monooxygenase 8.6 2.8

At2g20610 SUR1 alkylthiohydroximate C-S lyase 3.8 2.8

At1g54040 ESP epithiospecifier protein 0.4 0.3

At3g14210 ESM1 epithiospecifier modifier 0.1 0.3

At5g57220 CYP81F2 P450 monoxygenase required for 4-MeO-I3G 2.7 3.1

At2g44490 PEN2 myrosinase 1.5 1.1

At1g59870 PEN3 ABC Transporter 2.1 1.1

At5g44070 PCS1/CAD1 phytochelatin synthase 3.2 0.8

Salicylic acid synthesis and response

At3g52430 PAD4 lipase-like regulator 2.4 4.7

At1g74710 ICS1 isochorismate synthase 1 5.1 6.5

At5g13320 PBS3 GH3 acyl-adenylate/thioester forming enzyme 3.0 9.2

At2g14610 PR-1 pathogenesis-related protein 1 137.2 36.3

At3g57260 PR-2/BGL2 !-glucanase 105.7 8.2

At1g75040 PR-5 pathogenesis-related protein 5 127.8 6.2

Bolded values = infected (I)/uninfected (UI) ratios with 2-fold change in expression and p" 0.05.

Locus Gene description (TAIR9 update-June 09)

LMD I/UI

ratio 5 dpi p-value

AT1G02930 ATGSTF6 (GLUTATHIONE S-TRANSFERASE); copper ion binding / glutathione binding / 217.0 0.01

AT3G18250 unknown protein 170.4 0.00

AT2G14610 PR1 (PATHOGENESIS-RELATED GENE 1) 137.2 0.01


AT3G57260 BGL2 (BETA-1,3-GLUCANASE 2); cellulase/ glucan 1,3-beta-glucosidase/ hydrolase, 105.7 0.04

AT2G02930 ATGSTF3 (GLUTATHIONE S-TRANSFERASE F3); glutathione transferase102.7 0.01

AT1G65820 microsomal glutathione s-transferase, putative microsomal glutathione s-transfer92.0 0.00



AT5G37600 ATGSR1; copper ion binding / glutamate-ammonia ligase 67.8 0.01

AT5G05730 ASA1 (ANTHRANILATE SYNTHASE ALPHA SUBUNIT 1); anthranilate synthase54.1 0.02

AT2G18660 EXLB3 (EXPANSIN-LIKE B3 PRECURSOR) 52.5 0.01

AT5G64000 SAL2; 3'(2'),5'-bisphosphate nucleotidase/ inositol or phosphatidylinositol phos43.3 0.00

AT4G24190 SHD (SHEPHERD); ATP binding / unfolded protein binding SHD (SHEPHERD); ATP bindi42.7 0.01

AT2G38860 YLS5 YLS5 YLS5 36.3 0.01

AT5G02380 MT2B (METALLOTHIONEIN 2B); copper ion binding 36.2 0.02

AT5G56150 UBC30 (ubiquitin-conjugating enzyme 30); ubiquitin-protein ligase UBC30 (ubiquit35.9 0.02

AT1G05010 EFE (ETHYLENE-FORMING ENZYME); 1-aminocyclopropane-1-carboxylate oxidase34.9 0.04

AT2G39400 hydrolase, alpha/beta fold family protein 33.8 0.03

AT3G49120 PRXCB (PEROXIDASE CB); peroxidase 33.2 0.00

AT2G04400 indole-3-glycerol phosphate synthase (IGPS) 32.3 0.00

AT3G51860 CAX3 (CATION EXCHANGER 3); calcium:cation antiporter/ calcium:hydrogen antiporte32.2 0.02

AT1G53310 ATPPC1 (PHOSPHOENOLPYRUVATE CARBOXYLASE 1); catalytic/ phosphoenolpyruvate carbo32.1 0.02

AT1G52600 signal peptidase, putative 31.3 0.00

AT1G72060 serine-type endopeptidase inhibitor 30.2 0.04

AT5G66680 DGL1; dolichyl-diphosphooligosaccharide-protein glycotransferase29.0 0.02

AT3G50480 HR4 (HOMOLOG OF RPW8 4) 28.8 0.03

AT3G01280 VDAC1 (VOLTAGE DEPENDENT ANION CHANNEL 1); voltage-gated anion channel28.1 0.00

AT1G35720 ANNAT1 (ANNEXIN ARABIDOPSIS 1); ATP binding / calcium ion binding / calcium-depe27.9 0.02


AT1G10340 ankyrin repeat family protein ankyrin repeat family protein 25.4 0.00

AT1G17745 PGDH (3-PHOSPHOGLYCERATE DEHYDROGENASE); phosphoglycerate dehydrogenase25.2 0.01

AT3G01290 band 7 family protein 24.9 0.03

AT4G11890 protein kinase family protein protein kinase family protein protein kinase famil23.6 0.01

AT2G43570 chitinase, putative 23.6 0.03

AT4G38540 monooxygenase, putative (MO2) 23.1 0.01

AT5G10380 RING1; protein binding / ubiquitin-protein ligase/ zinc ion binding23.1 0.05

AT2G20530 ATPHB6 (PROHIBITIN 6) ATPHB6 (PROHIBITIN 6) 21.6 0.01

AT5G07340 calnexin, putative 21.4 0.05

AT1G13110 CYP71B7; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxyg21.3 0.03

SI Table S2B. LMD genes with PM-altered expression. Genes with ! 2-fold change in expression and

p " 0.05 were selelcted using one-way analysis of variance. Selected genes also exhibited a false

discovery rate (q-value) <5%.

AT5G51070 ERD1 (EARLY RESPONSIVE TO DEHYDRATION 1); ATP binding / ATPase/ nucleoside-‐triph20.9 0.03AT2G01060 myb family transcription factor myb family transcription factor20.3 0.00ATMG00050 hypothetical protein 20.2 0.03AT5G22250 CCR4-‐NOT transcription complex protein, putative 20.0 0.00AT1G22300 GRF10 (GENERAL REGULATORY FACTOR 10); ATP binding / protein binding / protein ph19.9 0.00AT3G11280 myb family transcription factor myb family transcription factor19.7 0.02AT1G56700 pyrrolidone-‐carboxylate peptidase family protein pyrrolidone-‐carboxylate peptida19.6 0.00AT2G04900 unknown protein unknown protein 19.5 0.01AT2G24550 unknown protein 19.4 0.01AT3G51920 CAM9 (CALMODULIN 9); calcium ion binding 19.2 0.00AT3G24503 ALDH2C4; 3-‐chloroallyl aldehyde dehydrogenase/ aldehyde dehydrogenase (NAD)/ con19.1 0.01AT5G63680 pyruvate kinase, putative 18.8 0.02AT5G40670 PQ-‐loop repeat family protein / transmembrane family protein18.7 0.05AT1G09210 calreticulin 2 (CRT2) 18.6 0.00AT1G22920 CSN5A (COP9 SIGNALOSOME 5A) CSN5A (COP9 SIGNALOSOME 5A)18.0 0.00AT5G11000 unknown protein 17.9 0.01AT5G20950 glycosyl hydrolase family 3 protein glycosyl hydrolase family 3 protein17.9 0.03AT5G52740 heavy-‐metal-‐associated domain-‐containing protein 17.7 0.01AT3G02840 immediate-‐early fungal elicitor family protein 17.6 0.00AT4G27450 unknown protein 17.6 0.01AT5G10710 protein binding protein binding 17.5 0.04AT2G26440 pectinesterase family protein 17.3 0.03AT3G07600 heavy-‐metal-‐associated domain-‐containing protein 17.3 0.01AT2G23170 GH3.3; indole-‐3-‐acetic acid amido synthetase 17.0 0.03AT3G60540 sec61beta family protein sec61beta family protein 17.0 0.00AT4G39670 glycolipid binding / glycolipid transporter 16.9 0.00AT4G21150 HAP6 (HAPLESS 6); dolichyl-‐diphosphooligosaccharide-‐protein glycotransferase16.9 0.00AT5G50460 protein transport protein SEC61 gamma subunit, putative 16.9 0.00AT5G18310 unknown protein unknown protein 16.8 0.00AT3G13790 ATBFRUCT1; beta-‐fructofuranosidase/ hydrolase, hydrolyzing O-‐glycosyl compounds16.5 0.04AT4G30190 AHA2; ATPase/ hydrogen-‐exporting ATPase, phosphorylative mechanism16.4 0.02AT2G35020 UTP-‐-‐glucose-‐1-‐phosphate uridylyltransferase family protein16.4 0.02AT2G47470 UNE5 (UNFERTILIZED EMBRYO SAC 5); protein disulfide isomerase UNE5 (UNFERTILIZED16.0 0.02AT5G24530 DMR6 (DOWNY MILDEW RESISTANT 6); oxidoreductase/ oxidoreductase, acting on paire15.8 0.03AT4G00700 C2 domain-‐containing protein 15.4 0.01AT3G55830 EPC1 (ECTOPICALLY PARTING CELLS); UDP-‐glucosyltransferase/ transferase, transfer15.3 0.00AT4G33050 EDA39 (embryo sac development arrest 39); calmodulin binding EDA39 (embryo sac d14.9 0.02AT4G16450 unknown protein 14.7 0.02AT2G24945 unknown protein 14.6 0.03AT1G16670 protein kinase family protein 14.5 0.00AT3G50590 nucleotide binding 14.3 0.00AT2G44100 ATGDI1 (ARABIDOPSIS THALIANA GUANOSINE NUCLEOTIDE DIPHOSPHATE DISSOCIATION INHIB14.3 0.00AT2G18690 unknown protein unknown protein 14.2 0.04AT3G13930 dihydrolipoamide S-‐acetyltransferase, putative 14.2 0.02AT5G48540 33 kDa secretory protein-‐related 13.9 0.02AT4G32940 GAMMA-‐VPE (GAMMA VACUOLAR PROCESSING ENZYME); cysteine-‐type endopeptidase13.9 0.01AT2G30860 ATGSTF9 (GLUTATHIONE S-‐TRANSFERASE PHI 9); copper ion binding / glutathione bind13.8 0.03

AT5G10760 aspartyl protease family protein 13.7 0.00AT5G40780 LHT1; amino acid transmembrane transporter LHT1; amino acid transmembrane transp13.6 0.01AT1G19020 unknown protein 13.6 0.00AT4G21830 methionine sulfoxide reductase domain-‐containing protein / SeIR domain-‐containin13.6 0.04AT1G13350 protein kinase family protein 13.5 0.00AT1G13750 calcineurin-‐like phosphoesterase family protein 13.4 0.04AT3G13910 unknown protein 13.4 0.00AT5G52750 heavy-‐metal-‐associated domain-‐containing protein 13.4 0.02AT1G45145 ATTRX5; oxidoreductase, acting on sulfur group of donors, disulfide as acceptor13.3 0.05AT3G19930 STP4 (SUGAR TRANSPORTER 4); carbohydrate transmembrane transporter/ monosacchari13.2 0.01AT2G47380 cytochrome c oxidase subunit Vc family protein / COX5C family protein13.0 0.01AT5G26830 threonyl-‐tRNA synthetase / threonine-‐-‐tRNA ligase (THRRS)13.0 0.00AT3G02740 aspartyl protease family protein 12.9 0.01AT1G33960 AIG1 (AVRRPT2-‐INDUCED GENE 1); GTP binding 12.8 0.00AT3G45860 receptor-‐like protein kinase, putative 12.7 0.01AT1G08450 CRT3 (CALRETICULIN 3); calcium ion binding / unfolded protein binding CRT3 (CALR12.4 0.01AT5G60950 COBL5 (COBRA-‐LIKE PROTEIN 5 PRECURSOR) 12.3 0.01AT1G63460 glutathione peroxidase, putative 12.2 0.02AT2G43510 ATTI1; serine-‐type endopeptidase inhibitor 12.2 0.03AT3G17240 mtLPD2 (LIPOAMIDE DEHYDROGENASE 2); ATP binding / dihydrolipoyl dehydrogenase mt12.0 0.01AT1G03290 unknown protein 11.9 0.01AT1G05575 unknown protein 11.9 0.00AT4G14420 lesion inducing protein-‐related 11.8 0.02AT5G52760 heavy-‐metal-‐associated domain-‐containing protein 11.5 0.02AT1G68000 ATPIS1 (PHOSPHATIDYLINOSITOL SYNTHASE 1); CDP-‐diacylglycerol-‐inositol 3-‐phosphat11.4 0.00AT1G27330 unknown protein 11.4 0.00AT1G36050 unknown protein unknown protein 11.4 0.00AT2G22480 PFK5 (PHOSPHOFRUCTOKINASE 5); 6-‐phosphofructokinase11.3 0.00AT2G35930 PUB23 (PLANT U-‐BOX 23); ubiquitin-‐protein ligase 11.3 0.04AT5G21090 leucine-‐rich repeat protein, putative 11.2 0.01AT5G53870 plastocyanin-‐like domain-‐containing protein 11.2 0.04AT5G10840 endomembrane protein 70, putative 11.0 0.01AT3G54960 ATPDIL1-‐3 (PDI-‐LIKE 1-‐3); protein disulfide isomerase ATPDIL1-‐3 (PDI-‐LIKE 1-‐3); 11.0 0.00AT3G17790 PAP17; acid phosphatase/ phosphatase/ protein serine/threonine phosphatase10.9 0.00AT4G38260 unknown protein 10.9 0.01AT5G08380 AtAGAL1 (Arabidopsis thaliana ALPHA-‐GALACTOSIDASE 1); alpha-‐galactosidase/ catal10.9 0.04AT3G19740 ATP binding / ATPase/ nucleoside-‐triphosphatase/ nucleotide binding10.8 0.01AT1G69340 appr-‐1-‐p processing enzyme family protein 10.8 0.00AT3G54640 TSA1 (TRYPTOPHAN SYNTHASE ALPHA CHAIN); tryptophan synthase10.8 0.04AT1G67560 lipoxygenase family protein 10.8 0.00AT2G24850 TAT3 (TYROSINE AMINOTRANSFERASE 3); L-‐tyrosine:2-‐oxoglutarate aminotransferase/ 10.8 0.04AT1G61780 postsynaptic protein-‐related 10.8 0.01AT3G52730 ubiquinol-‐cytochrome C reductase UQCRX/QCR9-‐like family protein10.7 0.03AT3G27240 cytochrome c1, putative 10.6 0.04AT1G19250 FMO1 (FLAVIN-‐DEPENDENT MONOOXYGENASE 1); FAD binding / NADP or NADPH binding / e10.6 0.04AT1G13340 unknown protein 10.6 0.01AT5G17380 pyruvate decarboxylase family protein 10.6 0.01

AT1G72160 SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein10.5 0.03AT3G09390 MT2A (METALLOTHIONEIN 2A); copper ion binding 10.5 0.00AT3G04120 GAPC1 (GLYCERALDEHYDE-‐3-‐PHOSPHATE DEHYDROGENASE C SUBUNIT 1); glyceraldehyde-‐3-‐p10.4 0.00AT1G57630 disease resistance protein (TIR class), putative 10.3 0.00AT4G24920 protein transport protein SEC61 gamma subunit, putative 10.2 0.00AT1G75270 DHAR2 (DEHYDROASCORBATE REDUCTASE 2); glutathione binding / glutathione dehydrog10.2 0.00AT2G04450 ATNUDT6 (Arabidopsis thaliana Nudix hydrolase homolog 6); ADP-‐ribose diphosphata10.2 0.02AT2G17120 LYM2 (LYSM DOMAIN GPI-‐ANCHORED PROTEIN 2 PRECURSOR)10.1 0.02AT2G39660 BIK1 (BOTRYTIS-‐INDUCED KINASE1); kinase 10.0 0.00AT2G33040 ATP synthase gamma chain, mitochondrial (ATPC) 9.9 0.01AT5G18420 unknown protein unknown protein unknown protein 9.9 0.03AT2G29120 ATGLR2.7; intracellular ligand-‐gated ion channel 9.9 0.00AT5G54760 eukaryotic translation initiation factor SUI1, putative eukaryotic translation i9.9 0.00AT2G30550 lipase class 3 family protein lipase class 3 family protein 9.9 0.01AT2G40360 transducin family protein / WD-‐40 repeat family protein 9.8 0.03AT4G23220 kinase 9.7 0.01AT3G10930 unknown protein 9.7 0.03AT5G24110 WRKY30; transcription factor 9.7 0.00AT1G74210 glycerophosphoryl diester phosphodiesterase family protein9.6 0.01AT1G19130 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow9.6 0.05AT2G38870 protease inhibitor, putative 9.6 0.04AT5G40370 glutaredoxin, putative glutaredoxin, putative 9.5 0.01AT1G04410 malate dehydrogenase, cytosolic, putative 9.4 0.04AT4G14800 PBD2 (20S PROTEASOME BETA SUBUNIT 2); peptidase/ threonine-‐type endopeptidase9.4 0.01AT3G28480 oxidoreductase, 2OG-‐Fe(II) oxygenase family protein 9.3 0.01AT4G22150 PUX3; protein binding 9.2 0.02AT3G07230 wound-‐responsive protein-‐related 9.2 0.01AT2G28890 PLL4 (POLTERGEIST LIKE 4); catalytic/ protein serine/threonine phosphatase9.1 0.02AT3G04120 GAPC1 (GLYCERALDEHYDE-‐3-‐PHOSPHATE DEHYDROGENASE C SUBUNIT 1); glyceraldehyde-‐3-‐p9.0 0.01AT2G44080 ARL (ARGOS-‐LIKE) 9.0 0.04AT2G42310 unknown protein 9.0 0.00AT1G08830 CSD1 (COPPER/ZINC SUPEROXIDE DISMUTASE 1); superoxide dismutase CSD1 (COPPER/ZIN9.0 0.03AT5G35680 eukaryotic translation initiation factor 1A, putative / eIF-‐1A, putative / eIF-‐48.9 0.00AT1G72020 unknown protein 8.8 0.01AT1G08480 unknown protein 8.8 0.02AT1G20980 SPL14 (squamosa promoter binding protein-‐like 14); DNA binding / transcription a8.8 0.00AT1G77510 ATPDIL1-‐2 (PDI-‐LIKE 1-‐2); protein disulfide isomerase 8.7 0.01AT3G01520 universal stress protein (USP) family protein 8.7 0.01AT4G31500 CYP83B1 (CYTOCHROME P450 MONOOXYGENASE 83B1); oxidoreductase, acting on paired d8.6 0.01AT3G03300 DCL2 (DICER-‐LIKE 2); ATP binding / ATP-‐dependent helicase/ RNA binding / double-‐8.6 0.01AT2G29350 SAG13; alcohol dehydrogenase/ oxidoreductase SAG13; alcohol dehydrogenase/ oxido8.6 0.01AT5G49540 unknown protein 8.6 0.01AT5G55070 2-‐oxoacid dehydrogenase family protein 8.6 0.01AT5G38900 DSBA oxidoreductase family protein 8.6 0.01AT2G41090 calmodulin-‐like calcium-‐binding protein, 22 kDa (CaBP-‐22) 8.5 0.01AT3G62600 ATERDJ3B; heat shock protein binding / unfolded protein binding8.4 0.05AT2G46560 transducin family protein / WD-‐40 repeat family protein 8.4 0.02

AT5G02290 NAK; ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ prot8.4 0.03AT1G51920 unknown protein 8.4 0.04AT3G06690 FAD binding / acyl-‐CoA oxidase/ electron carrier/ oxidoreductase/ oxidoreductase8.3 0.04AT2G29420 ATGSTU7 (ARABIDOPSIS THALIANA GLUTATHIONE S-‐TRANSFERASE TAU 7); glutathione tran8.3 0.01AT4G20110 vacuolar sorting receptor, putative 8.2 0.00AT4G35230 BSK1 (BR-‐SIGNALING KINASE 1); ATP binding / binding / kinase/ protein kinase/ pr8.2 0.02AT2G01650 PUX2 (PLANT UBX DOMAIN-‐CONTAINING PROTEIN 2); nucleic acid binding / zinc ion bi8.2 0.01AT3G51430 YLS2; strictosidine synthase 8.1 0.03AT2G19130 S-‐locus lectin protein kinase family protein 8.1 0.04AT1G05570 CALS1 (CALLOSE SYNTHASE 1); 1,3-‐beta-‐glucan synthase/ transferase, transferring 8.1 0.00AT2G02810 UTR1 (UDP-‐GALACTOSE TRANSPORTER 1); UDP-‐galactose transmembrane transporter/ UDP8.0 0.02AT3G07680 emp24/gp25L/p24 family protein 8.0 0.02AT2G45790 PMM (PHOSPHOMANNOMUTASE); phosphomannomutase7.9 0.03AT1G09130 ATP-‐dependent Clp protease proteolytic subunit, putative ATP-‐dependent Clp prote7.9 0.03AT4G34200 EDA9 (embryo sac development arrest 9); ATP binding 7.9 0.03AT5G61210 SNAP33 (SOLUBLE N-‐ETHYLMALEIMIDE-‐SENSITIVE FACTOR ADAPTOR PROTEIN 33); SNAP rece7.9 0.03AT4G02030 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow7.9 0.03AT2G31350 GLX2-‐5 (GLYOXALASE 2-‐5); hydroxyacylglutathione hydrolase/ iron ion binding / zi7.8 0.00AT3G28540 AAA-‐type ATPase family protein AAA-‐type ATPase family protein7.7 0.02AT3G43520 unknown protein 7.7 0.01AT1G63840 zinc finger (C3HC4-‐type RING finger) family protein 7.7 0.01AT3G03250 UGP (UDP-‐glucose pyrophosphorylase); UTP:glucose-‐1-‐phosphate uridylyltransferase7.6 0.00AT3G23250 MYB15 (MYB DOMAIN PROTEIN 15); DNA binding / transcription factor MYB15 (MYB DOM7.6 0.01AT3G13670 protein kinase family protein 7.6 0.01AT3G17020 universal stress protein (USP) family protein 7.6 0.01AT2G44350 ATCS; ATP binding / ATP citrate synthase/ citrate (SI)-‐synthase ATCS; ATP bindin7.6 0.03AT1G13990 unknown protein unknown protein unknown protein 7.6 0.00AT3G03990 esterase/lipase/thioesterase family protein 7.5 0.01AT5G58710 ROC7; peptidyl-‐prolyl cis-‐trans isomerase 7.5 0.01AT5G43460 lesion inducing protein-‐related 7.4 0.02AT5G51040 unknown protein unknown protein 7.4 0.00AT1G72520 lipoxygenase, putative 7.4 0.00AT5G15320 unknown protein unknown protein 7.3 0.00AT1G29310 P-‐P-‐bond-‐hydrolysis-‐driven protein transmembrane transporter7.3 0.00AT3G60450 INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown;7.2 0.02AT1G08310 esterase/lipase/thioesterase family protein esterase/lipase/thioesterase family 7.2 0.05AT1G24510 T-‐complex protein 1 epsilon subunit, putative / TCP-‐1-‐epsilon, putative / chaper7.2 0.01AT5G12170 unknown protein 7.2 0.03AT4G33250 EIF3K (EUKARYOTIC TRANSLATION INITIATION FACTOR 3K); translation initiation fact7.1 0.00AT2G31090 unknown protein 7.1 0.02AT1G16890 ubiquitin-‐conjugating enzyme, putative ubiquitin-‐conjugating enzyme, putative7.1 0.01AT4G26970 aconitate hydratase/ copper ion binding 7.1 0.04AT1G23960 unknown protein unknown protein 7.1 0.04AT5G14780 FDH (FORMATE DEHYDROGENASE); NAD or NADH binding / binding / catalytic/ cofactor7.1 0.03AT1G23140 C2 domain-‐containing protein 7.0 0.00AT4G35600 CONNEXIN 32; ATP binding / kinase/ protein kinase/ protein serine/threonine kina7.0 0.01AT1G66960 lupeol synthase, putative / 2,3-‐oxidosqualene-‐triterpenoid cyclase, putative7.0 0.00

AT4G39830 L-‐ascorbate oxidase, putative 6.9 0.02AT1G64520 RPN12a (Regulatory Particle non-‐ATPase 12a); peptidase 6.9 0.01AT5G20050 protein kinase family protein 6.9 0.01AT1G27970 NTF2B (NUCLEAR TRANSPORT FACTOR 2B); Ran GTPase binding / protein transporter NT6.9 0.01AT3G05970 LACS6 (long-‐chain acyl-‐CoA synthetase 6); long-‐chain-‐fatty-‐acid-‐CoA ligase6.8 0.01AT1G05720 selenoprotein family protein 6.8 0.00AT3G04120 GAPC1 (GLYCERALDEHYDE-‐3-‐PHOSPHATE DEHYDROGENASE C SUBUNIT 1); glyceraldehyde-‐3-‐p6.8 0.01AT5G39950 ATTRX2 (THIOREDOXIN 2); oxidoreductase, acting on sulfur group of donors, disulf6.8 0.01AT1G26550 peptidyl-‐prolyl cis-‐trans isomerase PPIC-‐type family protein6.7 0.01AT3G53890 40S ribosomal protein S21 (RPS21B) 40S ribosomal protein S21 (RPS21B)6.7 0.02AT4G14716 ATARD1 (ACIREDUCTONE DIOXYGENASE 1); acireductone dioxygenase [iron(II)-‐requirin6.7 0.01AT3G48570 protein transport protein SEC61 gamma subunit, putative 6.7 0.00AT3G11230 yippee family protein yippee family protein 6.7 0.05AT5G20660 24 kDa vacuolar protein, putative 24 kDa vacuolar protein, putative6.7 0.00AT3G10860 ubiquinol-‐cytochrome C reductase complex ubiquinone-‐binding protein, putative / 6.7 0.00AT5G13430 ubiquinol-‐cytochrome C reductase iron-‐sulfur subunit, mitochondrial, putative / 6.7 0.00AT3G44340 CEF (clone eighty-‐four); protein binding / transporter/ zinc ion binding CEF (cl6.7 0.02AT2G39990 EIF2; translation initiation factor 6.7 0.01AT2G42790 CSY3 (citrate synthase 3); citrate (SI)-‐synthase 6.6 0.02AT3G20510 unknown protein 6.6 0.03AT3G13410 unknown protein 6.6 0.02AT1G19310 zinc finger (C3HC4-‐type RING finger) family protein 6.6 0.01AT4G11010 NDPK3 (NUCLEOSIDE DIPHOSPHATE KINASE 3); ATP binding / nucleoside diphosphate ki6.5 0.01AT2G44360 unknown protein 6.5 0.02AT3G30720 QQS (QUA-‐QUINE STARCH) 6.5 0.00AT3G04120 GAPC1 (GLYCERALDEHYDE-‐3-‐PHOSPHATE DEHYDROGENASE C SUBUNIT 1); glyceraldehyde-‐3-‐p6.5 0.03AT2G26670 TED4 (REVERSAL OF THE DET PHENOTYPE 4); heme oxygenase (decyclizing) TED4 (REVER6.5 0.00AT5G63030 glutaredoxin, putative 6.5 0.04AT5G50900 armadillo/beta-‐catenin repeat family protein 6.5 0.04AT3G13920 EIF4A1 (EUKARYOTIC TRANSLATION INITIATION FACTOR 4A1); ATP-‐dependent helicase/ t6.4 0.04AT2G03510 band 7 family protein 6.4 0.04AT4G11380 beta-‐adaptin, putative 6.4 0.02AT2G05520 GRP-‐3 (GLYCINE-‐RICH PROTEIN 3) GRP-‐3 (GLYCINE-‐RICH PROTEIN 3) GRP-‐3 (GLYCINE-‐RIC6.4 0.03AT1G66680 AR401 6.3 0.02AT1G55840 SEC14 cytosolic factor (SEC14) / phosphoglyceride transfer protein SEC14 cytosol6.3 0.01AT1G09630 ATRAB11C (ARABIDOPSIS RAB GTPASE 11C); GTP binding 6.3 0.00AT4G29040 RPT2a (regulatory particle AAA-‐ATPase 2a); ATPase 6.3 0.00AT5G59820 RHL41 (RESPONSIVE TO HIGH LIGHT 41); nucleic acid binding / transcription factor6.3 0.02AT4G23470 hydroxyproline-‐rich glycoprotein family protein hydroxyproline-‐rich glycoprotein6.2 0.01AT2G18680 unknown protein 6.2 0.00AT4G16520 ATG8F (autophagy 8f); microtubule binding ATG8F (autophagy 8f); microtubule bind6.2 0.01AT5G44580 unknown protein 6.2 0.01AT2G26240 unknown protein 6.2 0.04AT3G07030 nucleic acid binding 6.2 0.04AT4G39950 CYP79B2; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxyg6.2 0.01AT1G52890 ANAC019 (Arabidopsis NAC domain containing protein 19); transcription factor6.1 0.02AT1G72680 cinnamyl-‐alcohol dehydrogenase, putative 6.1 0.00

AT3G26280 CYP71B4; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxyg6.1 0.05AT3G26740 CCL (CCR-‐LIKE) 6.1 0.03AT4G18930 cyclic phosphodiesterase 6.0 0.03AT1G15120 ubiquinol-‐cytochrome C reductase complex 7.8 kDa protein, putative / mitochondri6.0 0.03AT1G75130 CYP721A1; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxy6.0 0.03AT5G62740 band 7 family protein 6.0 0.00AT2G22660 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow6.0 0.02AT4G10970 unknown protein unknown protein unknown protein unknown protein unknown protein 5.9 0.01AT1G32790 RNA-‐binding protein, putative RNA-‐binding protein, putative5.9 0.01AT5G20900 JAZ12 (JASMONATE-‐ZIM-‐DOMAIN PROTEIN 12) 5.9 0.00AT3G63420 AGG1 (Arabidopsis Ggamma-‐subunit 1); GTP binding AGG1 (Arabidopsis Ggamma-‐subuni5.9 0.02ATMG01040 hypothetical protein 5.9 0.00AT2G02510 unknown protein 5.9 0.01AT4G16330 oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or r5.9 0.00AT1G15880 GOS11 (golgi snare 11); SNARE binding 5.9 0.02AT1G32940 SBT3.5; identical protein binding / serine-‐type endopeptidase5.9 0.00AT3G54840 ARA6; GTP binding / GTPase ARA6; GTP binding / GTPase 5.8 0.03AT1G56330 ATSAR1B (SECRETION-‐ASSOCIATED RAS 1 B); GTP binding 5.8 0.05AT2G29020 Rab5-‐interacting family protein 5.8 0.00AT3G10090 40S ribosomal protein S28 (RPS28A) 5.8 0.00AT5G20090 unknown protein unknown protein unknown protein 5.8 0.01AT2G33120 SAR1 (SYNAPTOBREVIN-‐RELATED PROTEIN 1) SAR1 (SYNAPTOBREVIN-‐RELATED PROTEIN 1)5.8 0.03AT5G08300 succinyl-‐CoA ligase (GDP-‐forming) alpha-‐chain, mitochondrial, putative / succiny5.8 0.01AT1G55210 disease resistance response 5.8 0.02AT3G46560 TIM9; P-‐P-‐bond-‐hydrolysis-‐driven protein transmembrane transporter5.8 0.00AT5G10980 histone H3 5.8 0.03AT1G55850 ATCSLE1; cellulose synthase/ transferase, transferring glycosyl groups5.8 0.04AT3G57890 tubulin-‐specific chaperone C-‐related 5.7 0.02AT3G07110 60S ribosomal protein L13A (RPL13aA) 60S ribosomal protein L13A (RPL13aA)5.7 0.04AT1G19330 unknown protein unknown protein 5.7 0.02AT2G19540 transducin family protein / WD-‐40 repeat family protein 5.7 0.03AT4G31985 60S ribosomal protein L39 (RPL39C) 5.7 0.01AT5G42980 ATTRX3 (THIOREDOXIN 3); oxidoreductase, acting on sulfur group of donors, disulf5.7 0.04AT2G03680 SPR1 (SPIRAL1) SPR1 (SPIRAL1) 5.6 0.00AT4G13850 GR-‐RBP2 (GLYCINE-‐RICH RNA-‐BINDING PROTEIN 2); ATP binding / RNA binding / double5.6 0.02AT4G10500 oxidoreductase, 2OG-‐Fe(II) oxygenase family protein 5.6 0.00AT4G21105 cytochrome-‐c oxidase/ electron carrier cytochrome-‐c oxidase/ electron carrier5.6 0.03AT1G09430 ACLA-‐3; ATP citrate synthase 5.6 0.03AT1G16740 ribosomal protein L20 family protein 5.6 0.02AT4G29520 LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 23 plant struc5.6 0.01AT5G59140 SKP1 family protein 5.6 0.01AT1G70160 unknown protein 5.6 0.03AT5G45010 ATDSS1(V) (Arabidopsis dss1 homolog on chromosome V) 5.6 0.03AT1G28480 GRX480; electron carrier/ protein disulfide oxidoreductase 5.5 0.02AT1G61790 OST3/OST6 family protein 5.5 0.05AT5G07400 forkhead-‐associated domain-‐containing protein / FHA domain-‐containing protein5.5 0.01AT3G03920 Gar1 RNA-‐binding region family protein 5.5 0.02

AT4G23150 protein kinase family protein 5.5 0.04AT5G22270 unknown protein 5.4 0.01AT4G29660 EMB2752 (EMBRYO DEFECTIVE 2752) 5.4 0.03AT3G29090 pectinesterase family protein 5.4 0.01AT3G13060 ECT5; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process 5.4 0.00AT5G47910 RBOHD (RESPIRATORY BURST OXIDASE HOMOLOGUE D); NAD(P)H oxidase5.4 0.03AT5G20570 RBX1 (RING-‐BOX 1); protein binding RBX1 (RING-‐BOX 1); protein binding RBX1 (RING5.4 0.00AT2G22425 peptidase peptidase 5.4 0.05AT1G02475 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow5.3 0.05AT1G71010 phosphatidylinositol-‐4-‐phosphate 5-‐kinase family protein 5.3 0.02AT1G69750 cox19 family protein 5.3 0.02AT1G23290 RPL27AB; structural constituent of ribosome 5.3 0.01AT5G66040 STR16 (SULFURTRANSFERASE PROTEIN 16) STR16 (SULFURTRANSFERASE PROTEIN 16)5.3 0.00AT1G51760 IAR3 (IAA-‐ALANINE RESISTANT 3); IAA-‐Ala conjugate hydrolase/ metallopeptidase5.3 0.02AT2G26660 SPX2 (SPX DOMAIN GENE 2) 5.3 0.02AT3G16080 60S ribosomal protein L37 (RPL37C) 5.3 0.01AT4G16710 glycosyltransferase family protein 28 glycosyltransferase family protein 285.2 0.02AT5G52820 WD-‐40 repeat family protein / notchless protein, putative 5.2 0.00AT1G56060 unknown protein 5.2 0.04AT2G30140 UDP-‐glucoronosyl/UDP-‐glucosyl transferase family protein UDP-‐glucoronosyl/UDP-‐gl5.2 0.00AT3G18035 HON4; DNA binding 5.2 0.03AT5G07830 AtGUS2 (Arabidopsis thaliana glucuronidase 2); beta-‐glucuronidase5.2 0.00AT3G18480 AtCASP (Arabidopsis thaliana CCAAT-‐displacement protein alternatively spliced pr5.2 0.01AT5G33290 XGD1 (XYLOGALACTURONAN DEFICIENT 1); UDP-‐xylosyltransferase/ catalytic5.2 0.02AT2G45070 SEC61 BETA; protein transporter SEC61 BETA; protein transporter SEC61 BETA; prot5.2 0.01AT1G51890 leucine-‐rich repeat protein kinase, putative 5.1 0.03AT2G46540 unknown protein 5.1 0.04AT1G74710 isochorismate synthase 1 (ICS1) / isochorismate mutase isochorismate synthase 1 5.1 0.00AT5G42300 UBL5 (UBIQUITIN-‐LIKE PROTEIN 5) 5.1 0.02AT1G31580 ECS1 5.1 0.03AT2G02390 ATGSTZ1 (ARABIDOPSIS THALIANA GLUTATHIONE S-‐TRANSFERASE ZETA 1); catalytic/ glut5.1 0.01AT5G20990 B73; molybdenum ion binding 5.1 0.05AT4G30270 MERI5B (meristem-‐5); hydrolase, acting on glycosyl bonds / xyloglucan:xyloglucos5.0 0.00AT5G02100 UNE18 (UNFERTILIZED EMBRYO SAC 18); oxysterol binding / sterol binding5.0 0.00AT5G66760 SDH1-‐1; ATP binding / succinate dehydrogenase 5.0 0.00AT1G03900 ATNAP4 (Arabidopsis thaliana non-‐intrinsic ABC protein 4); ATPase, coupled to tr5.0 0.01AT1G25520 unknown protein 5.0 0.02AT5G57030 LUT2 (LUTEIN DEFICIENT 2); lycopene epsilon cyclase 5.0 0.02AT2G29700 ATPH1 (ARABIDOPSIS THALIANA PLECKSTRIN HOMOLOGUE 1); phosphoinositide binding5.0 0.00AT2G27730 unknown protein 5.0 0.04AT1G10590 DNA-‐binding protein-‐related DNA-‐binding protein-‐related DNA-‐binding protein-‐rela5.0 0.00AT1G67940 ATNAP3; transporter 4.9 0.03AT5G19550 ASP2 (ASPARTATE AMINOTRANSFERASE 2); L-‐aspartate:2-‐oxoglutarate aminotransferase4.9 0.01AT3G22370 AOX1A (ALTERNATIVE OXIDASE 1A); alternative oxidase 4.9 0.00AT5G54860 integral membrane transporter family protein 4.9 0.04AT5G59880 ADF3 (ACTIN DEPOLYMERIZING FACTOR 3); actin binding ADF3 (ACTIN DEPOLYMERIZING F4.9 0.01AT3G54110 PUMP1 (PLANT UNCOUPLING MITOCHONDRIAL PROTEIN 1); binding / oxidative phosphoryl4.9 0.01

AT5G50400 PAP27 (PURPLE ACID PHOSPHATASE 27); acid phosphatase/ protein serine/threonine p4.9 0.01AT2G40765 unknown protein 4.9 0.01AT1G22840 CYTC-‐1 (CYTOCHROME C-‐1); electron carrier/ heme binding / iron ion binding CYTC-‐4.9 0.00AT2G24180 CYP71B6 (CYTOCHROME P450 71B6); electron carrier/ heme binding / iron ion bindin4.9 0.01AT5G18780 F-‐box family protein 4.9 0.01AT1G74340 dolichol phosphate-‐mannose biosynthesis regulatory protein-‐related4.8 0.03AT1G58180 carbonic anhydrase family protein / carbonate dehydratase family protein carboni4.8 0.01AT3G60190 ADL1E (ARABIDOPSIS DYNAMIN-‐LIKE 1E); GTP binding / GTPase4.8 0.03AT5G67600 unknown protein 4.8 0.05AT3G62290 ATARFA1E (ADP-‐ribosylation factor A1E); GTP binding / phospholipase activator/ p4.8 0.01AT3G57090 BIGYIN; binding 4.8 0.00AT2G23090 unknown protein 4.8 0.01AT2G38740 haloacid dehalogenase-‐like hydrolase family protein 4.8 0.05AT2G33470 GLTP1 (glycolipid transfer protein 1); glycolipid binding / glycolipid transport4.8 0.01AT4G03030 kelch repeat-‐containing F-‐box family protein 4.8 0.03AT4G25630 FIB2 (FIBRILLARIN 2); snoRNA binding 4.8 0.01AT3G27890 NQR (NADPH:QUINONE OXIDOREDUCTASE); FMN reductase4.8 0.02AT2G39550 PGGT-‐I; CAAX-‐protein geranylgeranyltransferase/ protein heterodimerization4.8 0.00AT3G56460 oxidoreductase, zinc-‐binding dehydrogenase family protein4.7 0.04AT5G61790 calnexin 1 (CNX1) 4.7 0.01AT3G51130 unknown protein 4.7 0.00AT5G64350 FKBP12 (FK506-‐BINDING PROTEIN); FK506 binding / peptidyl-‐prolyl cis-‐trans isomer4.7 0.01AT1G66240 ATX1 (ARABIDOPSIS HOMOLOG OF ANTI-‐OXIDANT 1); metal ion binding ATX1 (ARABIDOPSI4.7 0.00AT1G15270 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow4.7 0.01AT2G47250 RNA helicase, putative 4.6 0.01AT3G51890 protein binding / structural molecule 4.6 0.02AT5G61590 AP2 domain-‐containing transcription factor family protein 4.6 0.03AT5G15490 UDP-‐glucose 6-‐dehydrogenase, putative 4.6 0.01AT1G77420 hydrolase, alpha/beta fold family protein 4.6 0.00AT5G54500 FQR1 (FLAVODOXIN-‐LIKE QUINONE REDUCTASE 1); FMN binding / oxidoreductase, acting4.6 0.02AT1G61570 TIM13 (TRANSLOCASE OF THE INNER MITOCHONDRIAL MEMBRANE 13); P-‐P-‐bond-‐hydrolysis-‐4.6 0.04AT5G48380 leucine-‐rich repeat family protein / protein kinase family protein4.6 0.04AT1G76150 maoC-‐like dehydratase domain-‐containing protein 4.5 0.05AT1G53780 ATP binding / ATPase/ hydrolase/ nucleoside-‐triphosphatase/ nucleotide binding /4.5 0.00AT5G48590 unknown protein 4.5 0.03AT1G23840 unknown protein 4.5 0.02AT2G47440 DNAJ heat shock N-‐terminal domain-‐containing protein 4.5 0.04AT5G26920 CBP60G (CAM-‐BINDING PROTEIN 60-‐LIKE.G); calmodulin binding4.5 0.03AT1G22750 unknown protein unknown protein unknown protein unknown protein4.5 0.01AT3G57480 zinc finger (C2H2 type, AN1-‐like) family protein 4.5 0.00AT1G11890 SEC22; transporter 4.5 0.01AT2G25070 protein phosphatase 2C, putative / PP2C, putative 4.5 0.04AT3G57240 BG3 (BETA-‐1,3-‐GLUCANASE 3); cellulase/ hydrolase, hydrolyzing O-‐glycosyl compoun4.5 0.01AT5G63980 SAL1; 3'(2'),5'-‐bisphosphate nucleotidase/ inositol or phosphatidylinositol phos4.5 0.02AT4G17830 peptidase M20/M25/M40 family protein 4.5 0.00AT4G29350 PFN2 (PROFILIN 2); actin binding / protein binding 4.4 0.01AT3G59920 ATGDI2 (RAB GDP DISSOCIATION INHIBITOR 2); RAB GDP-‐dissociation inhibitor4.4 0.00

AT3G25800 PP2AA2 (PROTEIN PHOSPHATASE 2A SUBUNIT A2); protein phosphatase type 2A regulato4.4 0.02AT1G17160 pfkB-‐type carbohydrate kinase family protein pfkB-‐type carbohydrate kinase famil4.4 0.01AT3G46040 RPS15AD (ribosomal protein S15A D); structural constituent of ribosome4.4 0.00AT1G79380 copine-‐related 4.3 0.03AT4G21160 ZAC; ARF GTPase activator/ phospholipid binding ZAC; ARF GTPase activator/ phosp4.3 0.02AT2G07691 unknown protein 4.3 0.03AT5G59890 ADF4 (ACTIN DEPOLYMERIZING FACTOR 4); actin binding ADF4 (ACTIN DEPOLYMERIZING F4.3 0.00AT3G43590 zinc knuckle (CCHC-‐type) family protein 4.3 0.00AT2G20820 unknown protein unknown protein 4.3 0.00AT2G07728 unknown protein 4.3 0.03AT4G23010 UDP-‐galactose transporter-‐related UDP-‐galactose transporter-‐related4.3 0.00AT3G06860 MFP2 (MULTIFUNCTIONAL PROTEIN 2); 3-‐hydroxyacyl-‐CoA dehydrogenase/ enoyl-‐CoA hyd4.3 0.00AT3G07910 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow4.3 0.00AT3G06700 60S ribosomal protein L29 (RPL29A) 60S ribosomal protein L29 (RPL29A) 60S riboso4.3 0.01AT5G19440 cinnamyl-‐alcohol dehydrogenase, putative (CAD) 4.3 0.01AT3G01740 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow4.2 0.02AT3G44010 40S ribosomal protein S29 (RPS29B) 4.2 0.00no_match no_match 4.2 0.00AT1G02500 SAM1 (S-‐ADENOSYLMETHIONINE SYNTHETASE 1); methionine adenosyltransferase SAM1 (S4.2 0.02AT5G38890 exoribonuclease-‐related 4.2 0.03AT2G30770 CYP71A13 (cytochrome P450, family 71, subfamily A, polypeptide 13); indoleacetal4.2 0.01AT1G22410 2-‐dehydro-‐3-‐deoxyphosphoheptonate aldolase, putative / 3-‐deoxy-‐D-‐arabino-‐heptulo4.2 0.01no_match no_match 4.2 0.01AT3G23600 dienelactone hydrolase family protein dienelactone hydrolase family protein4.2 0.01AT3G57870 SCE1 (SUMO CONJUGATION ENZYME 1); SUMO ligase 4.2 0.00AT5G05370 ubiquinol-‐cytochrome C reductase complex ubiquinone-‐binding protein, putative / 4.2 0.00AT2G40740 WRKY55; transcription factor WRKY55; transcription factor 4.1 0.03AT5G08290 YLS8; catalytic 4.1 0.04AT3G24830 60S ribosomal protein L13A (RPL13aB) 4.1 0.03AT3G12200 AtNek7 (NIMA-‐related kinase7); ATP binding / kinase/ protein kinase/ protein ser4.1 0.04AT5G66320 zinc finger (GATA type) family protein zinc finger (GATA type) family protein4.1 0.03AT2G44525 unknown protein 4.1 0.02AT2G46390 unknown protein 4.1 0.02AT2G38710 AMMECR1 family AMMECR1 family 4.1 0.02AT2G05630 autophagy 8d (APG8d) autophagy 8d (APG8d) 4.1 0.04AT1G45000 26S proteasome regulatory complex subunit p42D, putative 26S proteasome regulato4.1 0.01AT3G13330 binding 4.1 0.03AT4G03960 tyrosine specific protein phosphatase family protein 4.1 0.01AT1G32460 unknown protein 4.1 0.01AT1G56450 PBG1; peptidase/ threonine-‐type endopeptidase 4.1 0.02AT1G61250 SC3 (SECRETORY CARRIER 3); transmembrane transporter 4.1 0.03AT1G31910 GHMP kinase family protein 4.0 0.01AT2G45170 AtATG8e; microtubule binding AtATG8e; microtubule binding4.0 0.04AT1G27980 DPL1; carboxy-‐lyase/ catalytic/ pyridoxal phosphate binding4.0 0.00AT2G34470 UREG (UREASE ACCESSORY PROTEIN G); ATP binding / metal ion binding / nickel ion 4.0 0.03AT2G30110 ATUBA1; ubiquitin activating enzyme/ ubiquitin-‐protein ligase4.0 0.02AT3G48570 protein transport protein SEC61 gamma subunit, putative 4.0 0.03

AT4G36030 ARO3 (ARMADILLO REPEAT ONLY 3); binding 4.0 0.03AT1G01730 unknown protein 4.0 0.02AT5G04750 F1F0-‐ATPase inhibitor protein, putative F1F0-‐ATPase inhibitor protein, putative4.0 0.02AT3G48780 SPT1 (SERINE PALMITOYLTRANSFERASE 1); serine C-‐palmitoyltransferase4.0 0.01AT5G03290 isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative4.0 0.04AT1G06650 2-‐oxoglutarate-‐dependent dioxygenase, putative 2-‐oxoglutarate-‐dependent dioxygen4.0 0.02AT3G11940 ATRPS5A (RIBOSOMAL PROTEIN 5A); structural constituent of ribosome ATRPS5A (RIBO4.0 0.03AT1G53280 DJ-‐1 family protein 4.0 0.02AT2G05710 aconitate hydratase, cytoplasmic, putative / citrate hydro-‐lyase/aconitase, puta4.0 0.02AT1G56340 CRT1 (CALRETICULIN 1); calcium ion binding / unfolded protein binding CRT1 (CALR4.0 0.03AT2G32680 AtRLP23 (Receptor Like Protein 23); kinase/ protein binding4.0 0.02AT3G60860 guanine nucleotide exchange family protein 4.0 0.04AT2G20670 unknown protein 4.0 0.00AT1G67350 unknown protein unknown protein 3.9 0.04AT4G39640 GGT1 (GAMMA-‐GLUTAMYL TRANSPEPTIDASE 1); gamma-‐glutamyltransferase/ glutathione g3.9 0.03AT1G03860 ATPHB2 (PROHIBITIN 2) ATPHB2 (PROHIBITIN 2) ATPHB2 (PROHIBITIN 2)3.9 0.01AT1G53030 cytochrome c oxidase copper chaperone family protein 3.9 0.03AT5G53120 SPDS3 (SPERMIDINE SYNTHASE 3); spermidine synthase/ spermine synthase SPDS3 (SPE3.9 0.01AT5G58420 40S ribosomal protein S4 (RPS4D) 3.9 0.00AT1G18540 60S ribosomal protein L6 (RPL6A) 3.9 0.01AT3G62150 PGP21 (P-‐GLYCOPROTEIN 21); ATPase, coupled to transmembrane movement of substanc3.9 0.03AT1G08940 phosphoglycerate/bisphosphoglycerate mutase family protein3.9 0.04no_match no_match 3.9 0.01AT1G76200 unknown protein 3.9 0.01AT3G24160 PMP (PUTATIVE TYPE 1 MEMBRANE PROTEIN) 3.9 0.03AT2G05940 protein kinase, putative 3.9 0.05AT2G30930 unknown protein 3.9 0.01AT5G51940 NRPB6A; DNA binding / DNA-‐directed RNA polymerase 3.9 0.02AT3G04120 GAPC1 (GLYCERALDEHYDE-‐3-‐PHOSPHATE DEHYDROGENASE C SUBUNIT 1); glyceraldehyde-‐3-‐p3.9 0.02AT1G28680 transferase family protein 3.9 0.00AT1G80420 DNA repair protein, putative (XRCC1) DNA repair protein, putative (XRCC1) DNA re3.8 0.02AT2G20610 SUR1 (SUPERROOT 1); S-‐alkylthiohydroximate lyase/ carbon-‐sulfur lyase/ transamin3.8 0.05AT5G55190 RAN3 (RAN GTPASE 3); GTP binding / GTPase/ protein binding3.8 0.04AT4G33640 unknown protein 3.8 0.02AT5G20400 oxidoreductase, 2OG-‐Fe(II) oxygenase family protein 3.8 0.02AT1G62840 unknown protein 3.8 0.01AT5G47200 ATRAB1A; GTP binding 3.8 0.03AT5G39570 unknown protein 3.8 0.00AT1G67250 proteasome maturation factor UMP1 family protein 3.8 0.03AT1G21370 unknown protein unknown protein 3.8 0.05AT3G24170 ATGR1 (glutathione-‐disulfide reductase); FAD binding / NADP or NADPH binding / g3.8 0.03AT1G18720 unknown protein 3.8 0.03AT1G34130 STT3B (staurosporin and temperature sensitive 3-‐like b); oligosaccharyl transfer3.8 0.01AT3G04090 SIP1A (SMALL AND BASIC INTRINSIC PROTEIN 1A); water channel3.8 0.02AT1G78380 ATGSTU19 (GLUTATHIONE S-‐TRANSFERASE TAU 19); glutathione binding / glutathione t3.8 0.05AT2G47320 peptidyl-‐prolyl cis-‐trans isomerase cyclophilin-‐type family protein3.8 0.03AT4G24220 VEP1 (VEIN PATTERNING 1); binding / catalytic VEP1 (VEIN PATTERNING 1); binding 3.8 0.00

AT4G16430 basic helix-‐loop-‐helix (bHLH) family protein 3.7 0.02AT3G08610 unknown protein 3.7 0.02AT4G24470 TIFY1; transcription factor TIFY1; transcription factor 3.7 0.05AT4G21620 glycine-‐rich protein 3.7 0.01AT1G66580 60S ribosomal protein L10 (RPL10C) 3.7 0.04AT5G67330 ATNRAMP4; inorganic anion transmembrane transporter/ manganese ion transmembrane3.7 0.00AT4G14410 basic helix-‐loop-‐helix (bHLH) family protein basic helix-‐loop-‐helix (bHLH) famil3.7 0.03AT2G27020 PAG1; endopeptidase/ peptidase/ threonine-‐type endopeptidase3.7 0.00AT4G39940 AKN2 (APS-‐kinase 2); ATP binding / adenylylsulfate kinase/ kinase/ transferase, 3.7 0.01AT2G41410 calmodulin, putative 3.7 0.03AT1G51650 ATP synthase epsilon chain, mitochondrial 3.7 0.02AT1G29850 double-‐stranded DNA-‐binding family protein double-‐stranded DNA-‐binding family pr3.7 0.02AT1G14320 SAC52 (SUPPRESSOR OF ACAULIS 52); structural constituent of ribosome SAC52 (SUPP3.7 0.01AT3G03470 CYP89A9; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxyg3.7 0.04AT5G59210 myosin heavy chain-‐related myosin heavy chain-‐related 3.7 0.04AT3G27310 PUX1 (PLANT UBX DOMAIN-‐CONTAINING PROTEIN 1) 3.7 0.02AT4G17230 SCL13 (Scarecrow-‐like 13); transcription factor 3.6 0.00AT1G61730 DNA-‐binding storekeeper protein-‐related 3.6 0.02AT5G58740 nuclear movement family protein 3.6 0.04AT4G27230 HTA2 (histone H2A); DNA binding 3.6 0.05AT3G09735 DNA-‐binding S1FA family protein 3.6 0.03AT5G67490 unknown protein 3.6 0.00AT2G14750 APK (APS KINASE); ATP binding / adenylylsulfate kinase/ kinase/ transferase, tra3.6 0.03AT2G31570 ATGPX2 (GLUTATHIONE PEROXIDASE 2); glutathione peroxidase3.6 0.03AT5G52020 AP2 domain-‐containing protein 3.6 0.03AT1G03210 phenazine biosynthesis PhzC/PhzF family protein 3.6 0.05AT4G31180 aspartyl-‐tRNA synthetase, putative / aspartate-‐-‐tRNA ligase, putative aspartyl-‐t3.6 0.01AT5G52560 ATUSP (ARABIDOPSIS THALIANA UDP-‐SUGAR PYROPHOSPHORYLASE); UTP-‐monosaccharide-‐1-‐p3.6 0.01AT2G20570 GPRI1 (GBF'S PRO-‐RICH REGION-‐INTERACTING FACTOR 1); transcription factor/ transc3.6 0.01AT5G03850 40S ribosomal protein S28 (RPS28B) 3.6 0.00AT2G36160 40S ribosomal protein S14 (RPS14A) 3.6 0.03AT1G14000 VIK (VH1-‐INTERACTING KINASE); ATP binding / protein kinase/ protein serine/threo3.6 0.02AT3G26220 CYP71B3; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxyg3.5 0.01AT5G36880 acetyl-‐CoA synthetase, putative / acetate-‐CoA ligase, putative acetyl-‐CoA synthe3.5 0.01AT2G47170 ARF1A1C; GTP binding / phospholipase activator/ protein binding3.5 0.01AT5G47220 ERF2 (ETHYLENE RESPONSIVE ELEMENT BINDING FACTOR 2); DNA binding / transcription3.5 0.03AT1G18160 protein kinase family protein 3.5 0.01AT3G04120 GAPC1 (GLYCERALDEHYDE-‐3-‐PHOSPHATE DEHYDROGENASE C SUBUNIT 1); glyceraldehyde-‐3-‐p3.5 0.04AT3G52400 SYP122 (SYNTAXIN OF PLANTS 122); SNAP receptor 3.5 0.02AT4G19860 lecithin:cholesterol acyltransferase family protein / LACT family protein3.5 0.02AT5G64300 ATGCH; 3,4-‐dihydroxy-‐2-‐butanone-‐4-‐phosphate synthase/ GTP cyclohydrolase II3.5 0.02AT3G44750 HDA3 (HISTONE DEACETYLASE 3); histone deacetylase/ nucleic acid binding / zinc i3.5 0.02AT2G17980 ATSLY1; protein transporter 3.5 0.01AT5G53550 YSL3 (YELLOW STRIPE LIKE 3); oligopeptide transporter 3.5 0.01AT4G00860 ATOZI1 3.5 0.00AT3G03160 unknown protein 3.5 0.00AT1G47640 unknown protein 3.5 0.01

AT5G18190 protein kinase family protein protein kinase family protein 3.5 0.00AT5G26030 FC1 (ferrochelatase 1); ferrochelatase FC1 (ferrochelatase 1); ferrochelatase3.5 0.02AT1G56140 leucine-‐rich repeat family protein / protein kinase family protein3.5 0.01AT4G18040 EIF4E (EUKARYOTIC TRANSLATION INITATION FACTOR 4E); RNA binding / RNA cap bindin3.5 0.00AT3G15580 APG8H (AUTOPHAGY 8H); APG8 activating enzyme/ APG8-‐specific protease/ Atg8 ligas3.5 0.03AT3G55410 2-‐oxoglutarate dehydrogenase E1 component, putative / oxoglutarate decarboxylase3.4 0.02AT1G54030 GDSL-‐motif lipase, putative 3.4 0.01AT4G29735 unknown protein unknown protein 3.4 0.02AT4G21980 APG8A (AUTOPHAGY 8A); APG8 activating enzyme/ APG8-‐specific protease/ Atg8 ligas3.4 0.02AT4G22190 unknown protein 3.4 0.02AT2G27600 SKD1 (SUPPRESSOR OF K+ TRANSPORT GROWTH DEFECT1); ATP binding / nucleoside-‐triph3.4 0.01AT3G51000 epoxide hydrolase, putative 3.4 0.02AT3G49010 ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1); structural constituent o3.4 0.03AT4G21850 methionine sulfoxide reductase domain-‐containing protein / SeIR domain-‐containin3.4 0.04AT3G11730 ATFP8; GTP binding / GTP-‐dependent protein binding / myosin XI tail binding3.4 0.02AT3G56360 unknown protein 3.4 0.05AT1G77710 INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown;3.4 0.01AT1G21900 emp24/gp25L/p24 family protein 3.4 0.03AT5G23740 RPS11-‐BETA (RIBOSOMAL PROTEIN S11-‐BETA); structural constituent of ribosome3.4 0.03no_match no_match 3.4 0.03AT5G44320 eukaryotic translation initiation factor 3 subunit 7, putative / eIF-‐3 zeta, put3.4 0.05AT5G16970 AT-‐AER (alkenal reductase); 2-‐alkenal reductase 3.4 0.03AT2G47640 small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative /3.4 0.04AT2G36530 LOS2; copper ion binding / phosphopyruvate hydratase 3.4 0.00AT1G77940 60S ribosomal protein L30 (RPL30B) 3.4 0.03AT1G50430 DWF5 (DWARF 5); sterol delta7 reductase DWF5 (DWARF 5); sterol delta7 reductase3.4 0.01AT1G15400 unknown protein unknown protein unknown protein 3.4 0.03ATMG01060 hypothetical protein 3.4 0.01AT4G21810 DER2.1 (DERLIN-‐2.1) 3.3 0.01AT3G47810 MAG1 (MAIGO 1); hydrolase/ protein serine/threonine phosphatase MAG1 (MAIGO 1); 3.3 0.01AT1G35620 ATPDIL5-‐2 (PDI-‐LIKE 5-‐2); protein disulfide isomerase 3.3 0.03AT3G26340 20S proteasome beta subunit E, putative 3.3 0.02AT5G57020 NMT1 (MYRISTOYL-‐COA:PROTEIN N-‐MYRISTOYLTRANSFERASE); glycylpeptide N-‐tetradecano3.3 0.03AT3G44100 MD-‐2-‐related lipid recognition domain-‐containing protein / ML domain-‐containing 3.3 0.01AT3G49490 unknown protein 3.3 0.00AT2G17740 DC1 domain-‐containing protein 3.3 0.00AT4G28460 unknown protein 3.3 0.01AT4G33865 40S ribosomal protein S29 (RPS29C) 3.3 0.04AT5G51620 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow3.3 0.00AT5G20560 beta-‐1,3-‐glucanase, putative 3.3 0.02AT4G23040 UBX domain-‐containing protein 3.3 0.01AT1G20050 HYD1 (HYDRA1); C-‐8 sterol isomerase 3.2 0.03AT5G19140 AILP1 AILP1 3.2 0.04AT1G07750 cupin family protein 3.2 0.02AT1G21770 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow3.2 0.02AT3G19910 zinc finger (C3HC4-‐type RING finger) family protein 3.2 0.01AT2G43970 La domain-‐containing protein La domain-‐containing protein3.2 0.00

AT5G43260 chaperone protein dnaJ-‐related 3.2 0.00AT5G53330 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow3.2 0.01AT3G10210 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow3.2 0.04AT4G38920 ATVHA-‐C3 (VACUOLAR-‐TYPE H(+)-‐ATPASE C3); ATPase 3.2 0.03no_match no_match 3.2 0.05AT5G48370 thioesterase family protein thioesterase family protein 3.2 0.04AT5G63800 MUM2 (MUCILAGE-‐MODIFIED 2); beta-‐galactosidase 3.2 0.02AT1G28580 GDSL-‐motif lipase, putative GDSL-‐motif lipase, putative 3.2 0.00AT3G15290 3-‐hydroxybutyryl-‐CoA dehydrogenase, putative 3.2 0.04AT1G54770 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow3.2 0.01AT5G20290 40S ribosomal protein S8 (RPS8A) 3.2 0.03AT3G46430 unknown protein 3.2 0.03AT5G53140 protein phosphatase 2C, putative / PP2C, putative 3.2 0.02AT1G29940 NRPA2; DNA binding / DNA-‐directed RNA polymerase/ ribonucleoside binding3.2 0.01AT1G79940 ATERDJ2A; heat shock protein binding / unfolded protein binding ATERDJ2A; heat s3.2 0.05AT2G45330 emb1067 (embryo defective 1067); tRNA 2'-‐phosphotransferase/ transferase, transf3.2 0.03AT4G23885 unknown protein 3.2 0.05AT5G37070 unknown protein 3.2 0.00AT3G45980 HTB9; DNA binding 3.2 0.03AT3G24560 RSY3 (RASPBERRY 3) RSY3 (RASPBERRY 3) RSY3 (RASPBERRY 3); ATP binding / ligase, 3.1 0.01AT5G61530 small G protein family protein / RhoGAP family protein small G protein family pr3.1 0.02AT4G36760 ATAPP1; N-‐1-‐naphthylphthalamic acid binding / aminopeptidase3.1 0.01AT5G42320 metallocarboxypeptidase/ zinc ion binding 3.1 0.03AT2G40600 appr-‐1-‐p processing enzyme family protein 3.1 0.03AT3G56800 CAM3 (CALMODULIN 3); calcium ion binding 3.1 0.05AT5G65430 GRF8 (GENERAL REGULATORY FACTOR 8); protein binding / protein phosphorylated ami3.1 0.00AT5G42790 PAF1; endopeptidase/ peptidase/ threonine-‐type endopeptidase3.1 0.03AT5G05010 clathrin adaptor complexes medium subunit-‐related clathrin adaptor complexes med3.1 0.02AT2G03870 small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putati3.1 0.02AT4G21610 LOL2 (LSD ONE LIKE 2); transcription factor 3.1 0.00AT4G15800 RALFL33 (ralf-‐like 33); signal transducer 3.1 0.01AT4G33950 OST1 (OPEN STOMATA 1); calcium-‐dependent protein serine/threonine kinase/ kinase3.1 0.04AT1G71860 PTP1 (PROTEIN TYROSINE PHOSPHATASE 1); protein tyrosine phosphatase PTP1 (PROTEI3.1 0.01AT1G56110 NOP56 (Arabidopsis homolog of nucleolar protein Nop56) 3.1 0.04AT1G08880 H2AXA; DNA binding 3.1 0.03AT4G02080 ATSAR2 (ARABIDOPSIS THALIANA SECRETION-‐ASSOCIATED RAS SUPER FAMILY 2); GTP bindi3.1 0.02AT5G20920 EIF2 BETA; translation initiation factor EIF2 BETA; translation initiation facto3.1 0.03AT3G53020 STV1 (SHORT VALVE1); structural constituent of ribosome 3.1 0.01AT3G17000 UBC32 (ubiquitin-‐conjugating enzyme 32); ubiquitin-‐protein ligase3.1 0.04AT5G55290 ATP synthase subunit H family protein ATP synthase subunit H family protein3.1 0.05AT4G32470 ubiquinol-‐cytochrome C reductase complex 14 kDa protein, putative ubiquinol-‐cyto3.1 0.01AT4G33510 DHS2 (3-‐deoxy-‐d-‐arabino-‐heptulosonate 7-‐phosphate synthase); 3-‐deoxy-‐7-‐phosphohe3.1 0.03AT2G40590 40S ribosomal protein S26 (RPS26B) 3.1 0.04AT5G22950 VPS24.1 3.1 0.01AT3G23580 RNR2A (RIBONUCLEOTIDE REDUCTASE 2A); ribonucleoside-‐diphosphate reductase3.0 0.03AT1G74090 SOT18 (DESULFO-‐GLUCOSINOLATE SULFOTRANSFERASE 18); 3-‐methylthiopropyl-‐desulfoglu3.0 0.02AT2G43350 ATGPX3 (GLUTATHIONE PEROXIDASE 3); glutathione peroxidase3.0 0.03

AT1G07610 MT1C; copper ion binding 3.0 0.03AT1G09780 2,3-‐biphosphoglycerate-‐independent phosphoglycerate mutase, putative / phosphogl3.0 0.05AT5G42020 BIP2; ATP binding BIP2; ATP binding 3.0 0.01AT1G57720 elongation factor 1B-‐gamma, putative / eEF-‐1B gamma, putative elongation factor 3.0 0.03AT1G62020 coatomer protein complex, subunit alpha, putative 3.0 0.04AT2G15570 thioredoxin M-‐type 3, chloroplast (TRX-‐M3) thioredoxin M-‐type 3, chloroplast (TR3.0 0.04AT3G10370 SDP6 (SUGAR-‐DEPENDENT 6); glycerol-‐3-‐phosphate dehydrogenase3.0 0.02AT4G40030 histone H3.2 histone H3.2 histone H3.2 3.0 0.04AT1G67860 unknown protein 3.0 0.00AT5G27840 TOPP8; protein serine/threonine phosphatase TOPP8; protein serine/threonine phos3.0 0.01AT1G47420 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow3.0 0.05AT4G02930 elongation factor Tu, putative / EF-‐Tu, putative 3.0 0.04AT3G04400 emb2171 (embryo defective 2171); structural constituent of ribosome3.0 0.02AT3G15540 IAA19 (INDOLE-‐3-‐ACETIC ACID INDUCIBLE 19); transcription factor3.0 0.01AT5G13190 INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown;3.0 0.02AT1G16470 PAB1 (PROTEASOME SUBUNIT PAB1); endopeptidase/ peptidase/ threonine-‐type endopep3.0 0.01AT4G27960 UBC9 (UBIQUITIN CONJUGATING ENZYME 9); ubiquitin-‐protein ligase UBC9 (UBIQUITIN 3.0 0.01AT1G65720 unknown protein 3.0 0.01AT2G31880 leucine-‐rich repeat transmembrane protein kinase, putative3.0 0.00AT2G02050 NADH-‐ubiquinone oxidoreductase B18 subunit, putative 3.0 0.02AT4G30490 AFG1-‐like ATPase family protein 3.0 0.04AT5G13320 PBS3 (AVRPPHB SUSCEPTIBLE 3) 3.0 0.00AT1G68520 zinc finger (B-‐box type) family protein 3.0 0.02AT3G12980 HAC5; H3/H4 histone acetyltransferase/ histone acetyltransferase3.0 0.05AT5G20500 glutaredoxin, putative 3.0 0.02AT1G66410 CAM4 (calmodulin 4); calcium ion binding / signal transducer3.0 0.00AT3G52880 monodehydroascorbate reductase, putative monodehydroascorbate reductase, putativ3.0 0.01AT1G12360 KEU (keule); protein transporter 3.0 0.00AT1G24440 protein binding / zinc ion binding 3.0 0.05AT1G27930 unknown protein 2.9 0.01AT1G49140 NADH-‐ubiquinone oxidoreductase-‐related 2.9 0.00AT3G53630 unknown protein 2.9 0.05AT5G65720 NFS1; ATP binding / cysteine desulfurase/ transaminase NFS1; ATP binding / cyste2.9 0.02AT4G09800 RPS18C (S18 RIBOSOMAL PROTEIN); RNA binding / nucleic acid binding / structural 2.9 0.03AT5G65910 BSD domain-‐containing protein 2.9 0.01AT3G12570 FYD FYD FYD FYD 2.9 0.04AT3G18830 ATPLT5 (POLYOL TRANSPORTER 5); D-‐ribose transmembrane transporter/ D-‐xylose tran2.9 0.01AT1G19910 AVA-‐P2; ATPase/ proton-‐transporting ATPase, rotational mechanism2.9 0.03AT2G42680 MBF1A (MULTIPROTEIN BRIDGING FACTOR 1A); DNA binding / transcription coactivator2.9 0.00AT4G17420 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow2.9 0.02AT2G31110 unknown protein unknown protein 2.9 0.05AT3G25220 FKBP15-‐1; FK506 binding / peptidyl-‐prolyl cis-‐trans isomerase2.9 0.00AT1G16000 unknown protein 2.9 0.01AT1G29880 glycyl-‐tRNA synthetase / glycine-‐-‐tRNA ligase 2.9 0.00AT1G34190 anac017 (Arabidopsis NAC domain containing protein 17); transcription factor2.9 0.01AT4G15475 F-‐box family protein (FBL4) 2.9 0.02AT1G48900 signal recognition particle 54 kDa protein 3 / SRP54 (SRP-‐54C) signal recognitio2.9 0.00

AT1G43170 ARP1 (ARABIDOPSIS RIBOSOMAL PROTEIN 1); structural constituent of ribosome ARP1 2.9 0.01AT1G34030 40S ribosomal protein S18 (RPS18B) 2.9 0.02AT2G11810 MGDC; 1,2-‐diacylglycerol 3-‐beta-‐galactosyltransferase MGDC; 1,2-‐diacylglycerol 32.9 0.05AT2G13560 malate oxidoreductase, putative 2.9 0.03AT5G06530 ABC transporter family protein ABC transporter family protein ABC transporter fa2.9 0.03AT3G25010 AtRLP41 (Receptor Like Protein 41); kinase/ protein binding2.9 0.02AT1G19120 small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putati2.9 0.01AT4G05070 unknown protein 2.9 0.03AT5G38650 proteasome maturation factor UMP1 family protein 2.9 0.05AT3G18430 calcium-‐binding EF hand family protein 2.9 0.00AT3G10640 VPS60.1 VPS60.1 2.9 0.00AT1G04750 VAMP721 (VESICLE-‐ASSOCIATED MEMBRANE PROTEIN 721) VAMP721 (VESICLE-‐ASSOCIATED ME2.9 0.00AT4G07390 PQ-‐loop repeat family protein / transmembrane family protein2.9 0.02AT4G35460 NTRB (NADPH-‐DEPENDENT THIOREDOXIN REDUCTASE B); thioredoxin-‐disulfide reductase2.8 0.03AT2G14720 VSR-‐2; calcium ion binding VSR-‐2; calcium ion binding 2.8 0.02AT1G70490 ARFA1D; GTP binding / phospholipase activator/ protein binding ARFA1D; GTP bindi2.8 0.02AT3G22200 POP2 (POLLEN-‐PISTIL INCOMPATIBILITY 2); 4-‐aminobutyrate transaminase/ 4-‐aminobut2.8 0.03AT2G45510 CYP704A2; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxy2.8 0.05AT5G47050 protein binding / zinc ion binding 2.8 0.01AT3G19970 unknown protein 2.8 0.03AT3G56310 alpha-‐galactosidase, putative / melibiase, putative / alpha-‐D-‐galactoside galact2.8 0.04AT4G02980 ABP1 (ENDOPLASMIC RETICULUM AUXIN BINDING PROTEIN 1); auxin binding2.8 0.04AT3G61110 ARS27A (ARABIDOPSIS RIBOSOMAL PROTEIN S27); structural constituent of ribosome2.8 0.02AT3G62830 AUD1; UDP-‐glucuronate decarboxylase/ catalytic/ dTDP-‐glucose 4,6-‐dehydratase AUD2.8 0.00AT2G35790 unknown protein 2.8 0.01AT3G05230 signal peptidase subunit family protein signal peptidase subunit family protein2.8 0.04AT1G30500 NF-‐YA7 (NUCLEAR FACTOR Y, SUBUNIT A7); specific transcriptional repressor/ trans2.8 0.00AT4G19400 actin binding 2.8 0.01AT3G07480 electron carrier/ iron-‐sulfur cluster binding 2.8 0.02AT2G07180 protein kinase, putative 2.8 0.02AT2G19760 PRF1 (PROFILIN 1); actin binding 2.8 0.00AT5G43780 APS4; sulfate adenylyltransferase (ATP) 2.8 0.03AT1G16210 unknown protein 2.8 0.03AT3G48140 senescence-‐associated protein, putative 2.8 0.03AT1G50370 serine/threonine protein phosphatase, putative 2.8 0.05AT3G47836 unknown protein unknown protein 2.8 0.04AT5G61500 ATG3 2.8 0.00AT1G14820 SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein2.8 0.02AT1G12710 AtPP2-‐A12 (Phloem protein 2-‐A12); carbohydrate binding 2.7 0.04AT5G56670 40S ribosomal protein S30 (RPS30C) 2.7 0.04AT1G79710 integral membrane transporter family protein 2.7 0.02AT5G15400 U-‐box domain-‐containing protein 2.7 0.00AT4G14320 60S ribosomal protein L36a/L44 (RPL36aB) 2.7 0.01AT1G28660 lipase, putative lipase, putative 2.7 0.04AT3G12650 unknown protein 2.7 0.01AT4G02060 PRL (PROLIFERA); ATP binding / DNA binding / DNA-‐dependent ATPase/ nucleoside-‐tr2.7 0.02AT5G57660 zinc finger (B-‐box type) family protein 2.7 0.02

AT5G52240 MSBP1 (membrane steroid binding protein 1); steroid binding2.7 0.02AT2G04390 40S ribosomal protein S17 (RPS17A) 2.7 0.01AT5G38630 ACYB-‐1; carbon-‐monoxide oxygenase 2.7 0.04AT2G35050 protein kinase family protein 2.7 0.01AT1G06890 transporter-‐related transporter-‐related 2.7 0.01AT4G09320 NDPK1; ATP binding / nucleoside diphosphate kinase 2.7 0.01AT1G07170 LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRE2.7 0.03AT5G55850 NOI NOI 2.7 0.00AT3G26640 LWD2 (LIGHT-‐REGULATED WD 2); nucleotide binding 2.7 0.02AT4G26570 ATCBL3 (ARABIDOPSIS THALIANA CALCINEURIN B-‐LIKE 3); calcium ion binding ATCBL3 (2.7 0.05AT3G19490 ATNHD1; potassium:hydrogen antiporter/ sodium:hydrogen antiporter2.7 0.02AT3G10380 SEC8 (SUBUNIT OF EXOCYST COMPLEX 8) 2.7 0.03AT1G62040 ATG8C (autophagy 8c); microtubule binding 2.7 0.02AT1G30230 elongation factor 1-‐beta / EF-‐1-‐beta elongation factor 1-‐beta / EF-‐1-‐beta2.7 0.01AT1G47260 GAMMA CA2 (GAMMA CARBONIC ANHYDRASE 2); carbonate dehydratase2.7 0.02AT2G25210 60S ribosomal protein L39 (RPL39A) 2.7 0.03AT5G02790 In2-‐1 protein, putative 2.7 0.02AT3G18860 transducin family protein / WD-‐40 repeat family protein transducin family protei2.7 0.03AT3G10420 sporulation protein-‐related sporulation protein-‐related 2.7 0.04AT5G06820 SRF2 (STRUBBELIG-‐RECEPTOR FAMILY 2); ATP binding / kinase/ protein serine/threon2.7 0.00AT3G29075 glycine-‐rich protein 2.7 0.02AT5G46430 60S ribosomal protein L32 (RPL32B) 60S ribosomal protein L32 (RPL32B)2.7 0.03AT1G51200 zinc finger (AN1-‐like) family protein zinc finger (AN1-‐like) family protein2.7 0.01AT1G48920 ATNUC-‐L1; nucleic acid binding / nucleotide binding 2.6 0.02AT4G34450 coatomer gamma-‐2 subunit, putative / gamma-‐2 coat protein, putative / gamma-‐2 CO2.6 0.03AT5G11520 ASP3 (ASPARTATE AMINOTRANSFERASE 3); L-‐aspartate:2-‐oxoglutarate aminotransferase2.6 0.02AT4G20840 FAD-‐binding domain-‐containing protein 2.6 0.03AT4G23710 VAG2; hydrolase, acting on acid anhydrides, catalyzing transmembrane movement of2.6 0.04AT3G22330 PMH2 (putative mitochondrial RNA helicase 2); ATP binding / ATP-‐dependent helica2.6 0.04AT2G26230 uricase / urate oxidase / nodulin 35, putative 2.6 0.02AT1G74270 60S ribosomal protein L35a (RPL35aC) 2.6 0.00AT5G39510 SGR4 (SHOOT GRAVITROPSIM 4); receptor 2.6 0.00AT1G48160 signal recognition particle 19 kDa protein, putative / SRP19, putative2.6 0.03AT5G35080 protein binding 2.6 0.02AT2G47710 universal stress protein (USP) family protein 2.6 0.01AT3G07580 unknown protein 2.6 0.02AT3G32930 unknown protein 2.6 0.04AT4G10790 UBX domain-‐containing protein 2.6 0.04AT5G52840 NADH-‐ubiquinone oxidoreductase-‐related 2.6 0.03AT1G60610 protein binding / zinc ion binding protein binding / zinc ion binding protein bi2.6 0.00AT2G25510 unknown protein 2.6 0.00AT3G23300 dehydration-‐responsive protein-‐related 2.6 0.01AT5G27850 60S ribosomal protein L18 (RPL18C) 2.6 0.02AT4G22750 zinc finger (DHHC type) family protein zinc finger (DHHC type) family protein2.6 0.05AT1G27530 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow2.6 0.01AT1G64850 calcium-‐binding EF hand family protein 2.6 0.01AT4G10840 kinesin light chain-‐related kinesin light chain-‐related 2.6 0.00

AT3G22845 emp24/gp25L/p24 protein-‐related 2.6 0.00AT1G21270 WAK2; ATP binding / calcium ion binding / protein kinase/ protein serine/threoni2.6 0.03AT5G58290 RPT3 (REGULATORY PARTICLE TRIPLE-‐A ATPASE 3); ATPase 2.6 0.02AT4G36800 RCE1 (RUB1 CONJUGATING ENZYME 1); NEDD8 ligase/ small conjugating protein ligase2.6 0.00AT3G21865 PEX22 (peroxin 22); protein binding 2.6 0.04AT3G55520 immunophilin, putative / FKBP-‐type peptidyl-‐prolyl cis-‐trans isomerase, putative2.5 0.00AT5G11510 MYB3R-‐4 (myb domain protein 3R-‐4); DNA binding / transcription coactivator/ tran2.5 0.02AT3G09970 calcineurin-‐like phosphoesterase family protein 2.5 0.04AT5G54310 AGD5 (ARF-‐GAP domain 5); ARF GTPase activator/ DNA binding / zinc ion binding2.5 0.03AT1G42480 unknown protein unknown protein unknown protein 2.5 0.01AT1G67360 rubber elongation factor (REF) family protein rubber elongation factor (REF) fam2.5 0.01AT4G26840 SUMO1 (SMALL UBIQUITIN-‐LIKE MODIFIER 1); protein binding / protein tag2.5 0.05AT3G09810 isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative2.5 0.04AT4G22310 unknown protein 2.5 0.04AT5G42890 SCP2 (STEROL CARRIER PROTEIN 2); oxidoreductase/ sterol carrier2.5 0.02AT1G30640 protein kinase, putative 2.5 0.02AT5G47570 unknown protein 2.5 0.02AT1G04270 RPS15 (CYTOSOLIC RIBOSOMAL PROTEIN S15); structural constituent of ribosome RPS12.5 0.04AT2G31490 unknown protein 2.5 0.01AT3G48680 GAMMA CAL2 (GAMMA CARBONIC ANHYDRASE-‐LIKE 2); transferase2.5 0.05AT5G58630 unknown protein 2.5 0.00AT3G15352 ATCOX17; copper chaperone 2.5 0.03AT3G52590 UBQ1 (UBIQUITIN EXTENSION PROTEIN 1); protein binding / structural constituent o2.5 0.01AT1G29970 RPL18AA (60S RIBOSOMAL PROTEIN L18A-‐1) RPL18AA (60S RIBOSOMAL PROTEIN L18A-‐1) RP2.5 0.04AT4G02580 NADH-‐ubiquinone oxidoreductase 24 kDa subunit, putative2.5 0.04AT3G13310 DNAJ heat shock N-‐terminal domain-‐containing protein 2.5 0.00AT1G27820 CCR4-‐NOT transcription complex protein, putative 2.5 0.03AT3G23290 LSH4 (LIGHT SENSITIVE HYPOCOTYLS 4) 2.5 0.00AT5G65110 ACX2 (ACYL-‐COA OXIDASE 2); acyl-‐CoA oxidase ACX2 (ACYL-‐COA OXIDASE 2); acyl-‐CoA 2.5 0.05AT3G11810 unknown protein 2.5 0.01AT2G21870 unknown protein unknown protein 2.5 0.04AT5G08670 ATP binding / hydrogen ion transporting ATP synthase, rotational mechanism2.4 0.05AT3G58170 BS14A (BET1P/SFT1P-‐LIKE PROTEIN 14A); SNAP receptor/ protein transporter2.4 0.02AT5G10860 CBS domain-‐containing protein 2.4 0.04AT3G62400 unknown protein unknown protein 2.4 0.00AT2G37410 ATTIM17-‐2; P-‐P-‐bond-‐hydrolysis-‐driven protein transmembrane transporter/ protein2.4 0.05AT5G57060 unknown protein unknown protein 2.4 0.00AT5G49500 signal recognition particle 54 kDa protein 2 / SRP54 (SRP-‐54B)2.4 0.01AT1G31550 GDSL-‐motif lipase, putative GDSL-‐motif lipase, putative 2.4 0.00AT3G53430 60S ribosomal protein L12 (RPL12B) 2.4 0.04AT3G52430 PAD4 (PHYTOALEXIN DEFICIENT 4); lipase/ protein binding / triacylglycerol lipase2.4 0.05AT4G22820 zinc finger (AN1-‐like) family protein zinc finger (AN1-‐like) family protein2.4 0.02AT4G27090 60S ribosomal protein L14 (RPL14B) 2.4 0.02AT3G55770 LIM domain-‐containing protein LIM domain-‐containing protein LIM domain-‐containin2.4 0.02AT2G28430 unknown protein 2.4 0.03AT4G25030 unknown protein unknown protein 2.4 0.04AT2G23810 TET8 (TETRASPANIN8) 2.4 0.04

AT2G43000 anac042 (Arabidopsis NAC domain containing protein 42); transcription factor2.4 0.01AT5G52470 FIB1 (FIBRILLARIN 1); snoRNA binding FIB1 (FIBRILLARIN 1); snoRNA binding2.4 0.04AT3G09680 40S ribosomal protein S23 (RPS23A) 2.4 0.02AT1G78210 hydrolase, alpha/beta fold family protein 2.4 0.01AT5G58350 WNK4 (WITH NO K (=LYSINE) 4); kinase/ protein kinase 2.4 0.02AT4G39200 40S ribosomal protein S25 (RPS25E) 40S ribosomal protein S25 (RPS25E)2.4 0.03AT5G14040 mitochondrial phosphate transporter 2.4 0.02AT5G14030 translocon-‐associated protein beta (TRAPB) family protein translocon-‐associated 2.4 0.04AT5G45775 60S ribosomal protein L11 (RPL11D) 60S ribosomal protein L11 (RPL11D)2.4 0.00AT5G42030 ABIL4 (ABL INTERACTOR-‐LIKE PROTEIN 4) 2.4 0.00AT4G03020 transducin family protein / WD-‐40 repeat family protein 2.4 0.02AT4G20330 transcription initiation factor-‐related 2.4 0.03AT2G26780 binding 2.4 0.04AT3G12490 cysteine protease inhibitor, putative / cystatin, putative cysteine protease inh2.4 0.00AT5G54160 ATOMT1 (O-‐METHYLTRANSFERASE 1); caffeate O-‐methyltransferase/ myricetin 3'-‐O-‐met2.4 0.01AT4G16720 60S ribosomal protein L15 (RPL15A) 2.4 0.05AT3G47833 unknown protein 2.4 0.05AT2G40205 60S ribosomal protein L41 (RPL41C) 2.4 0.01AT4G29390 40S ribosomal protein S30 (RPS30B) 2.3 0.02AT5G03345 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow2.3 0.00AT4G24690 ubiquitin-‐associated (UBA)/TS-‐N domain-‐containing protein / octicosapeptide/Phox2.3 0.00AT5G16880 VHS domain-‐containing protein / GAT domain-‐containing protein VHS domain-‐contain2.3 0.02AT3G21430 DNA binding 2.3 0.02AT2G01490 phytanoyl-‐CoA dioxygenase (PhyH) family protein 2.3 0.02AT3G17810 dihydroorotate dehydrogenase family protein / dihydroorotate oxidase family prot2.3 0.00AT4G15470 EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS 2.3 0.00AT5G16070 chaperonin, putative 2.3 0.00AT5G43440 2-‐oxoglutarate-‐dependent dioxygenase, putative 2-‐oxoglutarate-‐dependent dioxygen2.3 0.04AT1G73030 VPS46.2 2.3 0.01AT5G20230 ATBCB (ARABIDOPSIS BLUE-‐COPPER-‐BINDING PROTEIN); copper ion binding / electron c2.3 0.03AT1G78280 transferase, transferring glycosyl groups 2.3 0.00AT5G07470 PMSR3 (PEPTIDEMETHIONINE SULFOXIDE REDUCTASE 3); oxidoreductase, acting on sulfu2.3 0.04AT5G62440 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development, re2.3 0.05AT2G17380 AP19; protein binding / protein transporter 2.3 0.02AT3G15590 DNA-‐binding protein, putative 2.3 0.03AT2G19710 unknown protein 2.3 0.04AT3G11010 AtRLP34 (Receptor Like Protein 34); kinase/ protein binding2.3 0.03AT5G41560 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow2.3 0.00AT2G01540 C2 domain-‐containing protein 2.3 0.02AT1G03330 small nuclear ribonucleoprotein D, putative / snRNP core SM-‐like protein, putati2.3 0.03AT4G37830 cytochrome c oxidase-‐related cytochrome c oxidase-‐related2.3 0.01AT1G48140 dolichol-‐phosphate mannosyltransferase-‐related 2.3 0.02AT1G75510 transcription initiation factor IIF beta subunit (TFIIF-‐beta) family protein2.3 0.05AT4G35360 pantothenate kinase family protein 2.3 0.03AT3G23280 zinc finger (C3HC4-‐type RING finger) family protein / ankyrin repeat family prot2.3 0.01AT2G28720 histone H2B, putative 2.3 0.05AT5G61970 signal recognition particle-‐related / SRP-‐related 2.3 0.00

AT1G50120 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow2.3 0.04AT1G09690 60S ribosomal protein L21 (RPL21C) 2.3 0.03AT4G28260 unknown protein unknown protein 2.3 0.04AT2G29070 ubiquitin fusion degradation UFD1 family protein ubiquitin fusion degradation UF2.2 0.00AT1G56070 LOS1; copper ion binding / translation elongation factor/ translation factor, nu2.2 0.01AT2G46400 WRKY46; transcription factor 2.2 0.04AT4G23140 CRK6 (CYSTEINE-‐RICH RLK 6); kinase CRK6 (CYSTEINE-‐RICH RLK 6); kinase2.2 0.01AT1G27000 bZIP family transcription factor 2.2 0.01AT5G18380 40S ribosomal protein S16 (RPS16C) 40S ribosomal protein S16 (RPS16C)2.2 0.01AT2G38280 FAC1 (EMBRYONIC FACTOR1); AMP deaminase FAC1 (EMBRYONIC FACTOR1); AMP deaminase2.2 0.00AT3G55970 oxidoreductase, 2OG-‐Fe(II) oxygenase family protein 2.2 0.02AT1G78620 integral membrane family protein integral membrane family protein2.2 0.05AT1G78460 SOUL heme-‐binding family protein 2.2 0.01AT4G31170 protein kinase family protein protein kinase family protein protein kinase famil2.2 0.00AT1G32920 unknown protein 2.2 0.04AT2G28860 CYP710A4 (cytochrome P450, family 710, subfamily A, polypeptide 4); electron car2.2 0.02AT4G39100 SHL1 (short life); transcription factor/ zinc-‐mediated transcriptional activator2.2 0.02AT1G78420 protein binding / zinc ion binding 2.2 0.01AT3G02070 OTU-‐like cysteine protease family protein 2.2 0.01AT3G60340 palmitoyl protein thioesterase family protein palmitoyl protein thioesterase fam2.2 0.02AT2G15230 ATLIP1 (Arabidopsis thaliana lipase 1); galactolipase/ hydrolase/ phospholipase/2.2 0.01AT3G03890 FMN binding FMN binding 2.2 0.01AT2G36880 MAT3 (methionine adenosyltransferase 3); copper ion binding / methionine adenosy2.2 0.00AT4G10480 nascent polypeptide associated complex alpha chain protein, putative / alpha-‐NAC2.2 0.01AT1G60870 MEE9 (maternal effect embryo arrest 9) 2.2 0.01ATMG01270 encodes a mitochondrial ribosomal protein S7 2.2 0.01AT3G06310 NADH-‐ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein NADH-‐ubiqu2.2 0.01AT2G17130 IDH2 (ISOCITRATE DEHYDROGENASE SUBUNIT 2); isocitrate dehydrogenase (NAD+)/ oxid2.2 0.00AT5G32440 LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 152.2 0.03AT5G02450 60S ribosomal protein L36 (RPL36C) 2.2 0.02AT4G24450 PWD (PHOSPHOGLUCAN, WATER DIKINASE); ATP binding / kinase2.2 0.02AT4G28770 FUNCTIONS IN: molecular_function unknown; LOCATED IN: plasma membrane, vacuole, 2.2 0.00AT1G31812 ACBP6 (acyl-‐CoA-‐binding protein 6); acyl-‐CoA binding / phosphatidylcholine bindi2.2 0.04AT1G69270 RPK1 (RECEPTOR-‐LIKE PROTEIN KINASE 1); kinase/ protein binding / receptor signal2.2 0.02AT2G32970 unknown protein 2.2 0.00AT1G55920 ATSERAT2;1 (SERINE ACETYLTRANSFERASE 2;1); serine O-‐acetyltransferase2.2 0.04AT1G76520 auxin efflux carrier family protein auxin efflux carrier family protein2.1 0.03AT3G03790 ankyrin repeat family protein / regulator of chromosome condensation (RCC1) fami2.1 0.00AT5G63670 SPT42 (SPT4 HOMOLOG 2); positive transcription elongation factor/ zinc ion bindi2.1 0.01AT2G25000 WRKY60; transcription factor 2.1 0.00AT3G60640 ATG8G (AUTOPHAGY 8G); microtubule binding 2.1 0.02AT1G36640 unknown protein 2.1 0.04AT5G11110 ATSPS2F (SUCROSE PHOSPHATE SYNTHASE 2F); sucrose-‐phosphate synthase2.1 0.00AT1G50940 ETFALPHA (electron transfer flavoprotein alpha); FAD binding / electron carrier2.1 0.01AT2G01180 ATPAP1 (PHOSPHATIDIC ACID PHOSPHATASE 1); phosphatidate phosphatase ATPAP1 (PHOS2.1 0.02AT1G42990 ATBZIP60 (BASIC REGION/LEUCINE ZIPPER MOTIF 60); DNA binding / transcription fac2.1 0.01AT1G52300 60S ribosomal protein L37 (RPL37B) 2.1 0.04

AT3G59060 PIL6 (PHYTOCHROME INTERACTING FACTOR 3-‐LIKE 6); DNA binding / transcription fact2.1 0.02AT1G04810 26S proteasome regulatory subunit, putative 2.1 0.00AT1G67970 AT-‐HSFA8; DNA binding / transcription factor 2.1 0.04AT5G10170 MIPS3 (MYO-‐INOSITOL-‐1-‐PHOSTPATE SYNTHASE 3); binding / catalytic/ inositol-‐3-‐pho2.1 0.00AT3G43740 leucine-‐rich repeat family protein leucine-‐rich repeat family protein2.1 0.00AT5G04930 ALA1 (aminophospholipid ATPase1); ATPase, coupled to transmembrane movement of i2.1 0.00AT3G05500 rubber elongation factor (REF) family protein 2.1 0.01AT1G80940 unknown protein unknown protein 2.1 0.00AT3G27210 unknown protein 2.1 0.00AT3G46620 zinc finger (C3HC4-‐type RING finger) family protein 2.1 0.01AT3G05590 RPL18 (RIBOSOMAL PROTEIN L18); structural constituent of ribosome2.1 0.01AT1G63880 disease resistance protein (TIR-‐NBS-‐LRR class), putative 2.1 0.03AT5G33390 glycine-‐rich protein 2.1 0.01AT5G27170 unknown protein 2.1 0.01AT1G72450 JAZ6 (JASMONATE-‐ZIM-‐DOMAIN PROTEIN 6) 2.1 0.00AT5G55920 nucleolar protein, putative 2.1 0.00AT2G05840 PAA2 (20S PROTEASOME SUBUNIT PAA2); endopeptidase/ peptidase/ threonine-‐type end2.1 0.04AT3G12390 nascent polypeptide associated complex alpha chain protein, putative / alpha-‐NAC2.0 0.02AT4G27880 seven in absentia (SINA) family protein 2.0 0.04AT4G32150 ATVAMP711 (ARABIDOPSIS THALIANA VESICLE-‐ASSOCIATED MEMBRANE PROTEIN 711)2.0 0.04AT3G22630 PBD1 (20S PROTEASOME BETA SUBUNIT D1); peptidase/ threonine-‐type endopeptidase2.0 0.04AT5G01650 macrophage migration inhibitory factor family protein / MIF family protein macro2.0 0.02AT3G53500 zinc knuckle (CCHC-‐type) family protein zinc knuckle (CCHC-‐type) family protein2.0 0.01AT4G27270 quinone reductase family protein 2.0 0.03AT1G14980 CPN10 (CHAPERONIN 10); chaperone binding 2.0 0.05AT1G22780 PFL (POINTED FIRST LEAVES); RNA binding / nucleic acid binding / structural cons2.0 0.01AT2G47790 transducin family protein / WD-‐40 repeat family protein 2.0 0.03AT2G28080 glycosyltransferase family protein 2.0 0.00AT5G08520 myb family transcription factor 2.0 0.01AT5G03350 legume lectin family protein 2.0 0.02AT3G22320 NRPB5; DNA binding / DNA-‐directed RNA polymerase 2.0 0.03AT3G19640 magnesium transporter CorA-‐like family protein (MRS2-‐3) 2.0 0.03AT1G56280 ATDI19 2.0 0.04AT1G60970 clathrin adaptor complex small chain family protein 2.0 0.02AT2G47240 long-‐chain-‐fatty-‐acid-‐-‐CoA ligase family protein / long-‐chain acyl-‐CoA synthetas2.0 0.02AT5G42270 VAR1 (VARIEGATED 1); ATP-‐dependent peptidase/ ATPase/ metallopeptidase2.0 0.04AT3G49720 unknown protein unknown protein 2.0 0.01AT2G41530 SFGH (S-‐FORMYLGLUTATHIONE HYDROLASE); S-‐formylglutathione hydrolase/ hydrolase, 2.0 0.04AT3G04680 CLPS3 (CLP-‐SIMILAR PROTEIN 3); binding CLPS3 (CLP-‐SIMILAR PROTEIN 3); binding2.0 0.00AT3G04780 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: cell redox homeostasis; L2.0 0.03AT5G14800 P5CR (PYRROLINE-‐5-‐ CARBOXYLATE (P5C) REDUCTASE); pyrroline-‐5-‐carboxylate reducta2.0 0.04AT2G28120 nodulin family protein 2.0 0.01no_match no_match 0.5 0.02AT4G00370 ANTR2; inorganic phosphate transmembrane transporter/ organic anion transmembran0.5 0.04AT5G47840 AMK2 (Adenosine monophosphate kinase); ATP binding / adenylate kinase/ nucleobas0.5 0.03AT5G56010 HSP81-‐3; ATP binding / unfolded protein binding 0.5 0.01AT4G20450 leucine-‐rich repeat protein kinase, putative 0.5 0.02

AT3G59970 MTHFR1 (METHYLENETETRAHYDROFOLATE REDUCTASE 1); methylenetetrahydrofolate reduct0.5 0.01AT2G38350 unknown protein 0.5 0.02AT1G72390 unknown protein 0.5 0.01AT3G51360 aspartyl protease family protein 0.5 0.00AT1G33000 transposable element gene 0.5 0.00AT1G54180 BRX-‐LIKE3 (BREVIS RADIX-‐LIKE 3) BRX-‐LIKE3 (BREVIS RADIX-‐LIKE 3)0.5 0.03AT3G03230 esterase/lipase/thioesterase family protein 0.5 0.01AT5G28140 transposable element gene 0.5 0.00AT3G22770 F-‐box family protein-‐related 0.5 0.04AT5G51480 SKS2 (SKU5 SIMILAR 2); copper ion binding / oxidoreductase0.5 0.01AT4G23890 unknown protein 0.5 0.02AT4G30440 GAE1 (UDP-‐D-‐GLUCURONATE 4-‐EPIMERASE 1); UDP-‐glucuronate 4-‐epimerase/ catalytic0.5 0.02no_match no_match 0.5 0.02AT3G07660 unknown protein 0.5 0.02AT2G42770 peroxisomal membrane 22 kDa family protein 0.5 0.01AT3G13980 unknown protein 0.5 0.04AT4G12040 zinc finger (AN1-‐like) family protein zinc finger (AN1-‐like) family protein0.5 0.04AT2G24780 unknown protein 0.5 0.02AT1G14420 AT59; lyase/ pectate lyase 0.5 0.01AT3G33064 transposable element gene 0.5 0.04AT3G06780 glycine-‐rich protein 0.5 0.00AT1G65350 UBQ13; protein binding 0.5 0.01AT5G15180 peroxidase, putative 0.5 0.04AT1G65330 PHE1 (PHERES1); DNA binding / transcription factor 0.5 0.04no_match no_match 0.5 0.03AT3G17170 RFC3 (REGULATOR OF FATTY-‐ACID COMPOSITION 3); structural constituent of ribosome0.5 0.01AT5G54270 LHCB3 (LIGHT-‐HARVESTING CHLOROPHYLL B-‐BINDING PROTEIN 3); structural molecule0.5 0.03AT1G04150 C2 domain-‐containing protein 0.5 0.01AT1G02530 PGP12 (P-‐GLYCOPROTEIN 12); ATPase, coupled to transmembrane movement of substanc0.5 0.00AT1G36550 transposable element gene 0.5 0.01AT4G33900 kelch repeat-‐containing F-‐box family protein 0.5 0.04AT5G17480 APC1 (ARABIDOPSIS POLLEN CALCIUM-‐BINDING PROTEIN 1); calcium ion binding0.5 0.00AT3G63410 APG1 (ALBINO OR PALE GREEN MUTANT 1); 2-‐methyl-‐6-‐phytyl-‐1,4-‐benzoquinone methylt0.5 0.04AT1G22590 MADS-‐box family protein MADS-‐box family protein 0.5 0.00AT5G12150 pleckstrin homology (PH) domain-‐containing protein / RhoGAP domain-‐containing pr0.5 0.01AT4G01050 hydroxyproline-‐rich glycoprotein family protein 0.5 0.00AT5G23660 MTN3 (Arabidopsis homolog of Medicago truncatula MTN3)0.5 0.00AT4G14210 PDS3 (PHYTOENE DESATURASE 3); phytoene dehydrogenase PDS3 (PHYTOENE DESATURASE 30.5 0.03AT5G04810 pentatricopeptide (PPR) repeat-‐containing protein 0.5 0.02AT5G50960 NBP35 (NUCLEOTIDE BINDING PROTEIN 35); iron-‐sulfur cluster binding / nucleotide 0.5 0.02AT5G25050 integral membrane transporter family protein 0.5 0.01AT2G04039 unknown protein unknown protein unknown protein 0.5 0.03AT4G09930 avirulence-‐responsive family protein / avirulence induced gene (AIG1) family pro0.5 0.02AT3G63490 ribosomal protein L1 family protein ribosomal protein L1 family protein0.5 0.05AT5G51270 protein kinase family protein 0.5 0.00AT4G35950 ARAC6 (ARABIDOPSIS RAC-‐LIKE 6); GTP binding 0.5 0.03AT2G43500 RWP-‐RK domain-‐containing protein RWP-‐RK domain-‐containing protein0.5 0.00

AT1G56300 DNAJ heat shock N-‐terminal domain-‐containing protein 0.5 0.00AT2G25150 transferase family protein 0.5 0.04AT3G47340 ASN1 (GLUTAMINE-‐DEPENDENT ASPARAGINE SYNTHASE 1); asparagine synthase (glutamine0.5 0.01AT5G07260 homeobox protein-‐related 0.5 0.01AT1G50560 CYP705A25; electron carrier/ heme binding / iron ion binding / monooxygenase/ ox0.5 0.03ATCG01020 RIBOSOMAL PROTEIN L32 (RPL32); FUNCTIONS IN: structural constituent of ribosome;0.5 0.02AT4G37450 AGP18 (ARABINOGALACTAN PROTEIN 18) 0.5 0.04AT5G01530 chlorophyll A-‐B binding protein CP29 (LHCB4) 0.5 0.02AT2G27680 aldo/keto reductase family protein 0.5 0.02AT5G06340 ATNUDX27 (ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 27); bis(5'-‐adenosyl)-‐pen0.5 0.03AT1G76190 auxin-‐responsive family protein 0.5 0.01AT4G08140 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow0.5 0.02AT3G14300 ATPMEPCRC; pectinesterase 0.5 0.01AT5G39700 MYB89 (myb domain protein 89); DNA binding / transcription factor0.5 0.01AT5G13140 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow0.5 0.00AT1G67310 calmodulin binding / transcription regulator 0.5 0.03AT3G01580 pentatricopeptide (PPR) repeat-‐containing protein 0.5 0.05AT1G77820 transposable element gene 0.5 0.03AT4G03280 PETC (PHOTOSYNTHETIC ELECTRON TRANSFER C); electron transporter, transferring el0.5 0.04AT5G35130 transposable element gene 0.5 0.05AT3G08940 LHCB4.2 (light harvesting complex PSII); chlorophyll binding LHCB4.2 (light harv0.5 0.03AT5G58310 MES18 (METHYL ESTERASE 18); hydrolase/ hydrolase, acting on ester bonds / methyl0.5 0.00AT3G46330 MEE39 (maternal effect embryo arrest 39); kinase 0.5 0.04AT3G25855 unknown protein 0.5 0.04AT3G52960 peroxiredoxin type 2, putative 0.5 0.02AT2G38620 CDKB1;2 (cyclin-‐dependent kinase B1;2); cyclin binding / kinase/ protein serine/0.5 0.01AT2G18700 ATTPS11; transferase, transferring glycosyl groups 0.5 0.04AT3G09820 ADK1 (adenosine kinase 1); adenosine kinase/ copper ion binding ADK1 (adenosine 0.5 0.04AT2G10650 transposable element gene 0.5 0.01AT1G23420 INO (INNER NO OUTER); protein binding / transcription factor0.5 0.01AT3G21070 NADK1 (NAD KINASE 1); NAD+ kinase/ NADH kinase/ calmodulin binding NADK1 (NAD KI0.5 0.00AT1G34530 transposable element gene 0.5 0.01AT1G27120 galactosyltransferase family protein 0.5 0.02AT2G11590 transposable element gene 0.5 0.03AT3G50820 PSBO2 (PHOTOSYSTEM II SUBUNIT O-‐2); oxygen evolving/ poly(U) binding0.5 0.03AT3G16040 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow0.5 0.00AT1G70470 unknown protein 0.5 0.04AT4G07540 transposable element gene 0.5 0.01AT3G16770 ATEBP (ETHYLENE-‐RESPONSIVE ELEMENT BINDING PROTEIN); DNA binding / protein bindi0.5 0.00AT2G21380 kinesin motor protein-‐related 0.5 0.03AT2G30950 VAR2 (VARIEGATED 2); ATP-‐dependent peptidase/ ATPase/ metallopeptidase/ zinc ion0.5 0.00AT5G40930 TOM20-‐4 (TRANSLOCASE OF OUTER MEMBRANE 20-‐4); P-‐P-‐bond-‐hydrolysis-‐driven protein0.5 0.03AT2G43200 dehydration-‐responsive family protein 0.5 0.04AT5G38030 MATE efflux family protein 0.5 0.04AT5G28550 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow0.5 0.01AT3G03170 unknown protein 0.5 0.02AT5G62140 unknown protein 0.5 0.01

AT5G51600 PLE (PLEIADE); microtubule binding 0.5 0.05AT3G43130 transposable element gene 0.5 0.01AT2G17450 RHA3A; protein binding / zinc ion binding 0.5 0.02AT4G34970 ADF9 (ACTIN DEPOLYMERIZING FACTOR 9); actin binding 0.5 0.00AT5G06400 pentatricopeptide (PPR) repeat-‐containing protein 0.5 0.00AT4G14360 dehydration-‐responsive protein-‐related dehydration-‐responsive protein-‐related0.5 0.04AT1G45100 polyadenylate-‐binding protein, putative / PABP, putative 0.4 0.01AT1G79790 haloacid dehalogenase-‐like hydrolase family protein haloacid dehalogenase-‐like h0.4 0.04AT3G14000 ATBRXL2 ATBRXL2 0.4 0.03AT2G36250 FTSZ2-‐1; protein binding / structural molecule FTSZ2-‐1; protein binding / struct0.4 0.02AT1G74880 NDH-‐O (NAD(P)H:plastoquinone dehydrogenase complex subunit O)0.4 0.00AT1G73470 unknown protein unknown protein 0.4 0.04AT2G45770 CPFTSY; 7S RNA binding / GTP binding / nucleoside-‐triphosphatase/ nucleotide bin0.4 0.04AT3G23330 pentatricopeptide (PPR) repeat-‐containing protein 0.4 0.01AT5G48140 polygalacturonase, putative / pectinase, putative 0.4 0.00AT4G08685 SAH7 0.4 0.03AT2G05960 transposable element gene 0.4 0.04AT3G16090 zinc finger (C3HC4-‐type RING finger) family protein 0.4 0.04AT4G25950 VATG3 (vacuolar ATP synthase G3); hydrolase, acting on acid anhydrides, catalyzi0.4 0.02AT5G25130 CYP71B12; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxy0.4 0.05AT3G05030 NHX2 (SODIUM HYDROGEN EXCHANGER 2); sodium ion transmembrane transporter/ sodium0.4 0.03AT4G17540 unknown protein 0.4 0.01AT1G67580 protein kinase family protein protein kinase family protein 0.4 0.03AT5G65685 soluble glycogen synthase-‐related 0.4 0.01AT5G51650 unknown protein 0.4 0.03AT1G07150 MAPKKK13; ATP binding / kinase/ protein kinase/ protein serine/threonine kinase0.4 0.01AT1G32030 DNA binding 0.4 0.04AT3G49050 lipase class 3 family protein / calmodulin-‐binding heat-‐shock protein, putative0.4 0.03AT4G12330 CYP706A7; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxy0.4 0.01AT1G08520 CHLD; ATP binding / magnesium chelatase/ nucleoside-‐triphosphatase/ nucleotide b0.4 0.01AT3G44210 unknown protein 0.4 0.00AT5G14270 ATBET9 (Arabidopsis thaliana Bromodomain and Extraterminal Domain protein 9); DN0.4 0.03AT2G11270 citrate synthase-‐related 0.4 0.01AT3G55040 GSTL2 0.4 0.00AT5G56780 unknown protein 0.4 0.01AT3G28360 PGP16 (P-‐GLYCOPROTEIN 16); ATPase, coupled to transmembrane movement of substanc0.4 0.01AT3G01140 MYB106 (myb domain protein 106); DNA binding / transcription factor0.4 0.01AT1G16080 unknown protein 0.4 0.01AT1G14150 oxygen evolving enhancer 3 (PsbQ) family protein oxygen evolving enhancer 3 (Psb0.4 0.00AT4G35560 FUNCTIONS IN: molecular_function unknown; LOCATED IN: CUL4 RING ubiquitin ligase0.4 0.02AT2G24790 COL3 (CONSTANS-‐LIKE 3); protein binding / transcription factor/ zinc ion binding0.4 0.00AT3G46020 RNA-‐binding protein, putative 0.4 0.05AT1G09950 transcription factor-‐related 0.4 0.04AT5G37990 S-‐adenosylmethionine-‐dependent methyltransferase/ methyltransferase0.4 0.01AT4G18240 ATSS4; transferase, transferring glycosyl groups 0.4 0.03AT1G15820 LHCB6 (LIGHT HARVESTING COMPLEX PSII SUBUNIT 6); chlorophyll binding0.4 0.01AT5G40360 MYB115 (myb domain protein 115); DNA binding / transcription factor0.4 0.02

AT3G56880 VQ motif-‐containing protein 0.4 0.03AT3G04450 transcription factor 0.4 0.04AT5G58470 TAF15b (TBP-‐ASSOCIATED FACTOR 15b); binding / nucleic acid binding / nucleotide 0.4 0.01AT1G26850 dehydration-‐responsive family protein dehydration-‐responsive family protein dehy0.4 0.01AT5G15960 KIN1 0.4 0.01AT5G38140 NF-‐YC12 (NUCLEAR FACTOR Y, SUBUNIT C12); DNA binding / transcription factor0.4 0.00AT5G46710 zinc-‐binding family protein 0.4 0.04AT5G51110 4-‐alpha-‐hydroxytetrahydrobiopterin dehydratase 0.4 0.02AT5G51550 EXL3 (EXORDIUM LIKE 3) 0.4 0.00AT1G76880 trihelix DNA-‐binding protein, putative 0.4 0.02AT3G44960 unknown protein 0.4 0.03AT2G25620 protein phosphatase 2C, putative / PP2C, putative 0.4 0.04AT1G56410 ERD2 (EARLY-‐RESPONSIVE TO DEHYDRATION 2); ATP binding0.4 0.04AT1G75860 unknown protein 0.4 0.04AT5G52920 PKP-‐BETA1 (PLASTIDIC PYRUVATE KINASE BETA SUBUNIT 1); pyruvate kinase0.4 0.05ATCG00280 PSBC; FUNCTIONS IN: chlorophyll binding; INVOLVED IN: photosynthesis, light reac0.4 0.01AT4G01830 PGP5 (P-‐GLYCOPROTEIN 5); ATPase, coupled to transmembrane movement of substances0.4 0.02AT5G18590 kelch repeat-‐containing protein kelch repeat-‐containing protein0.4 0.01AT5G03920 unknown protein 0.4 0.00AT4G15560 CLA1 (CLOROPLASTOS ALTERADOS 1); 1-‐deoxy-‐D-‐xylulose-‐5-‐phosphate synthase0.4 0.03ATCG00820 RIBOSOMAL PROTEIN S19 (RPS19); FUNCTIONS IN: structural constituent of ribosome;0.4 0.00AT3G05900 neurofilament protein-‐related 0.4 0.00AT2G38140 PSRP4 (PLASTID-‐SPECIFIC RIBOSOMAL PROTEIN 4); structural constituent of ribosome0.4 0.03AT4G24930 thylakoid lumenal 17.9 kDa protein, chloroplast 0.4 0.01AT3G02890 PHD finger protein-‐related 0.4 0.00AT1G08540 SIG2 (RNA POLYMERASE SIGMA SUBUNIT 2); DNA binding / DNA-‐directed RNA polymerase0.4 0.04AT1G61450 unknown protein 0.4 0.00AT4G12830 hydrolase, alpha/beta fold family protein 0.4 0.03AT1G64510 ribosomal protein S6 family protein 0.4 0.00AT1G75350 emb2184 (embryo defective 2184); structural constituent of ribosome0.4 0.02AT3G59400 GUN4; enzyme binding / tetrapyrrole binding 0.4 0.03AT2G35880 FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXP0.4 0.05AT1G50620 PHD finger family protein 0.4 0.01AT1G11160 nucleotide binding 0.4 0.01AT5G04140 GLU1 (GLUTAMATE SYNTHASE 1); glutamate synthase (ferredoxin) GLU1 (GLUTAMATE SYN0.4 0.02AT2G40760 rhodanese-‐like domain-‐containing protein 0.4 0.05AT1G29910 CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3); chlorophyll binding0.4 0.00AT3G50685 unknown protein 0.4 0.00AT5G03000 kelch repeat-‐containing F-‐box family protein 0.4 0.01AT5G48880 PKT2 (PEROXISOMAL 3-‐KETO-‐ACYL-‐COA THIOLASE 2); acetyl-‐CoA C-‐acyltransferase/ cat0.4 0.04AT1G32830 transposable element gene 0.4 0.01AT5G16200 50S ribosomal protein-‐related 0.4 0.02AT5G58200 unknown protein 0.4 0.01AT2G17260 GLR2 (GLUTAMATE RECEPTOR 2); intracellular ligand-‐gated ion channel0.4 0.01AT2G47280 pectinesterase 0.4 0.00AT4G07790 transposable element gene 0.4 0.05AT4G31780 MGD1 (MONOGALACTOSYL DIACYLGLYCEROL SYNTHASE 1); 1,2-‐diacylglycerol 3-‐beta-‐galac0.4 0.02

AT4G39420 unknown protein unknown protein 0.4 0.02AT1G75080 BZR1 (BRASSINAZOLE-‐RESISTANT 1); DNA binding / transcription regulator/ transcri0.4 0.02no_match no_match 0.4 0.00AT5G08590 SNRK2.1 (SNF1-‐RELATED PROTEIN KINASE 2.1); kinase/ protein kinase0.4 0.02ATCG00130 ATPF; FUNCTIONS IN: hydrogen ion transporting ATP synthase activity, rotational 0.4 0.03AT4G16155 dihydrolipoyl dehydrogenase 0.4 0.04AT1G13560 AAPT1 (AMINOALCOHOLPHOSPHOTRANSFERASE 1); phosphatidyltransferase/ phosphotransf0.4 0.03AT4G27600 pfkB-‐type carbohydrate kinase family protein 0.4 0.01AT5G14970 unknown protein 0.4 0.01AT1G03600 photosystem II family protein 0.4 0.01AT4G02790 GTP-‐binding family protein 0.4 0.01AT3G60020 ASK5 (ARABIDOPSIS SKP1-‐LIKE 5); protein binding / ubiquitin-‐protein ligase0.4 0.02AT3G51820 G4; chlorophyll synthetase 0.4 0.00AT4G02920 unknown protein unknown protein 0.4 0.04AT3G63160 unknown protein 0.4 0.01AT5G65790 MYB68 (MYB DOMAIN PROTEIN 68); DNA binding / transcription factor0.4 0.00AT1G60550 ECHID (ENOYL-‐COA HYDRATASE/ISOMERASE D); catalytic/ naphthoate synthase0.4 0.02AT1G50900 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow0.4 0.01AT2G01280 MEE65 (maternal effect embryo arrest 65); RNA polymerase II transcription factor0.4 0.04AT1G08980 AMI1 (AMIDASE 1); amidase/ hydrolase, acting on carbon-‐nitrogen (but not peptide0.4 0.02AT4G25480 DREB1A (DEHYDRATION RESPONSE ELEMENT B1A); DNA binding / transcription activator0.4 0.03AT5G57340 unknown protein unknown protein 0.4 0.01AT2G29180 unknown protein 0.4 0.05AT5G66570 PSBO1 (PS II OXYGEN-‐EVOLVING COMPLEX 1); oxygen evolving/ poly(U) binding0.4 0.00ATCG01080 NDHG; FUNCTIONS IN: NADPH dehydrogenase activity; INVOLVED IN: photosynthesis; L0.4 0.05AT2G28900 ATOEP16-‐1 (OUTER PLASTID ENVELOPE PROTEIN 16-‐1); P-‐P-‐bond-‐hydrolysis-‐driven prot0.4 0.02AT3G61870 unknown protein unknown protein 0.4 0.03AT5G12950 catalytic 0.4 0.05AT4G22890 PGR5-‐LIKE A PGR5-‐LIKE A PGR5-‐LIKE A PGR5-‐LIKE A PGR5-‐LIKE A0.4 0.04AT1G55370 carbohydrate binding / catalytic carbohydrate binding / catalytic0.4 0.05AT2G35570 pseudogene, serpin (serine protease inhibitor) family, similar to phloem serpin-‐0.4 0.01AT1G01120 KCS1 (3-‐KETOACYL-‐COA SYNTHASE 1); acyltransferase/ fatty acid elongase0.4 0.04AT5G20470 myosin, putative 0.4 0.02AT5G66190 FNR1 (FERREDOXIN-‐NADP(+)-‐OXIDOREDUCTASE 1); NADPH dehydrogenase/ electron transp0.4 0.00AT3G50060 MYB77; DNA binding / transcription factor 0.4 0.02AT1G54040 ESP (EPITHIOSPECIFIER PROTEIN); enzyme regulator ESP (EPITHIOSPECIFIER PROTEIN);0.4 0.05ATCG00840 One of two chloroplast genes that encode chloroplast ribosomal protein0.4 0.01AT3G60750 transketolase, putative 0.4 0.04AT5G24490 30S ribosomal protein, putative 0.4 0.03AT5G37050 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow0.4 0.01AT1G49230 zinc finger (C3HC4-‐type RING finger) family protein 0.4 0.01ATCG00870 hypothetical protein 0.4 0.01AT1G30520 AAE14 (Acyl-‐Activating Enzyme 14); AMP binding / o-‐succinylbenzoate-‐CoA ligase0.3 0.01AT5G42650 AOS (ALLENE OXIDE SYNTHASE); allene oxide synthase/ hydro-‐lyase/ oxygen binding0.3 0.00AT3G13270 transposable element gene 0.3 0.02AT1G72860 disease resistance protein (TIR-‐NBS-‐LRR class), putative 0.3 0.00AT1G56650 PAP1 (PRODUCTION OF ANTHOCYANIN PIGMENT 1); DNA binding / transcription factor0.3 0.00

AT5G13120 peptidyl-‐prolyl cis-‐trans isomerase cyclophilin-‐type family protein0.3 0.03AT2G29670 binding 0.3 0.03AT5G17710 EMB1241 (embryo defective 1241); adenyl-‐nucleotide exchange factor/ chaperone bi0.3 0.01AT3G24430 HCF101 (HIGH-‐CHLOROPHYLL-‐FLUORESCENCE 101); ATP binding0.3 0.02AT5G66100 La domain-‐containing protein 0.3 0.03AT3G23630 ATIPT7; ATP binding / tRNA isopentenyltransferase/ transferase, transferring alk0.3 0.03AT5G64860 DPE1 (DISPROPORTIONATING ENZYME); 4-‐alpha-‐glucanotransferase/ catalytic/ cation 0.3 0.01AT3G15520 peptidyl-‐prolyl cis-‐trans isomerase TLP38, chloroplast / thylakoid lumen PPIase 0.3 0.03AT5G65010 ASN2 (ASPARAGINE SYNTHETASE 2); asparagine synthase (glutamine-‐hydrolyzing) ASN20.3 0.04AT4G03690 transposable element gene 0.3 0.00AT2G25800 INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPR0.3 0.00AT3G56910 PSRP5 (PLASTID-‐SPECIFIC 50S RIBOSOMAL PROTEIN 5) 0.3 0.00AT3G17130 invertase/pectin methylesterase inhibitor family protein 0.3 0.00AT1G07320 RPL4; poly(U) binding / structural constituent of ribosome RPL4; poly(U) binding0.3 0.01AT5G15600 SP1L4 (SPIRAL1-‐LIKE4) 0.3 0.04AT1G03630 POR C (PROTOCHLOROPHYLLIDE OXIDOREDUCTASE); NADPH dehydrogenase/ oxidoreductase/0.3 0.04AT4G32340 EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arab0.3 0.01AT1G05190 emb2394 (embryo defective 2394); structural constituent of ribosome0.3 0.02AT3G13900 ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism0.3 0.02AT5G44500 small nuclear ribonucleoprotein associated protein B, putative / snRNP-‐B, putati0.3 0.00AT1G67740 PSBY 0.3 0.03ATCG00420 NADH DEHYDROGENASE SUBUNIT J (NDHJ); FUNCTIONS IN: NADH dehydrogenase (ubiquinon0.3 0.04AT2G36910 ABCB1 (ATP BINDING CASSETTE SUBFAMILY B1); ATPase, coupled to transmembrane move0.3 0.01AT2G35650 ATCSLA07 (CELLULOSE SYNTHASE LIKE); mannan synthase/ transferase, transferring g0.3 0.01AT2G30600 BTB/POZ domain-‐containing protein BTB/POZ domain-‐containing protein BTB/POZ doma0.3 0.01AT2G39820 eukaryotic translation initiation factor 6, putative / eIF-‐6, putative0.3 0.00AT1G74970 RPS9 (RIBOSOMAL PROTEIN S9); structural constituent of ribosome0.3 0.03AT1G56500 haloacid dehalogenase-‐like hydrolase family protein 0.3 0.03AT3G54210 ribosomal protein L17 family protein 0.3 0.01AT1G56190 phosphoglycerate kinase, putative phosphoglycerate kinase, putative0.3 0.00AT1G44575 NPQ4 (NONPHOTOCHEMICAL QUENCHING); chlorophyll binding / xanthophyll binding NPQ0.3 0.01AT1G06680 PSBP-‐1 (PHOTOSYSTEM II SUBUNIT P-‐1); poly(U) binding PSBP-‐1 (PHOTOSYSTEM II SUBU0.3 0.04AT3G53800 armadillo/beta-‐catenin repeat family protein 0.3 0.00AT1G42970 GAPB (GLYCERALDEHYDE-‐3-‐PHOSPHATE DEHYDROGENASE B SUBUNIT); glyceraldehyde-‐3-‐phos0.3 0.03AT5G48770 disease resistance protein (TIR-‐NBS-‐LRR class), putative 0.3 0.00ATCG00040 MATURASE K (MATK); FUNCTIONS IN: RNA binding, RNA-‐directed DNA polymerase activi0.3 0.01AT2G47510 FUM1 (FUMARASE 1); catalytic/ fumarate hydratase FUM1 (FUMARASE 1); catalytic/ f0.3 0.03AT5G55220 trigger factor type chaperone family protein 0.3 0.02AT5G40850 UPM1 (UROPHORPHYRIN METHYLASE 1); uroporphyrin-‐III C-‐methyltransferase0.3 0.04AT1G43590 transposable element gene 0.3 0.00AT1G35680 50S ribosomal protein L21, chloroplast / CL21 (RPL21) 0.3 0.01AT5G14650 polygalacturonase, putative / pectinase, putative 0.3 0.00AT3G08920 rhodanese-‐like domain-‐containing protein 0.3 0.03AT2G46910 plastid-‐lipid associated protein PAP / fibrillin family protein 0.3 0.00AT4G03430 EMB2770 (EMBRYO DEFECTIVE 2770); RNA splicing factor, transesterification mechan0.3 0.02AT3G19480 D-‐3-‐phosphoglycerate dehydrogenase, putative / 3-‐PGDH, putative0.3 0.01AT5G17670 hydrolase, acting on ester bonds 0.3 0.01

AT5G35170 adenylate kinase family protein adenylate kinase family protein0.3 0.03AT1G18060 unknown protein 0.3 0.04AT1G64720 CP5 0.3 0.02AT1G13650 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow0.3 0.01AT5G55180 glycosyl hydrolase family 17 protein glycosyl hydrolase family 17 protein0.3 0.03AT5G14910 heavy-‐metal-‐associated domain-‐containing protein 0.3 0.00AT3G27160 GHS1 (GLUCOSE HYPERSENSITIVE 1); structural constituent of ribosome0.3 0.00AT1G21500 unknown protein 0.3 0.02AT1G27510 INVOLVED IN: response to singlet oxygen; LOCATED IN: thylakoid membrane; EXPRESS0.3 0.00AT4G24750 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow0.3 0.00AT1G14345 oxidoreductase 0.3 0.04AT1G74730 unknown protein 0.3 0.01ATCG00330 chloroplast ribosomal protein S14 (RPS14); FUNCTIONS IN: structural constituent 0.3 0.04AT2G36200 kinesin motor protein-‐related 0.3 0.00ATCG01230 chloroplast gene encoding ribosomal protein s12 0.3 0.02AT3G55800 SBPASE (sedoheptulose-‐bisphosphatase); phosphoric ester hydrolase/ sedoheptulose0.3 0.00AT3G52380 CP33; RNA binding 0.3 0.04AT1G10180 unknown protein 0.3 0.04AT5G54600 50S ribosomal protein L24, chloroplast (CL24) 50S ribosomal protein L24, chloro0.3 0.01AT4G30950 FAD6 (FATTY ACID DESATURASE 6); omega-‐6 fatty acid desaturase0.3 0.00AT2G47910 CRR6 (chlororespiratory reduction 6) CRR6 (chlororespiratory reduction 6)0.3 0.02AT3G01480 CYP38 (cyclophilin 38); peptidyl-‐prolyl cis-‐trans isomerase CYP38 (cyclophilin 30.3 0.00AT5G49030 OVA2 (ovule abortion 2); ATP binding / aminoacyl-‐tRNA ligase/ catalytic/ isoleuc0.3 0.01AT2G21170 TIM (TRIOSEPHOSPHATE ISOMERASE); catalytic/ triose-‐phosphate isomerase TIM (TRIO0.3 0.02AT1G11860 aminomethyltransferase, putative aminomethyltransferase, putative0.3 0.01AT1G24090 RNase H domain-‐containing protein 0.3 0.04AT2G46340 SPA1 (SUPPRESSOR OF PHYA-‐105 1); protein binding / signal transducer0.3 0.00AT1G35420 dienelactone hydrolase family protein 0.3 0.03AT2G46820 PSI-‐P (PHOTOSYSTEM I P SUBUNIT); DNA binding PSI-‐P (PHOTOSYSTEM I P SUBUNIT); DN0.3 0.01AT2G21280 SULA; binding / catalytic/ coenzyme binding 0.3 0.01AT4G24770 RBP31 (31-‐KDA RNA BINDING PROTEIN); RNA binding / poly(U) binding0.3 0.00AT5G57650 eukaryotic translation initiation factor-‐related 0.3 0.00AT1G66860 hydrolase 0.3 0.00AT2G21330 fructose-‐bisphosphate aldolase, putative fructose-‐bisphosphate aldolase, putativ0.3 0.03AT2G34560 katanin, putative katanin, putative 0.3 0.03AT5G36170 HCF109 (HIGH CHLOROPHYLL FLUORESCENT 109); translation release factor/ translati0.3 0.04AT3G10940 protein phosphatase-‐related 0.3 0.02AT3G48560 CSR1 (CHLORSULFURON/IMIDAZOLINONE RESISTANT 1); acetolactate synthase/ pyruvate 0.3 0.03AT5G65220 ribosomal protein L29 family protein 0.3 0.01AT2G24060 translation initiation factor 3 (IF-‐3) family protein 0.3 0.01AT4G31800 WRKY18; transcription factor WRKY18; transcription factor 0.3 0.00AT2G18560 UDP-‐glucoronosyl/UDP-‐glucosyl transferase family protein 0.3 0.00AT1G67700 unknown protein unknown protein 0.3 0.01AT4G12410 auxin-‐responsive family protein 0.3 0.01ATCG00430 PSBG; FUNCTIONS IN: 4 iron, 4 sulfur cluster binding, NADH dehydrogenase (ubiqui0.3 0.04AT5G63330 DNA-‐binding bromodomain-‐containing protein 0.3 0.00AT5G19940 plastid-‐lipid associated protein PAP-‐related / fibrillin-‐related plastid-‐lipid a0.3 0.02

AT2G23340 AP2 domain-‐containing transcription factor, putative 0.3 0.01AT3G47860 apolipoprotein D-‐related 0.3 0.00ATCG00650 RIBOSOMAL PROTEIN S18 (RPS18); FUNCTIONS IN: structural constituent of ribosome;0.3 0.04AT5G35360 CAC2; acetyl-‐CoA carboxylase/ biotin carboxylase CAC2; acetyl-‐CoA carboxylase/ b0.3 0.02AT4G34090 unknown protein unknown protein 0.3 0.05AT5G63060 transporter 0.3 0.03AT1G51080 unknown protein 0.3 0.01AT1G48450 unknown protein unknown protein 0.3 0.02AT1G58290 HEMA1; glutamyl-‐tRNA reductase 0.3 0.00AT4G00310 EDA8 (EMBRYO SAC DEVELOPMENT ARREST 8) EDA8 (EMBRYO SAC DEVELOPMENT ARREST 8)0.3 0.00AT3G51510 unknown protein 0.3 0.04AT5G04970 pectinesterase, putative 0.3 0.01ATCG01070 NDHE; FUNCTIONS IN: NADPH dehydrogenase activity; INVOLVED IN: ubiquinone biosyn0.3 0.00AT3G11170 FAD7 (FATTY ACID DESATURASE 7); omega-‐3 fatty acid desaturase0.3 0.00AT5G11420 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow0.3 0.04ATCG01060 PSAC; FUNCTIONS IN: electron carrier activity, iron-‐sulfur cluster binding; INVO0.3 0.02AT1G13830 beta-‐1,3-‐glucanase-‐related 0.3 0.02ATCG00780 RIBOSOMAL PROTEIN L14 (RPL14); FUNCTIONS IN: structural constituent of ribosome;0.3 0.02AT2G30600 BTB/POZ domain-‐containing protein BTB/POZ domain-‐containing protein BTB/POZ doma0.3 0.04AT2G21385 unknown protein unknown protein 0.3 0.05AT1G75680 AtGH9B7 (Arabidopsis thaliana glycosyl hydrolase 9B7); catalytic/ hydrolase, hyd0.3 0.00ATCG00065 RIBOSOMAL PROTEIN S12A (RPS12A); FUNCTIONS IN: structural constituent of ribosom0.3 0.00AT3G29185 unknown protein unknown protein 0.3 0.04AT1G73060 unknown protein 0.3 0.00AT1G20450 ERD10 (EARLY RESPONSIVE TO DEHYDRATION 10); actin binding ERD10 (EARLY RESPONSIV0.3 0.04AT1G64020 serpin-‐related / serine protease inhibitor-‐related 0.3 0.00AT1G70370 BURP domain-‐containing protein / polygalacturonase, putative0.3 0.00AT1G07370 PCNA1 (PROLIFERATING CELLULAR NUCLEAR ANTIGEN); DNA binding / DNA polymerase pro0.3 0.03AT5G53580 aldo/keto reductase family protein 0.2 0.03AT4G23820 glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family pro0.2 0.03AT4G34260 FUC95A; 1,2-‐alpha-‐L-‐fucosidase 0.2 0.03AT1G69523 UbiE/COQ5 methyltransferase family protein 0.2 0.02AT5G47190 ribosomal protein L19 family protein 0.2 0.00AT4G09650 ATPD (ATP SYNTHASE DELTA-‐SUBUNIT GENE); hydrogen ion transporting ATP synthase, 0.2 0.04AT5G62670 AHA11 (Arabidopsis H(+)-‐ATPase 11); ATPase 0.2 0.02AT3G61060 AtPP2-‐A13 (Arabidopsis thaliana phloem protein 2-‐A13); carbohydrate binding AtPP0.2 0.00AT2G42380 bZIP transcription factor family protein bZIP transcription factor family protei0.2 0.00ATCG01120 chloroplast chloroplast ribosomal protein S15 (RPS15); FUNCTIONS IN: structural 0.2 0.01ATCG00360 YCF3; FUNCTIONS IN: unfolded protein binding; INVOLVED IN: photosystem I assembl0.2 0.01AT1G71500 Rieske (2Fe-‐2S) domain-‐containing protein 0.2 0.01AT3G11630 2-‐cys peroxiredoxin, chloroplast (BAS1) 0.2 0.05AT4G29770 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow0.2 0.02AT1G11720 ATSS3 (starch synthase 3); starch synthase/ transferase, transferring glycosyl g0.2 0.00AT3G28860 ABCB19; ATPase, coupled to transmembrane movement of substances / auxin efflux t0.2 0.01AT1G26270 phosphatidylinositol 3-‐ and 4-‐kinase family protein 0.2 0.02AT5G08650 GTP-‐binding protein LepA, putative 0.2 0.02AT3G23050 IAA7 (INDOLE-‐3-‐ACETIC ACID 7); transcription factor IAA7 (INDOLE-‐3-‐ACETIC ACID 70.2 0.03

AT4G25670 unknown protein 0.2 0.03AT4G09010 APX4 (ASCORBATE PEROXIDASE 4); heme binding / peroxidase0.2 0.00AT3G06750 hydroxyproline-‐rich glycoprotein family protein 0.2 0.00AT5G58870 ftsh9 (FtsH protease 9); ATP-‐dependent peptidase/ ATPase/ metallopeptidase0.2 0.01AT1G57770 amine oxidase family 0.2 0.03AT2G33800 ribosomal protein S5 family protein 0.2 0.04AT5G28430 transposable element gene 0.2 0.00AT4G27350 unknown protein 0.2 0.02AT3G23700 S1 RNA-‐binding domain-‐containing protein 0.2 0.01AT5G45680 FK506-‐binding protein 1 (FKBP13) 0.2 0.02AT4G29060 emb2726 (embryo defective 2726); RNA binding / translation elongation factor emb0.2 0.02AT3G62700 ATMRP10; ATPase, coupled to transmembrane movement of substances0.2 0.03AT1G29070 ribosomal protein L34 family protein 0.2 0.01AT4G27030 small conjugating protein ligase 0.2 0.00AT3G62910 APG3 (ALBINO AND PALE GREEN); translation release factor/ translation release fa0.2 0.00AT3G26950 unknown protein 0.2 0.00AT5G50740 metal ion binding metal ion binding metal ion binding 0.2 0.02AT2G05920 subtilase family protein 0.2 0.02ATCG00170 RPOC2; FUNCTIONS IN: DNA-‐directed RNA polymerase activity; INVOLVED IN: RNA elon0.2 0.04AT1G15980 NDF1 (NDH-‐DEPENDENT CYCLIC ELECTRON FLOW 1) 0.2 0.01AT2G12400 unknown protein 0.2 0.05AT1G51110 plastid-‐lipid associated protein PAP / fibrillin family protein 0.2 0.01ATCG00860 unknown protein 0.2 0.04AT4G24510 CER2 (ECERIFERUM 2); transferase/ transferase, transferring acyl groups other th0.2 0.01AT3G25660 glutamyl-‐tRNA(Gln) amidotransferase, putative 0.2 0.04ATCG00800 RESISTANCE TO PSEUDOMONAS SYRINGAE 3 (RPS3); FUNCTIONS IN: structural constituen0.2 0.00AT1G04420 aldo/keto reductase family protein 0.2 0.02AT4G17600 LIL3:1; transcription factor 0.2 0.04AT1G55490 CPN60B (CHAPERONIN 60 BETA); ATP binding / protein binding CPN60B (CHAPERONIN 600.2 0.04AT3G01210 nucleic acid binding / oxidoreductase 0.2 0.00AT5G43750 unknown protein 0.2 0.03AT5G64740 CESA6 (CELLULOSE SYNTHASE 6); cellulose synthase/ transferase, transferring glyc0.2 0.01AT4G33905 peroxisomal membrane protein 22 kDa, putative 0.2 0.01AT5G14660 PDF1B (PEPTIDE DEFORMYLASE 1B); iron ion binding / peptide deformylase PDF1B (PE0.2 0.02AT5G44020 acid phosphatase class B family protein 0.2 0.04AT1G01090 PDH-‐E1 ALPHA (PYRUVATE DEHYDROGENASE E1 ALPHA); pyruvate dehydrogenase (acetyl-‐t0.2 0.02AT2G40400 unknown protein unknown protein 0.2 0.02AT5G65630 GTE7 (Global transcription factor group E 7); DNA binding 0.2 0.01AT3G08740 elongation factor P (EF-‐P) family protein 0.2 0.05AT5G03940 CPSRP54 (CHLOROPLAST SIGNAL RECOGNITION PARTICLE 54 KDA SUBUNIT); 7S RNA binding0.2 0.01AT4G37550 formamidase, putative / formamide amidohydrolase, putative formamidase, putative0.2 0.01ATCG00710 PSBH; FUNCTIONS IN: phosphate binding; INVOLVED IN: photosynthesis, light harves0.2 0.02AT5G23120 HCF136; protein binding 0.2 0.00AT4G23060 IQD22 (IQ-‐domain 22); calmodulin binding 0.2 0.01no_match no_match 0.2 0.04AT1G69526 UbiE/COQ5 methyltransferase family protein UbiE/COQ5 methyltransferase family pr0.2 0.04AT1G18730 NDF6 (NDH DEPENDENT FLOW 6) NDF6 (NDH DEPENDENT FLOW 6) NDF6 (NDH DEPENDENT FLOW0.2 0.01

AT2G34680 AIR9; protein binding 0.2 0.01AT1G65390 ATPP2-‐A5 (ARABIDOPSIS THALIANA PHLOEM PROTEIN 2 A5); carbohydrate binding ATPP2-‐0.2 0.00AT4G24340 phosphorylase family protein 0.2 0.04AT4G30690 translation initiation factor 3 (IF-‐3) family protein 0.2 0.02AT1G12900 GAPA-‐2 (GLYCERALDEHYDE 3-‐PHOSPHATE DEHYDROGENASE A SUBUNIT 2); NAD or NADH bindi0.2 0.00AT3G61080 fructosamine kinase family protein 0.2 0.03AT5G64230 unknown protein 0.2 0.00AT3G12780 PGK1 (PHOSPHOGLYCERATE KINASE 1); phosphoglycerate kinase0.2 0.03AT2G46900 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow0.2 0.03AT1G79500 2-‐dehydro-‐3-‐deoxyphosphooctonate aldolase / phospho-‐2-‐dehydro-‐3-‐deoxyoctonate al0.2 0.00AT3G63140 CSP41A (CHLOROPLAST STEM-‐LOOP BINDING PROTEIN OF 41 KDA); mRNA binding / poly(U)0.2 0.04AT1G01790 KEA1 (K EFFLUX ANTIPORTER 1); potassium ion transmembrane transporter/ potassium0.2 0.00AT1G08550 NPQ1 (NON-‐PHOTOCHEMICAL QUENCHING 1); violaxanthin de-‐epoxidase NPQ1 (NON-‐PHOTOC0.2 0.02AT1G77490 TAPX (THYLAKOIDAL ASCORBATE PEROXIDASE); L-‐ascorbate peroxidase0.2 0.00AT2G43030 ribosomal protein L3 family protein 0.2 0.04ATCG00520 YCF4; FUNCTIONS IN: unfolded protein binding; INVOLVED IN: photosystem I assembl0.2 0.05ATCG00770 RIBOSOMAL PROTEIN S8 (RPS8); FUNCTIONS IN: structural constituent of ribosome; I0.2 0.01AT1G10370 ERD9 (EARLY-‐RESPONSIVE TO DEHYDRATION 9); glutathione transferase0.2 0.01AT5G51720 unknown protein 0.2 0.01AT5G01920 STN8; kinase/ protein kinase 0.2 0.00AT3G25920 RPL15; structural constituent of ribosome 0.2 0.01AT4G12970 unknown protein 0.2 0.01ATCG01110 NAD(P)H DEHYDROGENASE SUBUNIT H (NDHH); FUNCTIONS IN: NADPH dehydrogenase activi0.2 0.01AT5G63310 NDPK2 (NUCLEOSIDE DIPHOSPHATE KINASE 2); ATP binding / nucleoside diphosphate ki0.2 0.00AT5G44520 ribose 5-‐phosphate isomerase-‐related 0.2 0.00AT2G42220 rhodanese-‐like domain-‐containing protein 0.2 0.00AT1G20440 COR47 (COLD-‐REGULATED 47) 0.2 0.04AT4G35250 vestitone reductase-‐related 0.2 0.00AT1G32080 membrane protein, putative 0.1 0.04AT4G39970 haloacid dehalogenase-‐like hydrolase family protein 0.1 0.05AT3G16250 NDF4 (NDH-‐DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-‐sulfur clust0.1 0.04AT3G54050 fructose-‐1,6-‐bisphosphatase, putative / D-‐fructose-‐1,6-‐bisphosphate 1-‐phosphohyd0.1 0.01ATCG00050 RIBOSOMAL PROTEIN S16 (RPS16); FUNCTIONS IN: structural constituent of ribosome;0.1 0.02AT1G15410 aspartate-‐glutamate racemase family 0.1 0.00AT2G34620 mitochondrial transcription termination factor-‐related / mTERF-‐related0.1 0.01AT4G25080 CHLM (magnesium-‐protoporphyrin IX methyltransferase); magnesium protoporphyrin I0.1 0.01ATCG00160 RIBOSOMAL PROTEIN S2 (RPS2); FUNCTIONS IN: structural constituent of ribosome; I0.1 0.04ATCG00790 RIBOSOMAL PROTEIN L16 (RPL16); FUNCTIONS IN: structural constituent of ribosome;0.1 0.01AT1G20010 TUB5; structural constituent of cytoskeleton 0.1 0.02AT1G19150 LHCA6; chlorophyll binding 0.1 0.00AT1G74470 geranylgeranyl reductase 0.1 0.01AT5G04610 spermidine synthase-‐related / putrescine aminopropyltransferase-‐related0.1 0.01AT3G26710 CCB1 (COFACTOR ASSEMBLY OF COMPLEX C) 0.1 0.05AT1G73920 lipase family protein lipase family protein 0.1 0.01AT3G46780 PTAC16 (PLASTID TRANSCRIPTIONALLY ACTIVE 16); binding / catalytic0.1 0.01AT3G10720 pectinesterase, putative pectinesterase, putative 0.1 0.01AT4G39890 AtRABH1c (Arabidopsis Rab GTPase homolog H1c); GTP binding / protein binding0.1 0.02

AT4G36010 pathogenesis-‐related thaumatin family protein pathogenesis-‐related thaumatin fam0.1 0.01AT3G19820 DWF1 (DWARF 1); calmodulin binding / catalytic DWF1 (DWARF 1); calmodulin bindin0.1 0.01AT5G52310 LTI78 (LOW-‐TEMPERATURE-‐INDUCED 78) 0.1 0.03AT3G01500 CA1 (CARBONIC ANHYDRASE 1); carbonate dehydratase/ zinc ion binding CA1 (CARBONI0.1 0.03ATCG00810 RIBOSOMAL PROTEIN L22 (RPL22); FUNCTIONS IN: structural constituent of ribosome;0.1 0.04AT2G18710 SCY1 (SecY Homolog 1); P-‐P-‐bond-‐hydrolysis-‐driven protein transmembrane transpor0.1 0.02AT5G64460 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow0.1 0.02AT5G62360 invertase/pectin methylesterase inhibitor family protein 0.1 0.01AT3G63350 AT-‐HSFA7B; DNA binding / transcription factor 0.1 0.05AT5G18660 PCB2 (PALE-‐GREEN AND CHLOROPHYLL B REDUCED 2); 3,8-‐divinyl protochlorophyllide a0.1 0.02AT5G58090 glycosyl hydrolase family 17 protein 0.1 0.03AT5G09870 CESA5 (CELLULOSE SYNTHASE 5); cellulose synthase/ transferase, transferring glyc0.1 0.01AT4G31290 ChaC-‐like family protein 0.1 0.01AT4G26530 fructose-‐bisphosphate aldolase, putative fructose-‐bisphosphate aldolase, putativ0.1 0.00AT2G10940 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein prot0.1 0.00AT3G19270 CYP707A4; (+)-‐abscisic acid 8'-‐hydroxylase/ oxygen binding 0.1 0.00AT1G09750 chloroplast nucleoid DNA-‐binding protein-‐related 0.1 0.00AT1G29395 COR414-‐TM1 0.1 0.01AT5G60790 ATGCN1; transporter 0.1 0.00AT2G42270 U5 small nuclear ribonucleoprotein helicase, putative 0.1 0.04AT1G01620 PIP1C (PLASMA MEMBRANE INTRINSIC PROTEIN 1C); water channel PIP1C (PLASMA MEMBRA0.1 0.01AT1G10170 ATNFXL1 (ARABIDOPSIS THALIANA NF-‐X-‐LIKE 1); protein binding / transcription fact0.1 0.00AT2G29290 tropinone reductase, putative / tropine dehydrogenase, putative tropinone reduct0.1 0.00AT3G27690 LHCB2.3; chlorophyll binding 0.1 0.00AT5G01015 unknown protein 0.1 0.01AT2G38540 LP1; calmodulin binding 0.1 0.04AT2G05790 glycosyl hydrolase family 17 protein 0.1 0.00AT4G04840 methionine sulfoxide reductase domain-‐containing protein / SeIR domain-‐containin0.0 0.01AT5G48490 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein0.0 0.01AT3G16240 DELTA-‐TIP; ammonia transporter/ methylammonium transmembrane transporter/ water 0.0 0.00AT1G12090 ELP (EXTENSIN-‐LIKE PROTEIN); lipid binding 0.0 0.00AT4G18280 glycine-‐rich cell wall protein-‐related 0.0 0.00AT4G24960 ATHVA22D ATHVA22D 0.0 0.00

Locus Gene description (TAIR9 update-June 09) LEAF I/UI ratio p-value

AT2G23170 GH3.3; indole-3-acetic acid amido synthetase 126.8 0.00


AT2G30770 CYP71A13 (cytochrome P450, family 71, subfamily A, polypeptide 13); indoleacetal54.0 0.02

AT4G23700 ATCHX17 (CATION/H+ EXCHANGER 17); monovalent cation:proton antiporter/ sodium:hy48.8 0.01

AT1G51890 leucine-rich repeat protein kinase, putative 43.1 0.00

AT1G21240 WAK3 (wall associated kinase 3); kinase/ protein serine/threonine kinase39.9 0.00

AT2G29460 ATGSTU4 (ARABIDOPSIS THALIANA GLUTATHIONE S-TRANSFERASE TAU 4); glutathione tran37.4 0.03


AT3G26830 PAD3 (PHYTOALEXIN DEFICIENT 3); dihydrocamalexic acid decarboxylase/ monooxygena32.5 0.01

AT4G04490 protein kinase family protein 32.1 0.01

AT3G54700 carbohydrate transmembrane transporter/ phosphate transmembrane transporter/ sug31.7 0.04


AT1G26420 FAD-binding domain-containing protein 27.2 0.00

AT5G64000 SAL2; 3'(2'),5'-bisphosphate nucleotidase/ inositol or phosphatidylinositol phos25.9 0.00

AT1G33030 O-methyltransferase family 2 protein 24.9 0.02

AT3G22600 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein22.9 0.01

AT3G47420 glycerol-3-phosphate transporter, putative / glycerol 3-phosphate permease, puta22.7 0.04

AT4G29520 LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 23 plant struc22.3 0.01

AT5G52740 heavy-metal-associated domain-containing protein 22.3 0.01

AT4G21830 methionine sulfoxide reductase domain-containing protein / SeIR domain-containin22.2 0.01

AT5G46050 PTR3 (PEPTIDE TRANSPORTER 3); dipeptide transporter/ transporter/ tripeptide tra21.5 0.00


AT2G18660 EXLB3 (EXPANSIN-LIKE B3 PRECURSOR) 20.0 0.01


AT1G26380 FAD-binding domain-containing protein 19.7 0.02

AT3G45290 MLO3 (MILDEW RESISTANCE LOCUS O 3); calmodulin binding 19.0 0.01

AT2G30750 CYP71A12 (cytochrome P450, family 71, subfamily A, polypeptide 12); electron car18.9 0.02

AT3G09940 MDHAR (MONODEHYDROASCORBATE REDUCTASE); monodehydroascorbate reductase (NADH) MD18.8 0.01

SI Table S2B. Whole leaf genes with PM-altered expression at 5 dpi. Genes with ! 2-fold change in

expression and p " 0.05 were selelcted using one-way analysis of variance. Selected genes also

exhibited a false discovery rate (q-value) <5%.

AT5G65600 legume lectin family protein / protein kinase family protein 18.5 0.01AT4G21850 methionine sulfoxide reductase domain-‐containing protein / SeIR domain-‐containin18.1 0.00AT3G51860 CAX3 (CATION EXCHANGER 3); calcium:cation antiporter/ calcium:hydrogen antiporte17.8 0.00AT1G79680 wall-‐associated kinase, putative 17.7 0.01AT2G43570 chitinase, putative 16.7 0.01AT1G14870 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative str16.3 0.01AT1G09080 BIP3; ATP binding 16.2 0.00AT4G11890 protein kinase family protein protein kinase family protein protein kinase famil15.9 0.00AT4G00700 C2 domain-‐containing protein 15.9 0.00AT4G12290 amine oxidase/ copper ion binding / quinone binding 15.5 0.00AT1G56600 AtGolS2 (Arabidopsis thaliana galactinol synthase 2); transferase, transferring 14.9 0.02AT4G10500 oxidoreductase, 2OG-‐Fe(II) oxygenase family protein 14.5 0.01AT1G76960 unknown protein 14.5 0.02AT1G04980 ATPDIL2-‐2 (PDI-‐LIKE 2-‐2); protein disulfide isomerase 14.4 0.00AT2G13810 ALD1 (AGD2-‐LIKE DEFENSE RESPONSE PROTEIN1); catalytic/ pyridoxal phosphate bindi13.8 0.01AT4G38540 monooxygenase, putative (MO2) 13.4 0.02AT1G26390 FAD-‐binding domain-‐containing protein 13.4 0.00AT1G19250 FMO1 (FLAVIN-‐DEPENDENT MONOOXYGENASE 1); FAD binding / NADP or NADPH binding / e13.1 0.03AT5G38900 DSBA oxidoreductase family protein 13.0 0.04AT1G66960 lupeol synthase, putative / 2,3-‐oxidosqualene-‐triterpenoid cyclase, putative12.6 0.02AT4G34131 UGT73B3 (UDP-‐glucosyl transferase 73B3); UDP-‐glycosyltransferase/ abscisic acid 12.3 0.02AT5G11920 AtcwINV6 (6-‐&1-‐fructan exohydrolase); hydrolase, hydrolyzing O-‐glycosyl compound12.0 0.00AT1G55210 disease resistance response 12.0 0.00AT2G38860 YLS5 YLS5 YLS5 11.9 0.00AT2G39220 PLP6 (PATATIN-‐LIKE PROTEIN 6); nutrient reservoir 11.7 0.00AT2G32680 AtRLP23 (Receptor Like Protein 23); kinase/ protein binding11.2 0.00AT1G07090 LSH6 (LIGHT SENSITIVE HYPOCOTYLS 6) 11.2 0.04AT1G74360 leucine-‐rich repeat transmembrane protein kinase, putative10.9 0.00AT2G30140 UDP-‐glucoronosyl/UDP-‐glucosyl transferase family protein UDP-‐glucoronosyl/UDP-‐gl10.5 0.01AT1G77510 ATPDIL1-‐2 (PDI-‐LIKE 1-‐2); protein disulfide isomerase 10.4 0.00AT1G08310 esterase/lipase/thioesterase family protein esterase/lipase/thioesterase family 10.4 0.02AT4G23310 receptor-‐like protein kinase, putative 10.4 0.00AT3G55130 ATWBC19 (White-‐Brown Complex homolog 19); ATPase, coupled to transmembrane movem10.4 0.00AT1G30900 vacuolar sorting receptor, putative 10.4 0.02

AT5G18470 curculin-‐like (mannose-‐binding) lectin family protein 10.3 0.01AT4G28390 AAC3 (ADP/ATP CARRIER 3); ATP:ADP antiporter/ binding 10.3 0.01AT5G47220 ERF2 (ETHYLENE RESPONSIVE ELEMENT BINDING FACTOR 2); DNA binding / transcription10.2 0.01AT4G16260 catalytic/ cation binding / hydrolase, hydrolyzing O-‐glycosyl compounds10.2 0.00AT5G39670 calcium-‐binding EF hand family protein 10.1 0.04AT3G25010 AtRLP41 (Receptor Like Protein 41); kinase/ protein binding10.1 0.00AT1G57630 disease resistance protein (TIR class), putative 9.8 0.01AT5G61790 calnexin 1 (CNX1) 9.8 0.00AT1G17745 PGDH (3-‐PHOSPHOGLYCERATE DEHYDROGENASE); phosphoglycerate dehydrogenase9.8 0.00AT1G05300 ZIP5; cation transmembrane transporter/ metal ion transmembrane transporter ZIP59.7 0.02AT1G13340 unknown protein 9.7 0.02AT4G23140 CRK6 (CYSTEINE-‐RICH RLK 6); kinase CRK6 (CYSTEINE-‐RICH RLK 6); kinase9.4 0.00AT4G36988 CPuORF49 (Conserved peptide upstream open reading frame 49)9.3 0.02AT5G10740 protein phosphatase 2C-‐related / PP2C-‐related 9.3 0.00AT5G13320 PBS3 (AVRPPHB SUSCEPTIBLE 3) 9.2 0.02AT4G18250 receptor serine/threonine kinase, putative 9.2 0.00AT2G01670 atnudt17 (Arabidopsis thaliana Nudix hydrolase homolog 17); hydrolase9.1 0.00AT2G02810 UTR1 (UDP-‐GALACTOSE TRANSPORTER 1); UDP-‐galactose transmembrane transporter/ UDP8.9 0.00AT5G41410 BEL1 (BELL 1); DNA binding / protein binding / transcription factor8.4 0.02AT3G51330 aspartyl protease family protein 8.4 0.01AT1G02930 ATGSTF6 (GLUTATHIONE S-‐TRANSFERASE); copper ion binding / glutathione binding / 8.4 0.01AT1G61800 GPT2; antiporter/ glucose-‐6-‐phosphate transmembrane transporter8.4 0.00AT3G57260 BGL2 (BETA-‐1,3-‐GLUCANASE 2); cellulase/ glucan 1,3-‐beta-‐glucosidase/ hydrolase, 8.2 0.00AT5G42020 BIP2; ATP binding BIP2; ATP binding 8.0 0.00AT5G67340 armadillo/beta-‐catenin repeat family protein / U-‐box domain-‐containing protein7.9 0.00AT3G26210 CYP71B23; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxy7.8 0.00AT2G04450 ATNUDT6 (Arabidopsis thaliana Nudix hydrolase homolog 6); ADP-‐ribose diphosphata7.8 0.01AT1G21120 O-‐methyltransferase, putative 7.8 0.02AT3G60540 sec61beta family protein sec61beta family protein 7.7 0.02AT3G28540 AAA-‐type ATPase family protein AAA-‐type ATPase family protein7.7 0.03AT2G04400 indole-‐3-‐glycerol phosphate synthase (IGPS) 7.6 0.00AT2G29120 ATGLR2.7; intracellular ligand-‐gated ion channel 7.6 0.04AT1G63380 binding / catalytic/ oxidoreductase 7.6 0.01AT3G20250 APUM5 (Arabidopsis Pumilio 5); RNA binding / binding 7.6 0.01

AT3G62600 ATERDJ3B; heat shock protein binding / unfolded protein binding7.5 0.00AT3G44450 unknown protein 7.5 0.04AT3G51660 macrophage migration inhibitory factor family protein / MIF family protein7.4 0.04AT1G75170 SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein7.4 0.01AT1G64400 long-‐chain-‐fatty-‐acid-‐-‐CoA ligase, putative / long-‐chain acyl-‐CoA synthetase, pu7.4 0.01AT1G33960 AIG1 (AVRRPT2-‐INDUCED GENE 1); GTP binding 7.3 0.00AT1G27980 DPL1; carboxy-‐lyase/ catalytic/ pyridoxal phosphate binding 7.3 0.01AT2G47130 short-‐chain dehydrogenase/reductase (SDR) family protein 7.3 0.01AT5G27600 LACS7 (LONG-‐CHAIN ACYL-‐COA SYNTHETASE 7); long-‐chain-‐fatty-‐acid-‐CoA ligase/ prot7.3 0.00AT1G21110 O-‐methyltransferase, putative 7.2 0.00AT2G17290 CPK6 (CALCIUM-‐DEPENDENT PROTEIN KINASE 6); ATP binding / calcium ion binding / c7.2 0.04AT4G35630 PSAT; O-‐phospho-‐L-‐serine:2-‐oxoglutarate aminotransferase 7.2 0.02AT5G25910 AtRLP52 (Receptor Like Protein 52); kinase/ protein binding 7.1 0.01AT2G33480 ANAC041 (Arabidopsis NAC domain containing protein 41); transcription factor ANA7.0 0.05AT5G01540 LECRKA4.1 (LECTIN RECEPTOR KINASE A4.1); kinase 7.0 0.01AT5G37600 ATGSR1; copper ion binding / glutamate-‐ammonia ligase 7.0 0.00AT5G10760 aspartyl protease family protein 6.8 0.01AT4G23810 WRKY53; DNA binding / protein binding / transcription activator/ transcription f6.8 0.00AT3G54150 embryo-‐abundant protein-‐related 6.7 0.02AT1G20350 ATTIM17-‐1; P-‐P-‐bond-‐hydrolysis-‐driven protein transmembrane transporter/ protein6.7 0.00AT2G19190 FRK1 (FLG22-‐INDUCED RECEPTOR-‐LIKE KINASE 1); kinase 6.7 0.02AT1G78410 VQ motif-‐containing protein 6.7 0.04AT5G15860 ATPCME (PRENYLCYSTEINE METHYLESTERASE); prenylcysteine methylesterase ATPCME (PR6.6 0.03AT1G74710 isochorismate synthase 1 (ICS1) / isochorismate mutase isochorismate synthase 1 6.5 0.01AT5G09290 3'(2'),5'-‐bisphosphate nucleotidase, putative / inositol polyphosphate 1-‐phospha6.4 0.01AT1G08050 zinc finger (C3HC4-‐type RING finger) family protein 6.4 0.00AT1G77920 bZIP family transcription factor 6.4 0.04AT5G38250 serine/threonine protein kinase, putative 6.4 0.03AT2G38870 protease inhibitor, putative 6.4 0.03AT1G75040 PR5 (PATHOGENESIS-‐RELATED GENE 5) 6.2 0.01AT1G32940 SBT3.5; identical protein binding / serine-‐type endopeptidase6.2 0.03AT5G17860 CAX7 (calcium exchanger 7); calcium:sodium antiporter/ cation:cation antiporter6.2 0.03AT2G47000 ABCB4 (ATP BINDING CASSETTE SUBFAMILY B4); ATPase, coupled to transmembrane move6.1 0.00AT5G20960 AAO1 (ARABIDOPSIS ALDEHYDE OXIDASE 1); aldehyde oxidase/ indole-‐3-‐acetaldehyde o6.1 0.03

AT2G47800 ATMRP4 (ARABIDOPSIS THALIANA MULTIDRUG RESISTANCE-‐ASSOCIATED PROTEIN 4); ATPase,6.1 0.01AT2G15480 UGT73B5 (UDP-‐glucosyl transferase 73B5); UDP-‐glucosyltransferase/ UDP-‐glycosyltr6.1 0.01AT4G01720 WRKY47; transcription factor 6.0 0.02AT4G24190 SHD (SHEPHERD); ATP binding / unfolded protein binding SHD (SHEPHERD); ATP bindi6.0 0.00AT5G63680 pyruvate kinase, putative 6.0 0.02AT3G26230 CYP71B24; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxy6.0 0.03AT1G67970 AT-‐HSFA8; DNA binding / transcription factor 6.0 0.01AT5G45380 sodium:solute symporter family protein 5.9 0.00AT1G66880 serine/threonine protein kinase family protein 5.9 0.01AT3G50930 BCS1 (CYTOCHROME BC1 SYNTHESIS); ATP binding / ATPase/ nucleoside-‐triphosphatase5.9 0.02AT5G12420 unknown protein 5.9 0.02AT4G13920 AtRLP50 (Receptor Like Protein 50); kinase/ protein binding 5.9 0.03AT3G28580 AAA-‐type ATPase family protein 5.9 0.01AT4G05020 NDB2 (NAD(P)H dehydrogenase B2); FAD binding / disulfide oxidoreductase/ oxidore5.8 0.01AT1G12320 unknown protein 5.7 0.00AT2G18690 unknown protein unknown protein 5.7 0.00AT3G49340 cysteine proteinase, putative 5.6 0.02AT1G25155 anthranilate synthase beta subunit, putative 5.6 0.01AT1G14360 UTR3 (UDP-‐GALACTOSE TRANSPORTER 3); pyrimidine nucleotide sugar transmembrane tr5.6 0.03AT2G04040 TX1; antiporter/ multidrug efflux pump/ multidrug transporter/ transporter5.5 0.04AT3G19510 HAT3.1; DNA binding / sequence-‐specific DNA binding / transcription activator/ t5.5 0.05AT4G04510 protein kinase family protein 5.5 0.00AT1G72280 AERO1 (Arabidopsis endoplasmic reticulum oxidoreductins 1); FAD binding / electr5.5 0.03AT3G54960 ATPDIL1-‐3 (PDI-‐LIKE 1-‐3); protein disulfide isomerase ATPDIL1-‐3 (PDI-‐LIKE 1-‐3); 5.5 0.00AT4G10955 lipase class 3 family protein 5.5 0.01AT3G55950 CCR3 (ARABIDOPSIS THALIANA CRINKLY4 RELATED 3); kinase5.5 0.00AT3G10500 anac053 (Arabidopsis NAC domain containing protein 53); transcription factor5.4 0.01AT1G21750 ATPDIL1-‐1 (PDI-‐LIKE 1-‐1); protein disulfide isomerase ATPDIL1-‐1 (PDI-‐LIKE 1-‐1); 5.4 0.00AT2G26660 SPX2 (SPX DOMAIN GENE 2) 5.4 0.02AT4G15610 integral membrane family protein 5.4 0.02AT1G12290 disease resistance protein (CC-‐NBS-‐LRR class), putative disease resistance prote5.4 0.01AT3G50550 unknown protein unknown protein 5.3 0.02AT4G39270 leucine-‐rich repeat transmembrane protein kinase, putative leucine-‐rich repeat t5.2 0.00AT3G11010 AtRLP34 (Receptor Like Protein 34); kinase/ protein binding 5.2 0.02

AT3G26670 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow5.2 0.00AT5G58940 CRCK1 (CALMODULIN-‐BINDING RECEPTOR-‐LIKE CYTOPLASMIC KINASE 1); ATP binding / kin5.1 0.01AT1G52200 unknown protein 5.1 0.01AT2G29110 ATGLR2.8; intracellular ligand-‐gated ion channel 5.0 0.03AT1G60610 protein binding / zinc ion binding protein binding / zinc ion binding protein bi5.0 0.01AT5G61520 hexose transporter, putative hexose transporter, putative 5.0 0.03AT3G09010 protein kinase family protein 5.0 0.04AT4G16660 heat shock protein 70, putative / HSP70, putative 5.0 0.01AT2G29990 NDA2 (ALTERNATIVE NAD(P)H DEHYDROGENASE 2); FAD binding / NADH dehydrogenase/ ox4.9 0.00AT5G59780 MYB59 (MYB DOMAIN PROTEIN 59); DNA binding / transcription factor MYB59 (MYB DOM4.9 0.05AT1G08450 CRT3 (CALRETICULIN 3); calcium ion binding / unfolded protein binding CRT3 (CALR4.9 0.00AT2G32920 ATPDIL2-‐3 (PDI-‐LIKE 2-‐3); protein disulfide isomerase 4.9 0.02AT4G05390 ATRFNR1 (ROOT FNR 1); FAD binding / NADP or NADPH binding / electron carrier/ fe4.9 0.03AT4G19670 zinc finger (C3HC4-‐type RING finger) family protein zinc finger (C3HC4-‐type RING4.9 0.00AT2G40330 Bet v I allergen family protein 4.9 0.04AT3G54640 TSA1 (TRYPTOPHAN SYNTHASE ALPHA CHAIN); tryptophan synthase4.9 0.01AT5G08240 unknown protein 4.8 0.01AT1G70690 HWI1 (HOPW1-‐1-‐INDUCED GENE1) 4.8 0.00AT5G47370 HAT2; DNA binding / transcription factor/ transcription repressor4.8 0.02AT3G28930 AIG2 (AVRRPT2-‐INDUCED GENE 2) 4.8 0.03AT5G24530 DMR6 (DOWNY MILDEW RESISTANT 6); oxidoreductase/ oxidoreductase, acting on paire4.8 0.00AT1G32900 starch synthase, putative 4.8 0.02AT1G53645 hydroxyproline-‐rich glycoprotein family protein 4.8 0.04AT2G46620 AAA-‐type ATPase family protein 4.8 0.04AT2G47470 UNE5 (UNFERTILIZED EMBRYO SAC 5); protein disulfide isomerase UNE5 (UNFERTILIZED4.7 0.01AT3G52430 PAD4 (PHYTOALEXIN DEFICIENT 4); lipase/ protein binding / triacylglycerol lipase4.7 0.00AT5G53870 plastocyanin-‐like domain-‐containing protein 4.7 0.00AT1G72060 serine-‐type endopeptidase inhibitor 4.7 0.00AT1G13470 unknown protein 4.7 0.04AT1G62840 unknown protein 4.6 0.01AT2G24180 CYP71B6 (CYTOCHROME P450 71B6); electron carrier/ heme binding / iron ion bindin4.6 0.02AT5G10380 RING1; protein binding / ubiquitin-‐protein ligase/ zinc ion binding4.6 0.01AT1G56340 CRT1 (CALRETICULIN 1); calcium ion binding / unfolded protein binding CRT1 (CALR4.6 0.03AT5G07340 calnexin, putative 4.6 0.01

AT3G01830 calmodulin-‐related protein, putative calmodulin-‐related protein, putative4.6 0.02AT3G57240 BG3 (BETA-‐1,3-‐GLUCANASE 3); cellulase/ hydrolase, hydrolyzing O-‐glycosyl compoun4.6 0.01AT1G04770 male sterility MS5 family protein 4.6 0.01AT2G25110 SDF2 (STROMAL CELL-‐DERIVED FACTOR 2-‐LIKE PROTEIN PRECURSOR)4.6 0.00AT1G33390 helicase domain-‐containing protein 4.6 0.00AT5G47580 unknown protein 4.5 0.04AT1G06760 histone H1, putative 4.5 0.03AT4G17720 RNA recognition motif (RRM)-‐containing protein 4.5 0.01AT5G42150 electron carrier/ protein disulfide oxidoreductase 4.5 0.02AT5G61160 AACT1 (anthocyanin 5-‐aromatic acyltransferase 1); transferase/ transferase, tran4.5 0.04AT4G27830 BGLU10 (BETA GLUCOSIDASE 10); catalytic/ cation binding / hydrolase, hydrolyzing4.4 0.04AT1G29310 P-‐P-‐bond-‐hydrolysis-‐driven protein transmembrane transporter4.4 0.00AT1G10410 INVOLVED IN: N-‐terminal protein myristoylation; LOCATED IN: chloroplast; EXPRESS4.4 0.05AT1G28050 zinc finger (B-‐box type) family protein 4.4 0.01AT3G59660 C2 domain-‐containing protein / GRAM domain-‐containing protein4.4 0.01AT1G64710 alcohol dehydrogenase, putative alcohol dehydrogenase, putative4.4 0.00AT4G13810 AtRLP47 (Receptor Like Protein 47); protein binding 4.3 0.00AT4G19810 glycosyl hydrolase family 18 protein 4.3 0.01AT5G12930 unknown protein 4.3 0.00AT5G66640 DAR3 (DA1-‐RELATED PROTEIN 3) 4.3 0.03AT4G10590 ubiquitin carboxyl-‐terminal hydrolase family protein ubiquitin carboxyl-‐terminal4.2 0.04AT1G06000 UDP-‐glucoronosyl/UDP-‐glucosyl transferase family protein 4.2 0.04AT4G21990 APR3 (APS REDUCTASE 3); adenylyl-‐sulfate reductase 4.1 0.05AT5G45800 MEE62 (maternal effect embryo arrest 62); ATP binding / protein binding / protei4.1 0.02AT5G62620 galactosyltransferase family protein galactosyltransferase family protein4.1 0.00AT1G09210 calreticulin 2 (CRT2) 4.1 0.03AT2G04070 antiporter/ drug transporter/ transporter 4.1 0.03AT1G49470 unknown protein 4.1 0.01AT3G13380 BRL3 (BRI1-‐LIKE 3); ATP binding / protein binding / protein kinase/ protein seri4.1 0.00AT3G06450 anion exchange family protein anion exchange family protein4.1 0.00AT1G21100 O-‐methyltransferase, putative 4.0 0.00AT1G56350 peptide chain release factor, putative 4.0 0.01AT1G12200 flavin-‐containing monooxygenase family protein / FMO family protein4.0 0.00AT4G02930 elongation factor Tu, putative / EF-‐Tu, putative 4.0 0.03

AT5G51830 pfkB-‐type carbohydrate kinase family protein 4.0 0.04AT4G25900 aldose 1-‐epimerase family protein 4.0 0.02AT3G13910 unknown protein 4.0 0.01AT1G52880 NAM (NO APICAL MERISTEM); transcription factor 4.0 0.02AT4G20110 vacuolar sorting receptor, putative 3.9 0.00AT3G04350 unknown protein 3.9 0.02AT5G50460 protein transport protein SEC61 gamma subunit, putative 3.9 0.02AT1G48210 serine/threonine protein kinase, putative serine/threonine protein kinase, putat3.8 0.04AT3G13790 ATBFRUCT1; beta-‐fructofuranosidase/ hydrolase, hydrolyzing O-‐glycosyl compounds3.8 0.01AT5G60900 RLK1 (RECEPTOR-‐LIKE PROTEIN KINASE 1); ATP binding / carbohydrate binding / kina3.8 0.03AT5G05730 ASA1 (ANTHRANILATE SYNTHASE ALPHA SUBUNIT 1); anthranilate synthase3.8 0.00AT1G71100 RSW10 (RADIAL SWELLING 10); ribose-‐5-‐phosphate isomerase3.8 0.01AT5G25260 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow3.8 0.00AT5G44240 haloacid dehalogenase-‐like hydrolase family protein 3.8 0.05AT2G32240 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to cadmium ion; 3.8 0.01AT5G20410 MGD2; 1,2-‐diacylglycerol 3-‐beta-‐galactosyltransferase/ UDP-‐galactosyltransferase3.8 0.00AT2G30550 lipase class 3 family protein lipase class 3 family protein 3.7 0.01AT1G13990 unknown protein unknown protein unknown protein 3.7 0.01AT5G64770 unknown protein 3.7 0.04AT3G09440 heat shock cognate 70 kDa protein 3 (HSC70-‐3) (HSP70-‐3) 3.7 0.03AT5G53800 unknown protein 3.7 0.01AT5G52630 MEF1 (MITOCHONDRIAL RNA EDITING FACTOR 1) 3.7 0.05AT1G09740 ethylene-‐responsive protein, putative 3.7 0.03AT2G03120 ATSPP (ARABIDOPSIS SIGNAL PEPTIDE PEPTIDASE); aspartic-‐type endopeptidase3.7 0.01AT4G35180 LHT7 (Lys/His transporter 7); amino acid transmembrane transporter3.7 0.02AT3G26220 CYP71B3; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxyg3.7 0.01AT3G23550 MATE efflux family protein 3.6 0.00AT2G31390 pfkB-‐type carbohydrate kinase family protein 3.6 0.03AT3G63380 calcium-‐transporting ATPase, plasma membrane-‐type, putative / Ca(2+)-‐ATPase, put3.6 0.04AT1G51760 IAR3 (IAA-‐ALANINE RESISTANT 3); IAA-‐Ala conjugate hydrolase/ metallopeptidase3.6 0.01AT3G50910 unknown protein 3.6 0.00AT1G67850 unknown protein unknown protein 3.6 0.03AT4G00500 lipase class 3 family protein / calmodulin-‐binding heat-‐shock protein-‐related li3.6 0.02AT5G17990 TRP1 (tryptophan biosynthesis 1); anthranilate phosphoribosyltransferase3.5 0.00

AT5G19320 RANGAP2 (RAN GTPASE ACTIVATING PROTEIN 2); RAN GTPase activator3.5 0.00AT1G23840 unknown protein 3.5 0.01AT3G25020 AtRLP42 (Receptor Like Protein 42); protein binding 3.5 0.00AT5G52750 heavy-‐metal-‐associated domain-‐containing protein 3.5 0.03AT1G32340 NHL8; protein binding / zinc ion binding 3.5 0.04AT1G05570 CALS1 (CALLOSE SYNTHASE 1); 1,3-‐beta-‐glucan synthase/ transferase, transferring 3.5 0.00AT5G18130 unknown protein unknown protein 3.5 0.02AT5G17380 pyruvate decarboxylase family protein 3.5 0.02AT1G30420 ATMRP12; ATPase, coupled to transmembrane movement of substances3.5 0.04AT5G56010 HSP81-‐3; ATP binding / unfolded protein binding 3.5 0.01AT2G44240 unknown protein 3.5 0.00AT1G35710 leucine-‐rich repeat transmembrane protein kinase, putative 3.4 0.02AT4G04220 AtRLP46 (Receptor Like Protein 46); kinase/ protein binding 3.4 0.01AT4G23300 protein kinase family protein 3.4 0.00AT3G53810 lectin protein kinase, putative 3.4 0.00AT2G17980 ATSLY1; protein transporter 3.4 0.03AT4G17500 ATERF-‐1 (ETHYLENE RESPONSIVE ELEMENT BINDING FACTOR 1); DNA binding / transcript3.4 0.02AT5G22300 NIT4 (NITRILASE 4); 3-‐cyanoalanine hydratase/ cyanoalanine nitrilase/ indole-‐3-‐a3.4 0.01AT3G19260 LOH2 (LAG ONE HOMOLOGUE 2) 3.4 0.02AT1G68740 EXS family protein / ERD1/XPR1/SYG1 family protein 3.4 0.04AT3G45620 transducin family protein / WD-‐40 repeat family protein 3.4 0.03AT3G23000 CIPK7 (CBL-‐INTERACTING PROTEIN KINASE 7); ATP binding / kinase/ protein kinase/ 3.4 0.00AT4G26240 unknown protein 3.4 0.05AT1G24140 matrixin family protein 3.4 0.02AT5G61760 ATIPK2BETA; inositol or phosphatidylinositol kinase/ inositol trisphosphate 6-‐ki3.3 0.05AT2G30870 GSTF10 (HALIANA GLUTATHIONE S-‐TRANSFERASE PHI 10); copper ion binding / glutathi3.3 0.00AT1G52600 signal peptidase, putative 3.3 0.01AT2G40110 yippee family protein yippee family protein 3.3 0.00AT5G25070 unknown protein 3.3 0.05AT3G03470 CYP89A9; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxyg3.3 0.03AT3G06860 MFP2 (MULTIFUNCTIONAL PROTEIN 2); 3-‐hydroxyacyl-‐CoA dehydrogenase/ enoyl-‐CoA hyd3.3 0.00AT5G50200 WR3 (WOUND-‐RESPONSIVE 3); nitrate transmembrane transporter WR3 (WOUND-‐RESPONSIV3.3 0.00AT1G18480 calcineurin-‐like phosphoesterase family protein 3.3 0.02AT5G54960 PDC2 (pyruvate decarboxylase-‐2); carboxy-‐lyase/ catalytic/ magnesium ion binding3.3 0.01

AT3G08720 S6K2 (ARABIDOPSIS THALIANA SERINE/THREONINE PROTEIN KINASE 2); kinase/ protein k3.3 0.01AT5G23410 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow3.3 0.02AT5G14700 cinnamoyl-‐CoA reductase-‐related 3.3 0.02AT5G22250 CCR4-‐NOT transcription complex protein, putative 3.3 0.01AT2G21650 MEE3 (MATERNAL EFFECT EMBRYO ARREST 3); DNA binding / transcription factor3.3 0.01AT5G08380 AtAGAL1 (Arabidopsis thaliana ALPHA-‐GALACTOSIDASE 1); alpha-‐galactosidase/ catal3.3 0.01AT1G69870 proton-‐dependent oligopeptide transport (POT) family protein3.3 0.00AT2G17280 phosphoglycerate/bisphosphoglycerate mutase family protein phosphoglycerate/bisp3.3 0.03AT5G33290 XGD1 (XYLOGALACTURONAN DEFICIENT 1); UDP-‐xylosyltransferase/ catalytic3.3 0.02AT5G03630 ATMDAR2; monodehydroascorbate reductase (NADH) 3.2 0.01AT1G76300 SmD3 (snRNP core protein SmD3) 3.2 0.05AT1G66920 serine/threonine protein kinase, putative 3.2 0.01no_match no_match 3.2 0.02AT5G58710 ROC7; peptidyl-‐prolyl cis-‐trans isomerase 3.2 0.01AT1G30620 MUR4 (MURUS 4); UDP-‐arabinose 4-‐epimerase/ catalytic MUR4 (MURUS 4); UDP-‐arabino3.2 0.04AT4G32940 GAMMA-‐VPE (GAMMA VACUOLAR PROCESSING ENZYME); cysteine-‐type endopeptidase3.2 0.00AT5G19690 STT3A (STAUROSPORIN AND TEMPERATURE SENSITIVE 3-‐LIKE A); oligosaccharyl transfer3.2 0.01AT3G19010 oxidoreductase, 2OG-‐Fe(II) oxygenase family protein oxidoreductase, 2OG-‐Fe(II) o3.2 0.01AT4G02380 SAG21 (SENESCENCE-‐ASSOCIATED GENE 21) SAG21 (SENESCENCE-‐ASSOCIATED GENE 21)3.2 0.02AT4G34630 unknown protein 3.2 0.04AT2G36580 pyruvate kinase, putative 3.1 0.02AT4G28450 nucleotide binding / protein binding 3.1 0.02AT5G19550 ASP2 (ASPARTATE AMINOTRANSFERASE 2); L-‐aspartate:2-‐oxoglutarate aminotransferase3.1 0.00AT5G53400 nuclear movement family protein 3.1 0.01AT4G02570 ATCUL1 (ARABIDOPSIS THALIANA CULLIN 1); protein binding ATCUL1 (ARABIDOPSIS THAL3.1 0.05AT1G53310 ATPPC1 (PHOSPHOENOLPYRUVATE CARBOXYLASE 1); catalytic/ phosphoenolpyruvate carbo3.1 0.04AT5G54810 TSB1 (TRYPTOPHAN SYNTHASE BETA-‐SUBUNIT 1); tryptophan synthase3.1 0.01AT4G11840 PLDGAMMA3; phospholipase D 3.1 0.04AT1G11950 transcription factor 3.1 0.02AT5G44090 calcium-‐binding EF hand family protein, putative / protein phosphatase 2A 62 kDa3.1 0.02AT5G57220 CYP81F2; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxyg3.1 0.01AT1G01340 ATCNGC10 (CYCLIC NUCLEOTIDE GATED CHANNEL 10); calmodulin binding / cyclic nucle3.1 0.01AT4G36970 remorin family protein 3.1 0.03AT4G39260 GR-‐RBP8; RNA binding / nucleic acid binding / nucleotide binding GR-‐RBP8; RNA bi3.1 0.00

AT1G18210 calcium-‐binding protein, putative calcium-‐binding protein, putative3.1 0.01AT3G02520 GRF7 (GENERAL REGULATORY FACTOR 7); protein binding / protein phosphorylated ami3.1 0.01AT5G52450 MATE efflux protein-‐related 3.1 0.01AT3G24503 ALDH2C4; 3-‐chloroallyl aldehyde dehydrogenase/ aldehyde dehydrogenase (NAD)/ con3.1 0.02AT5G11000 unknown protein 3.1 0.01AT2G25650 DNA-‐binding storekeeper protein-‐related 3.1 0.02AT5G56630 PFK7 (PHOSPHOFRUCTOKINASE 7); 6-‐phosphofructokinase 3.0 0.00AT1G71400 AtRLP12 (Receptor Like Protein 12); protein binding 3.0 0.03AT1G21830 unknown protein 3.0 0.03AT4G27300 S-‐locus protein kinase, putative 3.0 0.05AT3G50480 HR4 (HOMOLOG OF RPW8 4) 3.0 0.02AT3G05830 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow3.0 0.01AT3G28480 oxidoreductase, 2OG-‐Fe(II) oxygenase family protein 3.0 0.01AT2G19130 S-‐locus lectin protein kinase family protein 3.0 0.04AT4G26910 2-‐oxoacid dehydrogenase family protein 2-‐oxoacid dehydrogenase family protein 2-‐3.0 0.01AT1G08940 phosphoglycerate/bisphosphoglycerate mutase family protein3.0 0.03AT4G23280 protein kinase, putative 3.0 0.02AT1G21400 2-‐oxoisovalerate dehydrogenase, putative / 3-‐methyl-‐2-‐oxobutanoate dehydrogenase3.0 0.01AT5G52810 ornithine cyclodeaminase/mu-‐crystallin family protein 3.0 0.04AT4G04570 protein kinase family protein protein kinase family protein 3.0 0.00AT5G26920 CBP60G (CAM-‐BINDING PROTEIN 60-‐LIKE.G); calmodulin binding3.0 0.04AT4G31860 protein phosphatase 2C, putative / PP2C, putative protein phosphatase 2C, putati3.0 0.01AT2G32260 cholinephosphate cytidylyltransferase, putative / phosphorylcholine transferase,3.0 0.00AT5G17060 ATARFB1B; GTP binding 3.0 0.00AT1G03350 BSD domain-‐containing protein 3.0 0.02AT5G51070 ERD1 (EARLY RESPONSIVE TO DEHYDRATION 1); ATP binding / ATPase/ nucleoside-‐triph3.0 0.01AT3G07800 thymidine kinase, putative 3.0 0.03AT2G39210 nodulin family protein 2.9 0.00AT4G39980 DHS1 (3-‐DEOXY-‐D-‐ARABINO-‐HEPTULOSONATE 7-‐PHOSPHATE SYNTHASE 1); 3-‐deoxy-‐7-‐phospho2.9 0.01AT4G36920 AP2 (APETALA 2); transcription factor 2.9 0.02AT2G26650 AKT1 (ARABIDOPSIS K TRANSPORTER 1); cyclic nucleotide binding / inward rectifier2.9 0.04AT4G34200 EDA9 (embryo sac development arrest 9); ATP binding 2.9 0.02AT4G17940 binding 2.9 0.04AT5G19960 RNA recognition motif (RRM)-‐containing protein 2.9 0.02

AT3G06540 GDP dissociation inhibitor family protein / Rab GTPase activator family protein2.9 0.02AT5G12890 UDP-‐glucoronosyl/UDP-‐glucosyl transferase family protein 2.9 0.03AT1G65690 harpin-‐induced protein-‐related / HIN1-‐related / harpin-‐responsive protein-‐relate2.9 0.00AT5G52760 heavy-‐metal-‐associated domain-‐containing protein 2.9 0.04AT3G51160 MUR1 (MURUS 1); GDP-‐mannose 4,6-‐dehydratase 2.9 0.01AT2G20420 succinyl-‐CoA ligase (GDP-‐forming) beta-‐chain, mitochondrial, putative / succinyl2.9 0.03AT5G57630 CIPK21 (CBL-‐interacting protein kinase 21); ATP binding / kinase/ protein kinase2.9 0.02AT3G09020 alpha 1,4-‐glycosyltransferase family protein / glycosyltransferase sugar-‐binding2.9 0.04AT1G67650 7S RNA binding 2.9 0.03AT4G37370 CYP81D8; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxyg2.9 0.03AT2G17040 anac036 (Arabidopsis NAC domain containing protein 36); transcription factor2.9 0.03AT4G34680 GATA transcription factor 3, putative (GATA-‐3) GATA transcription factor 3, puta2.9 0.04AT1G59600 ZCW7 2.9 0.01AT1G18570 MYB51 (MYB DOMAIN PROTEIN 51); DNA binding / transcription factor2.9 0.03AT3G50740 UGT72E1 (UDP-‐glucosyl transferase 72E1); UDP-‐glycosyltransferase/ coniferyl-‐alco2.9 0.01AT5G61510 NADP-‐dependent oxidoreductase, putative 2.9 0.02AT5G24110 WRKY30; transcription factor 2.9 0.04AT2G17720 oxidoreductase, 2OG-‐Fe(II) oxygenase family protein 2.9 0.01AT5G07360 amidase family protein amidase family protein 2.8 0.00AT5G05110 cysteine protease inhibitor, putative / cystatin, putative 2.8 0.04AT2G27190 PAP12 (PURPLE ACID PHOSPHATASE 12); acid phosphatase/ protein serine/threonine p2.8 0.04AT1G77770 protein binding / zinc ion binding protein binding / zinc ion binding2.8 0.02AT4G02410 lectin protein kinase family protein 2.8 0.03AT1G61870 PPR336 (pentatricopeptide repeat 336) 2.8 0.04AT3G13100 ATMRP7; ATPase, coupled to transmembrane movement of substances2.8 0.01AT2G45910 protein kinase family protein / U-‐box domain-‐containing protein2.8 0.01AT1G62380 ACO2 (ACC OXIDASE 2); 1-‐aminocyclopropane-‐1-‐carboxylate oxidase2.8 0.03AT1G07990 SIT4 phosphatase-‐associated family protein 2.8 0.00AT3G45860 receptor-‐like protein kinase, putative 2.8 0.01AT2G02360 AtPP2-‐B10 (Phloem protein 2-‐B10); carbohydrate binding 2.8 0.01AT2G37980 unknown protein 2.8 0.04AT4G31500 CYP83B1 (CYTOCHROME P450 MONOOXYGENASE 83B1); oxidoreductase, acting on paired d2.8 0.00AT2G20610 SUR1 (SUPERROOT 1); S-‐alkylthiohydroximate lyase/ carbon-‐sulfur lyase/ transamin2.8 0.00AT1G53280 DJ-‐1 family protein 2.8 0.00

AT3G04120 GAPC1 (GLYCERALDEHYDE-‐3-‐PHOSPHATE DEHYDROGENASE C SUBUNIT 1); glyceraldehyde-‐3-‐p2.8 0.01AT2G47240 long-‐chain-‐fatty-‐acid-‐-‐CoA ligase family protein / long-‐chain acyl-‐CoA synthetas2.8 0.00AT3G46030 HTB11; DNA binding 2.8 0.02AT1G71170 6-‐phosphogluconate dehydrogenase NAD-‐binding domain-‐containing protein2.8 0.02AT3G21220 ATMKK5 (ARABIDOPSIS THALIANA MITOGEN-‐ACTIVATED PROTEIN KINASE KINASE 5); MAP kin2.8 0.01AT4G37530 peroxidase, putative peroxidase, putative 2.7 0.02AT2G44430 DNA-‐binding bromodomain-‐containing protein 2.7 0.04AT2G47990 SWA1 (SLOW WALKER1); nucleotide binding 2.7 0.01AT3G28700 unknown protein 2.7 0.01AT5G66760 SDH1-‐1; ATP binding / succinate dehydrogenase 2.7 0.01AT3G57550 AGK2 (GUANYLATE KINASE); guanylate kinase AGK2 (GUANYLATE KINASE); guanylate kin2.7 0.00AT1G69270 RPK1 (RECEPTOR-‐LIKE PROTEIN KINASE 1); kinase/ protein binding / receptor signal2.7 0.05AT1G22180 SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein2.7 0.02AT5G60950 COBL5 (COBRA-‐LIKE PROTEIN 5 PRECURSOR) 2.7 0.01AT4G26620 sucrase-‐related 2.7 0.01AT5G13370 auxin-‐responsive GH3 family protein 2.7 0.03AT2G05540 glycine-‐rich protein 2.7 0.01AT5G55600 agenet domain-‐containing protein / bromo-‐adjacent homology (BAH) domain-‐containi2.7 0.00AT3G09390 MT2A (METALLOTHIONEIN 2A); copper ion binding 2.7 0.00AT5G50840 INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPR2.7 0.03AT4G08960 phosphotyrosyl phosphatase activator (PTPA) family protein2.7 0.02AT5G23850 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow2.7 0.03AT3G03520 phosphoesterase family protein 2.7 0.04AT2G39400 hydrolase, alpha/beta fold family protein 2.7 0.01AT1G09780 2,3-‐biphosphoglycerate-‐independent phosphoglycerate mutase, putative / phosphogl2.7 0.03AT4G28460 unknown protein 2.6 0.00AT3G04120 GAPC1 (GLYCERALDEHYDE-‐3-‐PHOSPHATE DEHYDROGENASE C SUBUNIT 1); glyceraldehyde-‐3-‐p2.6 0.04AT3G27080 TOM20-‐3 (TRANSLOCASE OF OUTER MEMBRANE 20 KDA SUBUNIT 3); P-‐P-‐bond-‐hydrolysis-‐dr2.6 0.02AT3G08640 alphavirus core protein family 2.6 0.04AT5G50780 ATP binding 2.6 0.03AT2G43080 AT-‐P4H-‐1 (A. THALIANA P4H ISOFORM 1); oxidoreductase, acting on paired donors, w2.6 0.04AT5G51770 protein kinase family protein 2.6 0.03AT2G05630 autophagy 8d (APG8d) autophagy 8d (APG8d) 2.6 0.00AT3G27570 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow2.6 0.00

AT2G32250 FRS2 (FAR1-‐related sequence 2); zinc ion binding FRS2 (FAR1-‐related sequence 2);2.6 0.00AT5G11670 ATNADP-‐ME2 (NADP-‐malic enzyme 2); malate dehydrogenase (oxaloacetate-‐decarboxyla2.6 0.00AT3G52570 ATP binding 2.6 0.03AT4G35770 SEN1 (SENESCENCE 1) SEN1 (SENESCENCE 1) SEN1 (SENESCENCE 1)2.6 0.00AT2G36530 LOS2; copper ion binding / phosphopyruvate hydratase 2.6 0.03AT5G10290 leucine-‐rich repeat family protein / protein kinase family protein2.6 0.02AT3G04580 EIN4 (ETHYLENE INSENSITIVE 4); ethylene binding / glycogen synthase kinase 3/ pr2.6 0.01AT1G69720 ho3 (HEME OXYGENASE 3); heme oxygenase (decyclizing) ho3 (HEME OXYGENASE 3); hem2.6 0.01AT1G01140 CIPK9 (CBL-‐INTERACTING PROTEIN KINASE 9); ATP binding / kinase/ protein kinase/ 2.6 0.01AT3G04120 GAPC1 (GLYCERALDEHYDE-‐3-‐PHOSPHATE DEHYDROGENASE C SUBUNIT 1); glyceraldehyde-‐3-‐p2.6 0.02AT1G59960 aldo/keto reductase, putative 2.6 0.03AT1G61560 MLO6 (MILDEW RESISTANCE LOCUS O 6); calmodulin binding2.6 0.02AT1G71130 AP2 domain-‐containing transcription factor, putative 2.6 0.04AT5G47120 ATBI1 (BAX INHIBITOR 1) 2.6 0.00AT1G56220 dormancy/auxin associated family protein dormancy/auxin associated family protei2.6 0.04AT3G17240 mtLPD2 (LIPOAMIDE DEHYDROGENASE 2); ATP binding / dihydrolipoyl dehydrogenase mt2.6 0.01AT5G13490 AAC2 (ADP/ATP carrier 2); ATP:ADP antiporter/ binding AAC2 (ADP/ATP carrier 2); 2.5 0.02AT1G61640 ABC1 family protein ABC1 family protein 2.5 0.00AT4G15530 PPDK (pyruvate orthophosphate dikinase); kinase/ pyruvate, phosphate dikinase PP2.5 0.00AT3G03610 phagocytosis and cell motility protein ELMO1-‐related 2.5 0.00AT5G07830 AtGUS2 (Arabidopsis thaliana glucuronidase 2); beta-‐glucuronidase2.5 0.00AT4G24330 unknown protein 2.5 0.01AT5G12170 unknown protein 2.5 0.05AT2G45510 CYP704A2; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxy2.5 0.05AT1G08570 ACHT4 (ATYPICAL CYS HIS RICH THIOREDOXIN 4); oxidoreductase, acting on sulfur gr2.5 0.01AT1G64610 WD-‐40 repeat family protein WD-‐40 repeat family protein 2.5 0.03AT5G52390 photoassimilate-‐responsive protein, putative 2.5 0.04AT5G05320 monooxygenase, putative (MO3) 2.5 0.03AT2G05710 aconitate hydratase, cytoplasmic, putative / citrate hydro-‐lyase/aconitase, puta2.5 0.01AT3G46440 UXS5; UDP-‐glucuronate decarboxylase/ catalytic UXS5; UDP-‐glucuronate decarboxyla2.5 0.05AT1G51350 armadillo/beta-‐catenin repeat family protein 2.5 0.01AT3G04420 anac048 (Arabidopsis NAC domain containing protein 48); transcription factor ana2.5 0.03AT4G38260 unknown protein 2.5 0.04AT3G04120 GAPC1 (GLYCERALDEHYDE-‐3-‐PHOSPHATE DEHYDROGENASE C SUBUNIT 1); glyceraldehyde-‐3-‐p2.5 0.01

AT1G78510 SPS1 (solanesyl diphosphate synthase 1); trans-‐octaprenyltranstransferase SPS1 (2.5 0.01AT1G77000 SKP2B; ubiquitin-‐protein ligase 2.5 0.02AT2G05050 catalytic 2.5 0.04AT3G04120 GAPC1 (GLYCERALDEHYDE-‐3-‐PHOSPHATE DEHYDROGENASE C SUBUNIT 1); glyceraldehyde-‐3-‐p2.5 0.02AT1G67360 rubber elongation factor (REF) family protein rubber elongation factor (REF) fam2.5 0.01AT1G22890 unknown protein 2.5 0.01AT5G62900 unknown protein 2.5 0.01AT2G35940 BLH1 (BEL1-‐LIKE HOMEODOMAIN 1); DNA binding / protein heterodimerization/ protei2.5 0.04AT1G79940 ATERDJ2A; heat shock protein binding / unfolded protein binding ATERDJ2A; heat s2.5 0.03AT5G54490 PBP1 (PINOID-‐BINDING PROTEIN 1); calcium ion binding / protein binding2.5 0.04AT4G26060 unknown protein 2.4 0.01AT1G20300 pentatricopeptide (PPR) repeat-‐containing protein 2.4 0.01AT1G16970 KU70 (ARABIDOPSIS THALIANA KU70 HOMOLOG); double-‐stranded DNA binding / protein 2.4 0.03AT3G51440 strictosidine synthase family protein 2.4 0.05AT1G56150 auxin-‐responsive family protein 2.4 0.03AT5G26600 catalytic/ pyridoxal phosphate binding catalytic/ pyridoxal phosphate binding2.4 0.04no_match no_match 2.4 0.03AT4G01610 cathepsin B-‐like cysteine protease, putative cathepsin B-‐like cysteine protease,2.4 0.00AT4G08390 SAPX (STROMAL ASCORBATE PEROXIDASE); L-‐ascorbate peroxidase SAPX (STROMAL ASCORB2.4 0.03AT5G63930 leucine-‐rich repeat transmembrane protein kinase, putative 2.4 0.01AT2G40140 CZF1; transcription factor CZF1; transcription factor 2.4 0.03AT1G64810 APO1 (ACCUMULATION OF PHOTOSYSTEM ONE 1) APO1 (ACCUMULATION OF PHOTOSYSTEM ONE 12.4 0.02AT2G23890 5' nucleotidase family protein 2.4 0.02AT3G04120 GAPC1 (GLYCERALDEHYDE-‐3-‐PHOSPHATE DEHYDROGENASE C SUBUNIT 1); glyceraldehyde-‐3-‐p2.4 0.01AT3G20720 unknown protein 2.4 0.02AT4G17420 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow2.4 0.02AT4G29040 RPT2a (regulatory particle AAA-‐ATPase 2a); ATPase 2.4 0.00AT3G46320 histone H4 2.4 0.03AT1G18890 ATCDPK1 (CALCIUM-‐DEPENDENT PROTEIN KINASE 1); calmodulin-‐dependent protein kinas2.4 0.05AT5G60790 ATGCN1; transporter 2.4 0.02AT4G36140 disease resistance protein (TIR-‐NBS-‐LRR class), putative 2.4 0.04AT2G24200 cytosol aminopeptidase cytosol aminopeptidase 2.4 0.03AT2G32950 COP1 (CONSTITUTIVE PHOTOMORPHOGENIC 1); protein binding / ubiquitin-‐protein liga2.4 0.02AT2G17530 protein kinase family protein protein kinase family protein 2.4 0.01

AT1G77420 hydrolase, alpha/beta fold family protein 2.4 0.01AT1G29720 protein kinase family protein protein kinase family protein 2.4 0.04AT5G45260 RRS1 (RESISTANT TO RALSTONIA SOLANACEARUM 1); DNA binding / transcription factor2.4 0.04AT5G38830 tRNA synthetase class I (C) family protein 2.4 0.04AT5G25930 leucine-‐rich repeat family protein / protein kinase family protein2.4 0.00AT1G03550 secretory carrier membrane protein (SCAMP) family protein 2.4 0.01AT1G07670 calcium-‐transporting ATPase 2.4 0.04AT1G80460 NHO1 (nonhost resistance to P. s. phaseolicola 1); carbohydrate kinase/ glycerol2.4 0.00AT5G15650 RGP2 (REVERSIBLY GLYCOSYLATED POLYPEPTIDE 2); transferase, transferring hexosyl 2.4 0.00AT5G04930 ALA1 (aminophospholipid ATPase1); ATPase, coupled to transmembrane movement of i2.4 0.01AT4G21660 proline-‐rich spliceosome-‐associated (PSP) family protein 2.4 0.02AT2G35660 CTF2A; monooxygenase/ oxidoreductase CTF2A; monooxygenase/ oxidoreductase CTF2A;2.4 0.04AT1G52760 esterase/lipase/thioesterase family protein 2.4 0.01AT2G29400 TOPP1 (TYPE ONE PROTEIN PHOSPHATASE 1); protein serine/threonine phosphatase2.4 0.01AT5G15640 mitochondrial substrate carrier family protein 2.4 0.02AT3G60420 LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRE2.4 0.04AT2G31060 elongation factor family protein elongation factor family protein2.4 0.03AT5G54500 FQR1 (FLAVODOXIN-‐LIKE QUINONE REDUCTASE 1); FMN binding / oxidoreductase, acting2.4 0.01AT4G21580 oxidoreductase, zinc-‐binding dehydrogenase family protein oxidoreductase, zinc-‐b2.4 0.04AT1G60420 DC1 domain-‐containing protein 2.4 0.00AT1G22410 2-‐dehydro-‐3-‐deoxyphosphoheptonate aldolase, putative / 3-‐deoxy-‐D-‐arabino-‐heptulo2.3 0.01AT2G30350 endo/excinuclease amino terminal domain-‐containing protein endo/excinuclease ami2.3 0.05AT5G43710 glycoside hydrolase family 47 protein 2.3 0.01AT4G24690 ubiquitin-‐associated (UBA)/TS-‐N domain-‐containing protein / octicosapeptide/Phox2.3 0.02AT5G46680 pentatricopeptide (PPR) repeat-‐containing protein 2.3 0.03AT3G62150 PGP21 (P-‐GLYCOPROTEIN 21); ATPase, coupled to transmembrane movement of substanc2.3 0.02AT1G77370 glutaredoxin, putative 2.3 0.01AT5G14040 mitochondrial phosphate transporter 2.3 0.04AT4G08850 kinase kinase 2.3 0.03AT5G09850 transcription elongation factor-‐related 2.3 0.03AT2G17570 undecaprenyl pyrophosphate synthetase family protein / UPP synthetase family pro2.3 0.03AT4G16430 basic helix-‐loop-‐helix (bHLH) family protein 2.3 0.01AT1G13750 calcineurin-‐like phosphoesterase family protein 2.3 0.00AT2G18330 AAA-‐type ATPase family protein 2.3 0.01

AT4G00040 chalcone and stilbene synthase family protein 2.3 0.03AT5G45010 ATDSS1(V) (Arabidopsis dss1 homolog on chromosome V) 2.3 0.03AT3G15090 oxidoreductase, zinc-‐binding dehydrogenase family protein 2.3 0.04AT5G43910 pfkB-‐type carbohydrate kinase family protein pfkB-‐type carbohydrate kinase famil2.3 0.01AT4G01560 MEE49 (maternal effect embryo arrest 49) 2.3 0.03AT2G37250 ADK (ADENOSINE KINASE); adenylate kinase/ nucleotide kinase2.3 0.01AT4G14420 lesion inducing protein-‐related 2.3 0.00AT1G34750 protein phosphatase 2C, putative / PP2C, putative 2.3 0.01AT1G60490 ATVPS34; 1-‐phosphatidylinositol-‐3-‐kinase/ binding / inositol or phosphatidylinos2.3 0.04AT1G21370 unknown protein unknown protein 2.3 0.03AT3G54130 josephin family protein 2.3 0.01AT2G25670 unknown protein unknown protein 2.3 0.02AT3G21520 unknown protein 2.3 0.03AT1G71840 transducin family protein / WD-‐40 repeat family protein 2.3 0.03AT4G23470 hydroxyproline-‐rich glycoprotein family protein hydroxyproline-‐rich glycoprotein2.3 0.03AT5G03290 isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative2.3 0.00AT5G47420 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow2.3 0.03AT3G08590 2,3-‐biphosphoglycerate-‐independent phosphoglycerate mutase, putative / phosphogl2.3 0.00AT3G50920 phosphatidic acid phosphatase-‐related / PAP2-‐related phosphatidic acid phosphata2.3 0.01AT2G24390 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow2.3 0.01AT5G53000 TAP46 (2A phosphatase associated protein of 46 kD); protein phosphatase type 2A 2.3 0.05AT5G39040 ATTAP2; ATPase, coupled to transmembrane movement of substances / transporter2.2 0.04AT2G34250 protein transport protein sec61, putative protein transport protein sec61, putat2.2 0.01AT3G60190 ADL1E (ARABIDOPSIS DYNAMIN-‐LIKE 1E); GTP binding / GTPase2.2 0.02AT5G14030 translocon-‐associated protein beta (TRAPB) family protein translocon-‐associated 2.2 0.01AT4G07950 DNA-‐directed RNA polymerase III family protein 2.2 0.03AT4G33050 EDA39 (embryo sac development arrest 39); calmodulin binding EDA39 (embryo sac d2.2 0.04AT5G60460 sec61beta family protein 2.2 0.00AT3G18930 zinc finger (C3HC4-‐type RING finger) family protein zinc finger (C3HC4-‐type RING2.2 0.00AT3G57090 BIGYIN; binding 2.2 0.04AT1G14020 unknown protein 2.2 0.03AT3G15460 brix domain-‐containing protein 2.2 0.01AT1G43890 ATRAB18 (ARABIDOPSIS RAB GTPASE HOMOLOG B18); GTP binding ATRAB18 (ARABIDOPSIS R2.2 0.04AT4G02220 zinc finger (MYND type) family protein / programmed cell death 2 C-‐terminal doma2.2 0.02

AT1G43910 AAA-‐type ATPase family protein 2.2 0.01AT1G49820 ATMTK (ARABIDOPSIS THALIANA S-‐METHYL-‐5-‐THIORIBOSE KINASE); S-‐methyl-‐5-‐thioribose2.2 0.02AT3G14620 CYP72A8; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxyg2.2 0.02AT1G25520 unknown protein 2.2 0.02AT1G30400 MRP1 (ARABIDOPSIS THALIANA MULTIDRUG RESISTANCE-‐ASSOCIATED PROTEIN 1); ATPase, c2.2 0.02AT4G11830 PLDGAMMA2; phospholipase D PLDGAMMA2; phospholipase D2.2 0.01AT2G11520 CRCK3; ATP binding / kinase/ protein kinase/ protein serine/threonine kinase2.2 0.05AT4G25720 QC (GLUTAMINYL CYCLASE); catalytic/ glutaminyl-‐peptide cyclotransferase QC (GLUT2.2 0.00AT5G60280 lectin protein kinase family protein 2.2 0.02AT5G61960 AML1 (ARABIDOPSIS MEI2-‐LIKE PROTEIN 1); RNA binding / protein binding AML1 (ARAB2.2 0.01AT5G15870 glycosyl hydrolase family 81 protein 2.2 0.03AT5G16880 VHS domain-‐containing protein / GAT domain-‐containing protein VHS domain-‐contain2.2 0.00AT4G08320 tetratricopeptide repeat (TPR)-‐containing protein tetratricopeptide repeat (TPR)2.2 0.02AT3G16430 JAL31 (JACALIN-‐RELATED LECTIN 31); copper ion binding JAL31 (JACALIN-‐RELATED LEC2.2 0.02AT2G33120 SAR1 (SYNAPTOBREVIN-‐RELATED PROTEIN 1) SAR1 (SYNAPTOBREVIN-‐RELATED PROTEIN 1)2.2 0.02AT1G03210 phenazine biosynthesis PhzC/PhzF family protein 2.2 0.02no_match no_match 2.2 0.03AT3G04080 ATAPY1 (APYRASE 1); ATPase/ calmodulin binding / nucleotide diphosphatase2.2 0.04AT3G51430 YLS2; strictosidine synthase 2.2 0.04AT2G45070 SEC61 BETA; protein transporter SEC61 BETA; protein transporter SEC61 BETA; prot2.2 0.05AT1G59970 matrixin family protein 2.2 0.02AT3G05970 LACS6 (long-‐chain acyl-‐CoA synthetase 6); long-‐chain-‐fatty-‐acid-‐CoA ligase2.2 0.03AT5G61930 APO3 (ACCUMULATION OF PHOTOSYSTEM ONE 3) APO3 (ACCUMULATION OF PHOTOSYSTEM ONE 32.2 0.03AT1G71780 unknown protein 2.2 0.01AT1G05180 AXR1 (AUXIN RESISTANT 1); small protein activating enzyme AXR1 (AUXIN RESISTANT 2.2 0.02AT1G06530 myosin heavy chain-‐related 2.1 0.04AT1G68160 unknown protein 2.1 0.05AT3G44720 ADT4 (arogenate dehydratase 4); arogenate dehydratase/ prephenate dehydratase2.1 0.00AT3G11660 NHL1 2.1 0.04AT1G28680 transferase family protein 2.1 0.01AT1G55850 ATCSLE1; cellulose synthase/ transferase, transferring glycosyl groups2.1 0.04AT3G51130 unknown protein 2.1 0.03AT4G35110 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow2.1 0.04AT5G25770 unknown protein unknown protein unknown protein 2.1 0.02

AT1G53780 ATP binding / ATPase/ hydrolase/ nucleoside-‐triphosphatase/ nucleotide binding /2.1 0.03AT1G06870 signal peptidase, putative 2.1 0.01AT1G02330 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow2.1 0.03AT2G37130 peroxidase 21 (PER21) (P21) (PRXR5) peroxidase 21 (PER21) (P21) (PRXR5)2.1 0.04AT2G26240 unknown protein 2.1 0.03AT4G38100 unknown protein 2.1 0.02AT2G04520 eukaryotic translation initiation factor 1A, putative / eIF-‐1A, putative / eIF-‐42.1 0.01AT2G04900 unknown protein unknown protein 2.1 0.04AT4G33030 SQD1; UDPsulfoquinovose synthase/ sulfotransferase 2.1 0.01AT3G23600 dienelactone hydrolase family protein dienelactone hydrolase family protein2.1 0.02AT2G16500 ADC1 (ARGININE DECARBOXYLASE 1); arginine decarboxylase2.1 0.03AT3G60520 unknown protein 2.1 0.01AT4G19010 4-‐coumarate-‐-‐CoA ligase family protein / 4-‐coumaroyl-‐CoA synthase family protein2.1 0.04AT3G05290 PNC1 (PEROXISOMAL ADENINE NUCLEOTIDE CARRIER 1); ADP transmembrane transporter/ 2.1 0.02AT5G55070 2-‐oxoacid dehydrogenase family protein 2.1 0.04AT1G19730 ATTRX4; oxidoreductase, acting on sulfur group of donors, disulfide as acceptor2.1 0.05AT5G62740 band 7 family protein 2.1 0.02AT5G20620 UBQ4; protein binding 2.1 0.02AT1G67800 copine-‐related copine-‐related copine-‐related copine-‐related2.1 0.02AT5G56650 ILL1; IAA-‐amino acid conjugate hydrolase/ metallopeptidase2.1 0.01AT3G48080 lipase class 3 family protein / disease resistance protein-‐related2.1 0.01AT1G08880 H2AXA; DNA binding 2.1 0.02AT2G15570 thioredoxin M-‐type 3, chloroplast (TRX-‐M3) thioredoxin M-‐type 3, chloroplast (TR2.1 0.03AT3G09410 pectinacetylesterase family protein pectinacetylesterase family protein2.1 0.04AT4G26970 aconitate hydratase/ copper ion binding 2.1 0.02AT3G53668 CPuORF51 (Conserved peptide upstream open reading frame 51)2.1 0.00AT4G25030 unknown protein unknown protein 2.1 0.05AT3G09970 calcineurin-‐like phosphoesterase family protein 2.1 0.01AT5G01220 SQD2 (sulfoquinovosyldiacylglycerol 2); UDP-‐glycosyltransferase/ UDP-‐sulfoquinov2.1 0.01AT2G16710 hesB-‐like domain-‐containing protein hesB-‐like domain-‐containing protein2.1 0.04AT1G13110 CYP71B7; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxyg2.1 0.00AT4G35260 IDH1 (ISOCITRATE DEHYDROGENASE 1); isocitrate dehydrogenase (NAD+)/ oxidoreducta2.1 0.00AT1G61250 SC3 (SECRETORY CARRIER 3); transmembrane transporter 2.1 0.01AT4G37120 SMP2; single-‐stranded RNA binding 2.1 0.00

AT3G51260 PAD1 (20s proteasome alpha subunit pad1); endopeptidase/ peptidase/ threonine-‐ty2.1 0.04AT1G03040 basic helix-‐loop-‐helix (bHLH) family protein 2.1 0.01AT1G28490 SYP61 (SYNTAXIN OF PLANTS 61); SNAP receptor SYP61 (SYNTAXIN OF PLANTS 61); SNAP2.1 0.04AT2G33310 IAA13; transcription factor IAA13; transcription factor IAA13; transcription fac2.1 0.02AT3G14920 unknown protein 2.1 0.01AT4G29130 HXK1 (HEXOKINASE 1); ATP binding / fructokinase/ glucokinase/ hexokinase2.1 0.03AT1G32640 MYC2; DNA binding / transcription activator/ transcription factor2.1 0.00AT5G39030 protein kinase family protein 2.1 0.04AT2G36460 fructose-‐bisphosphate aldolase, putative fructose-‐bisphosphate aldolase, putativ2.1 0.04AT1G24100 UGT74B1 (UDP-‐glucosyl transferase 74B1); UDP-‐glycosyltransferase/ thiohydroximat2.0 0.04AT5G13570 DCP2 (DECAPPING 2); hydrolase/ m7G(5')pppN diphosphatase/ mRNA binding / protein2.0 0.02AT1G80440 kelch repeat-‐containing F-‐box family protein 2.0 0.05AT1G55900 TIM50 2.0 0.02AT4G29660 EMB2752 (EMBRYO DEFECTIVE 2752) 2.0 0.00AT3G55510 RBL (REBELOTE) 2.0 0.02AT1G48430 dihydroxyacetone kinase family protein 2.0 0.02AT5G44580 unknown protein 2.0 0.04AT3G12740 ALIS1 (ALA-‐INTERACTING SUBUNIT 1); phospholipid transporter2.0 0.00AT5G16760 inositol 1,3,4-‐trisphosphate 5/6-‐kinase 2.0 0.02AT2G18250 ATCOAD (4-‐phosphopantetheine adenylyltransferase); nucleotidyltransferase/ pante2.0 0.03AT2G30640 transposable element gene 2.0 0.02AT4G14270 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow2.0 0.02AT2G22660 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow2.0 0.00AT2G05380 GRP3S (GLYCINE-‐RICH PROTEIN 3 SHORT ISOFORM) GRP3S (GLYCINE-‐RICH PROTEIN 3 SHORT2.0 0.03AT4G11220 BTI2 (VIRB2-‐INTERACTING PROTEIN 2) 2.0 0.03AT4G03020 transducin family protein / WD-‐40 repeat family protein 2.0 0.02AT4G24740 AFC2 (ARABIDOPSIS FUS3-‐COMPLEMENTING GENE 2); kinase/ protein kinase AFC2 (ARABI2.0 0.03AT3G29075 glycine-‐rich protein 2.0 0.01AT4G37640 ACA2 (CALCIUM ATPASE 2); calcium ion transmembrane transporter/ calcium-‐transpor2.0 0.01AT4G30960 SIP3 (SOS3-‐INTERACTING PROTEIN 3); ATP binding / kinase/ protein kinase/ protein2.0 0.03AT5G67500 VDAC2 (VOLTAGE DEPENDENT ANION CHANNEL 2); voltage-‐gated anion channel2.0 0.03AT2G22500 UCP5 (UNCOUPLING PROTEIN 5); binding 2.0 0.00AT1G05010 EFE (ETHYLENE-‐FORMING ENZYME); 1-‐aminocyclopropane-‐1-‐carboxylate oxidase2.0 0.04AT5G61450 2-‐phosphoglycerate kinase-‐related 2.0 0.02

AT5G52240 MSBP1 (membrane steroid binding protein 1); steroid binding2.0 0.04AT5G01820 ATSR1 (ARABIDOPSIS THALIANA SERINE/THREONINE PROTEIN KINASE 1); ATP binding / ki2.0 0.04AT2G17790 VPS35A (VPS35 HOMOLOG A) 2.0 0.00AT5G07940 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow2.0 0.02AT1G48850 EMB1144 (embryo defective 1144); chorismate synthase EMB1144 (embryo defective 12.0 0.03AT5G65220 ribosomal protein L29 family protein 0.5 0.03AT4G26300 emb1027 (embryo defective 1027); ATP binding / aminoacyl-‐tRNA ligase/ arginine-‐t0.5 0.03AT4G17950 DNA-‐binding family protein 0.5 0.01AT5G11060 KNAT4 (KNOTTED1-‐LIKE HOMEOBOX GENE 4); transcription activator/ transcription fa0.5 0.02AT3G15900 unknown protein 0.5 0.03AT5G40950 RPL27 (RIBOSOMAL PROTEIN LARGE SUBUNIT 27); structural constituent of ribosome0.5 0.01AT3G46370 leucine-‐rich repeat protein kinase, putative 0.5 0.03AT5G02230 haloacid dehalogenase-‐like hydrolase family protein haloacid dehalogenase-‐like h0.5 0.01AT4G33950 OST1 (OPEN STOMATA 1); calcium-‐dependent protein serine/threonine kinase/ kinase0.5 0.00AT4G20840 FAD-‐binding domain-‐containing protein 0.5 0.04AT1G19050 ARR7 (RESPONSE REGULATOR 7); transcription regulator/ two-‐component response reg0.5 0.01AT1G31230 AK-‐HSDH I (ASPARTATE KINASE-‐HOMOSERINE DEHYDROGENASE I); aspartate kinase/ homos0.5 0.04AT1G53120 RNA-‐binding S4 domain-‐containing protein 0.5 0.02AT1G63800 UBC5 (ubiquitin-‐conjugating enzyme 5); ubiquitin-‐protein ligase0.5 0.02AT2G17450 RHA3A; protein binding / zinc ion binding 0.5 0.00AT3G12930 INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 0.5 0.02AT3G47650 bundle-‐sheath defective protein 2 family / bsd2 family 0.5 0.04AT5G09650 AtPPa6 (Arabidopsis thaliana pyrophosphorylase 6); inorganic diphosphatase/ pyro0.5 0.04AT3G23310 protein kinase, putative 0.5 0.01AT4G13770 CYP83A1 (CYTOCHROME P450 83A1); oxidoreductase, acting on paired donors, with in0.5 0.01AT2G24020 unknown protein 0.5 0.01AT1G52510 hydrolase, alpha/beta fold family protein hydrolase, alpha/beta fold family prot0.5 0.00AT1G65490 unknown protein 0.5 0.02AT4G39040 RNA binding RNA binding 0.5 0.01AT1G16880 uridylyltransferase-‐related uridylyltransferase-‐related 0.5 0.03AT1G72810 threonine synthase, putative 0.5 0.03AT5G58260 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: NADH dehydrogenase comple0.5 0.00AT1G35340 ATP-‐dependent protease La (LON) domain-‐containing protein ATP-‐dependent protease0.5 0.03AT2G44870 unknown protein 0.5 0.05

AT5G59130 subtilase family protein 0.5 0.03ATCG00640 RIBOSOMAL PROTEIN L33 (RPL33); FUNCTIONS IN: structural constituent of ribosome;0.5 0.01AT1G65330 PHE1 (PHERES1); DNA binding / transcription factor 0.5 0.02AT5G04130 DNA topoisomerase, ATP-‐hydrolyzing, putative / DNA topoisomerase II, putative / 0.5 0.04AT1G71030 MYBL2 (ARABIDOPSIS MYB-‐LIKE 2); DNA binding / transcription factor0.5 0.03AT5G27560 unknown protein 0.5 0.00AT4G34150 C2 domain-‐containing protein 0.5 0.02AT5G53580 aldo/keto reductase family protein 0.5 0.03AT3G59000 F-‐box family protein F-‐box family protein 0.5 0.00AT3G06950 tRNA pseudouridine synthase family protein 0.5 0.01no_match no_match 0.5 0.00AT2G20260 PSAE-‐2 (photosystem I subunit E-‐2); catalytic 0.5 0.02AT4G21860 MSRB2 (methionine sulfoxide reductase B 2); peptide-‐methionine-‐(S)-‐S-‐oxide reduc0.5 0.02AT3G51510 unknown protein 0.5 0.00AT4G37470 hydrolase, alpha/beta fold family protein 0.5 0.00AT5G23330 riboflavin biosynthesis protein-‐related 0.5 0.04AT5G26000 TGG1 (THIOGLUCOSIDE GLUCOHYDROLASE 1); hydrolase, hydrolyzing O-‐glycosyl compoun0.5 0.05AT5G09960 unknown protein 0.5 0.01AT3G56650 thylakoid lumenal 20 kDa protein 0.5 0.05AT3G07200 zinc finger (C3HC4-‐type RING finger) family protein zinc finger (C3HC4-‐type RING0.5 0.02AT1G73080 PEPR1 (PEP1 receptor 1); ATP binding / kinase/ protein binding / protein serine/0.5 0.00AT3G17210 HS1 (HEAT STABLE PROTEIN 1) 0.5 0.00AT1G03630 POR C (PROTOCHLOROPHYLLIDE OXIDOREDUCTASE); NADPH dehydrogenase/ oxidoreductase/0.5 0.04ATCG00790 RIBOSOMAL PROTEIN L16 (RPL16); FUNCTIONS IN: structural constituent of ribosome;0.5 0.05AT3G57530 CPK32 (CALCIUM-‐DEPENDENT PROTEIN KINASE 32); calcium-‐dependent protein kinase C/0.5 0.00AT2G22240 MIPS2 (MYO-‐INOSITOL-‐1-‐PHOSTPATE SYNTHASE 2); binding / catalytic/ inositol-‐3-‐pho0.5 0.00AT2G29390 SMO2-‐2 (STEROL 4-‐ALPHA-‐METHYL-‐OXIDASE 2-‐2); 4-‐alpha-‐methyl-‐delta7-‐sterol-‐4alpha-‐0.5 0.04AT1G49930 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow0.5 0.03AT3G27850 RPL12-‐C (ribosomal protein l12-‐c); structural constituent of ribosome0.5 0.01AT1G43850 SEU (seuss); DNA binding / protein binding / protein heterodimerization/ transcr0.5 0.01AT2G32090 lactoylglutathione lyase family protein / glyoxalase I family protein lactoylglu0.5 0.04AT5G08410 FTRA2 (ferredoxin/thioredoxin reductase subunit A (variable subunit) 2); catalyt0.5 0.04AT5G16715 EMB2247 (embryo defective 2247); ATP binding / aminoacyl-‐tRNA ligase/ nucleotide0.5 0.02AT2G25200 unknown protein 0.5 0.03

AT4G11100 unknown protein unknown protein 0.5 0.05AT1G62480 vacuolar calcium-‐binding protein-‐related 0.5 0.03AT2G26900 bile acid:sodium symporter family protein 0.5 0.03AT3G20270 lipid-‐binding serum glycoprotein family protein lipid-‐binding serum glycoprotein0.5 0.02AT1G52230 PSAH2 (PHOTOSYSTEM I SUBUNIT H2) 0.5 0.03AT4G18370 DEG5 (DEGP PROTEASE 5); catalytic/ serine-‐type endopeptidase/ serine-‐type peptid0.5 0.05AT5G11070 unknown protein 0.5 0.03AT4G35250 vestitone reductase-‐related 0.5 0.04AT1G30120 PDH-‐E1 BETA (PYRUVATE DEHYDROGENASE E1 BETA); pyruvate dehydrogenase (acetyl-‐tra0.5 0.01AT5G37360 unknown protein 0.5 0.01AT1G12900 GAPA-‐2 (GLYCERALDEHYDE 3-‐PHOSPHATE DEHYDROGENASE A SUBUNIT 2); NAD or NADH bindi0.5 0.01AT1G69550 disease resistance protein (TIR-‐NBS class), putative 0.5 0.04AT1G60660 CB5LP (CYTOCHROME B5-‐LIKE PROTEIN); heme binding 0.5 0.05AT4G31270 transcription factor 0.5 0.01AT3G56940 CRD1 (COPPER RESPONSE DEFECT 1); DNA binding / magnesium-‐protoporphyrin IX monom0.5 0.00AT3G20310 ERF7 (ETHYLINE RESPONSE FACTOR 7); DNA binding / protein binding / transcription0.5 0.03AT4G31550 WRKY11; calmodulin binding / transcription factor WRKY11; calmodulin binding / t0.5 0.02AT5G40500 unknown protein unknown protein 0.5 0.00AT1G16080 unknown protein 0.5 0.02AT1G34350 unknown protein 0.5 0.03AT1G10740 unknown protein unknown protein 0.5 0.03AT1G11750 CLPP6; serine-‐type endopeptidase 0.4 0.01AT2G22980 serine-‐type carboxypeptidase serine-‐type carboxypeptidase serine-‐type carboxypep0.4 0.03AT1G49430 LACS2 (LONG-‐CHAIN ACYL-‐COA SYNTHETASE 2); long-‐chain-‐fatty-‐acid-‐CoA ligase0.4 0.04AT4G36150 disease resistance protein (TIR-‐NBS-‐LRR class), putative 0.4 0.03AT3G23760 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow0.4 0.04AT1G13280 AOC4 (ALLENE OXIDE CYCLASE 4); allene-‐oxide cyclase 0.4 0.01AT5G62090 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow0.4 0.02AT5G27350 SFP1; carbohydrate transmembrane transporter/ sugar:hydrogen symporter0.4 0.01AT5G62460 zinc finger (C3HC4-‐type RING finger) family protein 0.4 0.02AT2G29510 unknown protein 0.4 0.02AT4G23890 unknown protein 0.4 0.01AT5G58900 myb family transcription factor 0.4 0.02AT1G50730 unknown protein 0.4 0.01

AT5G24800 BZIP9 (BASIC LEUCINE ZIPPER 9); DNA binding / protein heterodimerization/ transc0.4 0.01AT3G21650 serine/threonine protein phosphatase 2A (PP2A) regulatory subunit B', putative0.4 0.02AT5G57960 GTP-‐binding family protein 0.4 0.02AT2G41990 unknown protein 0.4 0.01AT5G65390 AGP7 0.4 0.01AT1G54500 rubredoxin family protein 0.4 0.02AT1G52220 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow0.4 0.02AT2G21385 unknown protein unknown protein 0.4 0.01AT4G24090 unknown protein 0.4 0.03AT1G77640 AP2 domain-‐containing transcription factor, putative 0.4 0.01AT1G33040 NACA5 (NASCENT POLYPEPTIDE-‐ASSOCIATED COMPLEX SUBUNIT ALPHA-‐LIKE PROTEIN 5)0.4 0.02AT4G30660 hydrophobic protein, putative / low temperature and salt responsive protein, put0.4 0.03AT4G01080 unknown protein 0.4 0.01AT4G30620 unknown protein 0.4 0.01AT1G28110 SCPL45 (SERINE CARBOXYPEPTIDASE-‐LIKE 45 PRECURSOR); serine-‐type carboxypeptidase0.4 0.02AT4G32330 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow0.4 0.04AT1G31330 PSAF (photosystem I subunit F) 0.4 0.02AT5G23740 RPS11-‐BETA (RIBOSOMAL PROTEIN S11-‐BETA); structural constituent of ribosome0.4 0.01AT5G45280 pectinacetylesterase, putative pectinacetylesterase, putative0.4 0.04AT5G39360 EDL2 (EID1-‐like 2) 0.4 0.04AT4G19100 unknown protein 0.4 0.00AT4G14610 pseudogene, disease resistance protein (CC-‐NBS-‐LRR class), putative, domain sign0.4 0.02AT1G19650 SEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative S0.4 0.01AT2G42070 ATNUDX23 (ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 23); FAD diphosphatase/ h0.4 0.01AT3G09500 60S ribosomal protein L35 (RPL35A) 0.4 0.01no_match no_match 0.4 0.04AT3G44630 disease resistance protein RPP1-‐WsB-‐like (TIR-‐NBS-‐LRR class), putative disease r0.4 0.01AT4G27350 unknown protein 0.4 0.05AT3G25600 calcium ion binding 0.4 0.00AT2G06210 ELF8 (EARLY FLOWERING 8); binding 0.4 0.01AT1G17350 auxin-‐induced-‐related / indole-‐3-‐acetic acid induced-‐related auxin-‐induced-‐relat0.4 0.01AT5G50740 metal ion binding metal ion binding metal ion binding 0.4 0.02AT4G12110 SMO1-‐1 (STEROL-‐4ALPHA-‐METHYL OXIDASE 1-‐1); 4,4-‐dimethyl-‐9beta,19-‐cyclopropylster0.4 0.02AT3G48500 RNA binding RNA binding 0.4 0.01

AT5G54600 50S ribosomal protein L24, chloroplast (CL24) 50S ribosomal protein L24, chloro0.4 0.01AT1G49750 leucine-‐rich repeat family protein 0.4 0.01AT5G28630 glycine-‐rich protein 0.4 0.00AT1G49890 unknown protein 0.4 0.01AT4G30650 hydrophobic protein, putative / low temperature and salt responsive protein, put0.4 0.05AT5G42030 ABIL4 (ABL INTERACTOR-‐LIKE PROTEIN 4) 0.4 0.01AT3G56340 40S ribosomal protein S26 (RPS26C) 0.4 0.04AT5G24570 unknown protein 0.4 0.01AT1G10960 ATFD1 (FERREDOXIN 1); 2 iron, 2 sulfur cluster binding / electron carrier/ iron-‐0.4 0.04AT4G23270 protein kinase family protein 0.4 0.01AT4G19985 GCN5-‐related N-‐acetyltransferase (GNAT) family protein 0.4 0.02AT2G21140 ATPRP2 (PROLINE-‐RICH PROTEIN 2) 0.4 0.01AT1G18730 NDF6 (NDH DEPENDENT FLOW 6) NDF6 (NDH DEPENDENT FLOW 6) NDF6 (NDH DEPENDENT FLOW0.4 0.00ATCG00810 RIBOSOMAL PROTEIN L22 (RPL22); FUNCTIONS IN: structural constituent of ribosome;0.4 0.03AT3G02180 SP1L3 (SPIRAL 1-‐LIKE3) SP1L3 (SPIRAL 1-‐LIKE3) SP1L3 (SPIRAL 1-‐LIKE3)0.4 0.01AT1G24822 unknown protein 0.4 0.01AT2G36430 unknown protein 0.4 0.02AT4G17600 LIL3:1; transcription factor 0.4 0.02AT3G13430 zinc finger (C3HC4-‐type RING finger) family protein zinc finger (C3HC4-‐type RING0.4 0.03AT4G14870 P-‐P-‐bond-‐hydrolysis-‐driven protein transmembrane transporter0.4 0.04AT5G17870 PSRP6 (PLASTID-‐SPECIFIC 50S RIBOSOMAL PROTEIN 6) 0.4 0.01AT2G38750 ANNAT4 (ANNEXIN ARABIDOPSIS 4); calcium ion binding / calcium-‐dependent phosphol0.4 0.03AT1G62250 unknown protein unknown protein 0.4 0.01AT3G61380 unknown protein 0.4 0.03AT5G46570 BSK2 (BR-‐SIGNALING KINASE 2); ATP binding / binding / kinase/ protein kinase/ pr0.4 0.01AT1G04250 AXR3 (AUXIN RESISTANT 3); transcription factor 0.4 0.04AT1G07780 PAI1 (PHOSPHORIBOSYLANTHRANILATE ISOMERASE 1); phosphoribosylanthranilate isomer0.4 0.01AT1G27480 lecithin:cholesterol acyltransferase family protein / LACT family protein0.4 0.03AT5G16650 DNAJ heat shock N-‐terminal domain-‐containing protein 0.4 0.03AT3G52920 unknown protein unknown protein 0.4 0.01AT1G52830 IAA6 (INDOLE-‐3-‐ACETIC ACID 6); transcription factor 0.4 0.02AT1G14580 zinc finger (C2H2 type) family protein 0.4 0.01AT1G24610 SET domain-‐containing protein 0.4 0.03AT3G26950 unknown protein 0.4 0.03

AT5G45310 unknown protein 0.4 0.02AT3G56480 myosin heavy chain-‐related 0.4 0.04AT5G52920 PKP-‐BETA1 (PLASTIDIC PYRUVATE KINASE BETA SUBUNIT 1); pyruvate kinase0.4 0.04AT4G15800 RALFL33 (ralf-‐like 33); signal transducer 0.4 0.04AT1G71695 peroxidase 12 (PER12) (P12) (PRXR6) 0.4 0.05AT3G25410 bile acid:sodium symporter family protein 0.4 0.02AT3G04210 disease resistance protein (TIR-‐NBS class), putative 0.4 0.02AT1G11870 SRS (SERYL-‐TRNA SYNTHETASE); serine-‐tRNA ligase SRS (SERYL-‐TRNA SYNTHETASE); ser0.4 0.01ATCG01000 YCF1.1; LOCATED IN: endomembrane system; EXPRESSED IN: guard cell; CONTAINS Inte0.4 0.01AT5G48220 indole-‐3-‐glycerol phosphate synthase, putative indole-‐3-‐glycerol phosphate synth0.4 0.05AT1G68590 plastid-‐specific 30S ribosomal protein 3, putative / PSRP-‐3, putative plastid-‐sp0.4 0.04AT2G18162 CPuORF1 (Conserved peptide upstream open reading frame 1)0.4 0.01AT4G18060 clathrin binding 0.4 0.00AT2G36620 RPL24A (ribosomal protein L24); structural constituent of ribosome0.4 0.02AT1G52290 protein kinase family protein 0.4 0.02AT1G70090 LGT8 (GLUCOSYL TRANSFERASE FAMILY 8); polygalacturonate 4-‐alpha-‐galacturonosyltr0.4 0.01AT3G56910 PSRP5 (PLASTID-‐SPECIFIC 50S RIBOSOMAL PROTEIN 5) 0.4 0.00AT1G56580 unknown protein 0.4 0.00AT5G06320 NHL3 0.4 0.01AT2G20230 LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESS0.4 0.03AT1G03457 RNA-‐binding protein, putative RNA-‐binding protein, putative0.4 0.01AT1G27400 60S ribosomal protein L17 (RPL17A) 0.4 0.04AT5G08350 GRAM domain-‐containing protein / ABA-‐responsive protein-‐related0.4 0.04AT1G43560 Aty2 (Arabidopsis thioredoxin y2); electron carrier/ protein disulfide oxidoredu0.4 0.00AT2G25790 leucine-‐rich repeat transmembrane protein kinase, putative 0.4 0.00AT3G02560 40S ribosomal protein S7 (RPS7B) 40S ribosomal protein S7 (RPS7B)0.4 0.03AT5G11450 oxygen-‐evolving complex-‐related 0.4 0.01AT2G45340 leucine-‐rich repeat transmembrane protein kinase, putative 0.4 0.03AT5G56170 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow0.4 0.04AT1G06190 ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative0.4 0.04AT5G18760 zinc finger (C3HC4-‐type RING finger) family protein 0.4 0.01AT3G21055 PSBTN (photosystem II subunit T) 0.4 0.04AT2G32450 calcium-‐binding EF hand family protein 0.4 0.03AT4G12690 unknown protein 0.4 0.04

AT5G42070 unknown protein 0.4 0.01AT5G51720 unknown protein 0.4 0.01AT1G76020 INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, vacuole; EXPRESS0.4 0.00AT1G36390 co-‐chaperone grpE family protein co-‐chaperone grpE family protein0.4 0.00AT1G11430 plastid developmental protein DAG, putative 0.4 0.01AT3G43800 ATGSTU27 (GLUTATHIONE S-‐TRANSFERASE TAU 27); glutathione transferase0.4 0.02AT1G06630 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow0.4 0.04AT5G57100 transporter-‐related 0.4 0.02AT3G04940 CYSD1 (CYSTEINE SYNTHASE D1); cysteine synthase 0.4 0.02AT4G25910 NFU3; structural molecule 0.4 0.00AT2G22670 IAA8; transcription factor IAA8; transcription factor IAA8; transcription factor0.4 0.04AT4G02200 drought-‐responsive family protein drought-‐responsive family protein drought-‐resp0.4 0.04AT2G29300 tropinone reductase, putative / tropine dehydrogenase, putative0.4 0.04AT1G52280 AtRABG3d (Arabidopsis Rab GTPase homolog G3d); GTP binding0.4 0.03AT5G50900 armadillo/beta-‐catenin repeat family protein 0.4 0.05AT5G12130 PDE149 (PIGMENT DEFECTIVE 149) 0.4 0.03AT1G53290 galactosyltransferase family protein 0.4 0.00AT4G29750 RNA binding 0.4 0.04AT3G57040 ARR9 (RESPONSE REGULATOR 9); transcription regulator/ two-‐component response reg0.4 0.01AT3G47860 apolipoprotein D-‐related 0.4 0.05AT1G18870 ICS2 (ISOCHORISMATE SYNTHASE 2); isochorismate synthase ICS2 (ISOCHORISMATE SYNT0.4 0.03AT2G47590 PHR2 (photolyase/blue-‐light receptor 2); DNA photolyase 0.4 0.01AT3G06850 BCE2; acetyltransferase/ alpha-‐ketoacid dehydrogenase/ dihydrolipoamide branched0.4 0.00AT3G19720 ARC5 (ACCUMULATION AND REPLICATION OF CHLOROPLAST 5); GTP binding / GTPase ARC5 0.4 0.02AT4G04350 EMB2369 (EMBRYO DEFECTIVE 2369); ATP binding / aminoacyl-‐tRNA ligase/ leucine-‐tR0.4 0.03AT3G10080 germin-‐like protein, putative 0.4 0.00AT4G16442 integral membrane family protein 0.4 0.00AT2G31790 UDP-‐glucoronosyl/UDP-‐glucosyl transferase family protein 0.4 0.00AT1G77090 thylakoid lumenal 29.8 kDa protein 0.4 0.01AT3G20680 unknown protein 0.4 0.01AT1G51090 heavy-‐metal-‐associated domain-‐containing protein 0.4 0.03AT4G00895 ATP synthase delta chain-‐related 0.4 0.02AT2G34640 PTAC12 (PLASTID TRANSCRIPTIONALLY ACTIVE12) 0.4 0.02AT5G24420 glucosamine/galactosamine-‐6-‐phosphate isomerase-‐related0.4 0.00

AT5G39790 5'-‐AMP-‐activated protein kinase beta-‐1 subunit-‐related 0.4 0.04AT3G14110 FLU (FLUORESCENT IN BLUE LIGHT); binding FLU (FLUORESCENT IN BLUE LIGHT); bindin0.4 0.02AT5G02120 OHP (ONE HELIX PROTEIN) 0.4 0.00AT1G60230 radical SAM domain-‐containing protein 0.4 0.02AT1G16130 WAKL2 (wall associated kinase-‐like 2); kinase 0.4 0.00AT1G50590 pirin, putative 0.4 0.01AT1G74840 myb family transcription factor 0.4 0.05AT5G57345 unknown protein 0.4 0.01AT3G06130 heavy-‐metal-‐associated domain-‐containing protein 0.4 0.00AT1G27120 galactosyltransferase family protein 0.4 0.00AT3G61550 zinc finger (C3HC4-‐type RING finger) family protein 0.4 0.02AT5G42240 scpl42 (serine carboxypeptidase-‐like 42); serine-‐type carboxypeptidase0.4 0.04AT3G10610 40S ribosomal protein S17 (RPS17C) 0.4 0.03AT1G60160 potassium transporter family protein 0.4 0.03AT2G18710 SCY1 (SecY Homolog 1); P-‐P-‐bond-‐hydrolysis-‐driven protein transmembrane transpor0.4 0.02AT3G44735 PSK1; growth factor 0.4 0.01AT3G57700 protein kinase, putative 0.4 0.01AT1G01790 KEA1 (K EFFLUX ANTIPORTER 1); potassium ion transmembrane transporter/ potassium0.3 0.03AT1G70760 CRR23 ((chlororespiratory reduction 23) 0.3 0.01AT4G18220 purine permease family protein 0.3 0.01AT4G34090 unknown protein unknown protein 0.3 0.03AT1G63180 UGE3 (UDP-‐D-‐glucose/UDP-‐D-‐galactose 4-‐epimerase 3); UDP-‐glucose 4-‐epimerase/ pro0.3 0.02AT4G12970 unknown protein 0.3 0.01AT5G17670 hydrolase, acting on ester bonds 0.3 0.02AT5G49450 AtbZIP1 (Arabidopsis thaliana basic leucine-‐zipper 1); DNA binding / protein het0.3 0.02AT1G48240 ATNPSN12; protein transporter 0.3 0.02AT1G28100 unknown protein unknown protein unknown protein unknown protein unknown protein0.3 0.03AT2G36230 APG10 (ALBINO AND PALE GREEN 10); 1-‐(5-‐phosphoribosyl)-‐5-‐[(5-‐phosphoribosylamino0.3 0.03AT4G37250 leucine-‐rich repeat family protein / protein kinase family protein0.3 0.04AT5G42650 AOS (ALLENE OXIDE SYNTHASE); allene oxide synthase/ hydro-‐lyase/ oxygen binding0.3 0.03AT1G31480 SGR2 (SHOOT GRAVITROPISM 2); phospholipase A1 0.3 0.00AT5G27710 unknown protein 0.3 0.03AT2G01590 CRR3 (CHLORORESPIRATORY REDUCTION 3) 0.3 0.02AT5G20040 ATIPT9; ATP binding / tRNA isopentenyltransferase ATIPT9; ATP binding / tRNA iso0.3 0.03

AT1G19835 unknown protein 0.3 0.04AT4G18950 ankyrin protein kinase, putative 0.3 0.01AT1G18020 12-‐oxophytodienoate reductase, putative 0.3 0.05AT5G18410 PIR121; transcription activator PIR121; transcription activator PIR121; transcri0.3 0.01AT4G24570 mitochondrial substrate carrier family protein 0.3 0.02AT4G28660 PSB28 (PHOTOSYSTEM II REACTION CENTER PSB28 PROTEIN)0.3 0.04AT2G30500 kinase interacting family protein 0.3 0.03AT3G61080 fructosamine kinase family protein 0.3 0.04AT1G61900 unknown protein unknown protein 0.3 0.04AT2G35040 AICARFT/IMPCHase bienzyme family protein 0.3 0.02AT4G37300 MEE59 (maternal effect embryo arrest 59) 0.3 0.03AT3G44610 protein kinase family protein 0.3 0.00AT4G33110 coclaurine N-‐methyltransferase, putative 0.3 0.02AT1G01080 33 kDa ribonucleoprotein, chloroplast, putative / RNA-‐binding protein cp33, puta0.3 0.02AT2G36410 unknown protein unknown protein unknown protein 0.3 0.00AT5G22740 ATCSLA02; mannan synthase/ transferase, transferring glycosyl groups0.3 0.05AT4G20760 short-‐chain dehydrogenase/reductase (SDR) family protein 0.3 0.04AT3G51420 SSL4 (STRICTOSIDINE SYNTHASE-‐LIKE 4); strictosidine synthase0.3 0.01AT5G43750 unknown protein 0.3 0.00AT5G63060 transporter 0.3 0.02AT3G46110 unknown protein unknown protein 0.3 0.04AT2G04845 GCN5-‐related N-‐acetyltransferase (GNAT) family protein GCN5-‐related N-‐acetyltran0.3 0.02AT2G17880 DNAJ heat shock protein, putative 0.3 0.01AT4G39970 haloacid dehalogenase-‐like hydrolase family protein 0.3 0.05AT2G38140 PSRP4 (PLASTID-‐SPECIFIC RIBOSOMAL PROTEIN 4); structural constituent of ribosome0.3 0.03AT2G40960 nucleic acid binding 0.3 0.01AT1G75030 ATLP-‐3 0.3 0.01AT3G59310 unknown protein unknown protein 0.3 0.03AT3G52750 FTSZ2-‐2; GTP binding / GTPase/ structural molecule 0.3 0.04AT1G09390 GDSL-‐motif lipase/hydrolase family protein 0.3 0.01AT1G21880 LYM1 (LYSM DOMAIN GPI-‐ANCHORED PROTEIN 1 PRECURSOR) LYM1 (LYSM DOMAIN GPI-‐ANCHOR0.3 0.01AT2G30150 UDP-‐glucoronosyl/UDP-‐glucosyl transferase family protein 0.3 0.02AT3G05320 unknown protein 0.3 0.05AT5G58120 disease resistance protein (TIR-‐NBS-‐LRR class), putative 0.3 0.03

AT3G51950 zinc finger (CCCH-‐type) family protein / RNA recognition motif (RRM)-‐containing 0.3 0.04AT5G65460 kinesin motor protein-‐related 0.3 0.02AT2G03420 unknown protein 0.3 0.00AT4G32970 unknown protein 0.3 0.01AT2G39180 CCR2 (ARABIDOPSIS THALIANA CRINKLY4 RELATED 2); ATP binding / kinase/ protein ki0.3 0.02AT1G33810 unknown protein 0.3 0.00AT1G74970 RPS9 (RIBOSOMAL PROTEIN S9); structural constituent of ribosome0.3 0.03AT2G22990 SNG1 (SINAPOYLGLUCOSE 1); serine-‐type carboxypeptidase/ sinapoylglucose-‐malate O0.3 0.02AT3G20230 50S ribosomal protein L18 family 0.3 0.01AT4G33666 unknown protein 0.3 0.01AT2G01180 ATPAP1 (PHOSPHATIDIC ACID PHOSPHATASE 1); phosphatidate phosphatase ATPAP1 (PHOS0.3 0.05AT4G00430 PIP1;4 (PLASMA MEMBRANE INTRINSIC PROTEIN 1;4); water channel PIP1;4 (PLASMA MEM0.3 0.04AT1G59910 formin homology 2 domain-‐containing protein / FH2 domain-‐containing protein0.3 0.01AT5G57340 unknown protein unknown protein 0.3 0.03AT2G35860 FLA16 (FASCICLIN-‐LIKE ARABINOGALACTAN PROTEIN 16 PRECURSOR)0.3 0.03AT5G23550 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow0.3 0.02AT1G22370 AtUGT85A5 (UDP-‐glucosyl transferase 85A5); glucuronosyltransferase/ transferase,0.3 0.05AT1G12500 phosphate translocator-‐related 0.3 0.02AT1G35680 50S ribosomal protein L21, chloroplast / CL21 (RPL21) 0.3 0.04AT5G52960 unknown protein 0.3 0.01AT2G04530 CPZ; 3'-‐tRNA processing endoribonuclease 0.3 0.02AT1G11545 xyloglucan:xyloglucosyl transferase, putative / xyloglucan endotransglycosylase,0.3 0.02AT5G14660 PDF1B (PEPTIDE DEFORMYLASE 1B); iron ion binding / peptide deformylase PDF1B (PE0.3 0.04AT4G01900 GLB1 (GLNB1 HOMOLOG); acetylglutamate kinase regulator 0.3 0.03AT2G38460 ATIREG1 (IRON-‐REGULATED PROTEIN 1); transporter 0.3 0.00AT3G13740 URF 4-‐related 0.3 0.00AT4G16146 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow0.3 0.00AT4G02530 chloroplast thylakoid lumen protein 0.3 0.00AT1G52400 BGLU18 (BETA GLUCOSIDASE 18); catalytic/ cation binding / hydrolase, hydrolyzing0.3 0.00AT1G67910 unknown protein 0.3 0.02AT2G16990 tetracycline transporter tetracycline transporter 0.3 0.00AT1G05560 UGT75B1 (UDP-‐GLUCOSYLTRANSFERASE 75B1); UDP-‐glucose:4-‐aminobenzoate acylglucosyl0.3 0.04AT1G19960 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow0.3 0.00AT2G43820 UGT74F2 (UDP-‐GLUCOSYLTRANSFERASE 74F2); UDP-‐glucose:4-‐aminobenzoate acylglucosyl0.3 0.01

AT3G49260 iqd21 (IQ-‐domain 21); calmodulin binding iqd21 (IQ-‐domain 21); calmodulin bindin0.3 0.03AT2G27040 AGO4 (ARGONAUTE 4); nucleic acid binding 0.3 0.02AT1G76450 oxygen-‐evolving complex-‐related 0.3 0.01AT3G25805 unknown protein 0.3 0.04AT5G48790 unknown protein 0.3 0.00AT1G48520 GATB (GLU-‐ADT SUBUNIT B); carbon-‐nitrogen ligase, with glutamine as amido-‐N-‐dono0.3 0.03AT2G34810 FAD-‐binding domain-‐containing protein 0.3 0.00AT3G46630 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow0.3 0.01AT2G17550 unknown protein unknown protein 0.3 0.01AT5G40960 unknown protein 0.3 0.03AT5G13510 ribosomal protein L10 family protein 0.3 0.01AT2G26640 KCS11 (3-‐KETOACYL-‐COA SYNTHASE 11); acyltransferase/ catalytic/ transferase, tra0.3 0.01AT2G01760 ARR14 (ARABIDOPSIS RESPONSE REGULATOR 14); transcription factor/ two-‐component r0.3 0.04AT1G69523 UbiE/COQ5 methyltransferase family protein 0.3 0.01AT1G44000 unknown protein 0.3 0.04AT2G46250 myosin heavy chain-‐related 0.3 0.00AT5G57170 macrophage migration inhibitory factor family protein / MIF family protein0.3 0.02AT3G47560 esterase/lipase/thioesterase family protein esterase/lipase/thioesterase family 0.3 0.02AT1G11410 S-‐locus protein kinase, putative 0.3 0.04AT4G31800 WRKY18; transcription factor WRKY18; transcription factor 0.3 0.01AT1G22550 proton-‐dependent oligopeptide transport (POT) family protein0.3 0.04AT3G07470 unknown protein 0.3 0.04AT4G09650 ATPD (ATP SYNTHASE DELTA-‐SUBUNIT GENE); hydrogen ion transporting ATP synthase, 0.3 0.04AT2G39470 PPL2 (PsbP-‐like protein 2); calcium ion binding PPL2 (PsbP-‐like protein 2); calc0.3 0.01AT3G52960 peroxiredoxin type 2, putative 0.3 0.05AT1G32990 PRPL11 (PLASTID RIBOSOMAL PROTEIN L11); structural constituent of ribosome0.3 0.00AT3G56010 unknown protein 0.3 0.02AT1G17650 GLYR2 (GLYOXYLATE REDUCTASE 2); glyoxylate reductase (NADP)/ phosphogluconate de0.3 0.01AT5G25190 ethylene-‐responsive element-‐binding protein, putative 0.3 0.03no_match no_match 0.3 0.01AT5G63310 NDPK2 (NUCLEOSIDE DIPHOSPHATE KINASE 2); ATP binding / nucleoside diphosphate ki0.3 0.03AT3G07340 basic helix-‐loop-‐helix (bHLH) family protein 0.3 0.02AT1G63470 DNA-‐binding family protein 0.3 0.02AT3G23070 RNA binding 0.3 0.01

AT5G56750 Ndr family protein 0.3 0.03AT5G02710 unknown protein 0.3 0.02AT2G32500 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow0.3 0.03AT3G57930 unknown protein unknown protein 0.3 0.00AT1G65230 unknown protein 0.3 0.01AT1G72790 hydroxyproline-‐rich glycoprotein family protein 0.3 0.04AT4G37080 unknown protein unknown protein 0.3 0.03AT2G40540 KT2 (POTASSIUM TRANSPORTER 2); potassium ion transmembrane transporter KT2 (POTA0.3 0.05AT1G12845 unknown protein 0.3 0.03AT2G24060 translation initiation factor 3 (IF-‐3) family protein 0.3 0.00AT5G14320 30S ribosomal protein S13, chloroplast (CS13) 30S ribosomal protein S13, chlorop0.3 0.00AT5G02940 LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures0.3 0.01AT2G27130 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein0.3 0.02AT3G10940 protein phosphatase-‐related 0.3 0.02AT1G70740 protein kinase family protein 0.3 0.02AT2G35710 glycogenin glucosyltransferase (glycogenin)-‐related glycogenin glucosyltransfera0.3 0.01AT4G01070 GT72B1; UDP-‐glucosyltransferase/ UDP-‐glycosyltransferase/ transferase, transferr0.3 0.03AT3G06070 unknown protein 0.3 0.00AT5G62840 phosphoglycerate/bisphosphoglycerate mutase family protein0.3 0.01AT2G05940 protein kinase, putative 0.3 0.01AT1G27030 unknown protein 0.3 0.04AT2G33990 iqd9 (IQ-‐domain 9); calmodulin binding 0.3 0.04AT5G52440 HCF106; proton motive force dependent protein transmembrane transporter0.3 0.02AT4G15690 glutaredoxin family protein 0.3 0.02AT4G15630 integral membrane family protein 0.3 0.00AT2G37585 glycosyltransferase family 14 protein / core-‐2/I-‐branching enzyme family protein0.3 0.01AT4G12030 bile acid:sodium symporter family protein bile acid:sodium symporter family prot0.3 0.01AT4G22200 AKT2/3 (ARABIDOPSIS POTASSIUM TRANSPORT 2/3); cyclic nucleotide binding / inward0.3 0.02AT2G06925 PLA2-‐ALPHA; phospholipase A2 0.3 0.02AT1G56510 WRR4 (WHITE RUST RESISTANCE 4); ATP binding / nucleoside-‐triphosphatase/ nucleot0.3 0.02AT4G23940 FtsH protease, putative 0.3 0.02AT4G18740 transcription termination factor unknown protein 0.3 0.02AT1G65420 unknown protein 0.3 0.00AT5G53490 thylakoid lumenal 17.4 kDa protein, chloroplast thylakoid lumenal 17.4 kDa prote0.3 0.03

AT1G21410 SKP2A 0.3 0.02AT4G36730 GBF1; sequence-‐specific DNA binding / transcription factor GBF1; sequence-‐specif0.3 0.01AT1G16410 CYP79F1 (CYTOCHROME P450 79F1); oxidoreductase, acting on paired donors, with in0.3 0.02AT4G09900 MES12 (METHYL ESTERASE 12); hydrolase 0.3 0.01AT3G17380 meprin and TRAF homology domain-‐containing protein / MATH domain-‐containing prot0.3 0.01AT5G64310 AGP1 (ARABINOGALACTAN PROTEIN 1) 0.3 0.00AT2G29450 ATGSTU5 (ARABIDOPSIS THALIANA GLUTATHIONE S-‐TRANSFERASE TAU 5); glutathione bind0.3 0.02AT1G25450 KCS5 (3-‐KETOACYL-‐COA SYNTHASE 5); fatty acid elongase 0.3 0.04AT5G41800 amino acid transporter family protein 0.3 0.01AT3G07360 PUB9 (PLANT U-‐BOX 9) PUB9 (PLANT U-‐BOX 9) PUB9 (PLANT U-‐BOX 9); ubiquitin-‐protei0.3 0.03AT3G62700 ATMRP10; ATPase, coupled to transmembrane movement of substances0.3 0.05AT2G03240 LOCATED IN: integral to membrane; EXPRESSED IN: 18 plant structures; EXPRESSED D0.3 0.02AT1G18650 PDCB3 (PLASMODESMATA CALLOSE-‐BINDING PROTEIN 3); callose binding / polysaccharid0.3 0.00AT1G72970 HTH (HOTHEAD); FAD binding / aldehyde-‐lyase/ mandelonitrile lyase HTH (HOTHEAD);0.3 0.02AT5G03760 ATCSLA09; mannan synthase/ transferase, transferring glycosyl groups0.3 0.00AT1G20650 ATP binding / protein kinase/ protein serine/threonine kinase0.3 0.04AT4G08685 SAH7 0.3 0.03AT2G41640 transferase, transferring glycosyl groups 0.3 0.00AT5G64850 unknown protein 0.3 0.01AT5G22340 unknown protein unknown protein 0.3 0.01AT3G52870 calmodulin-‐binding family protein 0.2 0.05AT3G28040 leucine-‐rich repeat transmembrane protein kinase, putative 0.2 0.04AT1G48350 ribosomal protein L18 family protein 0.2 0.02AT3G05800 transcription factor 0.2 0.01AT3G28290 AT14A 0.2 0.01AT3G54200 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow0.2 0.02AT1G02816 unknown protein 0.2 0.05AT2G20670 unknown protein 0.2 0.05AT1G76790 O-‐methyltransferase family 2 protein 0.2 0.02AT1G51080 unknown protein 0.2 0.01AT5G48830 unknown protein 0.2 0.00AT5G56590 glycosyl hydrolase family 17 protein 0.2 0.01AT1G59840 CCB4 (COFACTOR ASSEMBLY OF COMPLEX C) CCB4 (COFACTOR ASSEMBLY OF COMPLEX C)0.2 0.01AT2G24090 ribosomal protein L35 family protein 0.2 0.04

AT4G10770 OPT7 (OLIGOPEPTIDE TRANSPORTER 7); oligopeptide transporter0.2 0.02AT5G51460 ATTPPA; trehalose-‐phosphatase ATTPPA; trehalose-‐phosphatase ATTPPA; trehalose-‐ph0.2 0.01AT1G50040 unknown protein 0.2 0.01AT5G38520 hydrolase, alpha/beta fold family protein hydrolase, alpha/beta fold family prot0.2 0.03AT5G24010 protein kinase family protein 0.2 0.02AT3G52950 CBS domain-‐containing protein / octicosapeptide/Phox/Bemp1 (PB1) domain-‐containi0.2 0.04AT5G48450 sks3 (SKU5 Similar 3); copper ion binding / oxidoreductase 0.2 0.01AT5G41760 nucleotide-‐sugar transporter family protein nucleotide-‐sugar transporter family 0.2 0.02AT5G41100 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow0.2 0.00AT1G66130 oxidoreductase N-‐terminal domain-‐containing protein 0.2 0.01AT4G39710 immunophilin, putative / FKBP-‐type peptidyl-‐prolyl cis-‐trans isomerase, putative0.2 0.05AT5G39320 UDP-‐glucose 6-‐dehydrogenase, putative 0.2 0.02AT4G18340 glycosyl hydrolase family 17 protein 0.2 0.01AT3G13672 seven in absentia (SINA) family protein seven in absentia (SINA) family protein0.2 0.01AT4G17560 ribosomal protein L19 family protein 0.2 0.01AT5G24150 SQP1; squalene monooxygenase SQP1; squalene monooxygenase0.2 0.01AT4G33080 protein kinase, putative protein kinase, putative 0.2 0.00AT2G33450 50S ribosomal protein L28, chloroplast (CL28) 0.2 0.00AT1G75690 chaperone protein dnaJ-‐related 0.2 0.02AT4G33660 unknown protein 0.2 0.01AT5G55400 fimbrin-‐like protein, putative 0.2 0.01AT3G22740 HMT3; homocysteine S-‐methyltransferase 0.2 0.03AT4G26670 mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family0.2 0.00AT2G05990 MOD1 (MOSAIC DEATH 1); enoyl-‐[acyl-‐carrier-‐protein] reductase (NADH)/ enoyl-‐[acy0.2 0.04AT5G65610 unknown protein 0.2 0.01AT3G55840 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow0.2 0.00AT1G75310 AUL1; heat shock protein binding 0.2 0.05AT5G47190 ribosomal protein L19 family protein 0.2 0.04AT4G15920 INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, integr0.2 0.00AT4G16155 dihydrolipoyl dehydrogenase 0.2 0.04AT3G07190 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular protein tra0.2 0.01AT4G01250 WRKY22; transcription factor 0.2 0.03AT3G62000 O-‐methyltransferase family 3 protein 0.2 0.00AT1G65390 ATPP2-‐A5 (ARABIDOPSIS THALIANA PHLOEM PROTEIN 2 A5); carbohydrate binding ATPP2-‐0.2 0.03

AT5G37770 TCH2 (TOUCH 2); calcium ion binding 0.2 0.01AT5G22640 emb1211 (embryo defective 1211) 0.2 0.02AT4G04840 methionine sulfoxide reductase domain-‐containing protein / SeIR domain-‐containin0.2 0.01AT1G29070 ribosomal protein L34 family protein 0.2 0.01AT5G53500 WD-‐40 repeat family protein 0.2 0.03AT1G48480 RKL1; ATP binding / kinase/ protein serine/threonine kinase 0.2 0.02AT3G49680 BCAT3 (BRANCHED-‐CHAIN AMINOTRANSFERASE 3); branched-‐chain-‐amino-‐acid transaminas0.2 0.05AT1G14345 oxidoreductase 0.2 0.01AT1G52030 MBP2 (MYROSINASE-‐BINDING PROTEIN 2); sugar binding / thioglucosidase binding MBP0.2 0.02AT5G13240 transcription regulator 0.2 0.02AT1G70280 NHL repeat-‐containing protein NHL repeat-‐containing protein0.2 0.01AT2G29730 UGT71D1 (UDP-‐GLUCOSYL TRANSFERASE 71D1); UDP-‐glycosyltransferase/ quercetin 3-‐O-‐0.2 0.01AT3G02380 COL2 (constans-‐like 2); transcription factor/ zinc ion binding 0.2 0.03AT5G57700 BNR/Asp-‐box repeat family protein BNR/Asp-‐box repeat family protein BNR/Asp-‐box 0.2 0.03AT2G44500 unknown protein unknown protein 0.2 0.05AT5G13140 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow0.2 0.01AT1G64355 unknown protein unknown protein 0.2 0.03AT3G45850 kinesin motor protein-‐related 0.2 0.03AT2G46225 ABIL1 (Abi-‐1-‐like 1) ABIL1 (Abi-‐1-‐like 1) 0.2 0.01AT1G68410 protein phosphatase 2C-‐related / PP2C-‐related protein phosphatase 2C-‐related / P0.2 0.00AT1G75900 family II extracellular lipase 3 (EXL3) 0.2 0.03AT5G65020 ANNAT2 (Annexin Arabidopsis 2); calcium ion binding / calcium-‐dependent phosphol0.2 0.05AT1G27950 LTPG1 (GLYCOSYLPHOSPHATIDYLINOSITOL-‐ANCHORED LIPID PROTEIN TRANSFER 1)0.2 0.03AT1G13700 glucosamine/galactosamine-‐6-‐phosphate isomerase family protein0.2 0.00AT3G21670 nitrate transporter (NTP3) 0.2 0.01AT4G29780 unknown protein 0.2 0.05AT2G35650 ATCSLA07 (CELLULOSE SYNTHASE LIKE); mannan synthase/ transferase, transferring g0.2 0.04AT2G29290 tropinone reductase, putative / tropine dehydrogenase, putative tropinone reduct0.2 0.04AT1G22330 RNA binding / nucleic acid binding / nucleotide binding 0.2 0.02AT5G55620 unknown protein 0.2 0.03AT5G51560 leucine-‐rich repeat transmembrane protein kinase, putative 0.2 0.03AT4G35470 leucine-‐rich repeat family protein 0.2 0.01AT2G21880 ATRAB7A; GTP binding ATRAB7A; GTP binding 0.2 0.01AT2G23000 scpl10 (serine carboxypeptidase-‐like 10); serine-‐type carboxypeptidase0.2 0.01

AT1G17970 zinc finger (C3HC4-‐type RING finger) family protein 0.2 0.03AT2G45400 BEN1; binding / catalytic/ coenzyme binding / oxidoreductase, acting on CH-‐OH gr0.2 0.01AT5G06870 PGIP2 (POLYGALACTURONASE INHIBITING PROTEIN 2); protein binding0.2 0.04AT5G13400 proton-‐dependent oligopeptide transport (POT) family protein0.2 0.03AT1G27910 PUB45 (PLANT U-‐BOX 45); ubiquitin-‐protein ligase 0.2 0.01AT1G62780 unknown protein 0.2 0.03AT5G57550 XTR3 (XYLOGLUCAN ENDOTRANSGLYCOSYLASE 3); hydrolase, acting on glycosyl bonds / 0.2 0.04AT1G31690 amine oxidase/ copper ion binding / quinone binding 0.2 0.00AT5G67260 CYCD3;2 (CYCLIN D3;2); cyclin-‐dependent protein kinase 0.2 0.00AT5G16590 LRR1; ATP binding / kinase/ protein serine/threonine kinase 0.2 0.00AT1G26210 unknown protein 0.2 0.02AT3G08680 leucine-‐rich repeat transmembrane protein kinase, putative leucine-‐rich repeat t0.2 0.01AT3G56880 VQ motif-‐containing protein 0.2 0.02AT5G54980 integral membrane family protein 0.1 0.03AT3G23750 leucine-‐rich repeat family protein / protein kinase family protein0.1 0.04AT2G41330 glutaredoxin family protein 0.1 0.00AT4G18970 GDSL-‐motif lipase/hydrolase family protein 0.1 0.01AT1G18360 hydrolase, alpha/beta fold family protein 0.1 0.05AT4G30470 cinnamoyl-‐CoA reductase-‐related 0.1 0.03AT5G42800 DFR (DIHYDROFLAVONOL 4-‐REDUCTASE); dihydrokaempferol 4-‐reductase0.1 0.00AT1G64200 VHA-‐E3 (VACUOLAR H+-‐ATPASE SUBUNIT E ISOFORM 3); proton-‐transporting ATPase, rot0.1 0.00AT5G20270 HHP1 (HEPTAHELICAL TRANSMEMBRANE PROTEIN1); receptor0.1 0.05AT4G39770 trehalose-‐6-‐phosphate phosphatase, putative 0.1 0.00AT3G01980 short-‐chain dehydrogenase/reductase (SDR) family protein short-‐chain dehydrogena0.1 0.02AT1G62560 FMO GS-‐OX3 (FLAVIN-‐MONOOXYGENASE GLUCOSINOLATE S-‐OXYGENASE 3); 3-‐methylthiopropy0.1 0.01AT1G56720 protein kinase family protein protein kinase family protein protein kinase famil0.1 0.01AT1G26560 BGLU40 (BETA GLUCOSIDASE 40); catalytic/ cation binding / hydrolase, hydrolyzing0.1 0.00AT4G33420 peroxidase, putative 0.1 0.01AT3G50660 DWF4 (DWARF 4); steroid 22-‐alpha hydroxylase 0.1 0.04AT2G43100 aconitase C-‐terminal domain-‐containing protein 0.1 0.02AT2G17230 EXL5 (EXORDIUM LIKE 5) 0.1 0.05AT2G29310 tropinone reductase, putative / tropine dehydrogenase, putative0.1 0.03AT1G36280 adenylosuccinate lyase, putative / adenylosuccinase, putative0.1 0.00AT1G30520 AAE14 (Acyl-‐Activating Enzyme 14); AMP binding / o-‐succinylbenzoate-‐CoA ligase0.1 0.04

AT1G62660 beta-‐fructosidase (BFRUCT3) / beta-‐fructofuranosidase / invertase, vacuolar0.1 0.02AT5G42200 zinc finger (C3HC4-‐type RING finger) family protein 0.1 0.00AT5G40380 protein kinase family protein 0.1 0.01AT1G07720 KCS3 (3-‐KETOACYL-‐COA SYNTHASE 3); acyltransferase/ catalytic/ transferase, trans0.1 0.00AT3G05490 RALFL22 (ralf-‐like 22); signal transducer 0.1 0.00AT4G12980 auxin-‐responsive protein, putative 0.1 0.01AT2G19440 glycosyl hydrolase family 17 protein 0.1 0.00AT1G77060 mutase family protein 0.1 0.04AT1G76600 unknown protein 0.1 0.01AT5G12940 leucine-‐rich repeat family protein 0.1 0.02AT1G78370 ATGSTU20 (GLUTATHIONE S-‐TRANSFERASE TAU 20); glutathione transferase0.1 0.02AT1G54820 protein kinase family protein 0.1 0.04AT5G45040 cytochrome c6 (ATC6) 0.1 0.00AT3G19620 glycosyl hydrolase family 3 protein 0.1 0.00AT3G28200 peroxidase, putative 0.1 0.01AT4G20170 unknown protein 0.1 0.00AT4G20870 FAH2 (FATTY ACID HYDROXYLASE 2); catalytic/ fatty acid alpha-‐hydroxylase0.1 0.03AT1G14230 nucleoside phosphatase family protein / GDA1/CD39 family protein0.1 0.00AT1G13650 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknow0.1 0.01AT3G60290 oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or r0.1 0.02AT1G10550 XTH33; hydrolase, acting on glycosyl bonds / hydrolase, hydrolyzing O-‐glycosyl c0.1 0.03AT1G49840 unknown protein 0.1 0.02AT2G14890 AGP9 (ARABINOGALACTAN PROTEIN 9) AGP9 (ARABINOGALACTAN PROTEIN 9)0.1 0.00AT1G53520 chalcone-‐flavanone isomerase-‐related 0.1 0.02AT2G34620 mitochondrial transcription termination factor-‐related / mTERF-‐related0.1 0.01AT3G47960 proton-‐dependent oligopeptide transport (POT) family protein0.1 0.03AT1G66100 thionin, putative 0.1 0.03AT3G12110 ACT11 (actin-‐11); structural constituent of cytoskeleton 0.1 0.00AT4G37610 BT5 (BTB AND TAZ DOMAIN PROTEIN 5); protein binding / transcription regulator0.1 0.01AT2G04780 FLA7 (FASCICLIN-‐LIKE ARABINOOGALACTAN 7) FLA7 (FASCICLIN-‐LIKE ARABINOOGALACTAN 70.1 0.01AT5G44050 MATE efflux family protein 0.1 0.02AT5G20630 GER3 (GERMIN 3); oxalate oxidase 0.1 0.00AT2G34930 disease resistance family protein 0.1 0.01AT4G01950 GPAT3 (GLYCEROL-‐3-‐PHOSPHATE ACYLTRANSFERASE 3); acyltransferase0.1 0.00

AT4G25810 XTR6 (XYLOGLUCAN ENDOTRANSGLYCOSYLASE 6); hydrolase, acting on glycosyl bonds / 0.1 0.02AT5G24030 SLAH3 (SLAC1 HOMOLOGUE 3); transporter 0.0 0.03AT3G23730 xyloglucan:xyloglucosyl transferase, putative / xyloglucan endotransglycosylase,0.0 0.04AT5G01015 unknown protein 0.0 0.01AT4G38400 ATEXLA2 (ARABIDOPSIS THALIANA EXPANSIN-‐LIKE A2) 0.0 0.00AT1G22330 RNA binding / nucleic acid binding / nucleotide binding 0.0 0.03AT2G43550 trypsin inhibitor, putative 0.0 0.01AT4G16563 aspartyl protease family protein 0.0 0.00AT1G58270 ZW9 0.0 0.02AT4G17470 palmitoyl protein thioesterase family protein 0.0 0.01AT5G24770 VSP2 (VEGETATIVE STORAGE PROTEIN 2); acid phosphatase VSP2 (VEGETATIVE STORAGE P0.0 0.03

bin name elements p-value

1 PS 37 0.001.1 PS.lightreaction 25 0.001.1.1 PS.lightreaction.photosystem II 13 0.001.1.1.2 PS.lightreaction.photosystem II.PSII polypeptide subunits 10 0.001.1.2 PS.lightreaction.photosystem I 2 0.031.1.40 PS.lightreaction.cyclic electron flow-chlororespiration 2 0.041.3 PS.calvin cyle 12 0.001.3.3 PS.calvin cyle.phosphoglycerate kinase 2 0.051.3.4 PS.calvin cyle.GAP 2 0.051.3.6 PS.calvin cyle.aldolase 2 0.04

3.5 minor CHO metabolism.others 6 0.03

4 glycolysis 14 0.014.9 glycolysis.glyceraldehyde 3-phosphate dehydrogenase 6 0.01

5 fermentation 2 0.03

8 TCA / org. transformation 18 0.058.1.1 TCA / org. transformation.TCA.pyruvate DH 2 0.03

9 mitochondrial electron transport / ATP synthesis 25 0.039.5 mitochondrial electron transport / ATP synthesis.cytochrome c reductase6 0.02

10.6.3 cell wall.degradation.pectate lyases and polygalacturonases 5 0.02

11.1 lipid metabolism.FA synthesis and FA elongation 11 0.02

SI Table S2C. Wild type LMD powdery mildew-impacted processes. MapMan analysis (Thimm et al., 2004) was performed using wild type LMD-selected genes ( 2-fold altered expression in PM infected versus uninfected samples at 5 dpi and p-value 0.05) to identify statisically enriched processes. MapMan bins with p-value 0.05 are shown. Specific genes in MapMan bins are provided in additional worksheets.

13.1.5.1 amino acid metabolism.synthesis.serine-glycine-cysteine group.serine2 0.0413.1.6 amino acid metabolism.synthesis.aromatic aa 5 0.0113.1.6.5 amino acid metabolism.synthesis.aromatic aa.tryptophan 3 0.01

15 metal handling 15 0.0015.2 metal handling.binding, chelation and storage 11 0.03

19 tetrapyrrole synthesis 11 0.00

21 redox.regulation 28 0.0121.1 redox.thioredoxin 9 0.0026.7 misc.oxidases - copper, flavone etc. 4 0.0226.9 misc.glutathione S transferases 7 0.0226.23 misc.rhodanese 3 0.03

27 RNA 121 0.0127.3 RNA.regulation of transcription 93 0.0127.3.23 RNA.regulation of transcription.HSF,Heat-shock transcription factor family3 0.0427.3.52 RNA.regulation of transcription.Global transcription factor group 3 0.0327.3.67 RNA.regulation of transcription.putative DNA-binding protein 9 0.03

29.2 protein.synthesis 107 0.0029.3 protein.targeting 31 0.0229.5 protein.degradation 87 0.0329.8 protein assembly and cofactor ligation 6 0.0029.2.1 protein.synthesis.chloroplast/mito - plastid ribosomal protein 32 0.0029.2.1.1 protein.synthesis.chloroplast/mito - plastid ribosomal protein.plastid26 0.0029.2.1.99protein.synthesis.chloroplast/mito - plastid ribosomal protein.unknown6 0.0029.2.5 protein.synthesis.release 2 0.0529.3.3 protein.targeting.chloroplast 3 0.0229.3.4 protein.targeting.secretory pathway 21 0.0029.3.4.99protein.targeting.secretory pathway.unspecified 16 0.0129.4.1 protein.postranslational modification.kinase 7 0.05

29.4.1.57protein.postranslational modification.kinase.receptor like cytoplasmatic kinase VII5 0.04

30 signalling 62 0.0030.2 signalling.receptor kinases 15 0.0330.2.17 signalling.receptor kinases.DUF 26 5 0.0230.3 signalling.calcium 18 0.0334.16 transport.ABC transporters and multidrug resistance systems 10 0.04

MapMan bins: LMD PMbin description1 At5g01530->chlorophyll A-B binding protein CP29 (LHCB4), identical to CP29 (Arabidopsis thaliana) GI:298036; contains Pfam profile: PF00504 chlorophyll A-B binding protein1 At3g27690->chlorophyll A-B binding protein (LHCB2:4), nearly identical to Lhcb2 protein (Arabidopsis thaliana) GI:4741950; similar to chlorophyll A-B binding protein 151 precursor (LHCP) GB:P27518 from (Gossypium hirsutum); contains Pfam PF00504: Chloroph1 At3g08940->chlorophyll A-B binding protein (LHCB4.2), contains Pfam profile: PF00504 chlorophyll A-B binding protein; identical to Lhcb4.2 protein GB:AAD28774 (Arabidopsis thaliana) or chlorophyll A-B binding protein (LHCB4.2), contains Pfam profile: PF01 AtCg00710->Encodes a 8 kD phosphoprotein that is a component of the photosystem II oxygen evolving core. Its exact molecular function has not been determined but it may play a role in mediating electron transfer between the secondary quinone acceptors, QA1 AtCg00280->chloroplast gene encoding a CP43 subunit of the photosystem II reaction center. promoter contains a blue-light responsive element.1 AtCg00430->photosystem II G protein1 At1g67740->YCF32;photosystem II core complex proteins psbY, chloroplast (PSBY) / L-arginine metabolising enzyme, identical to SP:O49347 Photosystem II core complex proteins psbY, chloroplast precursor (L-arginine metabolising enzyme) (L-AME) (Contains: Ph1 At1g44575->PSBS;NONPHOTOCHEMICAL QUENCHING;photosystem II 22kDa protein, chloroplast / CP22 (PSBS), identical to photosystem II 22 kDa protein, chloroplast (precursor) SP:Q9XF91 from (Arabidopsis thaliana); contains Pfam profile PF00504: Chlorophyll A-B b1 At5g66570->Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In Arabidopsis thaliana the PsbO proteins are encoded by two genes:1 At3g50820->Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In Arabidopsis thaliana the PsbO proteins are encoded by two genes:1 At1g14150->oxygen evolving enhancer 3 (PsbQ) family protein, extrinsic pII protein; contains Pfam profile PF05757: Oxygen evolving enhancer protein 3 (PsbQ) or oxygen evolving enhancer 3 (PsbQ) family protein, extrinsic pII protein; contains Pfam profile1 At1g06680->OEE2;OE23;OXYGEN-EVOLVING ENHANCER PROTEIN 2;photosystem II oxygen-evolving complex 23 (OEC23), JBC 14:211-238 (2002); identical to 23 kDa polypeptide of oxygen-evolving comlex (OEC) GB:CAA66785 GI:1769905 (Arabidopsis thaliana)1 At1g03600->photosystem II family protein, similar to SP:P74367 {Synechocystis sp.}; similar to ESTs emb:Z27038, gb:AA451546, emb:Z29876, gb:T45359 and gb:R903161 At1g19150->PSI TYPE II CHLOROPHYLL A/B-BINDING PROTEIN;chlorophyll A-B binding protein, putative / LHCI type II, putative, very strong similarity to PSI type II chlorophyll a/b-binding protein Lhca2*1 GI:541565 from (Arabidopsis thaliana); contains Pfam p1 AtCg01060->Encodes the PsaC subunit of photosystem I.1 At4g03280->cytochrome B6-F complex iron-sulfur subunit, chloroplast / Rieske iron-sulfur protein / plastoquinol-plastocyanin reductase (petC), identical to gi:9843639; identical to cDNA rieske iron-sulfur protein precursor (petC) GI:5725449 or cytochrome1 AtCg00130->ATPase F subunit.1 At4g09650->ATP synthase delta chain, chloroplast, putative / H(+)-transporting two-sector ATPase, delta (OSCP) subunit, putative, similar to SP:P32980 ATP synthase delta chain, chloroplast precursor (EC 3.6.3.14) {Nicotiana tabacum}; contains Pfam profile1 At3g16250->ferredoxin-related, contains Pfam profile: PF00111 2Fe-2S iron-sulfur cluster binding domains1 At5g66190->ferredoxin--NADP(+) reductase, putative / adrenodoxin reductase, putative, strong similarity to Ferredoxin--NADP reductase, chloroplast precursor (EC 1.18.1.2) (FNR) from {Pisum sativum} SP:P10933, {Mesembryanthemum crystallinum} SP:P41343, {Sp1 AtCg01080->NADH dehydrogenase ND61 AtCg00420->NADH dehydrogenase subunit1 At5g01920->protein kinase family protein, contains eukaryotic protein kinase domain, INTERPRO:IPR0007191 AtCg01070->NADH dehydrogenase ND4L1 AtCg01110->plastid NAD(P)H dehydrogenase subunit H 49KDa protein1 At1g56190->phosphoglycerate kinase, putative, similar to SP:P41758 Phosphoglycerate kinase, chloroplast precursor (EC 2.7.2.3) {Chlamydomonas reinhardtii}; contains Pfam profile PF00162: phosphoglycerate kinase1 At3g12780->PHOSPHOGLYCERATE KINASE 1;phosphoglycerate kinase, putative, similar to SP:P41758 Phosphoglycerate kinase, chloroplast precursor (EC 2.7.2.3) {Chlamydomonas reinhardtii}; contains Pfam profile PF00162: phosphoglycerate kinase1 At1g42970->GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE B SUBUNIT;glyceraldehyde-3-phosphate dehydrogenase B, chloroplast (GAPB) / NADP-dependent glyceraldehydephosphate dehydrogenase subunit B, identical to SP:P25857 Glyceraldehyde 3-phosphate dehydrogenase1 At1g12900->glyceraldehyde 3-phosphate dehydrogenase, chloroplast, putative / NADP-dependent glyceraldehydephosphate dehydrogenase, putative, similar to SP:P25856 Glyceraldehyde 3-phosphate dehydrogenase A, chloroplast precursor (EC 1.2.1.13) (NADP-depende1 At2g21170->TRIOSEPHOSPHATE ISOMERASE;triosephosphate isomerase, chloroplast, putative, similar to Triosephosphate isomerase, chloroplast precursor: SP:P48496 from Spinacia oleracea, SP:P46225 from Secale cereale1 At4g26530->fructose-bisphosphate aldolase, putative, strong similarity to SP:P22197 Fructose-bisphosphate aldolase, cytoplasmic isozyme (EC 4.1.2.13) {Arabidopsis thaliana} or similar to fructose-bisphosphate aldolase, cytoplasmic [Arabidopsis thaliana]1 At2g21330->fructose-bisphosphate aldolase, putative, strong similarity to plastidic fructose-bisphosphate aldolase (EC 4.1.2.13) from Nicotiana paniculata (NPALDP1) (GI:4827251), Oryza sativa, PIR2:T02057 (SP:Q40677) or similar to fructose-bisphosphate a1 At3g54050->fructose-1,6-bisphosphatase, putative / D-fructose-1,6-bisphosphate 1-phosphohydrolase, putative / FBPase, putative, strong similarity to fructose-1,6-bisphosphatase (Brassica napus) GI:289367; identical to SP:P25851 Fructose-1,6-bisphosphatase1 At3g60750->transketolase, putative, strong similarity to transketolase 1 (Capsicum annuum) GI:3559814; contains Pfam profiles PF02779: Transketolase, pyridine binding domain, PF02780: Transketolase, C-terminal domain, PF00456: Transketolase, thiamine diph1 At3g55800->Encodes the chloroplast enzyme sedoheptulose-1,7-bisphosphatase (SBPase), involved in the carbon reduction of the Calvin cycle. Increase in SBPase activity in transgenic lines accumulate up to 50% more sucrose and starch than wild-type.1 At5g44520->ribose 5-phosphate isomerase-related, low similarity to SP:P47968 Ribose 5-phosphate isomerase (EC 5.3.1.6) (Phosphoriboisomerase) {Mus musculus}1 At1g55490->LEN1;CHAPERONIN 60 BETA;CPN60BETA;LESION INITIATION 1;RuBisCO subunit binding-protein beta subunit, chloroplast / 60 kDa chaperonin beta subunit / CPN-60 beta, identical to SWISS-PROT:P21240- RuBisCO subunit binding-protein beta subunit, chloro

MapMan bins: LMD PMbin description3 At2g18700->ATTPSB;TPS11;glycosyl transferase family 20 protein / trehalose-phosphatase family protein, similar to trehalose-6-phosphate synthase SL-TPS/P (Selaginella lepidophylla) GI:4100325; contains Pfam profiles PF00982: Glycosyltransferase family 20,3 At5g10170->inositol-3-phosphate synthase, putative / myo-inositol-1-phosphate synthase, putative / MI-1-P synthase, putative, very strong similarity to SP:Q38862 Myo-inositol-1-phosphate synthase isozyme 2 (EC 5.5.1.4) (MI-1-P synthase 2) (IPS 2) {Arabido3 At5g53580->aldo/keto reductase family protein, contains Pfam profile PF00248: oxidoreductase, aldo/keto reductase family3 At4g27600->pfkB-type carbohydrate kinase family protein, contains Pfam profile: PF00294 pfkB family carbohydrate kinase3 At1g17160->pfkB-type carbohydrate kinase family protein, contains Pfam profile: PF00294 pfkB family carbohydrate kinase3 At1g79500->2-dehydro-3-deoxyphosphooctonate aldolase / phospho-2-dehydro-3-deoxyoctonate aldolase / 3-deoxy-D-manno-octulosonic acid 8-phosphate synthetase (KDSA), identical to Swiss-Prot:Q9AV97 2-dehydro-3-deoxyphosphooctonate aldolase (EC 4.1.2.16) (Pho3 At1g04420->aldo/keto reductase family protein, Similar to SP:Q46933 Tas protein {Escherichia coli}, Babesia aldo-keto reductase SP:P40690; contains Pfam profile PF00248: oxidoreductase, aldo/keto reductase family3 At2g27680->aldo/keto reductase family protein, contains Pfam profile PF00248: oxidoreductase, aldo/keto reductase family3 At1g05570->ATGSL06;ATGSL6;CALLOSE SYNTHASE 1;GLUCAN SYNTHASE-LIKE 6;similar to glycosyl transferase family 48 protein [Arabidopsis thaliana] (TAIR:At5g13000.1); similar to glycosyl transferase family 48 protein [Arabidopsis thaliana] (TAIR:At2g31960.1); s3 At5g08380->alpha-galactosidase, putative / melibiase, putative / alpha-D-galactoside galactohydrolase, putative, similar to alpha-galactosidase SP:Q42656 from (Coffea arabica); contains Pfam profile PF02065: Melibiase3 At3g56310->alpha-galactosidase, putative / melibiase, putative / alpha-D-galactoside galactohydrolase, putative, similar to alpha-galactosidase SP:Q42656 from (Coffea arabica) or alpha-galactosidase, putative / melibiase, putative / alpha-D-galactoside g

MapMan bins: LMD PMbin description4 At3g03250->UGP;UGPASE;Is thought to encodes a cytosolic UDP-glucose pyrophosphorylase with strong similarity to UTP--glucose-1-phosphate uridylyltransferase (SwissProt P19595, EC 2.7.7.9, UDP-glucose pyrophosphorylase Solanum tuberosum).4 At2g22480->phosphofructokinase family protein, similar to phosphofructokinase (Amycolatopsis methanolica) GI:17432243; contains Pfam profile PF00365: Phosphofructokinase4 At4g26530->fructose-bisphosphate aldolase, putative, strong similarity to SP:P22197 Fructose-bisphosphate aldolase, cytoplasmic isozyme (EC 4.1.2.13) {Arabidopsis thaliana} or similar to fructose-bisphosphate aldolase, cytoplasmic [Arabidopsis thaliana]4 At3g04120->GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE C SUBUNIT;glyceraldehyde-3-phosphate dehydrogenase, cytosolic (GAPC) / NAD-dependent glyceraldehyde-3-phosphate dehydrogenase, identical to SP:P25858 Glyceraldehyde 3-phosphate dehydrogenase, cytosolic (4 At3g04120->GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE C SUBUNIT;glyceraldehyde-3-phosphate dehydrogenase, cytosolic (GAPC) / NAD-dependent glyceraldehyde-3-phosphate dehydrogenase, identical to SP:P25858 Glyceraldehyde 3-phosphate dehydrogenase, cytosolic (4 At3g04120->GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE C SUBUNIT;glyceraldehyde-3-phosphate dehydrogenase, cytosolic (GAPC) / NAD-dependent glyceraldehyde-3-phosphate dehydrogenase, identical to SP:P25858 Glyceraldehyde 3-phosphate dehydrogenase, cytosolic (4 At3g04120->GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE C SUBUNIT;glyceraldehyde-3-phosphate dehydrogenase, cytosolic (GAPC) / NAD-dependent glyceraldehyde-3-phosphate dehydrogenase, identical to SP:P25858 Glyceraldehyde 3-phosphate dehydrogenase, cytosolic (4 At3g04120->GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE C SUBUNIT;glyceraldehyde-3-phosphate dehydrogenase, cytosolic (GAPC) / NAD-dependent glyceraldehyde-3-phosphate dehydrogenase, identical to SP:P25858 Glyceraldehyde 3-phosphate dehydrogenase, cytosolic (4 At3g04120->GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE C SUBUNIT;glyceraldehyde-3-phosphate dehydrogenase, cytosolic (GAPC) / NAD-dependent glyceraldehyde-3-phosphate dehydrogenase, identical to SP:P25858 Glyceraldehyde 3-phosphate dehydrogenase, cytosolic (4 At3g12780->PHOSPHOGLYCERATE KINASE 1;phosphoglycerate kinase, putative, similar to SP:P41758 Phosphoglycerate kinase, chloroplast precursor (EC 2.7.2.3) {Chlamydomonas reinhardtii}; contains Pfam profile PF00162: phosphoglycerate kinase4 At1g09780->2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative, strong similarity to SP:Q42908 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1) (Phosphoglyceromutase) {Mesembryanthe4 At2g36530->enolase, identical to SWISS-PROT:P25696 enolase (EC 4.2.1.11) (2-phosphoglycerate dehydratase)(2-phospho-D- glycerate hydro-lyase) (Arabidopsis thaliana)4 At5g63680->pyruvate kinase, putative, similar to pyruvate kinase, cytosolic isozyme (Glycine max) SWISS-PROT:Q428064 At1g53310->PHOSPHOENOLPYRUVATE CARBOXYLASE 1;phosphoenolpyruvate carboxylase, putative / PEP carboxylase, putative (PPC1), strong similarity to SP:P29196 Phosphoenolpyruvate carboxylase (EC 4.1.1.31) (PEPCASE) {Solanum tuberosum}; contains Pfam profile PF

MapMan bins: LMD PMbin description5 At5g17380->pyruvate decarboxylase family protein, similar to 2-hydroxyphytanoyl-CoA lyase (Homo sapiens) GI:6273457; contains InterPro entry IPR000399: Pyruvate decarboxylase5 At3g24503->ALDH1A;REF1;REDUCED EPIDERMAL FLUORESCENCE1;aldehyde dehydrogenase (ALDH1a), identical to aldehyde dehydrogenase ALDH1a (Arabidopsis thaliana) gi:20530143:gb:AAM27004

MapMan bins: LMD PM bin description8 At3g13930->dihydrolipoamide S-acetyltransferase, putative, similar to dihydrolipoamide S-acetyltransferase (Zea mays) GI:5669871; contains Pfam profiles PF00198: 2-oxo acid dehydrogenases acyltransferase (catalytic domain), PF00364: Biotin-requiring enzym8 At3g17240->LIPOAMIDE DEHYDROGENASE 2;dihydrolipoamide dehydrogenase 2, mitochondrial / lipoamide dehydrogenase 2 (MTLPD2), nearly identical to GB:AAF34796 (gi:6984216) from (Arabidopsis thaliana); alternative splice form exists or dihydrolipoamide dehydr8 At2g11270->citrate synthase-related, contains similarity to Swiss-Prot:P20115 citrate synthase, mitochondrial precursor (Arabidopsis thaliana)8 At2g44350->CSY4;CITRATE SYNTHASE 4;citrate synthase, mitochondrial, putative, strong similarity to SP:P20115 Citrate synthase, mitochondrial precursor {Arabidopsis thaliana}; contains Pfam profile PF00285: Citrate synthase or citrate synthase, mitochond8 At4g26970->aconitate hydratase, cytoplasmic, putative / citrate hydro-lyase/aconitase, putative, strong similarity to SP:P49608 Aconitate hydratase, cytoplasmic (EC 4.2.1.3) (Citrate hydro-lyase) (Aconitase) {Cucurbita maxima}; contains Pfam profiles PF008 At2g05710->aconitate hydratase, cytoplasmic, putative / citrate hydro-lyase/aconitase, putative, nearly identical to SP:P49608 Aconitate hydratase, cytoplasmic (EC 4.2.1.3) (Citrate hydro-lyase) (Aconitase) {Cucurbita maxima}; contains Pfam profiles PF0038 At2g17130->ISOCITRATE DEHYDROGENASE SUBUNIT 2;NAD+ DEPENDENT ISOCITRATE DEHYDROGENASE SUBUNIT 2;isocitrate dehydrogenase subunit 2 / NAD+ isocitrate dehydrogenase subunit 2, nearly identical to NAD+ dependent isocitrate dehydrogenase subunit 2 (Arabidopsi8 At3g55410->2-oxoglutarate dehydrogenase E1 component, putative / oxoglutarate decarboxylase, putative / alpha-ketoglutaric dehydrogenase, putative, similar to SP:P20967 2-oxoglutarate dehydrogenase E1 component, mitochondrial precursor (EC 1.2.4.2) (Alpha8 At5g08300->succinyl-CoA ligase (GDP-forming) alpha-chain, mitochondrial, putative / succinyl-CoA synthetase, alpha chain, putative / SCS-alpha, putative, identical to SP:P53586 Succinyl-CoA ligase (GDP-forming) alpha-chain, mitochondrial precursor (EC 6.28 At5g66760->succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial / flavoprotein subunit of complex II, identical to SP:O82663 Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1) (FP) (Flavoprotein subun8 At2g47510,At5g50950 flag_XH2 ->FUMARASE 1;fumarate hydratase, putative / fumarase, putative, similar to SP:P55250 Fumarate hydratase, mitochondrial precursor (EC 4.2.1.2) (Fumarase) {Rhizopus oryzae}; contains Pfam profile PF00206: Lyasefumarate hydratase8 At5g03290->isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative, strong similarity to isocitrate dehydrogenase (NAD+) (Nicotiana tabacum) GI:30215068 At3g09810->AT3G09805;isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative, strong similarity to isocitrate dehydrogenase (NAD+) GB:CAA65502 GI:3021506 (Nicotiana tabacum)8 At1g04410->malate dehydrogenase, cytosolic, putative, strong similarity to malate dehydrogenase from Mesembryanthemum crystallinum (SP:O24047), Medicago sativa (SP:O48905), Prunus persica (GI:15982948); contains InterPro entry IPR001236: Lactate/malate de8 At2g13560->malate oxidoreductase, putative, similar to NAD-dependent malic enzyme 62 kDa isoform, mitochondrial precursor (EC 1.1.1.39) (NAD-ME) (SP:P37221) {Solanum tuberosum}8 At1g09430->ATP-citrate synthase (ATP-citrate (pro-S-)-lyase/citrate cleavage enzyme), putative, similar to ATP-citrate-lyase (GI:16648642) (Arabidopsis thaliana); similar to ATP-citrate (pro-S-)-lyase (EC 4.1.3.8) (Citrate cleavage enzyme)(SP:Q91V92) {Mus8 At1g58180->carbonic anhydrase family protein / carbonate dehydratase family protein, similar to SP:P46512 Carbonic anhydrase 1 (EC 4.2.1.1) (Carbonate dehydratase 1) {Flaveria linearis}; contains Pfam profile PF00484: Carbonic anhydrase or carbonic anhyd8 At3g01500->CARBONIC ANHYDRASE 1;carbonic anhydrase 1, chloroplast / carbonate dehydratase 1 (CA1), nearly identical to SP:P27140 Carbonic anhydrase, chloroplast precursor (EC 4.2.1.1) (Carbonate dehydratase) {Arabidopsis thaliana} or carbonic anhydrase 1

MapMan bins: LMD PMbindescription9 At5g52840->NADH-ubiquinone oxidoreductase-related, contains weak similarity to NADH-ubiquinone oxidoreductase 13 kDa-B subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-13Kd-B) (CI-13Kd-B) (Complex I subunit B13) (Swiss-Prot:Q63362) (Rattus norvegicus)9 At4g21810->Der1-like family protein / degradation in the ER-like family protein, contains Pfam profile: PF04511 Der1-like family9 At4g02580->NADH-ubiquinone oxidoreductase 24 kDa subunit, putative, similar to NADH-ubiquinone oxidoreductase 24 kDa subunit, mitochondrial precursor (EC 1.6.5.3) (EC 1.6.99.3) (Polypeptide II) (Swiss-Prot:P04394) (Bos taurus)9 At3g06310->NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein, contains Pfam profile PF05850: NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8); similar to NADH-ubiquinone oxidoreductase 19 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (C9 At1g49140,At3g18410 flag_XH2 ->NADH-ubiquinone oxidoreductase-related, similar to NADH-ubiquinone oxidoreductase 12 kDa subunit, mitochondrial precursor (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-12KD) (CI-12KD). (Swiss-Prot:Q03015) (Neurospora crassa)NADH-ubi9 At2g02050->NADH-ubiquinone oxidoreductase B18 subunit, putative, contains Pfam PF05676: NADH-ubiquinone oxidoreductase B18 subunit (NDUFB7); similar to NADH-ubiquinone oxidoreductase B18 subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-B18) (CI-B18) (Cell ad9 At1g50940->electron transfer flavoprotein alpha subunit family protein, contains Pfam profile: PF00766 electron transfer flavoprotein, alpha subunit9 At3g22370->ATAOX1A;alternative oxidase 1a, mitochondrial (AOX1A), identical to GB:Q39219 (SP:Q39219) from (Arabidopsis thaliana)9 At5g13430,At5g13440 flag_XH2 ->ubiquinol-cytochrome C reductase iron-sulfur subunit, mitochondrial, putative / Rieske iron-sulfur protein, putative, similar to ubiquinol--cytochrome-c reductase from Solanum tuberosum (SP:P37841), Nicotiana tabacum (SP:P519 At5g05370->ubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative, strong similarity to SP:P46269 Ubiquinol-cytochrome C reductase complex ubiquinone-binding prote9 At3g52730->ubiquinol-cytochrome C reductase UQCRX/QCR9-like family protein, contains Pfam profile: PF05365 ubiquinol-cytochrome C reductase, UQCRX/QCR9 like9 At4g32470->ubiquinol-cytochrome C reductase complex 14 kDa protein, putative, similar to SP:P48502 Ubiquinol-cytochrome C reductase complex 14 kDa protein (EC 1.10.2.2) (CR14) {Solanum tuberosum}; contains Pfam profile PF02271: Ubiquinol-cytochrome C redu9 At3g10860->ubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative, similar to ubiquinol--cytochrome c reductase GI:633687 from (Solanum tuberosum)9 At1g15120->ubiquinol-cytochrome C reductase complex 7.8 kDa protein, putative / mitochondrial hinge protein, putative, similar to SP:P48504 Ubiquinol-cytochrome C reductase complex 7.8 kDa protein (EC 1.10.2.2) (Mitochondrial hinge protein) (CR7) {Solanum9 At3g27240->cytochrome c1, putative, cytochrome c1, heme protein, mitochondrial precursor (Clone PC13III) (Solanum tuberosum) SWISS-PROT:P250769 At3g62400->expressed protein, cytochrome c oxidase subunit 5c - Oryza sativa, EMBL:AB027123 or expressed protein, cytochrome c oxidase subunit 5c - Oryza sativa, EMBL:AB0271239 At4g37830->cytochrome c oxidase-related, contains weak similarity to cytochrome c oxidase polypeptide VIa-liver, mitochondrial precursor (EC 1.9.3.1) (Swiss-Prot:P10818) (Rattus norvegicus)9 At1g53030->cytochrome c oxidase copper chaperone family protein, contains Pfam domian, PF05051: Cytochrome C oxidase copper chaperone (COX17)9 At3g54110->plant uncoupling mitochondrial protein (PUMP), identical to plant uncoupling mitochondrial protein (Arabidopsis thaliana) GI:31151089 At5g08670,At5g08690 flag_XH2 ->ATP synthase beta chain 1, mitochondrial, identical to SP:P83483 ATP synthase beta chain 1, mitochondrial precursor (EC 3.6.3.14) {Arabidopsis thaliana}; strong similarity to SP:P17614 ATP synthase beta chain, mitochondrial9 At5g04750->F1F0-ATPase inhibitor protein, putative, similar to F1F0-ATPase inhibitor protein (Oryza sativa (japonica cultivar-group)) gi:5106371:dbj:BAA816619 At3g46430->expressed protein9 At1g51650->ATP synthase epsilon chain, mitochondrial, identical to ATP synthase epsilon chain, mitochondrial SP:Q96253 from (Arabidopsis thaliana)9 At2g21870->expressed protein or expressed protein9 At2g33040->ATP synthase gamma chain, mitochondrial (ATPC), identical to SP:Q96250 ATP synthase gamma chain, mitochondrial precursor (EC 3.6.3.14) {Arabidopsis thaliana}; contains Pfam profile: PF00231 ATP synthase

MapMan bins: LMD PMbin description10 At5g52560->This gene was shown to have sequence similarities with pea PsUSP gene, encoding an UDP-sugar pyrophosphorylase. UDP-N-acetylglucosamine pyrophosphorylase-related, contains weak similarity to UDP-N-acetylglucosamine pyrophosphorylase (EC 2.7.7.210 At5g15490->UDP-glucose 6-dehydrogenase, putative, very strong similarity to SP:Q96558 UDP-glucose 6-dehydrogenase (EC 1.1.1.22) (UDP-Glc dehydrogenase) (UDP-GlcDH) (UDPGDH) {Glycine max}; contains Pfam profiles PF03721: UDP-glucose/GDP-mannose dehydrogena10 At3g62830,At2g47650 flag_XH2 ->NAD-dependent epimerase/dehydratase family protein, similar to UDP-glucuronic acid decarboxylase Uxs1p from Filobasidiella neoformans GI:14318327; contains Pfam profile PF01370 NAD dependent epimerase/dehydratase family; con10 At4g30440->NAD-dependent epimerase/dehydratase family protein, similar to nucleotide sugar epimerase from Vibrio vulnificus GI:3093975 (PID:g3093975), WbnF (Escherichia coli) GI:5739472, CAPI protein {Staphylococcus aureus} SP:P39858; contains Pfam profil10 At2g45790->eukaryotic phosphomannomutase family protein, contains Pfam profile: PF03332 eukaryotic phosphomannomutase10 At5g64740->cellulose synthase, catalytic subunit, putative, similar to gi:2827141 cellulose synthase catalytic subunit (Ath-A), Arabidopsis thaliana10 At5g09870->cellulose synthase, catalytic subunit, putative, similar to gi:2827141 cellulose synthase catalytic subunit (Ath-A), Arabidopsis thaliana10 At1g55850->CSLE1;cellulose synthase family protein, similar to cellulose synthase catalytic subunit (gi:13925881) from Nicotiana alata, cellulose synthase-5 (gi:9622882) from Zea mays10 At2g35650->ATCSLA7;CSLA07;CELLULOSE SYNTHASE LIKE;glycosyl transferase family 2 protein, similar to beta-(1-3)-glucosyl transferase GB:AAC62210 GI:3687658 from (Bradyrhizobium japonicum), cellulose synthase from Agrobacterium tumeficiens (gi:710492) and A10 At1g27120->galactosyltransferase family protein, contains Pfam profile:PF01762 galactosyltransferase10 At4g37450->arabinogalactan-protein (AGP18), identical to gi_11935088_gb_AAG4196410 At5g20950->glycosyl hydrolase family 3 protein, beta-D-glucan exohydrolase, Nicotiana tabacum, EMBL:AB017502 or glycosyl hydrolase family 3 protein, beta-D-glucan exohydrolase, Nicotiana tabacum, EMBL:AB01750210 At1g75680->glycosyl hydrolase family 9 protein, similar to endo-beta-1,4-glucanase GB:AAC12685 GI:3025470 from (Pinus radiata)10 At4g30270->MERI-5 protein (MERI-5) (MERI5B) / endo-xyloglucan transferase / xyloglucan endo-1,4-beta-D-glucanase (SEN4), identical to endo-xyloglucan transferase gi:944810, SP:P24806 MERI-5 protein precursor (Endo-xyloglucan transferase) (Xyloglucan endo-10 At5g48140->polygalacturonase, putative / pectinase, putative, strong similarity to polygalacturonase PGA3 (Arabidopsis thaliana) GI:3152948; contains PF00295: Glycosyl hydrolases family 28 (polygalacturonases)10 At5g14650->polygalacturonase, putative / pectinase, putative, similar to polygalacturonase PG1 GP:5669846, PG2 GI:5669848 from (Glycine max); contains PF00295: Glycosyl hydrolases family 28 (polygalacturonases)10 At4g23820->glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein, weak similarity to polygalacturonase PG1 (Glycine max) GI:5669846; contains PF00295: Glycosyl hydrolases family 2810 At1g14420->pectate lyase family protein, similar to pectate lyase P59 SP:P15722 from (Lycopersicon esculentum)10 At1g70370->BURP domain-containing protein / polygalacturonase, putative, similar to polygalacturonase isoenzyme 1 beta subunit (Lycopersicon esculentum) GI:170480; contains Pfam profile PF03181: BURP domain10 At2g18660->expansin family protein (EXPR3), identical to Expansin-related protein 3 precursor (Ath-ExpGamma-1.2) (Swiss-Prot:Q9ZV52) (Arabidopsis thaliana); contains Prosite PS00092: N-6 Adenine-specific DNA methylases signature;10 At2g26440->pectinesterase family protein, contains Pfam profile: PF01095 pectinesterase10 At3g29090->pectinesterase family protein, similar to pectinesterase precursor GB:Q43043 (Petunia integrifolia); contains Pfam profile: PF01095 pectinesterase10 At3g14300->pectinesterase family protein, contains Pfam profile: PF01095 pectinesterase10 At3g10720->pectinesterase, putative, contains similarity to pectinesterase from Vitis vinifera GI:15081598, Prunus persica SP:Q43062; contains Pfam profile PF01095 pectinesterase or pectinesterase, putative, contains similarity to pectinesterase from Vit10 At2g47280->pectinesterase family protein, contains Pfam profile: PF01095 pectinesterase10 At5g04970->pectinesterase, putative, contains similarity to pectinesterase from Vitis vinifera GI:15081598, Prunus persica SP:Q43062; contains Pfam profile PF01095 pectinesterase

MapMan bins: LMD PMbin description11 At5g35360->acetyl-CoA carboxylase, biotin carboxylase subunit (CAC2), identical to acetyl-CoA carboxylase, biotin carboxylase subunit (CAC2) (Arabidopsis thaliana) GI:1905876 or similar to methylcrotonyl-CoA carboxylase alpha chain, mitochondrial / 3-met11 At5g36880->acetyl-CoA synthetase, putative / acetate-CoA ligase, putative, similar to SP:P27550 (Escherichia coli) and gi:8439651 (Homo sapiens); contains Pfam AMP-binding enzyme domain PF00501 or similar to acyl-activating enzyme 17 (AAE17) [Arabidopsis11 At1g30520->acyl-activating enzyme 14 (AAE14), identical to acyl-activating enzyme 14 (Arabidopsis thaliana); similar to SP:Q42524 4-coumarate--CoA ligase 1 (EC 6.2.1.12) (4-coumaroyl-CoA synthase 1) {Arabidopsis thaliana}; contains Pfam profile PF00501: A11 At3g05970->LONG-CHAIN ACYL-COA SYNTHETASE 6;long-chain-fatty-acid--CoA ligase / long-chain acyl-CoA synthetase (LACS6), strong similarity to AMP-binding protein (MF39P) gi:1617274 from Brassica napus, similar to putative long-chain-fatty-acid--CoA ligase11 At2g47240->long-chain-fatty-acid--CoA ligase family protein / long-chain acyl-CoA synthetase family protein, similar to GI:1617270 (MF7P) and gi:1617628 (MF45P) from (Brassica napus) ; contains Pfam AMP-binding enzyme domain PF00501 or similar to long-ch11 At1g01120->fatty acid elongase 3-ketoacyl-CoA synthase 1 (KCS1), nearly identical to GB:AAC99312 GI:4091810 from (Arabidopsis thaliana)11 At4g24510->eceriferum protein (CER2), identical to (CER2) (Arabidopsis thaliana) GI:1213594; contains Pfam profile PF02458: Transferase family11 At1g31812->acyl-CoA binding protein / ACBP, identical to acyl-CoA-binding protein (ACBP) (Arabidopsis thaliana) SWISS-PROT:P5775211 At5g52920->pyruvate kinase, putative, similar to pyruvate kinase isozyme G, chloroplast precursor (Nicotiana tabacum) SWISS-PROT:Q4054611 At4g16155->dihydrolipoamide dehydrogenase 2, plastidic / lipoamide dehydrogenase 2 (PTLPD2), identical to plastidic lipoamide dehydrogenase from Arabidopsis thaliana (gi:7159284)11 At1g01090->PYRUVATE DEHYDROGENASE E1 ALPHA;pyruvate dehydrogenase E1 component alpha subunit, chloroplast, identical to pyruvate dehydrogenase E1 alpha subunit GB:AAB86803 GI:2454182 from (Arabidopsis thaliana); identical to cDNA pyruvate dehydrogenase E111 At3g11170,At5g05580 flag_XH2 ->FADD;FATTY ACID DESATURASE 7;OMEGA-3 FATTY ACID DESATURASE, CHLOROPLAST PRECURSOR;omega-3 fatty acid desaturase, chloroplast (FAD7) (FADD), identical to omega-3 fatty acid desaturase, chloroplast precursor SP:P46310 (Arabido11 At4g30950->omega-6 fatty acid desaturase, chloroplast (FAD6) (FADC), identical to GI:49306811 At1g68000->ATPIS;CDP-diacylglycerol--inositol 3-phosphatidyltransferase / phosphatidylinositol synthase (PIS1), identical to phosphatidylinositol synthase (PIS1) GB:AJ000539 (gi:3367632)11 At3g10370->mitochondrial FAD-dependent glycerol-3-phosphate dehydrogenase. possibly involved in storage lipid catabolism and glycerol assimilation, and in glycerol-3-phosphate shuttle which transports reducing power from cytosol to mitochondrion.11 At2g38540->ATLTP1;LIPID TRANSFER PROTEIN 1;nonspecific lipid transfer protein 1 (LTP1), identical to SP:Q4258911 At5g54500->quinone reductase, putative, similar to 1,4-benzoquinone reductase (Phanerochaete chrysosporium)(GI:4454993); contains flavodoxin domain PF0025811 At5g42890->sterol carrier protein 2 (SCP-2) family protein, similar to sterol carrier protein-2 (Homo sapiens) GI:432973; contains Pfam profile PF02036: SCP-2 sterol transfer family11 At4g27270->quinone reductase family protein, similar to 1,4-benzoquinone reductase (Phanerochaete chrysosporium)(GI:4454993); similar to Trp repressor binding protein (Escherichia coli)(SP:P30849); contains flavodoxin domain PF0025811 At4g19860->lecithin:cholesterol acyltransferase family protein / LACT family protein, similar to lysosomal phospholipase A2 (Mus musculus) GI:18699602; contains Pfam profile PF02450: Lecithin:cholesterol acyltransferase (phosphatidylcholine-sterol acyltra11 At1g76150->maoC-like dehydratase domain-containing protein, contains similarity to Swiss-Prot:P51659 estradiol 17 beta-dehydrogenase 4 (17-beta-HSD 4) (17-beta-hydroxysteroid dehydrogenase 4) (Homo sapiens); contains Pfam profile PF01575: MaoC like domain11 At3g48780,At3g48790 flag_XH2 ->serine C-palmitoyltransferase, putative, similar to serine palmitoyltransferase from Solanum tuberosum (GI:4995890), Homo sapiens (SP:O15270), Mus musculus (SP:P97363)serine C-palmitoyltransferase, putative, similar to serin11 At1g27980->pyridoxal-dependent decarboxylase family protein, similar to sphingosine-1-phosphate lyase (Homo sapiens) GI:10129683; contains Pfam profile PF00282: Pyridoxal-dependent decarboxylase conserved domain11 At1g73920->lipase family protein, similar to lipase GB:CAA74737 (SP:O46108) from (Drosophila melanogaster) or lipase family protein, similar to lipase GB:CAA74737 (SP:O46108) from (Drosophila melanogaster)11 At1g28660,At1g28670 flag_XH2 ->lipase, putative, strong similarity to lipase (Arabidopsis thaliana) GI:1145627 or lipase, putative, strong similarity to lipase (Arabidopsis thaliana) GI:1145627lipase, identical to lipase GB:AAA93262 GI:1145627 (Arabidops11 At2g15230->ATLIP1;lipase family protein, similar to SP:P07098 Triacylglycerol lipase, gastric precursor (EC 3.1.1.3) {Homo sapiens}; contains Pfam profile PF04083: ab-hydrolase associated lipase region11 At2g30550->lipase class 3 family protein, similar to DEFECTIVE IN ANTHER DEHISCENCE1 (Arabidopsis thaliana) GI:16215706; contains Pfam profile PF01764: Lipase or lipase class 3 family protein, similar to DEFECTIVE IN ANTHER DEHISCENCE1 (Arabidopsis thali11 At3g18860->transducin family protein / WD-40 repeat family protein, contains seven G-protein beta WD-40 repeats; similar to phospholipase a-2-activating protein SP:P27612 from (Mus musculus) or transducin family protein / WD-40 repeat family protein, con11 At1g74210->glycerophosphoryl diester phosphodiesterase family protein, low similarity to glycerophosphodiester phosphodiesterase (Borrelia hermsii) GI:1399038; contains Pfam profile PF03009: Glycerophosphoryl diester phosphodiesterase family11 At5g65110->acyl-CoA oxidase (ACX2), identical to acyl-CoA oxidase (Arabidopsis thaliana) GI:3044212 or similar to acyl-CoA oxidase, putative [Arabidopsis thaliana] (TAIR:At1g06310.1); similar to acyl-CoA oxidase homolog [Phalaenopsis sp. 'True Lady'] (GB11 At3g06690,At1g06290 flag_XH2 ->acyl-CoA oxidase family, similar to acyl-CoA oxidase (Arabidopsis thaliana) GI:8515709, acyl-CoA oxidase ACX3 (Arabidopsis thaliana) GI:8163758; contains Pfam profile PF01756: Acyl-CoA oxidaseATACX3;ACYL-COA OXIDASE 3;acyl-C11 At5g48880->acetyl-CoA C-acyltransferase 1 / 3-ketoacyl-CoA thiolase 1 (PKT1), identical to 3-keto-acyl-CoA-thiolase 1 (Arabidopsis thaliana) GI:3169568 or acetyl-CoA C-acyltransferase 1 / 3-ketoacyl-CoA thiolase 1 (PKT1), identical to 3-keto-acyl-CoA-thi11 At3g06860->ATMPF2;MFP2;MULTIFUNCTIONAL PROTEIN;fatty acid multifunctional protein (MFP2), identical to fatty acid multifunctional protein (AtMFP2) GB:AF123254 (gi:4337027) (Arabidopsis thaliana) (fatty acid beta-oxidation); contains Pfam profiles PF0273711 At1g60550->naphthoate synthase, putative / dihydroxynaphthoic acid synthetase, putative / DHNA synthetase, putative, contains similarity to MENB from Escherichia coli (SP:P27290), Bacillus subtilis (SP:P23966); contains Pfam profile PF00378 enoyl-CoA hydr11 At4g31780->1,2-diacylglycerol 3-beta-galactosyltransferase, putative / monogalactosyldiacylglycerol synthase, putative / MGDG synthase, putative, similar to MGD synthase type A from Arabidopsis thaliana (gi:9927297), similar to monogalactosyldiacylglycero11 At2g11810->ATMGD3;MONOGALACTOSYLDIACYLGLYCEROL SYNTHASE;1,2-diacylglycerol 3-beta-galactosyltransferase, putative / monogalactosyldiacylglycerol synthase, putative / MGDG synthase, putative, identical to monogalactosyldiacylglycerol synthase type C (gi:99

MapMan bins: LMD PMbin description13 At3g22200->GABA-T;GAMMA-AMINOBUTYRATE TRANSAMINASE;POLLEN-PISTIL INCOMPATIBILITY 2;POLLEN-PISTIL INTERACTION 2;4-aminobutyrate aminotransferase / gamma-amino-N-butyrate transaminase / GABA transaminase / beta-alanine--oxoglutarate aminotransferase, identi13 At5g19550->aspartate aminotransferase, cytoplasmic isozyme 1 / transaminase A (ASP2), identical to SP:P46645 Aspartate aminotransferase, cytoplasmic isozyme 1 (EC 2.6.1.1) (Transaminase A) {Arabidopsis thaliana}13 At5g11520->aspartate aminotransferase, chloroplast / transaminase A (ASP3) (YLS4), identical to SP:P46644 Aspartate aminotransferase, chloroplast precursor (EC 2.6.1.1) (Transaminase A) {Arabidopsis thaliana}; identical to cDNA YLS4 mRNA for aspartate ami13 At5g14800->pyrroline-5-carboxylate reductase, identical to pyrroline-5-carboxylate reductase SP:P54904 from (Arabidopsis thaliana)13 At1g15410->aspartate-glutamate racemase family, contains Pfam profile PF:01177 Aspartate-glutamate racemase family; contains TIGRFAM TIGR00035: aspartate racemase; similar to aspartate racemase (GI:5458794){Pyrococcus abyssi}13 At5g65010->asparagine synthetase 2 (ASN2), identical to asparagine synthetase (ASN2) (Arabidopsis thaliana) GI:3859536 or asparagine synthetase 2 (ASN2), identical to asparagine synthetase (ASN2) (Arabidopsis thaliana) GI:385953613 At3g47340->asparagine synthetase 1 (glutamine-hydrolyzing) / glutamine-dependent asparagine synthetase 1 (ASN1), identical to SP:P49078 Asparagine synthetase (glutamine-hydrolyzing) (EC 6.3.5.4) (Glutamine- dependent asparagine synthetase) {Arabidopsis th13 At1g02500->MAT1;SAM-1;S-adenosylmethionine synthetase 1 (SAM1), identical to S-adenosylmethionine synthetase 1 (Methionine adenosyltransferase 1, AdoMet synthetase 1) (Arabidopsis thaliana) SWISS-PROT:P23686 or S-adenosylmethionine synthetase 1 (SAM1), i13 At2g36880->MAT3;S-adenosylmethionine synthetase, putative, similar to S-adenosylmethionine synthetase 3 (Methionine adenosyltransferase 3, AdoMet synthetase 3) (Lycopersicon esculentum) SWISS-PROT:P4328213 At3g48560->acetolactate synthase, chloroplast / acetohydroxy-acid synthase (ALS), nearly identical to SP:P17597 Acetolactate synthase, chloroplast precursor (EC 2.2.1.6, formerly EC 4.1.3.18) (Acetohydroxy-acid synthase) (ALS) {Arabidopsis thaliana}13 At4g34200->D-3-phosphoglycerate dehydrogenase, putative / 3-PGDH, putative, similar to phosphoglycerate dehydrogenase, Arabidopsis thaliana, SP:O0413013 At1g17745->3-PHOSPHOGLYCERATE DEHYDROGENASE;D-3-phosphoglycerate dehydrogenase / 3-PGDH, identical to SP:O04130 or similar to D-3-phosphoglycerate dehydrogenase, putative / 3-PGDH, putative [Arabidopsis thaliana] (TAIR:At3g19480.1); similar to D-3-phosph13 At1g55920->SAT1;SAT5;SERINE ACETYLTRANSFERASE;SERINE ACETYLTRANSFERASE 1;serine O-acetyltransferase, putative, identical to GI:608677 from (Arabidopsis thaliana)13 At4g33510->2-dehydro-3-deoxyphosphoheptonate aldolase 2 / 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase 2 / DAHP synthetase 2 (DHS2), nearly identical to SP:Q0021813 At1g22410->2-dehydro-3-deoxyphosphoheptonate aldolase, putative / 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase, putative / DAHP synthetase, putative, similar to 3-deoxy-D-arabino-heptulosonate 7-phosphate GI:170224 from (Nicotiana tabacum), SP:P2113 At5g05730->anthranilate synthase, alpha subunit, component I-1 (ASA1), identical to SP:P3206813 At3g54640->tryptophan synthase, alpha subunit (TSA1), identical to gi:61975313 At2g04400->indole-3-glycerol phosphate synthase (IGPS), nearly identical to SP:P4957213 At3g28480->oxidoreductase, 2OG-Fe(II) oxygenase family protein, similar to prolyl 4-hydroxylase, alpha subunit, from Gallus gallus (GI:212530), Rattus norvegicus (GI:474940), Mus musculus (SP:Q60715); contains PF03171 2OG-Fe(II) oxygenase superfamily doma13 At5g14800->pyrroline-5-carboxylate reductase, identical to pyrroline-5-carboxylate reductase SP:P54904 from (Arabidopsis thaliana)13 At2g34470->PSKF109;UREASE ACCESSORY PROTEIN UREG;urease accessory protein (UREG), identical to urease accessory protein UREG GI:4324678 from (Arabidopsis thaliana); contains Pfam profile: PF01495 HypB/UreG nucleotide-binding domain or similar to urease a13 At2g31350->GLX2-5;GLYOXALASE 2-5;hydroxyacylglutathione hydrolase, putative / glyoxalase II, putative, similar to glyoxalase II isozyme (Arabidopsis thaliana) gi:2570338:gb:AAC49865 or hydroxyacylglutathione hydrolase, putative / glyoxalase II, putative,13 At3g15290->3-hydroxybutyryl-CoA dehydrogenase, putative, similar to S(+)-beta-hydroxybutyryl CoA dehydrogenase (3-hydroxybutyryl-CoA dehydrogenase) (Paracoccus denitrificans) GI:12003356; contains Pfam profiles PF02737: 3-hydroxyacyl-CoA dehydrogenase NAD13 At1g60550->naphthoate synthase, putative / dihydroxynaphthoic acid synthetase, putative / DHNA synthetase, putative, contains similarity to MENB from Escherichia coli (SP:P27290), Bacillus subtilis (SP:P23966); contains Pfam profile PF00378 enoyl-CoA hydr13 At1g60550->naphthoate synthase, putative / dihydroxynaphthoic acid synthetase, putative / DHNA synthetase, putative, contains similarity to MENB from Escherichia coli (SP:P27290), Bacillus subtilis (SP:P23966); contains Pfam profile PF00378 enoyl-CoA hydr13 At5g48880->acetyl-CoA C-acyltransferase 1 / 3-ketoacyl-CoA thiolase 1 (PKT1), identical to 3-keto-acyl-CoA-thiolase 1 (Arabidopsis thaliana) GI:3169568 or acetyl-CoA C-acyltransferase 1 / 3-ketoacyl-CoA thiolase 1 (PKT1), identical to 3-keto-acyl-CoA-thi13 At1g11860->aminomethyltransferase, putative, similar to aminomethyltransferase, mitochondrial precursor SP:O49849 from (Flaveria anomala) or aminomethyltransferase, putative, similar to aminomethyltransferase, mitochondrial precursor SP:O49849 from (Flav13 At2g20610->ALF1;HLS3;RTY;RTY1;SUR1;ABERRANT LATERAL ROOT FORMATION 1;HOOKLESS 3;SUPERROOT 1;aminotransferase, putative, similar to nicotianamine aminotransferase from Hordeum vulgare (GI:6498122, GI:6469087); contains Pfam profile PF00155 aminotransferase

MapMan bins: LMD PMbin description15 At5g60950->phytochelatin synthetase-related, contains Pfam profile PF04833: Phytochelatin synthetase-like conserved region15 At5g19140->auxin/aluminum-responsive protein, putative, strong similarity to auxin down-regulated protein ARG10 (Vigna radiata) GI:2970051, wali7 (aluminum-induced protein) (Triticum aestivum) GI:451193 or expressed protein, similar to expressed protein15 At3g07600->heavy-metal-associated domain-containing protein, identical to residues 23 to 179 of farnesylated protein ATFP4 (putative metal-binding protein) GB:AAD09508 (Arabidopsis thaliana); contains Pfam profile PF00403: Heavy-metal-associated domain15 At5g02380->metallothionein protein 2B (MT-2B), identical to SWISS-PROT:Q38805 metallothionein-like protein 2B (MT-2B) (Arabidopsis thaliana)15 At3g15352->COX17;cytochrome c oxidase copper chaperone-related, contains similarity to cytochrome c oxidase copper chaperone (Mus musculus) SWISS-PROT:P5639415 At3g09390->ATMT-1;ATMT-K;MT2;METALLOTHIONEIN 2A;metallothionein protein, putative (MT2A), identical to Swiss-Prot:P25860 metallothionein-like protein 2A (MT-2A) (MT-K) (MT-1G) (Arabidopsis thaliana)15 At1g66240->ATX1;copper homeostasis factor, putative / copper chaperone, putative (CCH), similar to gi:3168840 contains Pfam profile PF00403: Heavy-metal-associated domain15 At2g43510->TRYPSIN INHIBITOR;Encodes a defensin-like (DEFL) family protein.15 At1g55920->SAT1;SAT5;SERINE ACETYLTRANSFERASE;SERINE ACETYLTRANSFERASE 1;serine O-acetyltransferase, putative, identical to GI:608677 from (Arabidopsis thaliana)15 At1g53030->cytochrome c oxidase copper chaperone family protein, contains Pfam domian, PF05051: Cytochrome C oxidase copper chaperone (COX17)15 At1g07610->metallothionein-like protein 1C (MT-1C), identical to Metallothionein-like protein 1C (MT-1C). (SP:Q38804) (Arabidopsis thaliana)15 At2g24850->TAT;TYROSINE AMINOTRANSFERASE 3;aminotransferase, putative, similar to nicotianamine aminotransferase from Hordeum vulgare (GI:6498122, GI:6469087); contains Pfam profile PF00155 aminotransferase, classes I and II15 At2g20610->ALF1;HLS3;RTY;RTY1;SUR1;ABERRANT LATERAL ROOT FORMATION 1;HOOKLESS 3;SUPERROOT 1;aminotransferase, putative, similar to nicotianamine aminotransferase from Hordeum vulgare (GI:6498122, GI:6469087); contains Pfam profile PF00155 aminotransferase15 At2g36880->MAT3;S-adenosylmethionine synthetase, putative, similar to S-adenosylmethionine synthetase 3 (Methionine adenosyltransferase 3, AdoMet synthetase 3) (Lycopersicon esculentum) SWISS-PROT:P4328215 At4g14716,At4g14710 flag_XH2 ->iron-deficiency-responsive protein, putative, strong similarity to iron-deficiency induced gene (Hordeum vulgare) GI:14522834; contains Pfam profile PF03079: ARD/ARD' familyiron-deficiency-responsive protein, putative, stron

MapMan bins: LMD PMbin description19 At3g25660->glutamyl-tRNA(Gln) amidotransferase, putative, similar to SP:O06491 Glutamyl-tRNA(Gln) amidotransferase subunit A (EC 6.3.5.-) {Bacillus subtilis}; contains Pfam profile PF01425: Amidase19 At1g58290->glutamyl-tRNA reductase 1 / GluTR (HEMA1), identical to glutamyl-tRNA reductase 1, chloroplast (SP:P42804)19 At1g08520->CHLD;PDE166;PIGMENT DEFECTIVE 166;magnesium-chelatase subunit chlD, chloroplast, putative / Mg-protoporphyrin IX chelatase, putative (CHLD), similar to Mg-chelatase SP:O24133 from Nicotiana tabacum, GB:AF014399 GI:2318116 from (Pisum sativum)19 At4g25080->magnesium-protoporphyrin O-methyltransferase, putative / magnesium-protoporphyrin IX methyltransferase, putative, similar to SP:Q55467 Magnesium-protoporphyrin O-methyltransferase (EC 2.1.1.1) (Magnesium-protoporphyrin IX methyltransferase) {Sy19 At5g18660->Encodes a protein with 3,8-divinyl protochlorophyllide a 8-vinyl reductase activity. Mutants accumulate divinyl chlorophyll rather than monovinyl chlorophyll.19 At1g03630->PORC;NADPH:PROTOCHLOROPHYLLIDE OXIDOREDUCTASE;protochlorophyllide reductase C, chloroplast / PCR C / NADPH-protochlorophyllide oxidoreductase C (PORC), identical to SP:O48741 protochlorophyllide reductase C, chloroplast precursor (EC 1.3.1.33)19 At3g51820->chlorophyll synthetase, putative, identical to gi:972938 putative chlorophyll synthetase from Arabidopsis thaliana19 At5g26030->ferrochelatase I, identical to Swiss-Prot:P42043 ferrochelatase I, chloroplast/mitochondrial precursor (EC 4.99.1.1) (Protoheme ferro-lyase) (Heme synthetase) (Arabidopsis thaliana) or similar to ferrochelatase II [Arabidopsis thaliana] (TAIR:19 At2g26670->ATHO1;GUN2;TED 4;ELONGATED HYPOCOTYL 1;GENOMES UNCOUPLED 2;HEME OXYGENASE;HEME OXYGENASE 1;PLASTID HEME OXYGENASE;heme oxygenase 1 (HO1) (HY1), identical to plastid heme oxygenase (HY1) (Arabidopsis thaliana) GI:4877362, heme oxygenase 1 (Arabi19 At5g40850->urophorphyrin III methylase (UPM1), identical to urophorphyrin III methylase (GI:1146165) (Arabidopsis thaliana); similar to s-adenosyl-L-methionine-dependent uroporphyrinogen III methyltransferase (GI:1490606) (Arabidopsis thaliana); similar t19 At3g59400->expressed protein

MapMan bins: LMD PMbin description21 At2g47470->ATPDIL2-1;PDI-LIKE 2-1;thioredoxin family protein, similar to protein disulfide isomerase (Dictyostelium discoideum) GI:2627440; contains Pfam profile: PF00085 Thioredoxin or Encodes a protein disulfide isomerase-like (PDIL) protein, a member21 At5g42980->thioredoxin H-type 3 (TRX-H-3) (GIF1), identical to SP:Q42403 Thioredoxin H-type 3 (TRX-H-3) {Arabidopsis thaliana}; identical to cDNA (GIF1) mRNA for thioredoxin GI:99296121 At5g39950->thioredoxin H-type 2 (TRX-H-2) (Gif2), identical to SP:Q38879 Thioredoxin H-type 2 (TRX-H-2) {Arabidopsis thaliana}; identical to cDNA (Gif2) mRNA for thioredoxin GI:99296321 At3g54960->Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily.21 At1g77510->ATPDIL1-2;PDI-LIKE 1-2;Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily.21 At1g45145->ATH5;THIOREDOXIN;thioredoxin H-type 5 (TRX-H-5) (TOUL), identical to SP:Q39241 Thioredoxin H-type 5 (TRX-H-5) {Arabidopsis thaliana}; identical to cDNA (TOUL) mRNA for thioredoxin GI:99296521 At1g35620->ATPDIL5-2;PDI-LIKE 5-2;Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily.21 At4g35460,At2g17420 flag_XH2 ->thioredoxin reductase 1 / NADPH-dependent thioredoxin reductase 1 (NTR1), identical to SP:Q39243ATNTRA;NTR2;similar to thioredoxin reductase 1 / NADPH-dependent thioredoxin reductase 1 (NTR1) [Arabidopsis thaliana] (TAIR:At421 At2g15570->ATM3;thioredoxin M-type 3, chloroplast (TRX-M3), identical to SP:Q9SEU7 Thioredoxin M-type 3, chloroplast precursor (TRX-M3) {Arabidopsis thaliana}21 At5g52240->cytochrome b5 domain-containing protein, similar to SP:P70580 Membrane associated progesterone receptor component 1 {Rattus norvegicus}; contains Pfam profile PF00173: Heme/Steroid binding domain21 At5g38630->cytochrome B561 family protein, contains Pfam domain, PF03188: Cytochrome b56121 At3g52880->monodehydroascorbate reductase, putative, monodehydroascorbate reductase (NADH), Lycoperison esculentum, PIR:T0640721 At2g43350->GLUTATHIONE PEROXIDASE 3;glutathione peroxidase, putative21 At1g06650->2-oxoglutarate-dependent dioxygenase, putative, similar to 2A6 (GI:599622) and tomato ethylene synthesis regulatory protein E8 (SP:P10967); contains Pfam profile: PF00671 Iron/Ascorbate oxidoreductase family or 2-oxoglutarate-dependent dioxyge21 At4g39830->L-ascorbate oxidase, putative, similar to SP:P14133 L-ascorbate oxidase precursor (EC 1.10.3.3) (Ascorbase) {Cucumis sativus}; contains Pfam profile PF00394: Multicopper oxidase21 At4g09010->L-ascorbate peroxidase, chloroplast, putative, identical to SP:P82281:TL29_ARATH (EC 1.11.1.11) {Arabidopsis thaliana}; ascorbate peroxidase - Spinacia oleracea, (gi:1669585); contains Pfam domain PF00141: Peroxidase; contains TIGRfam domain TI21 At1g75270->dehydroascorbate reductase, putative, similar to GI:6939839 from (Oryza sativa)21 At1g77490->L-ascorbate peroxidase, thylakoid-bound (tAPX), identical to thylakoid-bound ascorbate peroxidase GB:CAA67426 (Arabidopsis thaliana)21 At3g24170->ATGR1;glutathione reductase, putative, identical to GB:P48641 from (Arabidopsis thaliana) or similar to gluthatione reductase, chloroplast [Arabidopsis thaliana] (TAIR:At3g54660.1); similar to glutathione reductase [Mesembryanthemum crystallin21 At1g63460->glutathione peroxidase, putative, contains Pfam profile: PF00255 glutathione peroxidases21 At2g31570->GLUTATHIONE PEROXIDASE;GLUTATHIONE PEROXIDASE 2;glutathione peroxidase, putative21 At5g20500->glutaredoxin, putative, similar to glutaredoxin (Populus tremula x Populus tremuloides) gi:19548658:gb:AAL9075021 At5g63030->glutaredoxin, putative, similar to glutaredoxin (Ricinus communis) gi:1732424:emb:CAA8969921 At5g40370->glutaredoxin, putative, similar to glutaredoxin (Ricinus communis) SWISS-PROT:P5514321 At1g28480->glutaredoxin family protein, contains INTERPRO Domain IPR002109, Glutaredoxin (thioltransferase)21 At3g52960->peroxiredoxin type 2, putative, similar to type 2 peroxiredoxin (Brassica rapa subsp. pekinensis) GI:4928472; contains Pfam profile: PF00578 AhpC/TSA (alkyl hydroperoxide reductase and thiol-specific antioxidant) family21 At3g11630->2-cys peroxiredoxin, chloroplast (BAS1), identical to SP:Q96291 2-cys peroxiredoxin BAS1, chloroplast precursor {Arabidopsis thaliana}; contains Pfam profile: PF00578 AhpC/TSA (alkyl hydroperoxide reductase and thiol-specific antioxidant) famil21 At1g08830->superoxide dismutase (Cu-Zn) (SODCC) / copper/zinc superoxide dismutase (CSD1), identical to SWISS-PROT: P24704

MapMan bins: LMD PMbin description26 At5g66680->dolichyl-diphosphooligosaccharide-protein glycosyltransferase 48kDa subunit family protein, similar to SP:Q05052 Dolichyl-diphosphooligosaccharide--protein glycosyltransferase 48 kDa subunit precursor (EC 2.4.1.119) (Oligosaccharyl transferase26 At5g14660->peptide deformylase, chloroplast / polypeptide deformylase 1B (PDF1B), identical to SP:Q9FUZ2 Peptide deformylase, chloroplast precursor (EC 3.5.1.88) (PDF) (Polypeptide deformylase) {Arabidopsis thaliana}; supporting cDNA gi:11320965:gb:AF269126 At3g56460->oxidoreductase, zinc-binding dehydrogenase family protein, low similarity to probable NADP-dependent oxidoreductase (zeta-crystallin homolog) P1 (SP:Q39172)(gi:886428) and P2 (SP:Q39173)(gi:886430), zeta-crystallin / quinone reductase (NADPH) -26 At3g51000->epoxide hydrolase, putative, similar to epoxide hydrolase (Glycine max) GI:2764806; contains Pfam profile PF00561: hydrolase, alpha/beta fold family26 At4g37550->formamidase, putative / formamide amidohydrolase, putative, similar to SP:Q50228 Formamidase (EC 3.5.1.49) (Formamide amidohydrolase) {Methylophilus methylotrophus}; contains Pfam profile PF03069: Acetamidase/Formamidase family or similar to f26 At1g13560->AMINOALCOHOLPHOSPHOTRANSFERASE;AMINOALCOHOLPHOSPHOTRANSFERASE 1;aminoalcoholphosphotransferase (AAPT1), identical to aminoalcoholphosphotransferase GI:3661593 from (Arabidopsis thaliana) or aminoalcoholphosphotransferase (AAPT1), identical to26 At3g23600->dienelactone hydrolase family protein, similar to SP:Q9ZT66 Endo-1,3;1,4-beta-D-glucanase precursor (EC 3.2.1.-) {Zea mays}; contains Pfam profile: PF01738 Dienelactone hydrolase family or similar to dienelactone hydrolase family protein [Arab26 At1g35420->dienelactone hydrolase family protein, low similarity to dienelactone hydrolase (Rhodococcus opacus) GI:23094407; contains Pfam profile PF01738: Dienelactone hydrolase family26 At4g16710->glycosyltransferase family protein 28, low similarity to C terminus subunit of GlcA transferase from Escherichia coli (GI:2586169); contains Pfam profile PF04101: Glycosyltransferase family 28 C-terminal domain or glycosyltransferase family pr26 At3g55830->a member of the Glycosyltransferase Family 64 (according to CAZy Database)26 At1g27120->galactosyltransferase family protein, contains Pfam profile:PF01762 galactosyltransferase26 At2g28080->glycosyltransferase family protein, contains Pfam profile: PF00201 UDP-glucoronosyl and UDP-glucosyl transferase26 At2g30140->UDP-glucoronosyl/UDP-glucosyl transferase family protein, contains Pfam profile: PF00201 UDP-glucoronosyl and UDP-glucosyl transferase26 At5g33290->exostosin family protein, contains Pfam profile: PF03016 Exostosin family26 At5g63800->glycosyl hydrolase family 35 protein, similar to beta-galactosidase GI:7939621 from (Lycopersicon esculentum); contains Pfam profile PF01301: Glycosyl hydrolases family 3526 At1g75680->glycosyl hydrolase family 9 protein, similar to endo-beta-1,4-glucanase GB:AAC12685 GI:3025470 from (Pinus radiata)26 At5g20560->beta-1,3-glucanase, putative, similar to plant beta-1,3-glucanase genes bg4 GI:2808438 from (Arabidopsis thaliana)26 At3g57260->glycosyl hydrolase family 17 protein, similar to glucan endo-1,3-beta-glucosidase, acidic isoform precursor SP:P33157 from (Arabidopsis thaliana)26 At3g57240->similar to glycosyl hydrolase family 17 protein [Arabidopsis thaliana] (TAIR:At3g57260.1); similar to beta-1,3-glucanase (GB:AAA32756.1); contains InterPro domain Glycoside hydrolase, family 17 (InterPro:IPR000490)26 At1g13830->beta-1,3-glucanase-related, similar to beta-1,3-glucanase-like protein (GI:14279169) (Olea europaea) similar to Glucan endo-1,3-beta-glucosidase precursor (EC 3.2.1.39) ((1-3)-beta- glucan endohydrolase) ((1-3)-beta-glucanase) (Beta-1,3- endogl26 At5g16970->NADP-dependent oxidoreductase, putative (P1), identical to probable NADP-dependent oxidoreductase P1, zeta-crystallin homolog (SP:Q39172)(gi:886428), Arabidopsis thaliana; similar to allyl alcohol dehydrogenase (Nicotiana tabacum) GI:6692816; c26 At4g38540->monooxygenase, putative (MO2), identical to GI:342606426 At1g19250->flavin-containing monooxygenase family protein / FMO family protein, low similarity to SP:P97501 Dimethylaniline monooxygenase (N-oxide forming) 3 (EC 1.14.13.8) (Hepatic flavin-containing monooxygenase 3) (FMO 3) {Mus musculus}; contains Pfam26 At3g28480->oxidoreductase, 2OG-Fe(II) oxygenase family protein, similar to prolyl 4-hydroxylase, alpha subunit, from Gallus gallus (GI:212530), Rattus norvegicus (GI:474940), Mus musculus (SP:Q60715); contains PF03171 2OG-Fe(II) oxygenase superfamily doma26 At5g58310->hydrolase, alpha/beta fold family protein, low similarity to SP:Q40708 PIR7A protein {Oryza sativa}, polyneuridine aldehyde esterase (Rauvolfia serpentina) GI:6651393, ethylene-induced esterase (Citrus sinensis) GI:14279437; contains Pfam profi26 At4g20840->FAD-binding domain-containing protein, similar to SP:P30986 reticuline oxidase precursor (Berberine-bridge-forming enzyme) (BBE) (Tetrahydroprotoberberine synthase) (Eschscholzia californica); contains PF01565 FAD binding domain26 At1g08980->AMIDASE-LIKE PROTEIN 1;amidase family protein, similar to component of chloroplast outer membrane translocon Toc64 (Pisum sativum) GI:7453538; contains Pfam profile PF01425: Amidase; supporting cDNA gi:11493701:gb:AF202077.1:AF20207726 At2g29290->tropinone reductase, putative / tropine dehydrogenase, putative, similar to tropinone reductase SP:P50165 from (Datura stramonium)26 At2g29350->tropinone reductase, putative / tropine dehydrogenase, putative, similar to tropinone reductase SP:P50165 from (Datura stramonium) or tropinone reductase, putative / tropine dehydrogenase, putative, similar to tropinone reductase SP:P50165 fro26 At1g78380->GST8;GLUTATHIONE TRANSFERASE 8;glutathione S-transferase, putative, similar to glutathione transferase GI:2853219 from (Carica papaya)26 At1g65820->microsomal glutathione s-transferase, putative, similar to MGST3_HUMAN SP:O1488026 At1g10370->ATGSTU17;GST30;GST30B;GLUTATHIONE S-TRANSFERASE;GLUTATHIONE S-TRANSFERASE 30;GLUTATHIONE S-TRANSFERASE 30B;glutathione S-transferase, putative (ERD9), similar to glutathione S-transferase TSI-1 (Aegilops tauschii) gi:2190992 gb:AAD10129; simila26 At2g02390->GST18;GLUTATHIONE S-TRANSFERASE 18;glutathione S-transferase zeta 1 (GSTZ1) (GST18), identical to SP:Q9ZVQ3:GTZ1_ARATH Glutathione S-transferase zeta-class 1 (EC 2.5.1.18) (AtGSTZ1) (Maleylacetone isomerase) (EC 5.2.1.-) (MAI) {Arabidopsis thal26 At2g29420->GST25;GLUTATHIONE S-TRANSFERASE 25;glutathione S-transferase, putative26 At2g02930,At4g02520 flag_XH2 ->GST16;GLUTATHIONE S-TRANSFERASE 16;glutathione S-transferase, putativeglutathione S-transferase, putative26 At2g30860->ATGSTF7;GLUTTR;glutathione S-transferase, putative, identical to GB:Y1229526 At5g25130->cytochrome P450 family protein, CYTOCHROME P450 71B1 - Thlaspi arvense, EMBL:L2443826 At4g39950->cytochrome P450 79B2, putative (CYP79B2), identical to cytochrome P450 (79B2) SP:O81346 from (Arabidopsis thaliana)26 At4g31500->cytochrome P450 83B1 (CYP83B1), Identical to Cytochrome P450 (SP:O65782 )(Arabidopsis thaliana)26 At3g19270->cytochrome P450 family protein, similar to Cytochrome P450 85 (SP:Q43147) {Lycopersicon esculentum};26 At3g26220->cytochrome P450 family protein, identical to cytochrome P450 monooxygenase (CYP71B3) GB:D78602 (Arabidopsis thaliana) (Plant Mol. Biol. 37 (1), 39-52 (1998))26 At3g26280->cytochrome P450 family protein, identical to cytochrome P450 monooxygenase (CYP71B4) GB:D78603 (Arabidopsis thaliana) (Plant Mol. Biol. 37 (1), 39-52 (1998))26 At3g03470->cytochrome P450, putative, similar to cytochrome P450 89A2 GB:Q42602 (Arabidopsis thaliana)26 At1g75130->cytochrome P450 family protein, similar to Cytochrome P450 72A1 (SP:Q05047) (Catharanthus roseus)26 At1g50560->cytochrome P450, putative, similar to CYTOCHROME P450 93A3 (P450 CP5) (SP:O81973) (Glycine max)26 At1g13110->cytochrome P450 71B7 (CYP71B7), identical to (SP:Q96514) cytochrome P450 71B7 (Arabidopsis thaliana); PF:00067 Cytochrome P450 family. ESTs gb:T44875, gb:T04814, gb:R65111, gb:T44310 and gb:T04541 come from this gene; identical to cDNA cytoch26 At2g24180->CYTOCHROME P450 71B6;CYTOCHROME P450 MONOOXYGENASE 71B6;cytochrome P450 family protein26 At2g28860,At2g28850 flag_XH2 ->cytochrome P450 family protein, similar to Cytochrome P450 61 (C-22 sterol desaturase) (SP:P54781) {Saccharomyces cerevisiae}cytochrome P450 family protein, similar to Cytochrome P450 61 (C-22 sterol desaturase) (SP:P54781)26 At2g45510,At2g44890 flag_XH2 ->cytochrome P450, putativecytochrome P450 family protein, contains Pfam PF00067: Cytochrome P450; similar to Cytochrome P450 86A2 (SP:O23066) (Arabidopsis thaliana)26 At2g30770->cytochrome P450 71A13, putative (CYP71A13), Identical to Cytochrome P450 71A13 (SP:O49342) (Arabidopsis thaliana); similar to Cytochrome P450 (gi:5713172) (Nicotiana tabacum).26 At5g19440->similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), apple tree, PIR:T16995; NOT a cinnamyl-alcohol dehydrogenase26 At5g15180->peroxidase, putative, similar to peroxidase ATP12a (Arabidopsis thaliana) gi:1429217:emb:CAA6731126 At3g49120,At3g49110 flag_XH2 ->peroxidase, putative, identical to peroxidase (Arabidopsis thaliana) gi:405611:emb:CAA50677peroxidase 33 (PER33) (P33) (PRXCA) / neutral peroxidase C (PERC), identical to SP:P24101 Peroxidase 33 precursor (EC 1.11.1.7) (Atpe26 At5g50400->calcineurin-like phosphoesterase family protein, contains Pfam profile: PF00149 calcineurin-like phosphoesterase

26 At5g44020->acid phosphatase class B family protein, similar to SP:P15490 STEM 28 kDa glycoprotein precursor (Vegetative storage protein A) {Glycine max}, acid phosphatase (Glycine max) GI:3341443; contains Pfam profile PF03767: HAD superfamily (subfamily26 At1g13750->PAP1;calcineurin-like phosphoesterase family protein, contains Pfam profile: PF00149 calcineurin-like phosphoesterase26 At2g01180->LPP1;PAP1;PHOSPHATIDIC ACID PHOSPHATASE 1;phosphatidic acid phosphatase family protein / PAP2 family protein, similar to phosphatidic acid phosphatase 2a2 (Cavia porcellus) GI:3641336; contains Pfam profile PF01569 PAP2 superfamily or phosphat26 At5g03350->legume lectin family protein, contains Pfam domain, PF00139: Legume lectins beta domain26 At3g61060->F-box family protein / lectin-related, low similarity to PP2 lectin polypeptide (Cucurbita maxima) GI:410437; contains Pfam profile PF00646: F-box domain or F-box family protein / lectin-related, low similarity to PP2 lectin polypeptide (Cucur26 At1g54030->GDSL-motif lipase, putative, similar to myrosinase-associated proteins GI:1769968, GI:1769970, GI:1216391, GI:1216389 from (Brassica napus); contains Pfam profile PF00657: GDSL-like Lipase/Acylhydrolase26 At2g19130->S-locus lectin protein kinase family protein, contains Pfam domains PF00954: S-locus glycoprotein family, PF00069: Protein kinase domain and PF01453: Lectin (probable mannose binding)26 At3g60190->dynamin-like protein E (DL1E), nearly identical to dynamin-like protein E (Arabidopsis thaliana) GI:19423872; contains Pfam profiles PF01031: Dynamin central region, PF00350: Dynamin family, PF02212: Dynamin GTPase effector domain26 At5g62360->invertase/pectin methylesterase inhibitor family protein, similar to pectinesterase from Arabidosis thaliana SP:Q42534, Lycopersicon esculentum SP:Q43143; contains Pfam profile PF04043: Plant invertase/pectin methylesterase inhibitor26 At3g17130->invertase/pectin methylesterase inhibitor family protein, contains Pfam profile PF04043: Plant invertase/pectin methylesterase inhibitor26 At5g20230->plastocyanin-like domain-containing protein26 At5g53870->plastocyanin-like domain-containing protein, contains similarity to SP:Q02917 Early nodulin 55-2 precursor {Glycine max}; PF02298: Plastocyanin-like domain26 At5g48490->protease inhibitor/seed storage/lipid transfer protein (LTP) family protein, contains Pfam protease inhibitor/seed storage/LTP family domain PF0023426 At1g12090->EXTENSIN-LIKE PROTEIN;protease inhibitor/seed storage/lipid transfer protein (LTP) family protein, similar to 14 kDa polypeptide (Catharanthus roseus) GI:407410; contains Pfam protease inhibitor/seed storage/LTP family domain PF0023426 At2g10940->protease inhibitor/seed storage/lipid transfer protein (LTP) family protein, similar to proline-rich cell wall protein (Medicago sativa) GI:3818416; contains Pfam profile PF00234 Protease inhibitor/seed storage/LTP family or protease inhibitor26 At3g08920->rhodanese-like domain-containing protein, contains rhodanese-like domain PF:0058126 At2g40760->rhodanese-like domain-containing protein, contains rhodanese-like domain PF0058126 At2g42220->rhodanese-like domain-containing protein, contains rhodanese-like domain PF:0058126 At3g47810->calcineurin-like phosphoesterase family protein, contains Pfam profile: PF00149 calcineurin-like phosphoesterase or calcineurin-like phosphoesterase family protein, contains Pfam profile: PF00149 calcineurin-like phosphoesterase or calcineuri26 At1g31550->GDSL-motif lipase, putative, similar to lipase (Arabidopsis thaliana) GI:1145627; contains InterPro Entry IPR001087 Lipolytic enzyme, G-D-S-L family or similar to lipase, putative [Arabidopsis thaliana] (TAIR:At1g28600.1); similar to lipase-li26 At1g28580->GDSL-motif lipase, putative, similar to lipase (Arabidopsis thaliana) GI:1145627; contains InterPro Entry IPR001087 Lipolytic enzyme, G-D-S-L family or GDSL-motif lipase, putative, similar to lipase (Arabidopsis thaliana) GI:1145627; contains26 At1g71500->Rieske (2Fe-2S) domain-containing protein, contains Pfam profile PF00355: iron-sulfur cluster-binding protein, rieske family

MapMan bins: LMD PMbin description27 At5g44500->small nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative, similar to SP:P27048 Small nuclear ribonucleoprotein associated protein B (snRNP-B) (Sm protein B) (Sm-B) (SmB) {Mus musculus} or simi27 At4g25630->fibrillarin 2 (FIB2), identical to fibrillarin 2 GI:9965655 from (Arabidopsis thaliana)27 At3g04680->pre-mRNA cleavage complex family protein, similar to Pre-mRNA cleavage complex II protein Clp1 (Swiss-Prot:Q92989) (Homo sapiens) or pre-mRNA cleavage complex family protein, similar to Pre-mRNA cleavage complex II protein Clp1 (Swiss-Prot:Q9227 At1g19120->small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative, similar to U6 snRNA-associated Sm-like protein LSm1 (Small nuclear ribonuclear CaSm, Cancer-associated Sm-like) (Homo sapiens) SWISS-PROT:O1511627 At1g45100->polyadenylate-binding protein, putative / PABP, putative, similar to polyadenylate-binding protein (poly(A)-binding protein) from {Arabidopsis thaliana} SP:P42731, (Nicotiana tabacum) GI:7673355, (Cucumis sativus) GI:7528270; contains InterPro27 At2g03870->small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative, similar to U6 snRNA-associated Sm-like protein LSm7 (Homo sapiens) SWISS-PROT:Q9UK45 or small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protei27 At1g03330->small nuclear ribonucleoprotein D, putative / snRNP core SM-like protein, putative / U6 snRNA-associated Sm-like protein, putative, similar to SWISS-PROT:Q9Y333 U6 snRNA-associated Sm-like protein LSm2 (Small nuclear ribonuclear protein D homol27 At2g47640->small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative, similar to small nuclear ribonucleoprotein Sm D2 (snRNP core protein D2) (Sm-D2) (Mus musculus) SWISS-PROT:P43330 or small nuclear ribonu27 At2g42270->U5 small nuclear ribonucleoprotein helicase, putative27 At4g03430->pre-mRNA splicing factor-related, similar to pre-mRNA splicing factor pre-mRNA splicing factor prp1 (SP:Q12381) (Fission yeast)27 At3g22330,At3g22310 flag_XH2 ->DEAD box RNA helicase, putative, similar to RNA helicases GI:3775995, GI:3775987 from (Arabidopsis thaliana); contains Pfam profiles PF00270: DEAD/DEAH box helicase, PF00271: Helicase conserved C-terminal domainDEAD box RNA27 At2g47250->RNA helicase, putative, similar to SP:P53131 Pre-mRNA splicing factor RNA helicase PRP43 (Helicase JA1) {Saccharomyces cerevisiae}; contains Pfam profiles PF04408: Helicase associated domain (HA2), PF00271: Helicase conserved C-terminal domain27 At3g03300->DICER-LIKE 2;DEAD/DEAH box helicase carpel factory-related, similar to RNA helicase GB:AAF0353427 AtCg00170->RNA polymerase beta' subunit-227 At5g63670->transcription initiation protein-related, contains weak similarity to Transcription initiation protein SPT4 homolog 1 (Swiss-Prot:Q16550) (Mus musculus)27 At5g51940->DNA-directed RNA polymerase II, putative, similar to SP:O88828 DNA-directed RNA polymerase II 14.4 kDa polypeptide (EC 2.7.7.6) (RPB6) (RPB14.4) {Rattus norvegicus}; contains Pfam profile PF01192: RNA polymerases K / 14 to 18 kDa subunit27 At4g20330->transcription initiation factor-related, contains weak similarity to Transcription initiation factor IIE, beta subunit (TFIIE-beta) (Swiss-Prot:P29084) (Homo sapiens)27 At3g22320->DNA-directed RNA polymerase, putative, similar to SP:P19388 DNA-directed RNA polymerase II 23 kDa polypeptide (EC 2.7.7.6) {Homo sapiens}; contains Pfam profiles PF03871: RNA polymerase Rpb5 N-terminal domain, PF01191: RNA polymerase Rpb5 C-ter27 At1g29940->NRPA2;similar to DNA-directed RNA polymerase, putative [Arabidopsis thaliana] (TAIR:At5g45140.1); similar to hypothetical protein UM01133.1 [Ustilago maydis 521] (GB:EAK81692.1); similar to unnamed protein product [Debaryomyces hansenii CBS767]27 At1g75510->transcription initiation factor IIF beta subunit (TFIIF-beta) family protein, contains Pfam profile: PF02270 transcription initiation factor IIF, beta subunit27 At1g08540->SIG2;SIGA;PUTATIVE PLASTID RNA POLYMERASE SIGMA-SUBUNIT;SIGMA FACTOR B;RNA polymerase sigma subunit SigB (sigB) / sigma factor 2 (SIG2), identical to sigma factor SigB (Arabidopsis thaliana) GI:5478446, plastid RNA polymerase sigma-subunit (Ara27 At2g01280->transcription factor IIB (TFIIB) family protein, contains Pfam domain, PF00382: Transcription factor TFIIB repeat27 At2g23340->encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10.27 At5g52020->encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY.27 At4g25480->encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF3). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low tem27 At3g16770->ATEBP;RAP2.3;RAP2.3;RELATED TO AP2 3;Encodes a member of the ERF (ethylene response factor) subfamily B-2 of the plant specific ERF/AP2 transcription factor family (RAP2.3). The protein contains one AP2 domain. There are 5 members in this subf27 At4g16430->basic helix-loop-helix (bHLH) family protein, contains Pfam profile: PF00010 helix-loop-helix DNA-binding domain27 At4g14410->basic helix-loop-helix (bHLH) family protein or basic helix-loop-helix (bHLH) family protein27 At3g59060->basic helix-loop-helix (bHLH) family protein, contains Pfam profile: PF00010 helix-loop-helix DNA-binding domain or basic helix-loop-helix (bHLH) family protein, contains Pfam profile: PF00010 helix-loop-helix DNA-binding domain or similar to27 At5g57660->zinc finger (B-box type) family protein, contains Pfam domain, PF00643: B-box zinc finger27 At1g68520->zinc finger (B-box type) family protein, contains Pfam profile: PF00643 B-box zinc finger27 At2g24790->COL3;CONSTANS-LIKE 3;zinc finger (B-box type) family protein or zinc finger (B-box type) family protein27 At5g66320->zinc finger (GATA type) family protein or zinc finger (GATA type) family protein27 At4g24470->zinc finger (GATA type) protein ZIM (ZIM), identical to zinc-finger protein expressed in Inflorescence Meristem, ZIM gi:8918533 from (Arabidopsis thaliana) or zinc finger (GATA type) protein ZIM (ZIM), identical to zinc-finger protein expresse27 At1g23420->INNER NO OUTER;INO;inner no outer protein (INO), identical to INNER NO OUTER (INO) (Arabidopsis thaliana) GI:668481627 At5g59820->zinc finger (C2H2 type) family protein (ZAT12), identical to zinc finger protein ZAT12 (Arabidopsis thaliana) gi:1418325:emb:CAA6723227 At4g21160->zinc finger and C2 domain protein (ZAC), identical to zinc finger and C2 domain protein GI:9957238 from (Arabidopsis thaliana) or zinc finger and C2 domain protein (ZAC), identical to zinc finger and C2 domain protein GI:9957238 from (Arabidop27 At1g30500->CCAAT-binding transcription factor (CBF-B/NF-YA) family protein, contains Pfam profile: PF02045 CCAAT-binding transcription factor (CBF-B/NF-YA) or CCAAT-binding transcription factor (CBF-B/NF-YA) family protein, contains Pfam profile: PF0204527 At5g38140->histone-like transcription factor (CBF/NF-Y) family protein, similar to CCAAT-binding transcription factor subunit AAB-1 (GI:2583171) (Neurospora crassa); contains a CBF/NF-Y subunit signature (PDOC00578) presernt in members of histone-like tr27 At3g04450->myb family transcription factor, contains Pfam profile: PF00249 myb-like DNA-binding domain27 At2g01060->myb family transcription factor, contains Pfam profile: PF00249 myb-like DNA-binding domain or myb family transcription factor, contains Pfam profile: PF00249 myb-like DNA-binding domain27 At2g20570->GLK1;GOLDEN2-LIKE 1;golden2-like transcription factor (GLK1), identical to golden2-like transcription factor GI:13311003 from (Arabidopsis thaliana); contains Pfam profile: PF00249 Myb-like DNA-binding domain27 At4g17230->scarecrow-like transcription factor 13 (SCL13)27 At4g17600->lil3 protein, identical to Lil3 protein (Arabidopsis thaliana) gi:4741966:gb:AAD2878027 At3g63350->heat shock transcription factor family protein, contains Pfam profile: PF00447 HSF-type DNA-binding domain27 At1g67970->HSFA8;heat shock factor protein, putative (HSF5) / heat shock transcription factor, putative (HSTF5), identical to heat shock transcription factor 5 (HSF5) SP:Q9S7U5 from (Arabidopsis thaliana); contains Pfam profile: PF00447 HSF-type DNA-bindi27 At1g22590->MADS-box family protein, similar to putative DNA-binding protein GI:6714399 from (Arabidopsis thaliana); MADS-box protein AGL87 or MADS-box family protein, similar to putative DNA-binding protein GI:6714399 from (Arabidopsis thaliana); MADS-bo27 At1g65330,At1g65300 flag_XH2 ->AGL37;PHERES1;MADS-box family protein, similar to MADS-box transcription factor GI:6580941 from (Picea abies)MADS-box protein (AGL38), similar to MADS-box transcription factor GI:6580947 from (Picea abies); contains Pfam pro27 At5g65790->myb family transcription factor (MYB68), identical to putative transcription factor (MYB68) GI:3941493 from (Arabidopsis thaliana); contains Pfam profile: PF00249 myb-like DNA-binding domain27 At5g40360->myb family transcription factor (MYB115), contains Pfam profile: PF00249 myb-like DNA-binding domain27 At5g39700->myb family transcription factor (MYB89), identical to transcription factor (MYB89) GI:5823322 from (Arabidopsis thaliana)27 At5g11510->myb family transcription factor (MYB3R4), contains Pfam profile: PF00249 myb-like DNA-binding domain or similar to myb family transcription factor [Arabidopsis thaliana] (TAIR:At4g32730.1); similar to myb family transcription factor [Arabidops27 At3g50060->myb family transcription factor, contains Pfam profile: PF00249 myb-like DNA-binding domain; identical to cDNA MYB-related protein (1107 bp) GI:126309627 At3g23250->myb family transcription factor (MYB15), similar to myb-related transcription factor GB:CAA66952 from (Lycopersicon esculentum) or similar to myb family transcription factor [Arabidopsis thaliana] (TAIR:At1g06180.1); similar to myb-related tra

27 At3g01140->similar to myb family transcription factor [Arabidopsis thaliana] (TAIR:At5g15310.1); similar to protein 1 [Petunia x hybrida] (GB:CAA78386.1); contains InterPro domain Myb DNA-binding domain (InterPro:IPR001005)27 At5g08520->myb family transcription factor, contains Pfam profile: PF00249 myb-like DNA-binding domain27 At3g11280->myb family transcription factor, contains Pfam profile: PF00249 Myb-like DNA-binding domain or myb family transcription factor, contains Pfam profile: PF00249 Myb-like DNA-binding domain27 At1g52890->ANAC019;no apical meristem (NAM) family protein, contains Pfam PF02365: No apical meristem (NAM) domain; similar to NAM (no apical meristem) GB:CAA63101 from (Petunia x hybrida)27 At1g34190->ANAC017;no apical meristem (NAM) family protein, contains Pfam PF02365: No apical meristem (NAM) protein; similar to NAM protein GI:6066595 (Petunia hybrida); nam-like protein 9 (GI:21105746) (Petunia x hybrida); NAC1 GI:7716952 (Medicago tru27 At2g43000->ANAC042;no apical meristem (NAM) family protein, contains Pfam PF02365: No apical meristem (NAM) domain;27 At1g20980->ATSPL14;FBR6;SPL1R2;SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 14;SQUAMOSA PROMOTER BINDING PROTEIN-LIKE RELATED 2;SPL1-Related2 protein (SPL1R2), strong similarity to SPL1-Related2 protein (Arabidopsis thaliana) GI:6006427; contains Pfam profile P27 At1g76880->trihelix DNA-binding protein, putative, similar to DNA-binding protein DF1 (Pisum sativum) GI:1364698627 At5g24110->WRKY family transcription factor27 At4g31800->WRKY family transcription factor or similar to WRKY family transcription factor [Arabidopsis thaliana] (TAIR:At2g25000.1); similar to WRKY transcription factor 21 [Larrea tridentata] (GB:AAW30662.1); contains InterPro domain DNA-binding WRKY (27 At2g25000->ATWRKY60;WRKY family transcription factor, contains Pfam profile: PF03106 WRKY DNA -binding domain27 At2g46400->ATWRKY46;WRKY family transcription factor27 At2g40740->WRKY family transcription factor, contains Pfam profile: PF0310627 At1g42990->ATBZIP60;AtbZIP60 consists of a bZIP DNA binding domain followed by a putative transmembrane domain. GFP fusions containing the first 260 amino acids (AtbZIP60deltaC) are nuclear-localized. AtbZIP60 is upregulated by the addition of tunicamycin27 At1g27000->bZIP family transcription factor27 At2g42380->bZIP transcription factor family protein or bZIP transcription factor family protein27 At1g67310->similar to calmodulin-binding protein [Arabidopsis thaliana] (TAIR:At5g64220.1); similar to calmodulin-binding transcription activator [Brassica napus] (GB:AAM10969.1); contains InterPro domain IQ calmodulin-binding region (InterPro:IPR000048);27 At3g23050->AXR2;AUXIN RESISTANT 2;auxin-responsive protein / indoleacetic acid-induced protein 7 (IAA7), identical to SP:Q38825:AXI7_ARATH Auxin-responsive protein IAA7 (Indoleacetic acid-induced protein 7) or auxin-responsive protein / indoleacetic acid27 At3g15540->MSG2;auxin-responsive protein / indoleacetic acid-induced protein 19 (IAA19), identical to SP:O24409 Auxin-responsive protein IAA19 (Indoleacetic acid-induced protein 19) {Arabidopsis thaliana}27 At1g61730->DNA-binding storekeeper protein-related, contains Pfam profile: PF04504 protein of unknown function, DUF573; similar to storekeeper protein GI:14268476 (Solanum tuberosum)27 At3g55770->LIM domain-containing protein, similar to pollen specific LIM domain protein 1b (Nicotiana tabacum) GI:6467905, PGPS/D1 (Petunia x hybrida) GI:4105772; contains Pfam profile PF00412: LIM domain or similar to LIM domain-containing protein [Arab27 At5g65630->DNA-binding bromodomain-containing protein, similar to 5.9 kb fsh membrane protein (Drosophila melanogaster) GI:157455; contains Pfam profile PF00439: Bromodomain27 At5g63330->DNA-binding bromodomain-containing protein, contains bromodomain, INTERPRO:IPR001487 or similar to DNA-binding bromodomain-containing protein [Arabidopsis thaliana] (TAIR:At5g14270.1); similar to global transcription factor group E [Zea mays]27 At5g14270->DNA-binding bromodomain-containing protein, contains bromodomain, INTERPRO:IPR00148727 At3g12980->histone acetyltransferase 5 (HAC5), identical to HAC5 (GI:21105780) (Arabidopsis thaliana); similar to CREB-binding protein GB:S39162 from (Homo sapiens)27 At3g44750->histone deacetylase, putative (HD2A), contains Pfam domain, PF00096: Zinc finger, C2H2 type; identical to cDNA putative histone deacetylase (HD2A) GI:1106613427 At2g43500->RWP-RK domain-containing protein, low similarity to nodule inception protein (Lotus japonicus) GI:6448579; contains Pfam profile: PF02042 RWP-RK domain27 At2g35930->U-box domain-containing protein, similar to immediate-early fungal elicitor protein CMPG1 (Petroselinum crispum) GI:14582200; contains Pfam profile PF04564: U-box domain27 At5g65910->BSD domain-containing protein, contains Pfam profile PF03909: BSD domain27 At4g04840->methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein, low similarity to pilin-like transcription factor (Homo sapiens) GI:5059062; contains Pfam profile PF01641: SelR domain27 At3g15590->DNA-binding protein, putative, similar to DNA-binding protein (Triticum aestivum) GI:6958202; contains Pfam profile: PF01535 PPR repeat27 At3g26640->transducin family protein / WD-40 repeat family protein, contains 3 WD-40 repeats (PF00400); similar to ATAN11 (GI:2290528) (Arabidopsis thaliana) (Genes Dev. 11 (11), 1422-1434 (1997)); contains Pfam profile: PF00400 WD domain, G-beta repeat (27 At1g07370->PROLIFERATING CELLULAR NUCLEAR ANTIGEN;proliferating cell nuclear antigen 1 (PCNA1), identical to SP:Q9M7Q7 Proliferating cellular nuclear antigen 1 (PCNA 1) {Arabidopsis thaliana}; nearly identical to SP:Q43124 Proliferating cell nuclear antig27 At1g50620->PHD finger family protein, contains Pfam domain, PF00628: PHD-finger27 At1g56110->NOP56-LIKE PROTEIN;nucleolar protein Nop56, putative, similar to XNop56 protein (Xenopus laevis) GI:14799394; contains Pfam profile PF01798: Putative snoRNA binding domain27 At1g10170->NF-X1 type zinc finger family protein, contains Pfam PF01422: NF-X1 type zinc finger; similar to transcriptional repressor NF-X1 (SP:Q12986) (Homo sapiens); similar to EST gb:T2100227 At2g47790->transducin family protein / WD-40 repeat family protein, similar to WD-repeat protein 5 (SP:Q9UGP9) (Homo sapiens); The first 3 exons are identical to that of GB:AJ224957. This gene appears to be a truncated version of that in GB:AJ224957; cont27 At2g26780->expressed protein, contains Pfam profile TBP (TATA-binding protein) -interacting protein 120 (TIP120); contains TIGRFAM profile TIGR01612: reticulocyte binding protein27 At5g22950->SNF7 family protein, contains Pfam domain, PF03357: SNF7 family27 At3g10640->SNF7 family protein, contains Pfam domain, PF03357: SNF7 family or SNF7 family protein, contains Pfam domain, PF03357: SNF7 family27 At1g73030->SNF7 family protein, contains Pfam domain, PF03357: SNF7 family27 At3g09735->DNA-binding S1FA family protein, contains Pfam profile: PF04689 DNA binding protein S1FA27 At5g58470->zinc finger (Ran-binding) family protein, weak similarity to SP:Q01844 RNA-binding protein EWS (EWS oncogene) (Ewing sarcoma breakpoint region 1 protein) {Homo sapiens}; contains Pfam profiles PF00076: RNA recognition motif. (a.k.a. RRM, RBD, o27 At5g54310->ARF GAP-like zinc finger-containing protein ZIGA3 (ZIGA3), nearly identical to ARF GAP-like zinc finger-containing protein ZIGA3 GI:10441352 from (Arabidopsis thaliana); contains InterPro accession IPR001164: Human Rev interacting-like protein27 At5g10760->aspartyl protease family protein, contains Pfam domain, PF00026: eukaryotic aspartyl protease27 At5g07260->homeobox protein-related, contains weak similarity to Homeobox protein FWA (Swiss-Prot:Q9FVI6) (Arabidopsis thaliana)27 At3g63140->mRNA-binding protein, putative, similar to mRNA binding protein precursor (GI:26453355) (Lycopersicon esculentum)27 At3g57480->zinc finger (C2H2 type, AN1-like) family protein, contains Pfam domain, PF00096: Zinc finger, C2H2 type; contains Pfam domain, PF01428: AN1-like Zinc finger27 At4g39100->PHD finger family protein / bromo-adjacent homology (BAH) domain-containing protein, contains Pfam domain, PF00628: PHD-finger and PF01426: BAH domain27 At4g24770->31 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein RNP-T, putative / RNA-binding protein 1/2/3, putative / RNA-binding protein cp31, putative, similar to SP:Q04836 31 kDa ribonucleoprotein, chloroplast precursor (RNA-binding27 At4g22820->zinc finger (AN1-like) family protein, contains Pfam domains, PF01428: AN1-like Zinc finger and PF01754: A20-like zinc finger or zinc finger (AN1-like) family protein, contains Pfam domains, PF01428: AN1-like Zinc finger and PF01754: A20-like27 At4g22750->zinc finger (DHHC type) family protein, contains DHHC zinc finger domain PF0152927 At4g21610->zinc finger protein, putative, similar to zinc-finger protein Lsd1 (Arabidopsis thaliana) gi:1872521:gb:AAC4966027 At4g12040->zinc finger (AN1-like) family protein, contains Pfam domains, PF01428: AN1-like Zinc finger and PF01754: A20-like zinc finger or zinc finger (AN1-like) family protein, contains Pfam domains, PF01428: AN1-like Zinc finger and PF01754: A20-like27 At3g02890->PHD finger protein-related, contains low similarity to PHD-finger domain proteins27 At1g09950->transcription factor-related, low similarity to tumor-related protein (Nicotiana glauca x Nicotiana langsdorffii) GI:688423, SP:P23923 Transcription factor HBP-1b {Triticum aestivum}

27 At1g09750->chloroplast nucleoid DNA-binding protein-related, contains Pfam profile PF00026: Eukaryotic aspartyl protease;b similar to CND41, chloroplast nucleoid DNA binding protein (GI:2541876) (Nicotiana tabacum)27 At1g51200->zinc finger (AN1-like) family protein, contains Pfam domains, PF01428: AN1-like Zinc finger and PF01754: A20-like zinc finger27 At2g01650->PLANT UBX DOMAIN-CONTAINING PROTEIN 2;zinc finger (C2H2 type) family protein, contains Pfam domain, PF00096: Zinc finger, C2H2 type27 At2g19540->transducin family protein / WD-40 repeat family protein, contains WD-40 repeats (PF00400); similar to Glutamate-rich WD repeat protein (GRWD) (SP:Q9BQ67)(Homo sapiens)27 At2g34620->mitochondrial transcription termination factor-related / mTERF-related, contains Pfam profile PF02536: mTERF27 At5g52470->fibrillarin 1 (FBR1) (FIB1) (SKIP7), identical to fibrillarin 1 GI:9965653 from (Arabidopsis thaliana); C-terminus identical to SKP1 interacting partner 7 GI:10716959 from (Arabidopsis thaliana); contains Pfam domain PF01269: Fibrillarin27 At3g46020->RNA-binding protein, putative, similar to Cold-inducible RNA-binding protein (Glycine-rich RNA-binding protein CIRP) from {Homo sapiens} SP:Q14011, {Rattus norvegicus} SP:Q61413,{Xenopus laevis}; SP:O93235; contains InterPro entry IPR000504: RN27 At4g24770->31 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein RNP-T, putative / RNA-binding protein 1/2/3, putative / RNA-binding protein cp31, putative, similar to SP:Q04836 31 kDa ribonucleoprotein, chloroplast precursor (RNA-binding27 At4g13850->glycine-rich RNA-binding protein (GRP2), glycine-rich RNA binding protein 2 AtGRP2 (Arabidopsis thaliana) GI:2826811 or glycine-rich RNA-binding protein (GRP2), glycine-rich RNA binding protein 2 AtGRP2 (Arabidopsis thaliana) GI:282681127 At3g52380->33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative, similar to chloroplast RNA-binding protein (cp33) GB:BAA06523 (Arabidopsis thaliana) (Plant Mol. Biol. 27 (3), 529-539 (1995)); contains InterPro entry IPR00027 At3g03920->Gar1 RNA-binding region family protein, contains Pfam profile PF04410: Gar1 protein RNA binding region27 At1g32790->CID11;RNA-binding protein, putative, similar to RNA-binding protein GB:CAB40027 GI:4539439 from (Arabidopsis thaliana).Member of a family of PAB2 binding domain proteins. or similar to RNA-binding protein, putative [Arabidopsis thaliana] (TAIR

MapMan bins: LMD PMbin description29 At5g26830->threonyl-tRNA synthetase / threonine--tRNA ligase (THRRS), identical to SP:O04630 Threonyl-tRNA synthetase, mitochondrial precursor (EC 6.1.1.3) (Threonine--tRNA ligase) (ThrRS) {Arabidopsis thaliana}29 At5g49030->tRNA synthetase class I (I, L, M and V) family protein, similar to SP:P41972 Isoleucyl-tRNA synthetase (EC 6.1.1.5) (Isoleucine--tRNA ligase) (IleRS) {Staphylococcus aureus}; contains Pfam profile PF00133: tRNA synthetases class I (I, L, M and29 At3g60340->palmitoyl protein thioesterase family protein, palmitoyl-protein thioesterase precursor, Mus musculus, EMBL:AF071025 or palmitoyl protein thioesterase family protein, palmitoyl-protein thioesterase precursor, Mus musculus, EMBL:AF07102529 At4g31180->aspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative, similar to Aspartyl-tRNA synthetase (Aspartate--tRNA ligase) (AspRS) (Homo sapiens) GI:20178330 or aspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative, si29 At1g29880->glycyl-tRNA synthetase / glycine--tRNA ligase, identical to SP:O23627 Glycyl-tRNA synthetase (EC 6.1.1.14) (Glycine--tRNA ligase) (GlyRS) {Arabidopsis thaliana}29 AtCg01120->encodes a chloroplast ribosomal protein S15, a constituent of the small subunit of the ribosomal complex29 AtCg00065->chloroplast gene encoding ribosomal protein s12. The gene is located in three distinct loci on the chloroplast genome and is transpliced to make one transcript.29 AtCg01020->encodes a chloroplast ribosomal protein L32, a constituent of the large subunit of the ribosomal complex29 AtCg00650->chloroplast-encoded ribosomal protein S1829 AtCg00770->chloroplast 30S ribosomal protein S829 AtCg00780->encodes a chloroplast ribosomal protein L14, a constituent of the large subunit of the ribosomal complex29 AtCg00790->chloroplast gene encoding a ribosomal protein L16, which is a constituent of 50S large ribosomal subunit29 AtCg00800->encodes a chloroplast ribosomal protein S3, a constituent of the small subunit of the ribosomal complex29 AtCg00810->encodes a chloroplast ribosomal protein L22, a constituent of the large subunit of the ribosomal complex29 AtCg00820->Encodes a 6.8-kDa protein of the small ribosomal subunit.29 AtCg00840,AtCg01300 flag_XH2 ->One of two chloroplast genes that encode chloroplast ribosomal protein L23, a constituent of the large subunit of the ribosomal complexOne of two chloroplast genes that encode chloroplast ribosomal protein L23, a constituen29 AtCg00160->Chloroplast ribosomal protein S229 AtCg00330->30S chloroplast ribosomal protein S1429 AtCg00050->Homologous to the bacterial ribosomal protein S1629 At5g54600->50S ribosomal protein L24, chloroplast (CL24), identical to SP:P92959 50S ribosomal protein L24, chloroplast precursor {Arabidopsis thaliana} or 50S ribosomal protein L24, chloroplast (CL24), identical to SP:P92959 50S ribosomal protein L24,29 At5g47190->ribosomal protein L19 family protein, similar to plastid ribosomal protein L19 precursor (Spinacia oleracea) gi:7582403:gb:AAF6431229 At3g63490->ribosomal protein L1 family protein, ribosomal protein L1, S.oleracea, EMBL:SORPL1 or ribosomal protein L1 family protein, ribosomal protein L1, S.oleracea, EMBL:SORPL129 At3g54210->ribosomal protein L17 family protein, contains Pfam profile: PF01196 ribosomal protein L1729 At3g27160->ribosomal protein S21 family protein, contains Pfam profile: PF01165 ribosomal protein S2129 At3g25920->50S ribosomal protein L15, chloroplast (CL15), identical to GB:P25873 from (Arabidopsis thaliana)29 At1g29070->ribosomal protein L34 family protein, similar to plastid ribosomal protein L34 precursor GB:AAF64157 GI:7578860 from (Spinacia oleracea)29 At1g07320->RIBOSOMAL PROTEIN L4;50S ribosomal protein L4, chloroplast (CL4), identical to SP:O50061 from (Arabidopsis thaliana) or 50S ribosomal protein L4, chloroplast (CL4), identical to SP:O50061 from (Arabidopsis thaliana) or similar to ribosomal pr29 At1g75350->EMB2184;EMBRYO DEFECTIVE 2184;ribosomal protein L31 family protein, similar to SP:O46917 from (Guillardia theta)29 At1g64510->ribosomal protein S6 family protein, similar to plastid ribosomal protein S6 precursor GB:AAF64311 GI:7582401 from (Spinacia oleracea)29 At1g35680->50S ribosomal protein L21, chloroplast / CL21 (RPL21), identical to 50S ribosomal protein L21, chloroplast precursor (CL21) (Arabidopsis thaliana) SWISS-PROT:P5141229 At1g05190->EMB2394;EMBRYO DEFECTIVE 2394;ribosomal protein L6 family protein, Similar to Mycobacterium RlpF (gb:Z84395). ESTs gb:T75785,gb:R30580,gb:T04698 come from this gene29 At5g16200->50S ribosomal protein-related, contains weak similarity to Cyanelle 50S ribosomal protein L35. (Swiss-Prot:P14810) (Cyanophora paradoxa)29 At5g65220->ribosomal protein L29 family protein, contains Pfam profile PF00831: ribosomal protein L2929 At5g24490->30S ribosomal protein, putative, similar to SP:P19954 Plastid-specific 30S ribosomal protein 1, chloroplast precursor (CS-S5) (CS5) (S22) (Ribosomal protein 1) (PSRP-1) {Spinacia oleracea}; contains Pfam profile PF02482: Sigma 54 modulation pro29 At2g43030->ribosomal protein L3 family protein, contains Pfam profile PF00297: ribosomal protein L329 At2g38140->30S RIBOSOMAL PROTEIN S31;PLASTID-SPECIFIC RIBOSOMAL PROTEIN 4;chloroplast 30S ribosomal protein S31 (PSRP4)29 At2g33800->ribosomal protein S5 family protein, contains Pfam profiles PF03719: Ribosomal protein S5, C-terminal domain, PF00333: Ribosomal protein S5, N-terminal domain29 At4g14320->60S ribosomal protein L36a/L44 (RPL36aB)29 At4g16720->60S ribosomal protein L15 (RPL15A)29 At5g20290->40S ribosomal protein S8 (RPS8A), ribosomal protein S8 - Zea mays, PIR:T0408829 At5g27850->60S ribosomal protein L18 (RPL18C), 60S ribosomal protein L18, Arabidopsis thaliana, SWISSPROT:RL18_ARATH29 At5g58420->40S ribosomal protein S4 (RPS4D), ribosomal protein S4, Arabidopsis thaliana, PIR:T4848029 At5g56670->40S ribosomal protein S30 (RPS30C)29 At5g23740->40S ribosomal protein S11 (RPS11C)29 At2g04390,At5g04800,At2g05220 -> flag_XH3 40S ribosomal protein S17 (RPS17A)40S ribosomal protein S17 (RPS17D), 40S ribosomal protein S17, Lycopersicon esculentum, EMBL:AF161704 or 40S ribosomal protein S17 (RPS17D), 40S ribosomal protein S17, Lycopersic29 At5g03850->40S ribosomal protein S28 (RPS28B), ribosomal protein S28, Arabidopsis thaliana, EMBL:ATRP28A29 At5g02450->60S ribosomal protein L36 (RPL36C), 60S ribosomal protein L36, Arabidopsis thaliana, EMBL:AC00468429 At3g61110->40S ribosomal protein S27 (ARS27A), identical to cDNA ribosomal protein S27 (ARS27A) GI:419338129 At3g53890->40S ribosomal protein S21 (RPS21B), ribosomal protein S21, cytosolic - Oryza sativa, PIR:S3835729 At3g53430->60S ribosomal protein L12 (RPL12B), 60S RIBOSOMAL PROTEIN L12, Prunus armeniaca, SWISSPROT:RL12_PRUAR29 At3g53020->Regulated by TCP20.29 At3g49010->60S ribosomal protein L13 (RPL13B) / breast basic conserved protein 1-related (BBC1) or 60S ribosomal protein L13 (RPL13B) / breast basic conserved protein 1-related (BBC1) or similar to 60S ribosomal protein L13 (RPL13D) [Arabidopsis thalian29 At3g46040->Regulated by TCP20.29 At3g44010,At3g43980 flag_XH2 ->40S ribosomal protein S29 (RPS29B), ribosomal protein S29, rat, PIR:S3029840S ribosomal protein S29 (RPS29A), ribosomal protein S29, rat, PIR:S30298

29 At4g39200->40S ribosomal protein S25 (RPS25E), ribosomal protein S25, Lycopersicon esculentum, PIR2:S4008929 At4g33865->40S ribosomal protein S29 (RPS29C)29 At4g31985->60S ribosomal protein L39 (RPL39C)29 At4g29390->40S ribosomal protein S30 (RPS30B), RIBOSOMAL PROTEIN S30 - Arabidopsis thaliana,PID:e135818329 At4g27090->60S ribosomal protein L14 (RPL14B), ribosomal protein L14 - Human,PIR3:JC595429 At5g45775,At4g18730 flag_XH2 ->60S ribosomal protein L11 (RPL11D) or 60S ribosomal protein L11 (RPL11D)60S ribosomal protein L11 (RPL11C)29 At5g46430,At4g18100 flag_XH2 ->60S ribosomal protein L32 (RPL32B) or 60S ribosomal protein L32 (RPL32B)60S ribosomal protein L32 (RPL32A), ribosomal protein L32, human, PIR1:R5HU3229 At4g09800->40S ribosomal protein S18 (RPS18C)29 At1g16740->ribosomal protein L20 family protein, similar to ribosomal protein L20 GI:3603025 from (Guillardia theta)29 At1g18540->60S ribosomal protein L6 (RPL6A), similar to 60S ribosomal protein L6 GI:7208784 from (Cicer arietinum)29 At2g40590,At2g40510 flag_XH2 ->40S ribosomal protein S26 (RPS26B)40S ribosomal protein S26 (RPS26A)29 At1g34030->40S ribosomal protein S18 (RPS18B), similar to ribosomal protein S18 GI:38422 from (Homo sapiens)29 At1g66580->60S ribosomal protein L10 (RPL10C), contains Pfam profile: PF00826: Ribosomal L1029 At2g40205,At3g08520,At3g11120,At3g56020-> flag_XH4 60S ribosomal protein L41 (RPL41C)29 At3g24830->60S ribosomal protein L13A (RPL13aB), similar to 60S RIBOSOMAL PROTEIN L13A GB:P35427 from (Rattus norvegicus)29 At3g16080->60S ribosomal protein L37 (RPL37C), similar to ribosomal protein L37 GB:BAA04888 from (Homo sapiens)29 At3g06700->60S ribosomal protein L29 (RPL29A), similar to ribosomal protein L29 GI:7959366 (Panax ginseng) or similar to 60S ribosomal protein L29 (RPL29B) [Arabidopsis thaliana] (TAIR:At3g06680.1); similar to P0475H04.11 [Oryza sativa (japonica cultivar29 At3g04400->EMB2171;EMBRYO DEFECTIVE 2171;60S ribosomal protein L23 (RPL23C), similar to ribosomal protein L17 GB:AAA34113.1 from (Nicotiana tabacum)29 At3g09680,At5g02960 flag_XH2 ->40S ribosomal protein S23 (RPS23A), similar to 40S ribosomal protein S23 (S12) GB:P46297 from (Fragaria x ananassa)40S ribosomal protein S23 (RPS23B), ribosomal protein S23, Fragaria x ananassa, PIR:S5667329 At3g07110->60S ribosomal protein L13A (RPL13aA), similar to ribosomal protein L13A GB:O49885 (Lupinus luteus) or similar to 60S ribosomal protein L13A (RPL13aD) [Arabidopsis thaliana] (TAIR:At5g48760.1); similar to ribosomal protein L13a [Lupinus luteus]29 At3g05590->CYTOPLASMIC RIBOSOMAL PROTEIN L18;60S ribosomal protein L18 (RPL18B), similar to GB:P4279129 At3g10090->40S ribosomal protein S28 (RPS28A), similar to ribosomal protein S28 GB:P34789 (Arabidopsis thaliana)29 At1g52300->60S ribosomal protein L37 (RPL37B), similar to SP:Q43292 from (Arabidopsis thaliana)29 At1g29970->expressed protein, similar to GI:3128228 from (Arabidopsis thaliana) (Nature 402 (6763), 761-768 (1999))29 At1g74270->60S ribosomal protein L35a (RPL35aC), similar to ribosomal protein L33B GB:NP_014877 from (Saccharomyces cerevisiae)29 At1g14320->60S ribosomal protein L10 (RPL10A) / Wilm's tumor suppressor protein-related, similar to tumor suppressor GI:575354 from (Oryza sativa)29 At1g77940->60S ribosomal protein L30 (RPL30B), similar to ribosomal protein L30 GI:388034 from (Homo sapiens)29 At1g74970->TWN3;RIBOSOMAL PROTEIN S9;TWIN 3;ribosomal protein S9 (RPS9), identical to ribosomal protein S9 (Arabidopsis thaliana) GI:545694629 At1g70600,At1g23290 flag_XH2 ->60S ribosomal protein L27A (RPL27aC), identical to 60S ribosomal protein L27A GB:P49637 (Arabidopsis thaliana)RPL27AB;60S RIBOSOMAL PROTEIN L27A;Regulated by TCP20.29 At2g36160->40S ribosomal protein S14 (RPS14A)29 At2g25210->60S ribosomal protein L39 (RPL39A)29 At1g04270->RIBOSOMAL PROTEIN S15;40S ribosomal protein S15 (RPS15A), Strong similarity to Oryza 40S ribosomal protein S15. ESTs gb:R29788,gb:ATTS0365 come from this gene or similar to 40S ribosomal protein S15 (RPS15D) [Arabidopsis thaliana] (TAIR:At5g0929 At5g18380,At2g09990 flag_XH2 ->40S ribosomal protein S16 (RPS16C)40S ribosomal protein S16 (RPS16A), Same as GB:Q4234029 At1g22780->PFL1;RPS18A;40S RIBOSOMAL PROTEIN S18;POINTED FIRST LEAVES;40S ribosomal protein S18 (RPS18A), Match to ribosomal S18 gene mRNA gb:Z28701, DNA gb:Z23165 from A. thaliana. ESTs gb:T21121, gb:Z17755, gb:R64776 and gb:R30430 come from this gene29 At1g43170->EMB2207;RPL3A;ARABIDOPSIS RIBOSOMAL PROTEIN 1;EMBRYO DEFECTIVE 2207;60S ribosomal protein L3 (RPL3A), identical to ribosomal protein GI:166858 from (Arabidopsis thaliana) or 60S ribosomal protein L3 (RPL3A), identical to ribosomal protein GI:129 At1g09690,At1g09590 flag_XH2 ->60S ribosomal protein L21 (RPL21C), Similar to ribosomal protein L21 (gb:L38826). ESTs gb:AA395597,gb:ATTS5197 come from this gene60S ribosomal protein L21 (RPL21A), Similar to L21 family of ribosomal protein; amino acid seq29 AtMg01270,At2g07696 flag_XH2 ->encodes a mitochondrial ribosomal protein S7, a constituent of the small subunit of the ribosomal complexribosomal protein S7 family protein, contains Pfam profile PF00177: Ribosomal protein S7p/S5e29 At3g11940,At2g37270 flag_XH2 ->AML1;ARABIDOPSIS MINUTE-LIKE 1;RIBOSOMAL PROTEIN 5A;40S ribosomal protein S5 (RPS5B), similar to 40S ribosomal protein S5 GB:AAC98068 GI:4056502 from (Arabidopsis thaliana) or 40S ribosomal protein S5 (RPS5B), similar to 4029 At2g39820->eukaryotic translation initiation factor 6, putative / eIF-6, putative, similar to SP:O55135 Eukaryotic translation initiation factor 6 (eIF-6) (B4 integrin interactor) {Mus musculus}; contains Pfam profile PF01912: eIF-6 family29 At5g20920->eukaryotic translation initiation factor 2 subunit 2, putative / eIF-2-beta, putative, similar to SP:P41035 Eukaryotic translation initiation factor 2 subunit (eIF-2-beta) {Oryctolagus cuniculus}; contains Pfam profile PF01873: Domain found in29 At5g57650->eukaryotic translation initiation factor-related, contains weak similarity to Swiss-Prot:Q38884 eukaryotic translation initiation factor 3 subunit 2 (eIF-3 beta) (eIF3 p36) (eIF3i) (TGF-beta receptor interacting protein 1) (TRIP-1) (Arabidopsis29 At5g54760->eukaryotic translation initiation factor SUI1, putative, similar to SP:P32911 Protein translation factor SUI1 {Saccharomyces cerevisiae}; contains Pfam profile PF01253: Translation initiation factor SUI129 At5g44320->eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative, similar to initiation factor 3d (Arabidopsis thaliana) GI:12407755, SP:O15371 Eukaryotic translation initiation factor 3 subunit 7 (eIF-3 z29 At4g33250->eukaryotic translation initiation factor 3 subunit 11 / eIF-3 p25 / eIF3k (TIF3K1), identical to Swiss-Prot:Q9SZA3 eukaryotic translation initiation factor 3 subunit 11 (eIF-3 p25) (eIF3k) (Arabidopsis thaliana); identical to cDNA initiation fa29 At4g30690->translation initiation factor 3 (IF-3) family protein, similar to SP:P33319 Translation initiation factor IF-3 {Proteus vulgaris}; contains Pfam profiles PF00707: Translation initiation factor IF-3, C-terminal domain, PF05198: Translation initi29 At4g18040->eukaryotic translation initiation factor 4E 1 / eIF-4E1 / mRNA cap-binding protein 1 (EIF4E1), identical to SP:O23252 Eukaryotic translation initiation factor 4E (eIF-4E) (eIF4E) (mRNA cap-binding protein) (eIF-4F 25 kDa subunit) (eIF-4F P26 su29 At3g13920->RH4;TIF4A1;eukaryotic translation initiation factor 4A-1 / eIF-4A-1, eIF-4A-1 gi:15293046, gi:15450485; contains Pfam profile PF00270: DEAD/DEAH box helicase; contains Pfam profile PF00271: Helicase conserved C-terminal domain or similar to eu29 At2g24060->translation initiation factor 3 (IF-3) family protein, similar to SP:P33319 Translation initiation factor IF-3 {Proteus vulgaris}; contains Pfam profiles PF00707: Translation initiation factor IF-3, C-terminal domain, PF05198: Translation initi29 At4g29060->elongation factor Ts family protein, similar to SP:P35019 Elongation factor Ts (EF-Ts) {Galdieria sulphuraria}; contains Pfam profiles PF00627: UBA/TS-N domain, PF00889: Elongation factor TS, PF00575: S1 RNA binding domain or similar to transl29 At4g10480->nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative, similar to alpha-NAC, non-muscle form (Mus musculus) GI:1666690; contains Pfam profiles PF01849: NAC domain, PF00627: UBA/TS-N domain29 At4g02930->elongation factor Tu, putative / EF-Tu, putative, similar to mitochondrial elongation factor Tu (Arabidopsis thaliana) gi:1149571:emb:CAA6151129 At3g12390->nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative, similar to alpha-NAC, non-muscle form (Mus musculus) GI:1666690; contains Pfam profiles PF01849: NAC domain, PF00627: UBA/TS-N domain29 At3g08740->elongation factor P (EF-P) family protein, similar to SP:P33398 Elongation factor P (EF-P) {Escherichia coli O157:H7}; contains Pfam profile PF01132: Elongation factor P (EF-P)29 At1g56070->AT1G56075.1;elongation factor 2, putative / EF-2, putative, similar to ELONGATION FACTOR 2 GB:O14460 from (Schizosaccharomyces pombe)29 At1g57720,At1g09640 flag_XH2 ->elongation factor 1B-gamma, putative / eEF-1B gamma, putative, similar to elongation factor 1B gamma GI:3868758 from (Oryza sativa) or similar to elongation factor 1B-gamma, putative / eEF-1B gamma, putative [Arabidopsis th29 At1g30230,At2g18110 flag_XH2 ->elongation factor 1-beta / EF-1-beta, identical to SP:P48006 Elongation factor 1-beta (EF-1-beta) {Arabidopsis thaliana}elongation factor 1-beta, putative / EF-1-beta, putative, nearly identical to eEF-1beta (Arabidopsis tha

29 At5g36170->peptide chain release factor, putative, similar to SP:P28367 Peptide chain release factor 2 (RF-2) {Bacillus subtilis}; contains Pfam profiles PF00472: Peptidyl-tRNA hydrolase domain, PF03462: PCRF domain or peptide chain release factor, putat29 At3g62910->peptide chain release factor, putative, similar to peptide chain release factor 1 (Escherichia coli) GI:147567; contains Pfam profiles PF00472: Peptidyl-tRNA hydrolase domain, PF03462: PCRF domain29 At1g27970->nuclear transport factor 2 (NTF2), putative, similar to Swiss-Prot:P33331 nuclear transport factor 2 (NTF-2) (Nuclear transport factor P10) (Saccharomyces cerevisiae)29 At5g40930->mitochondrial import receptor subunit TOM20-4 / translocase of outer membrane 20 kDa subunit 4, identical to mitochondrial import receptor subunit TOM20-4 SP:P82805 from (Arabidopsis thaliana)29 At3g46560->mitochondrial import inner membrane translocase (TIM9), identical to mitochondrial import inner membrane translocase subunit Tim9 (Arabidopsis thaliana) Swiss-Prot:Q9XGX9; contains Pfam domain, PF02953: Tim10/DDP family zinc finger29 At1g61570->TIM13;mitochondrial import inner membrane translocase (TIM13), identical to mitochondrial import inner membrane translocase subunit Tim13 (Arabidopsis thaliana) Swiss-Prot:Q9XH48; contains Pfam domain, PF02953: Tim10/DDP family zinc finger29 At2g37410->TIM17;mitochondrial import inner membrane translocase (TIM17), nearly identical to SP:Q9SP35 Mitochondrial import inner membrane translocase subunit TIM17 {Arabidopsis thaliana} or mitochondrial import inner membrane translocase (TIM17), nearl29 At2g28900->mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein, contains Pfam PF02466: Mitochondrial import inner membrane translocase subunit Tim1729 At5g03940->signal recognition particle 54 kDa protein, chloroplast / 54 chloroplast protein / SRP54 (FFC), identical to Swiss-Prot:P37107 signal recognition particle 54 kDa protein, chloroplast precursor (SRP54) (54 chloroplast protein) (54CP) (FFC) (Arab29 At2g18710->preprotein translocase secY subunit, chloroplast (CpSecY), Identical to SP:Q38885 Preprotein translocase secY subunit, chloroplast precursor (CpSecY) {Arabidopsis thaliana}29 At2g45770->CHLOROPLAST SRP RECEPTOR HOMOLOG, ALPHA SUBUNIT CPFTSY;signal recognition particle receptor protein, chloroplast (FTSY), similar to Cell division protein ftsY homolog (SP:O67066) {Aquifex aeolicus}; contains Pfam PF00448: SRP54-type protein, GT29 At3g44340->sec23/sec24 transport family protein, contains Pfam domains PF04811: Sec23/Sec24 trunk domain, PF04815: Sec23/Sec24 helical domain and PF04810: Sec23/Sec24 zinc finger or similar to sec23/sec24 transport protein-related [Arabidopsis thaliana]29 At4g32940->vacuolar processing enzyme gamma / gamma-VPE, nearly identical to SP:Q39119 Vacuolar processing enzyme, gamma-isozyme precursor (EC 3.4.22.-) (Gamma-VPE) {Arabidopsis thaliana}29 At4g20110->vacuolar sorting receptor, putative, similar to BP-80 vacuolar sorting receptor (Pisum sativum) GI:1737222; identical to vacuolar sorting receptor-like protein (GI:2827665) (Arabidopsis thaliana)29 At2g14720,At2g14740 flag_XH2 ->vacuolar sorting receptor, putative, identical to GB:U79960 GI:1737220; contains a calcium-binding EGF-like domain signature or vacuolar sorting receptor, putative, identical to GB:U79960 GI:1737220; contains a calcium-bind29 At2g17980->sec1 family protein, similar to SWISS-PROT:P22213 SLY1 protein (Saccharomyces cerevisiae); contains Pfam domain, PF00995: Sec1 family29 At1g48900->signal recognition particle 54 kDa protein 3 / SRP54 (SRP-54C), identical to SP:P49967 Signal recognition particle 54 kDa protein 3 (SRP54) {Arabidopsis thaliana}29 At5g61970->signal recognition particle-related / SRP-related, low similarity to Signal recognition particle 68 kDa protein (SRP68) from Homo sapiens SP:Q9UHB9, Canis familiaris SP:Q0000429 At5g50460->protein transport protein SEC61 gamma subunit, putative, similar to Swiss-Prot:Q19967 protein transport protein SEC61 gamma subunit (Caenorhabditis elegans)29 At5g49500->signal recognition particle 54 kDa protein 2 / SRP54 (SRP-54B), identical to SP:P49966 Signal recognition particle 54 kDa protein 2 (SRP54) {Arabidopsis thaliana}29 At3g62290->Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. Members of this family are known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell div29 At3g60540->sec61beta family protein, similar to SP:P52870 Protein transport protein SEC61 beta 1 subunit {Saccharomyces cerevisiae}; contains Pfam profile PF03911: Sec61beta family or sec61beta family protein, similar to SP:P52870 Protein transport prote29 At3g48570->protein transport protein SEC61 gamma subunit, putative, similar to Swiss-Prot:Q19967 protein transport protein SEC61 gamma subunit (Caenorhabditis elegans)29 At3g48570->protein transport protein SEC61 gamma subunit, putative, similar to Swiss-Prot:Q19967 protein transport protein SEC61 gamma subunit (Caenorhabditis elegans)29 At4g24920->protein transport protein SEC61 gamma subunit, putative, similar to Swiss-Prot:Q19967 protein transport protein SEC61 gamma subunit (Caenorhabditis elegans)29 At1g14820->SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein, contains Pfam PF00650 : CRAL/TRIO domain; similar to phosphatidylinositol/phosphatidylcholine transfer protein SP:P24280 (Saccharomyces cerevisiae (Baker's yeast)29 At3g07680->emp24/gp25L/p24 family protein, similar to SP:Q15363 Cop-coated vesicle membrane protein p24 precursor (p24A) {Homo sapiens}; contains Pfam profile PF01105: emp24/gp25L/p24 family29 At1g60970->clathrin adaptor complex small chain family protein, contains Pfam profile: PF01217 clathrin adaptor complex small chain29 At1g48160->signal recognition particle 19 kDa protein, putative / SRP19, putative, similar to signal recognition particle 19 kDa protein subunit SRP19 GI:624221 (Oryza sativa (japonica cultivar-group)); contains Pfam profile: PF01922 SRP19 protein29 At1g52600->signal peptidase, putative, similar to SP:P13679 Microsomal signal peptidase 21 kDa subunit (EC 3.4.-.-) {Canis familiaris}; contains Pfam profile PF00461: Signal peptidase I29 At1g11890->ATSEC22;vesicle transport protein SEC22, putative, identified as SEC22 by Raikhel, NV, et al. in Plant Physiol. 124: 1558-69 (2000); similar to vesicle trafficking protein gb:U91538 from Mus musculus; ESTs gb:F15494 and gb:F14097 come from this29 At2g45070->SEC 61 BETA SUBUNIT;sec61beta family protein, similar to SP:P52870 Protein transport protein SEC61 beta 1 subunit {Saccharomyces cerevisiae}; contains Pfam profile PF03911: Sec61beta family or similar to sec61beta family protein [Arabidopsis t29 At2g27600->AAA-type ATPase family protein / vacuolar sorting protein-related, similar to SP:P46467 SKD1 protein (Vacuolar sorting protein 4b) {Mus musculus}; contains Pfam profiles PF00004: ATPase AAA family, PF04212: MIT domain29 At5g16070->chaperonin, putative, similar to SWISS-PROT:P80317 T-complex protein 1, zeta subunit (TCP-1-zeta) (Mus musculus); contains Pfam:PF00118 domain, TCP-1/cpn60 chaperonin family29 At5g27840->serine/threonine protein phosphatase PP1 isozyme 8 (TOPP8), identical to SP:O82734 Serine/threonine protein phosphatase PP1 isozyme 8 (EC 3.1.3.16) {Arabidopsis thaliana} or serine/threonine protein phosphatase PP1 isozyme 8 (TOPP8), identical29 At5g57020->myristoyl-CoA:protein N-myristoyltransferase 1 (NMT1), identical to N-myristoyltransferase 1 (NMT1) (Arabidopsis thaliana) GI:733983429 At5g53140->protein phosphatase 2C, putative / PP2C, putative29 At5g18190->protein kinase family protein, contains Pfam domains, PF00069: Protein kinase domain29 At5g08590->serine/threonine protein kinase (ASK2), identical to serine/threonine-protein kinase ASK2, SWISS-PROT: P43292; contains protein kinase domain, Pfam:PF0006929 At5g01920->protein kinase family protein, contains eukaryotic protein kinase domain, INTERPRO:IPR00071929 At4g33950->protein kinase, putative, similar to abscisic acid-activated protein kinase (Vicia faba) gi:6739629:gb:AAF27340; contains protein kinase domain, Pfam:PF0006929 At4g31170->protein kinase family protein, contains eukaryotic protein kinase domain, INTERPRO:IPR000719 or protein kinase family protein, contains eukaryotic protein kinase domain, INTERPRO:IPR000719 or similar to serine/threonine/tyrosine kinase, putat29 At4g03960->tyrosine specific protein phosphatase family protein, contains tyrosine specific protein phosphatases active site, PROSITE:PS0038329 At3g12200->protein kinase family protein, contains protein kinase domain, Pfam:PF00069; contains serine/threonine protein kinase domain, INTERPRO:IPR00229029 At3g13670->protein kinase family protein, contains Pfam domains, PF00069: Protein kinase domain29 At3g09970->calcineurin-like phosphoesterase family protein, contains Pfam profile: PF00149 Calcineurin-like phosphoesterase29 At1g13350,At3g53640 flag_XH2 ->protein kinase family protein, contains protein kinase domain, Pfam:PF00069 (likely that this cDNA contains a single unspliced intron. Putative intron removed in this gene model.)protein kinase family protein, contains prote29 At3g25800->serine/threonine protein phosphatase 2A (PP2A) 65 KDa regulatory subunit A, identical to protein phosphatase 2A 65 kDa regulatory subunit (pDF1) GI:683502 from (Arabidopsis thaliana) or similar to serine/threonine protein phosphatase 2A (PP2A)29 At1g67580->protein kinase family protein, contains protein kinase domain, Pfam:PF0006929 At1g70490->Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. Members of this family are known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell div29 At1g71860->ATPTP1;PROTEIN TYROSINE PHOSPHATASE 1;protein tyrosine phosphatase 1 (PTP1), identical to protein tyrosine phosphatase 1 GI:3170531 from (Arabidopsis thaliana); contains Pfam profile: PF00102 protein-tyrosine phosphatase or protein tyrosine ph29 At1g50370->serine/threonine protein phosphatase, putative, nearly identical to serine/threonine protein phosphatase (Arabidopsis thaliana) GI:1458220629 At1g14000->protein kinase family protein / ankyrin repeat family protein, contains Pfam profiles: PF00069 protein kinase domain, PF00023 ankyrin repeat29 At1g30640->protein kinase, putative, contains protein kinase domain, Pfam:PF0006929 At2g47170->ADP-RIBOSYLATION FACTOR;ADP-RIBOSYLATION FACTOR 1;Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. Members of this family are known to be essential for vesicle coating and uncoating and functions in GTP-bin29 At2g25070->protein phosphatase 2C, putative / PP2C, putative

29 At1g24510->T-complex protein 1 epsilon subunit, putative / TCP-1-epsilon, putative / chaperonin, putative, identical to SWISS-PROT:O04450- T-complex protein 1, epsilon subunit (TCP-1-epsilon) (Arabidopsis thaliana); strong similarity to SP:P54411 T-comple29 At2g25620->protein phosphatase 2C, putative / PP2C, putative29 At2g35050->protein kinase family protein, contains Pfam profile: PF00069 Eukaryotic protein kinase domain29 At2g19130->S-locus lectin protein kinase family protein, contains Pfam domains PF00954: S-locus glycoprotein family, PF00069: Protein kinase domain and PF01453: Lectin (probable mannose binding)29 At4g35230->protein kinase family protein, contains protein kinase domain, Pfam:PF0006929 At5g02290->protein kinase, putative, similar to protein kinase APK1A (Arabidopsis thaliana) SWISS-PROT:Q06548 or protein kinase, putative, similar to protein kinase APK1A (Arabidopsis thaliana) SWISS-PROT:Q0654829 At4g35600->protein kinase family protein, contains protein kinase domain, Pfam:PF0006929 At2g05940->protein kinase, putative, similar to auxin-regulated dual specificity cytosolic kinase (Lycopersicon esculentum) gi:14484938:gb:AAK6282129 At2g07180->protein kinase, putative, contains protein kinase domain, Pfam:PF0006929 At2g39660->protein kinase, putative, similar to protein kinase gi:166809:gb:AAA1885329 At5g51270->protein kinase family protein, contains Pfam profile: PF00069 Eukaryotic protein kinase domain29 At1g67700->expressed protein or expressed protein29 At4g36800->RUB1-conjugating enzyme, putative (RCE1), this gene is frameshifted and may be a pseudogene; identical over first 79 amino acids to RUB1 conjugating enzyme (Arabidopsis thaliana) GI:663545729 At4g36760->aminopeptidase P, similar to Xaa-Pro aminopeptidase 2 (Lycopersicon esculentum) GI:15384991; contains Pfam profile PF00557: metallopeptidase family M24 or aminopeptidase P, similar to Xaa-Pro aminopeptidase 2 (Lycopersicon esculentum) GI:1538429 At4g23040->UBX domain-containing protein, similar to Ara4-interacting protein (Arabidopsis thaliana) GI:13160609; contains Pfam profile PF00789: UBX domain29 At4g22150->UBX domain-containing protein, similar to XY40 protein (Rattus norvegicus) GI:2547025; contains Pfam profile PF00789: UBX domain29 At4g17830->peptidase M20/M25/M40 family protein, similar to acetylornithine deacetylase (Acetylornithinase, AO; N-acetylornithinase, NAO) (Dictyostelium discoideum) SWISS-PROT:P5463829 At4g10790->UBX domain-containing protein, low similarity to SP:Q9UNN5 FAS-associated factor 1 (FAF1 protein) {Homo sapiens}; contains Pfam profile PF00789: UBX domain29 At3g05230->signal peptidase subunit family protein, contains Pfam profile: PF04573 signal peptidase subunit or similar to signal peptidase subunit family protein [Arabidopsis thaliana] (TAIR:At5g27430.1); similar to signal peptidase protein-like [Cucumi29 At1g16470->PROTEASOME SUBUNIT PAB1;20S proteasome alpha subunit B (PAB1) (PRC3), identical to proteasome subunit alpha type 2 SP:O23708, GI:6093778; identical to cDNA proteasome subunit prc3 GI:2511573 or similar to 20S proteasome alpha subunit D2 (PAD2)29 At2g38860->proteaseI (pfpI)-like protein (YLS5), contains Pfam profile PF01965: DJ-1/PfpI family; supporting cDNA gi:13122287:dbj:AB047808.1:; identical to proteaseI (pfpI)-like protein (Arabidopsis thaliana) GI:13122288, cDNA proteaseI (pfpI)-like protei29 At1g32940->subtilase family protein, contains similarity to subtilase; SP1 GI:9957714 from (Oryza sativa)29 At2g05920->subtilase family protein, contains similarity to cucumisin-like serine protease GI:3176874 from (Arabidopsis thaliana)29 At4g16520->autophagy 8f (APG8f), identical to autophagy 8f (Arabidopsis thaliana) GI:19912161; contains Pfam profile PF02991: Microtubule associated protein 1A/1B, light chain 3 or autophagy 8f (APG8f), identical to autophagy 8f (Arabidopsis thaliana) GI29 At5g61500->autophagy 3 (APG3), identical to autophagy 3 (Arabidopsis thaliana) GI:19912141; contains Pfam profiles PF03986: Autophagocytosis associated protein N-terminal domain, PF03987: Autophagocytosis associated protein C-terminal domain29 At3g60640->autophagy 8g (APG8g), identical to autophagy 8g (Arabidopsis thaliana) GI:19912163; contains Pfam profile PF02991: Microtubule associated protein 1A/1B, light chain 3; supporting cDNA gi:19912162:dbj:AB073181.1:29 At4g21980->autophagy 8a (APG8a), identical to autophagy 8a (Arabidopsis thaliana) GI:19912151; contains Pfam profile PF02991: Microtubule associated protein 1A/1B, light chain 329 At3g15580->ATG8I;autophagy 8i (APG8i), identical to autophagy 8i (Arabidopsis thaliana) GI:19912167; contains Pfam profile PF02991: Microtubule associated protein 1A/1B, light chain 3; supporting cDNA gi:21636957:gb:AF492760.1:29 At1g62040->ATG8C;AUTOPHAGY 8C;autophagy 8c (APG8c), identical to autophagy 8c (Arabidopsis thaliana) GI:19912155; contains Pfam profile PF02991: Microtubule associated protein 1A/1B, light chain 329 At2g05630->autophagy 8d (APG8d), identical to autophagy 8d (Arabidopsis thaliana) GI:19912157; contains Pfam profile PF02991: Microtubule associated protein 1A/1B, light chain 329 At2g45170->ATG8E;AUTOPHAGY 8E;autophagy 8e (APG8e), identical to autophagy 8e (Arabidopsis thaliana) GI:19912159; contains Pfam profile PF02991: Microtubule associated protein 1A/1B, light chain 3 or autophagy 8e (APG8e), identical to autophagy 8e (Arabi29 At3g12490->similar to cysteine protease inhibitor, putative / cystatin, putative [Arabidopsis thaliana] (TAIR:At5g05110.1); similar to cysteine protease inhibitor CPI-1 [Brassica oleracea] (GB:AAL59842.1); contains InterPro domain Cystatin C/M (InterPro:I29 At3g02070->OTU-like cysteine protease family protein, contains Pfam profile PF02338: OTU-like cysteine protease29 At3g02740->aspartyl protease family protein, contains Pfam profile: PF00026 eukaryotic aspartyl protease29 At5g51070->ATP-dependent Clp protease ATP-binding subunit (ClpD), (ERD1), SAG15/ERD1; identical to ERD1 protein GI:497629, SP:P42762 from (Arabidopsis thaliana); contains Pfam profile PF02861: Clp amino terminal domain29 At1g64020->serpin-related / serine protease inhibitor-related, similar to phloem serpin-1 (Cucurbita maxima) GI:993731129 At1g09130->ATP-dependent Clp protease proteolytic subunit, putative, similar to nClpP5 GI:5360595 from (Arabidopsis thaliana) or similar to ATP-dependent Clp protease proteolytic subunit (ClpR1) (nClpP5) [Arabidopsis thaliana] (TAIR:At1g49970.1); similar29 At2g35570->pseudogene, serpin (serine protease inhibitor) family, similar to phloem serpin-1 (Cucurbita maxima) GI:9937311; blastp match of 49% identity and 9.9e-85 P-value to GP:26224736:gb:AAN76362.1::AY158152 serpin-like protein {Citrus x paradisi}29 At5g58870->encodes an FtsH protease that is localized to the chloroplast29 At5g42270->FtsH protease, putative, similar to FtsH protease GI:13183728 from (Medicago sativa)29 At5g42320->zinc carboxypeptidase family protein, contains Pfam domain, PF00246: Zinc carboxypeptidase29 At2g30950->FTSH2;VAR2;VARIEGATED 2;YELLOW VARIEGATED;FtsH protease (VAR2), identical to zinc dependent protease VAR2 GI:7650138 from (Arabidopsis thaliana)29 At3g28540->AAA-type ATPase family protein, contains Pfam profile: ATPase family PF00004 or similar to AAA-type ATPase family protein [Arabidopsis thaliana] (TAIR:At3g28510.1); similar to AAA-type ATPase family protein [Arabidopsis thaliana] (TAIR:At3g28529 At3g19740->similar to AAA-type ATPase family protein [Arabidopsis thaliana] (TAIR:At1g50140.1); similar to spastin-like [Oryza sativa (japonica cultivar-group)] (GB:BAD37292.1); contains InterPro domain AAA ATPase (InterPro:IPR003593); contains InterPro d29 At2g27600->AAA-type ATPase family protein / vacuolar sorting protein-related, similar to SP:P46467 SKD1 protein (Vacuolar sorting protein 4b) {Mus musculus}; contains Pfam profiles PF00004: ATPase AAA family, PF04212: MIT domain29 At1g26270->phosphatidylinositol 3- and 4-kinase family protein, similar to phosphatidylinositol 4-kinase type-II beta (Homo sapiens) GI:20159767; contains Pfam profile PF00454: Phosphatidylinositol 3- and 4-kinase29 At5g15400->U-box domain-containing protein, contains Pfam profile PF04564: U-box domain29 At3g52590->ubiquitin extension protein 1 (UBQ1) / 60S ribosomal protein L40 (RPL40B), identical to GI:166929, GI:16693029 At4g24690->ubiquitin-associated (UBA)/TS-N domain-containing protein / octicosapeptide/Phox/Bemp1 (PB1) domain-containing protein, contains Pfam profiles PF00627: Ubiquitin-associated (UBA)/TS-N domain, PF00569: Zinc finger ZZ type domain, PF00564: PB1 do29 At1g65350->polyubiquitin, putative, similar to polyubiquitin GI:248337 from (Zea mays)29 At2g29070->ubiquitin fusion degradation UFD1 family protein, similar to SP:P70362 Ubiquitin fusion degradation protein 1 homolog (UB fusion protein 1) {Mus musculus}; contains Pfam profile PF03152: Ubiquitin fusion degradation protein UFD1 or ubiquitin f29 At5g42300->ubiquitin family protein, contains INTERPRO:IPR000626 ubiquitin domain29 At4g26840->ubiquitin-like protein (SMT3), identical to Ubiquitin-like protein SMT3 SP:P55852 from(Arabidopsis thaliana); identical to cDNA SMT3 protein GI:170737129 At2g30110->ubiquitin activating enzyme 1 (UBA1), E1; identical to GB:U8080829 At5g56150->ubiquitin-conjugating enzyme, putative, strong similarity to ubiquitin-conjugating enzyme UBC2 (Mesembryanthemum crystallinum) GI:5762457, UBC4 (Pisum sativum) GI:456568; contains Pfam profile PF00179: Ubiquitin-conjugating enzyme or ubiquitin29 At3g57870->ubiquitin-conjugating enzyme, putative, strong similarity to SP:P50550 Ubiquitin-like protein SUMO-1 conjugating enzyme (EC 6.3.2.19) (SUMO- 1-protein ligase) (Ubiquitin carrier protein) (Ubiquitin-conjugating enzyme UbcE2A) {Xenopus laevis}; c

29 At4g27960,At5g53300 flag_XH2 ->ubiquitin-conjugating enzyme E2-17 kDa 9 (UBC9), E2; identical to gi:297883, SP:P35132; identical to cDNA UBC9 for ubiquitin conjugating enzyme homolog GI:297883 or ubiquitin-conjugating enzyme E2-17 kDa 9 (UBC9), E2; ident29 At3g17000->ubiquitin-conjugating enzyme, putative, similar to Non-Canonical UBiquitin Conjugating Enzyme 1 (NCUBE1) from (Gallus gallus) GI:7362937, (Mus musculus) GI:7363050, (Homo sapiens) GI:7362973; contains Pfam profile PF00179: Ubiquitin-conjugating29 At1g16890,At1g78870 flag_XH2 ->ubiquitin-conjugating enzyme, putative, nearly identical to ubiquitin-conjugating enzyme E2 (Catharanthus roseus) GI:5381319; contains Pfam profile PF00179: Ubiquitin-conjugating enzyme or ubiquitin-conjugating enzyme, puta29 At5g47050->expressed protein29 At5g10380->zinc finger (C3HC4-type RING finger) family protein, contains Pfam profile: PF00097 zinc finger, C3HC4 type (RING finger)29 At3g46620->zinc finger (C3HC4-type RING finger) family protein, contains Pfam domain, PF00097: Zinc finger, C3HC4 type (RING finger)29 At3g23280->zinc finger (C3HC4-type RING finger) family protein / ankyrin repeat family protein, contains Pfam profile: PF00097 zinc finger, C3HC4 type (RING finger) and Pfam profile: PF00023 ankyrin repeat or zinc finger (C3HC4-type RING finger) family p29 At3g19910->zinc finger (C3HC4-type RING finger) family protein, contains Pfam profile: PF00097 zinc finger, C3HC4 type (RING finger)29 At3g16090->zinc finger (C3HC4-type RING finger) family protein, contains Pfam profile: PF00097 zinc finger, C3HC4 type (RING finger)29 At1g63840->zinc finger (C3HC4-type RING finger) family protein, similar to RING-H2 finger protein RHA1a (GI:3790554) (Arabidopsis thaliana)' similar to BRH1 RING finger protein (Arabidopsis thaliana) GI:4689366; contains Pfam profile PF00097: Zinc finger,29 At1g19310->zinc finger (C3HC4-type RING finger) family protein, contains Pfam profile: PF00097 zinc finger, C3HC4 type (RING finger)29 At1g49230->zinc finger (C3HC4-type RING finger) family protein, contains Pfam domain, PF00097: Zinc finger, C3HC4 type (RING finger)29 At1g79380->copine-related, low similarity to SP:Q99829 Copine I {Homo sapiens}29 At2g17450->RING-H2 FINGER PROTEIN RHA3A;zinc finger (C3HC4-type RING finger) family protein, contains Pfam domain, PF00097: Zinc finger, C3HC4 type (RING finger)29 At1g60610->expressed protein or expressed protein29 At1g24440->expressed protein, similar to MTD2 (Medicago truncatula) GI:929481229 At5g59140->SKP1 family protein, similar to elongin C, Drosophila melanogaster, GI:2780365 PIR:JC5794; contains Pfam profile PF01466: Skp1 family, dimerisation domain29 At3g60020->E3 ubiquitin ligase SCF complex subunit SKP1/ASK1 (At5), putative, E3 ubiquitin ligase; similar to Skp1 GI:4959710 from (Medicago sativa)29 At4g15475->F-box family protein (FBL4), 99.7% identical to F-box protein family, AtFBL4 (GP:21536497) (Arabidopsis thaliana); similar to grr1 GI:2407790 from (Glycine max)29 At5g18780->F-box family protein, contains F-box domain Pfam:PF0064629 At5g03000->kelch repeat-containing F-box family protein, similar to SKP1 interacting partner 6 (Arabidopsis thaliana) GI:10716957; contains Pfam profiles PF01344: Kelch motif, PF00646: F-box domain29 At4g33900->kelch repeat-containing F-box family protein, contains F-box domain Pfam:PF00646 and Kelch motif Pfam:PF0134429 At4g03030->kelch repeat-containing F-box family protein, contains Pfam profiles PF01344: Kelch motif, PF00646: F-box domain29 At1g12710->ATPP2-A12;F-box family protein / SKP1 interacting partner 3-related, contains Pfam profile PF00646: F-box domain29 At3g22770->F-box family protein-related, contains TIGRFAM TIGR01640: F-box protein interaction domain29 At5g20570->ring-box protein-related, similar to ring-box protein 1 GI:4769004 from (Homo sapiens)29 At4g14800->20S proteasome beta subunit D2 (PBD2) (PRCGA), identical to SP:O24633 Proteasome subunit beta type 2-2 (EC 3.4.25.1) (20S proteasome alpha subunit D2) {Arabidopsis thaliana}, cDNA proteasome subunit prcga GI:251157129 At5g58290->26S proteasome AAA-ATPase subunit (RPT3), identical to 26S proteasome AAA-ATPase subunit RPT3 GI:6652882 from (Arabidopsis thaliana)29 At5g42790->20S proteasome alpha subunit F1 (PAF1), (gb:AAC32062.1)29 At5g38650->proteasome maturation factor UMP1 family protein, contains Pfam profile PF05348: Proteasome maturation factor UMP129 At4g29040->26S proteasome AAA-ATPase subunit (RPT2a), almost identical to 26S proteasome AAA-ATPase subunit RPT2a (GI:6652880) {Arabidopsis thaliana}; Drosophila melanogaster 26S proteasome subunit 4 ATPase, PID:g106606529 At3g22630->PRCGB;MULTICATALYTIC ENDOPEPTIDASE COMPLEX, PROTEASOME COMPONENT, BETA SUBUNIT;PROTEASOME SUBUNIT PRGB;20S proteasome beta subunit D (PBD1) (PRGB), identical to GB:CAA74026 from (Arabidopsis thaliana) ( FEBS Lett. (1997) 416 (3), 281-285); iden29 At1g56450->PROTEASOME BETA SUBUNIT PBG1;20S proteasome beta subunit G1 (PBG1) (PRCH), identical to 20S proteasome beta subunit (PBG1) GI:3421123 (Arabidopsis thaliana); identical to cDNA proteasome subunit prch GI:251159729 At1g45000->26S proteasome regulatory complex subunit p42D, putative, similar to 26S proteasome regulatory complex subunit p42D (Drosophila melanogaster) gi:6434958:gb:AAF0839129 At1g04810->26S proteasome regulatory subunit, putative, contains similarity to 26S proteasome regulatory subunit S1 SP:O88761, GI:3288594 from (Rattus norvegicus)29 At1g64520->26S proteasome regulatory subunit, putative (RPN12), similar to 26S proteasome regulatory complex subunit p30 GB:AAF08395 GI:6434966 from (Drosophila melanogaster)29 At1g53780,At1g53750 flag_XH2 ->26S proteasome AAA-ATPase subunit, putative, similar to 26S proteasome AAA-ATPase subunit RPT1 SP:Q41365 from (Spinacia oleracea)26S PROTEASOME ATPASE SUBUNIT;26S proteasome AAA-ATPase subunit (RPT1a), similar to 26S protea29 At3g26340,At1g13060 flag_XH2 ->20S proteasome beta subunit E, putative, very strong similarity to SP:O23717 Proteasome subunit beta type 5 precursor (EC 3.4.25.1) (20S proteasome subunit E) (Proteasome epsilon chain) {Arabidopsis thaliana}20S PROTEASOME B29 At1g67250->proteasome maturation factor UMP1 family protein, contains Pfam profile PF05348: Proteasome maturation factor UMP129 At2g05840,At5g35590 flag_XH2 ->20S PROTEASOME SUBUNIT PAA2;20S proteasome alpha subunit A2 (PAA2), identical to GB:AF043519 or similar to 20S proteasome alpha subunit A1 (PAA1) (PRC1) [Arabidopsis thaliana] (TAIR:At5g35590.1); similar to proteasome IOTA29 At2g27020->20S PROTEASOME SUBUNIT PAG1;20S proteasome alpha subunit G (PAG1) (PRC8), identical to proteasome subunit alpha type 3 SP:O23715, GI:12644056 from (Arabidopsis thaliana); identical to cDNA proteasome subunit prc8 GI:251159129 At2g39990->TRANSLATION INITIATION FACTOR EIF2 P47 SUBUNIT HOMOLOG;eukaryotic translation initiation factor 3 subunit 5 / eIF-3 epsilon / eIF3f (TIF3F1), identical to SP:O04202 Eukaryotic translation initiation factor 3 subunit 5 (eIF-3 epsilon) (eIF3 p3229 At5g55220->trigger factor type chaperone family protein, contains Pfam profiles PF05697: Bacterial trigger factor protein (TF), PF05698: Bacterial trigger factor protein (TF) C-terminus, PF00254: peptidyl-prolyl cis-trans isomerase, FKBP-type29 At5g43260->chaperone protein dnaJ-related, similar to Chaperone protein dnaJ (SP:Q9WZV3) (Thermotoga maritima)29 At5g17710->co-chaperone grpE family protein, similar to co-chaperone CGE1 precursor isoform a (Chlamydomonas reinhardtii) GI:15384277; contains Pfam profile PF01025: co-chaperone GrpE or co-chaperone grpE family protein, similar to co-chaperone CGE1 prec29 At3g01480->peptidyl-prolyl cis-trans isomerase, putative / cyclophilin, putative / rotamase, putative, similar to peptidyl-prolyl cis-trans isomerase, chloroplast precursor (40 kDa thylakoid lumen PPIase, 40 kDa thylakoid lumen rotamase) (Spinacia olerace29 At1g14980->CHAPERONIN 10;MITOCHONDRIAL CHAPERONIN 10;10 kDa chaperonin (CPN10), identical to SP:P34893 from (Arabidopsis thaliana)29 AtCg00860,AtCg01280 flag_XH2 ->hypothetical proteinhypothetical protein29 AtCg00360->hypothetical protein29 AtCg00520->hypothetical protein29 At5g45680->FK506-binding protein 1 (FKBP13), identical to Probable FKBP-type peptidyl-prolyl cis-trans isomerase 3, chloroplast precursor (Ppiase) (Rotamase) (SP:Q9SCY2) / FK506 binding protein 1 (GI:21535744) (Arabidopsis thaliana); contains Pfam PF0025429 At5g23120->photosystem II stability/assembly factor, chloroplast (HCF136), identical to SP:O82660 Photosystem II stability/assembly factor HCF136, chloroplast precursor {Arabidopsis thaliana}29 At3g24430->HIGH-CHLOROPHYLL-FLUORESCENCE 101;expressed protein, contains Pfam profile PF01883: Domain of unknown function

MapMan bins: LMD PM bin description30 At5g55850->similar to nitrate-responsive NOI protein, putative [Arabidopsis thaliana] (TAIR:At5g63270.1); similar to nitrate-induced NOI protein [Zea mays] (GB:AAC03022.1); contains InterPro domain Nitrate-induced NOI (InterPro:IPR008700)30 At2g17260->ATGLR2;ATGLR3.1;GLUTAMATE RECEPTOR 2;glutamate receptor family protein (GLR3.1) (GLR2), identical to putative glutamate receptor GLR2 (Arabidopsis thaliana) gi:4185740:gb:AAD09174; plant glutamate receptor family, PMID:1137962630 At2g29120->GLR2.7;similar to glutamate receptor family protein (GLR2.8) (GLUR9) [Arabidopsis thaliana] (TAIR:At2g29110.1); similar to glutamate receptor family protein (GLR2.1) (GLR3) [Arabidopsis thaliana] (TAIR:At5g27100.1); similar to glutamate recepto30 At5g06820->leucine-rich repeat transmembrane protein kinase, putative30 At1g16670->protein kinase family protein, contains protein kinase domain, Pfam:PF00069; similar to receptor-like serine/threonine kinase GI:2465923 from (Arabidopsis thaliana)30 At1g56140,At1g56130,At1g56120 -> flag_XH3 leucine-rich repeat family protein / protein kinase family protein, contains Pfam domains PF00560: Leucine Rich Repeat and PF00069: Protein kinase domainleucine-rich repeat family protein / protein kinase family p30 At5g48380->leucine-rich repeat family protein / protein kinase family protein, contains protein kinase domain, Pfam:PF00069; contains leucine-rich repeats, Pfam:PF0056030 At3g45860->receptor-like protein kinase, putative, similar to receptor-like protein kinase 4 (gi:13506745), 5 (gi:13506747), and 6 (gi:13506749) from Arabidopsis thaliana; contains Pfam protein kinase domain PF0006930 At4g23220->protein kinase family protein, contains Pfam PF00069: Protein kinase domain30 At4g23140,At4g23160 flag_XH2 ->receptor-like protein kinase 5 (RLK5), identical to receptor-like protein kinase 5 (Arabidopsis thaliana) GI:13506747; contains Pfam domain PF00069: Protein kinase domain; identical to cDNA receptor-like protein kinase 5 (RL30 At4g23150->protein kinase family protein, contains Pfam domain, PF00069: Protein kinase domain30 At4g11890->protein kinase family protein, contains protein kinase domain, Pfam:PF00069 or protein kinase family protein, contains protein kinase domain, Pfam:PF00069 or protein kinase family protein, contains protein kinase domain, Pfam:PF0006930 At1g21270->wall-associated kinase 2 (WAK2), identical to wall-associated kinase 2 (Arabidopsis thaliana) GI:4826399; induced by salicylic acid or INA (PMID:10380805)30 At5g20050->protein kinase family protein, contains protein kinase domain, Pfam:PF0006930 At1g51890->leucine-rich repeat protein kinase, putative, similar to light repressible receptor protein kinase (Arabidopsis thaliana) gi:1321686:emb:CAA66376; contains leucine rich repeat (LRR) domains, Pfam:PF00560; contains protein kinase domain, Pfam:PF30 At3g46330,At3g45920 flag_XH2 ->leucine-rich repeat protein kinase, putative, similar to light repressible receptor protein kinase (Arabidopsis thaliana) gi:1321686:emb:CAA66376; contains leucine rich repeat (LRR) domains, Pfam:PF00560; contains protein ki30 At4g20450->leucine-rich repeat protein kinase, putative, similar to light repressible receptor protein kinase (Arabidopsis thaliana) gi:1321686:emb:CAA66376; contains leucine rich repeat (LRR) domains, Pfam:PF00560; contains protein kinase domain, Pfam:PF30 At1g69270->RECEPTOR-LIKE PROTEIN KINASE 1;leucine-rich repeat family protein / protein kinase family protein, contains Pfam domains PF00560: Leucine Rich Repeat and PF00069: Protein kinase domain30 At3g56800->calmodulin-2/3/5 (CAM3), identical to calmodulin GI:474183 from (Arabidopsis thaliana); almost identical to calmodulin-2/3/5 SP:P25069 (Arabidopsis thaliana)30 At5g17480->polcalcin, putative / calcium-binding pollen allergen, putative, similar to polcalcin Bra r 2/Bra n 2 (Calcium-binding pollen allergen Bra r 2/Bra n 2) SP:Q39406 from (Brassica napus)30 At5g26920->similar to calmodulin-binding protein [Arabidopsis thaliana] (TAIR:At4g25800.1); similar to putative calmodulin-binding protein [Oryza sativa (japonica cultivar-group)] (GB:BAD27989.1)30 At5g61790->calnexin 1 (CNX1), identical to calnexin homolog 1, Arabidopsis thaliana, EMBL:AT08315 (SP:P29402)30 At5g07340->calnexin, putative, identical to calnexin homolog 2 from Arabidopsis thaliana (SP:Q38798), strong similarity to calnexin homolog 1, Arabidopsis thaliana, EMBL:AT08315 (SP:P29402); contains Pfam profile PF00262 calreticulin family30 At3g51920->calmodulin-9 (CAM9), identical to calmodulin 9 GI:5825602 from (Arabidopsis thaliana); contains Pfam profile PF00036: EF hand30 At3g49050->lipase class 3 family protein / calmodulin-binding heat-shock protein, putative, calmodulin-binding heat-shock protein, Nicotiana tabacum, PIR:T0410730 At4g33050->similar to calmodulin-binding family protein [Arabidopsis thaliana] (TAIR:At2g26190.1); similar to putative calmodulin-binding protein [Oryza sativa (japonica cultivar-group)] (GB:BAD45140.1); contains InterPro domain IQ calmodulin-binding regi30 At4g26570->calcineurin B-like protein 3 (CBL3), identical to calcineurin B-like protein 3 (GI:22136404) (Arabidopsis thaliana) or calcineurin B-like protein 3 (CBL3), identical to calcineurin B-like protein 3 (GI:22136404) (Arabidopsis thaliana)30 At4g23060->similar to calmodulin-binding family protein [Arabidopsis thaliana] (TAIR:At5g62070.1); similar to P0710E05.11 [Oryza sativa (japonica cultivar-group)] (GB:NP_914546.1); contains InterPro domain IQ calmodulin-binding region (InterPro:IPR000048)30 At1g56340->CALRETICULIN 1;calreticulin 1 (CRT1), identical to calreticulin (crt1) GI:2052379 (Arabidopsis thaliana) or similar to calreticulin 2 (CRT2) [Arabidopsis thaliana] (TAIR:At1g09210.1); similar to calreticulin [Beta vulgaris subsp. vulgaris] (GB30 At3g18430->calcium-binding EF hand family protein, similar to Calcineurin B subunit (Protein phosphatase 2B regulatory subunit) (Calcineurin regulatory subunit) SP:P42322 from (Naegleria gruberi); contains Pfam profile PF00036: EF hand30 At1g66410->ACAM-4;CALMODULIN 4;calmodulin-1/4 (CAM4), identical to calmodulin (Arabidopsis thaliana) GI:16223; nearly identical to SP:P25854 Calmodulin-1/4 {Arabidopsis thaliana}30 At1g08450->CALRETICULIN 3;calreticulin 3 (CRT3), identical to similar to SP:O04153 Calreticulin 3 precursor {Arabidopsis thaliana} or calreticulin 3 (CRT3), identical to similar to SP:O04153 Calreticulin 3 precursor {Arabidopsis thaliana}30 At1g64850->calcium-binding EF hand family protein, contains INTERPRO:IPR002048 calcium-binding EF-hand domain30 At1g09210->calreticulin 2 (CRT2), identical to SP:Q38858 Calreticulin 2 precursor {Arabidopsis thaliana}30 At2g41410->calmodulin, putative, identical to SP:P30188 Calmodulin-like protein {Arabidopsis thaliana}30 At2g41090->calmodulin-like calcium-binding protein, 22 kDa (CaBP-22), identical to SP:P30187 22 kDa calmodulin-like calcium-binding protein (CABP-22) (Arabidopsis thaliana)30 At5g06340->diadenosine 5',5'''-P1,P4-tetraphosphate hydrolase, putative, similar to diadenosine 5',5'''-P1,P4-tetraphosphate hydrolase from (Lupinus angustifolius) GI:1888557, (Hordeum vulgare subsp. vulgare) GI:2564253; contains Pfam profile PF00293: NUD30 At1g71010->phosphatidylinositol-4-phosphate 5-kinase family protein, low similarity to phosphatidylinositol 3,5-kinase (Candida albicans) GI:14571648; contains Pfam profile PF01504: Phosphatidylinositol-4-phosphate 5-Kinase30 At5g61530->small G protein family protein / RhoGAP family protein, contains Pfam domain, PF00620: RhoGAP domain or small G protein family protein / RhoGAP family protein, contains Pfam domain, PF00620: RhoGAP domain30 At5g55190->Ras-related GTP-binding protein (RAN3), identical to atran3 (Arabidopsis thaliana) GI:205828030 At5g47200->Ras-related GTP-binding protein, putative, similar to GTP-binding protein GI:303750 from (Pisum sativum)30 At5g08650->GTP-binding protein LepA, putative30 At3g60860->guanine nucleotide exchange family protein, similar to guanine nucleotide exchange factor, Homo sapiens, GI:5456754; contains Pfam profile PF01369: Sec7 domain30 At3g59920->Rab GDP dissociation inhibitor (GDI2), identical to Rab GDP dissociation inhibitor AtGDI2 (Arabidopsis thaliana) GI:244698130 At3g54840->Rab GTPase (ARA6), identical to small GTPase Ara6 (Arabidopsis thaliana) GI:1316060330 At4g39890->Ras-related GTP-binding family protein, contains Pfam profile: PF00071 Ras family30 At4g35950->rac-like GTP binding protein Arac630 At4g02790->GTP-binding family protein, contains Pfam domain, PF01926: GTPase of unknown function30 At4g02080->GTP-binding protein (SAR1A), identical to SP:O04834 GTP-binding protein SAR1A. (Arabidopsis thaliana)30 At1g56330->ATSAR1;ATSARA1B;SARL;SAR-LIKE;SECRETION-ASSOCIATED RAS;GTP-binding protein (SAR1B), identical to GTP-binding protein (SAR1B) (Arabidopsis thaliana) SP:Q0147430 At3g11730->ATFP8;Ras-related GTP-binding protein, putative, similar to Rab1-like small GTP-binding protein GI:4096662 from (Petunia x hybrida)30 At1g09630->RAS-RELATED SMALL GTPASE;Ras-related GTP-binding protein, putative, similar to GTP-binding protein GI:1370146 from (Lotus japonicus)30 At2g44100->Rab GDP dissociation inhibitor (GDI1), identical to GDP dissociation inhibitor (Arabidopsis thaliana) GI:165542430 At5g58350->protein kinase family protein, contains protein kinase domain, Pfam:PF00069

30 At1g07150->protein kinase family protein, contains eukaryotic protein kinase domain, INTERPRO:IPR00071930 At1g18160->protein kinase family protein, contains Pfam domain, PF00069: Protein kinase domain30 At5g65430->14-3-3 protein GF14 kappa (GRF8), identical to 14-3-3 protein GF14 kappa GI:5802794, SP:P48348 from (Arabidopsis thaliana) or 14-3-3 protein GF14 kappa (GRF8), identical to 14-3-3 protein GF14 kappa GI:5802794, SP:P48348 from (Arabidopsis thal30 At1g22300->GF14 EPSILON;14-3-3 protein GF14 epsilon (GRF10), identical to 14-3-3 protein GF14 epsilon GI:5802798, SP:P48347 from (Arabidopsis thaliana) or 14-3-3 protein GF14 epsilon (GRF10), identical to 14-3-3 protein GF14 epsilon GI:5802798, SP:P4834730 At1g51890->leucine-rich repeat protein kinase, putative, similar to light repressible receptor protein kinase (Arabidopsis thaliana) gi:1321686:emb:CAA66376; contains leucine rich repeat (LRR) domains, Pfam:PF00560; contains protein kinase domain, Pfam:PF30 At4g20450->leucine-rich repeat protein kinase, putative, similar to light repressible receptor protein kinase (Arabidopsis thaliana) gi:1321686:emb:CAA66376; contains leucine rich repeat (LRR) domains, Pfam:PF00560; contains protein kinase domain, Pfam:PF30 At3g26740->light responsive protein-related, similar to light regulated protein precursor SP:Q03200 (Oryza sativa) (Plant Mol. Biol. 22 (1), 165-170 (1993)), ccr protein GB:S52663 (Citrus X paradisi) (Plant Mol. Biol. 26 (1), 165-173 (1994))30 At2g46340->PHYTOCHROME A SUPRESSOR 1;PHYTOCHROME A SUPRESSOR SPA1;SUPPRESSOR OF PHYA-105 1;phytochrome A supressor spa1 (SPA1), identical to phytochrome A supressor spa1 (GI:4809171) (Arabidopsis thaliana); contains 8 WD-40 repeats (Pfam PF00400) (1 weak)30 At1g67310->similar to calmodulin-binding protein [Arabidopsis thaliana] (TAIR:At5g64220.1); similar to calmodulin-binding transcription activator [Brassica napus] (GB:AAM10969.1); contains InterPro domain IQ calmodulin-binding region (InterPro:IPR000048);30 At1g22920->CSN5A;JAB1;CSN5;PUTATIVE JUN KINASE ACTIVATOR;COP9 signalosome subunit 5B / CSN subunit 5B (CSN5B) / c-JUN coactivator protein AJH1, putative (AJH1), COP9 complex subunit CSN5-1; identical to Arabidopsis homologs of a c-Jun coactivator AJH1 GI:

MapMan bins: LMD PMbin description34 At5g62670->ATPase, plasma membrane-type, putative / proton pump, putative, strong similarity to P-type H(+)-transporting ATPase from Nicotiana plumbaginifolia (SP:Q08435, SP:Q08436), Lycopersicon esculentum (GI:5901757, SP:P22180), Solanum tuberosum (GI:434 At5g55290->ATP synthase subunit H family protein, contains weak similarity to Vacuolar ATP synthase subunit H (EC 3.6.3.14) (V-ATPase H subunit) (Vacuolar proton pump H subunit) (V-ATPase M9.2 subunit) (V-ATPase 9.2 kDa membrane accessory protein) (Swiss-34 At4g38920->vacuolar ATP synthase 16 kDa proteolipid subunit 3 / V-ATPase 16 kDa proteolipid subunit 3 (AVAP3) (AVA-P3), identical to SP:P59227 Vacuolar ATP synthase 16 kDa proteolipid subunit 1/3/5 (EC 3.6.3.14) (V-ATPase 16 kDa proteolipid subunit 1/3/5)34 At4g30190->ATPase 2, plasma membrane-type, putative / proton pump 2, putative / proton-exporting ATPase, putative, strong similarity to SP:P19456 ATPase 2, plasma membrane-type (EC 3.6.3.6) (Proton pump 2) {Arabidopsis thaliana}; contains InterPro accessi34 At4g25950->vacuolar ATP synthase, putative / V-ATPase, putative / vacuolar proton pump, putative, similar to Swiss-Prot:O82629 vacuolar ATP synthase subunit G 2 (V-ATPase G subunit 2, Vacuolar proton pump G subunit 2) (Arabidopsis thaliana)34 At4g23710->vacuolar ATP synthase subunit G 2 (VATG2) / V-ATPase G subunit 2 (VAG2) / vacuolar proton pump G subunit 2, identical to Swiss-Prot:O82629 vacuolar ATP synthase subunit G 2 (V-ATPase G subunit 2, Vacuolar proton pump G subunit 2) (Arabidopsis t34 At1g19910,At1g75630 flag_XH2 ->AVA-2PE;VACUOLAR H+-PUMPING ATPASE 16 KDA PROTEOLIPID;vacuolar ATP synthase 16 kDa proteolipid subunit 2 / V-ATPase 16 kDa proteolipid subunit 2 (AVAP2) (AVA-P2), identical to SP:Q39039 Vacuolar ATP synthase 16 kDa proteolip34 At4g00370->sugar transporter family protein, contains Pfam profile PF00083: major facilitator superfamily protein34 At3g18830->ATPLT5;This gene encodes a plasma membrane-localized polyol/cyclitol/monosaccharide-H+-symporter. The AtPLT5 symporter is able to catalyze the energy-dependent membrane passage of a wide range of linear polyols (three to six carbon backbone), o34 At3g19930->SUGAR TRANSPORTER 4;sugar transport protein (STP4), identical to GB:S25009 GI:16524 from (Arabidopsis thaliana)34 At5g40780->lysine and histidine specific transporter, putative, strong similarity to lysine and histidine specific transporter GI:2576361 from (Arabidopsis thaliana); contains Pfam profile PF01490: Transmembrane amino acid transporter protein or lysine a34 At5g14040->mitochondrial phosphate transporter, identical to mitochondrial phosphate transporter GI:3318617 from (Arabidopsis thaliana)34 At4g23010->UDP-galactose transporter-related, contains weak similarity to UDP-galactose transporter related isozyme 1 (GI:1669562) (Mus musculus)34 At2g02810->UDP-galactose/UDP-glucose transporter, contains transmembrane domains; identical to UDP-galactose/UDP-glucose transporter (GI:22651763) (Arabidopsis thaliana) similar to UGTrel1 (GI:1669564) (Rattus rattus); identical to cDNA UDP-galactose/UDP34 At3g51860->cation exchanger, putative (CAX3), similar to high affinity calcium antiporter CAX1 (Arabidopsis thaliana) gi:9256741:gb:AAB05913; Ca2+:Cation Antiporter (CaCA) Family member PMID:11500563; non-consensus AT-acceptor splice site at intron 134 At5g67330->NRAMP metal ion transporter 4 (NRAMP4), identical to metal transporter Nramp4 (Arabidopsis thaliana) gi:6468014:gb:AAF13279; member of the natural resistance-associated macrophage protein (NRAMP) metal transporter family, PMID:1150056334 At5g53550->transporter, putative, similar to iron-phytosiderophore transporter protein yellow stripe 1 (Zea mays) GI:10770865; contains Pfam profile PF03169: OPT oligopeptide transporter protein34 At3g19490->NHD1;sodium hydrogen antiporter, putative, similar to NhaD (Vibrio parahaemolyticus) gi:3123728:dbj:BAA25994; Na+/H+ aniporter (NhaD) family member, PMID:1150056334 At3g19640->magnesium transporter CorA-like family protein (MRS2-3), low similarity to SP:Q01926 RNA splicing protein MRS2, mitochondrial precursor {Saccharomyces cerevisiae}; contains Pfam profile PF01544: CorA-like Mg2+ transporter protein34 At3g05030->ATNHX2;sodium proton exchanger, putative (NHX2), similar to sodium proton exchanger Nhx1 GB:AAD16946 (Arabidopsis thaliana); Member of The Monovalent Cation:Proton Antiporter (CPA1) Family, PMID:1150056334 At1g01790->ATKEA1;K EFFLUX ANTIPORTER 1;K+ efflux antiporter, putative (KEA1), identical to GB:AAD01191 GI:4101473 from ( Arabidopsis thaliana); Monovalent cation:proton antiporter family 2 (CPA2 family) member, PMID:1150056334 At5g60790->ABC transporter family protein, similar to ABC transporter homolog PnATH GI:7573600 from (Populus nigra)34 At5g06530->similar to ABC transporter family protein [Arabidopsis thaliana] (TAIR:At3g52310.1); similar to putative ABC transporter AbcG1 [Oryza sativa (japonica cultivar-group)] (GB:XP_480256.1); contains InterPro domain AAA ATPase (InterPro:IPR003593);34 At3g62700->glutathione-conjugate transporter, putative, similar to glutathione-conjugate transporter AtMRP4 GI:2959767 from (Arabidopsis thaliana)34 At3g62150->multidrug resistant (MDR) ABC transporter, putative, similar to multidrug-resistant protein CjMDR1 GI:14715462 from (Coptis japonica); contains Pfam profiles PF00005: ABC transporter, PF00664: ABC transporter transmembrane region34 At4g01830,At4g01820 flag_XH2 ->multidrug resistance P-glycoprotein, putative, similar to multidrug resistant P-glycoprotein GI:4204793 from (Solanum tuberosum)multidrug resistance P-glycoprotein, putative, similar to multidrug-resistant protein CjMDR1 GI:34 At3g28860->Belongs to the family of ATP-binding cassette (ABC) transporters. Also known as AtMDR11 and PGP19. Possibly regulates auxin-dependent responses by influencing basipetal auxin transport in the root. Acts upstream of phyA in regulating hypocotyl34 At3g28360->ABC transporter family protein, similar to P-glycoprotein homologue GI:2292907 from (Hordeum vulgare subsp. vulgare)34 At1g67940->ABC transporter family protein, similar to ABC transporters: GB:BAA77876 (Escherichia coli), GB:P07655 (Escherichia coli); contains Pfam profile: PF00005 ABC transporter34 At1g02530,At1g02520 flag_XH2 ->multidrug resistance P-glycoprotein, putative, similar to multidrug-resistant protein CjMDR1 GI:14715462 from (Coptis japonica)multidrug resistance P-glycoprotein, putative, similar to multidrug-resistant protein CjMDR1 GI:134 At2g36910->ATMDR1;ARABIDOPSIS THALIANA P GLYCOPROTEIN1;multidrug resistance P-glycoprotein (PGP1), identical to P-glycoprotein GI:3849833 from (Arabidopsis thaliana); homologous to mammalian mdr gene,contains ATP-binding cassette; related to multi drug re34 At1g01620->PIP1;3;PIP1C;TMP-B;plasma membrane intrinsic protein 1C (PIP1C) / aquaporin PIP1.3 (PIP1.3) / transmembrane protein B (TMPB), identical to plasma membrane intrinsic protein 1c SP:Q08733 from (Arabidopsis thaliana)34 At3g16240->AQP1;ATTIP2;1;DELTA-TIP1;delta tonoplast integral protein (delta-TIP), identical to delta tonoplast integral protein (delta-TIP) (GI:9279707)(GB:U39485) (Arabidopsis thaliana) (Plant Cell 8 (4), 587-599 (1996))34 At3g04090->SIP1;1;SIP1A;SMALL AND BASIC INTRINSIC PROTEIN 1A;major intrinsic family protein / MIP family protein, contains Pfam profile: MIP PF0023034 At3g01280->porin, putative, similar to SP:P42055 34 kDa outer mitochondrial membrane protein porin (Voltage-dependent anion-selective channel protein) (VDAC) {Solanum tuberosum}; contains Pfam profile PF01459: Eukaryotic porin34 At3g51860->cation exchanger, putative (CAX3), similar to high affinity calcium antiporter CAX1 (Arabidopsis thaliana) gi:9256741:gb:AAB05913; Ca2+:Cation Antiporter (CaCA) Family member PMID:11500563; non-consensus AT-acceptor splice site at intron 134 At5g25050->integral membrane transporter family protein, similar to biopterin transporter (GI:3377706) (Leishmania mexicana); contains 7 transmembrane domains; contains Pfam PF03092: BT1 family; contains TIGRFAMS TIGR00788: folate/biopterin transporter34 At5g63060->similar to SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein [Arabidopsis thaliana] (TAIR:At4g08690.1); similar to sec14 like protein [Oryza sativa (japonica cultivar-group)] (GB:XP_463685.1); contains InterPro do34 At5g54860->integral membrane transporter family protein, contains 10 transmembrane domains; contains Pfam PF03092: BT1 family; contains TIGRFAMS TIGR00788: folate/biopterin transporter; similar to high affinity folic acid/methotrexate transporter 5 (GI:2134 At5g38030->MATE efflux family protein, similar to ripening regulated protein DDTFR18 (Lycopersicon esculentum) GI:12231296; contains Pfam profile PF01554: Uncharacterized membrane protein family; putative multidrug efflux protein NorM - Vibrio parahaemoly34 At1g14820->SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein, contains Pfam PF00650 : CRAL/TRIO domain; similar to phosphatidylinositol/phosphatidylcholine transfer protein SP:P24280 (Saccharomyces cerevisiae (Baker's yeast)34 At1g72160->PATL3;SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein, similar to GI:807956 from (Saccharomyces cerevisiae)similar to polyphosphoinositide binding protein Ssh2p (GI:2739046) {Glycine max}; contains Pfam PF0065034 At1g76520->auxin efflux carrier family protein, contains auxin efflux carrier domain, Pfam:PF03547 or auxin efflux carrier family protein, contains auxin efflux carrier domain, Pfam:PF0354734 At1g55840->SEC14 cytosolic factor (SEC14) / phosphoglyceride transfer protein, similar to polyphosphoinositide binding protein SEC14 homolog Ssh1p (GB:AAB94598) (Glycine max); identified in Eur J Biochem 1998 Dec 1;258(2):402-10 as AtSEC14, characterized34 At1g21900->emp24/gp25L/p24 family protein, similar to SP:O35587 Transmembrane protein Tmp21 precursor (21 kDa Transmembrane trafficking protein) {Mesocricetus auratus}; contains Pfam profile PF01105: emp24/gp25L/p24 family34 At1g29310->protein transport protein sec61, putative, similar to PfSec61 (Plasmodium falciparum) GI:3057044; contains Pfam profile PF00344: eubacterial secY protein34 At1g79710->integral membrane transporter family protein, similar to high affinity folic acid/methotrexate transporter 5 (GI:21898554) (Leishmania tarentolae); Interpro IPR001991/ PR00173 Sodium:dicarboxylater symporter family34 At1g61250,At1g11180 flag_XH2 ->SECRETORY CARRIER 3;secretory carrier membrane protein (SCAMP) family protein (SC3), contains Pfam domain, PF04144: SCAMP familysecretory carrier membrane protein (SCAMP) family protein, contains Pfam domain, PF04144: SCAMP

bin name elements p-value

1 PS 18 0.05

3.5 minor CHO metabolism.others 3 0.05

4 glycolysis 6 0.05

13 amino acid metabolism 13 0.04

13.1.6 amino acid metabolism.synthesis.aromatic aa 3 0.02

13.1.6.5 amino acid metabolism.synthesis.aromatic aa.tryptophan 2 0.03

16.1 secondary metabolism.isoprenoids 5 0.05

17.6.1 hormone metabolism.gibberelin.synthesis-degradation 2 0.03

20.1 stress.biotic 12 0.01

21 redox.regulation 17 0.00

21.2 redox.ascorbate and glutathione 6 0.02

21.2.2 redox.ascorbate and glutathione.glutathione 3 0.04

26.12 misc.peroxidases 2 0.04

27 RNA 95 0.02

27.1 RNA.processing 12 0.04

28 DNA 23 0.02

28.2 DNA.repair 2 0.02

SI Table S2D. LMD ICS1-impacted processes. MapMan analysis (Thimm et al., 2004) was

performed using ics1versus WT LMD-selected genes (! 2-fold altered expression in ics1PM-infected

versus WT infected samples at 5 dpi and p-value "0.05) to identify statisically enriched processes.

MapMan bins with p-value " 0.05 are shown. Specific genes in bins follow.

29.3 protein.targeting 19 0.02

29.2.1 protein.synthesis.chloroplast/mito - plastid ribosomal protein 6 0.02

29.2.1.1 protein.synthesis.chloroplast/mito - plastid ribosomal protein.plastid 5 0.02

29.5.5 protein.degradation.serine protease 3 0.03

29.5.11.20 protein.degradation.ubiquitin.proteasom 11 0.04

29.5.11.4.3.2 protein.degradation.ubiquitin.E3.SCF.FBOX 3 0.02

30 signalling 37 0.02

30.2.7 signalling.receptor kinases.leucine rich repeat VII 2 0.03

30.2.17 signalling.receptor kinases.DUF 26 3 0.02

30.3 signalling.calcium 11 0.00

35.1.5 not assigned.no ontology.pentatricopeptide (PPR) repeat-containing protein 3 0.02

35.1.9 not assigned.no ontology.BTB/POZ domain-containing protein 2 0.05

MapMan bins: ics1 versus WT LMD PMbin description1 At1g52230-‐>photosystem I reaction center subunit VI, chloroplast, putative / PSI-‐H, putative (PSAH2), identical to SP:Q9SUI6; similar to PSI-‐H precursor (Nicotiana sylvestris) GI:407355; contains Pfam profile PF03244: Photosystem I reaction centre subunit1 At3g04790-‐>ribose 5-‐phosphate isomerase-‐related, similar to ribose-‐5-‐phosphate isomerase GI:18654317 from (Spinacia oleracea)1 At1g68830-‐>STN7;STN7 protein kinase; required for state transitions, phosphorylation of the major antenna complex (LHCII) between PSII and PSI, and light adaptation1 At1g08380-‐>expressed protein1 At1g03600-‐>photosystem II family protein, similar to SP:P74367 {Synechocystis sp.}; similar to ESTs emb:Z27038, gb:AA451546, emb:Z29876, gb:T45359 and gb:R903161 At4g04640-‐>ATP synthase gamma chain 1, chloroplast (ATPC1), identical to SP:Q01908 ATP synthase gamma chain 1, chloroplast precursor (EC 3.6.3.14) {Arabidopsis thaliana}1 At2g20260-‐>photosystem I reaction center subunit IV, chloroplast, putative / PSI-‐E, putative (PSAE2), identical to SP:Q9S714; similar to SP:P12354 Photosystem I reaction center subunit IV, chloroplast precursor (PSI-‐E) {Spinacia oleracea}; contains Pfam p1 At1g32060-‐>PRK;PHOSPHORIBULOKINASE;phosphoribulokinase (PRK) / phosphopentokinase, nearly identical to SP:P25697 Phosphoribulokinase, chloroplast precursor (EC 2.7.1.19) (Phosphopentokinase) (PRKASE) (PRK) {Arabidopsis thaliana}1 At3g50820-‐>Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In Arabidopsis thaliana the PsbO proteins are encoded by two genes:1 At1g20340-‐>DRT112;plastocyanin, similar to plastocyanin GI:1865683 from (Arabidopsis thaliana)1 At5g26780-‐>glycine hydroxymethyltransferase, putative / serine hydroxymethyltransferase, putative / serine/threonine aldolase, putative, strong similarity to SP:P50433 Serine hydroxymethyltransferase, mitochondrial precursor (EC 2.1.2.1) (Serine methylase1 AtCg00680-‐>encodes for CP47, subunit of the photosystem II reaction center.1 AtCg00270-‐>PSII D2 protein1 At5g44520-‐>ribose 5-‐phosphate isomerase-‐related, low similarity to SP:P47968 Ribose 5-‐phosphate isomerase (EC 5.3.1.6) (Phosphoriboisomerase) {Mus musculus}1 AtCg00420-‐>NADH dehydrogenase subunit1 At5g01920-‐>protein kinase family protein, contains eukaryotic protein kinase domain, INTERPRO:IPR0007191 AtCg01070-‐>NADH dehydrogenase ND4L1 AtCg00700-‐>PSII low MW protein

MapMan bins: ics1 versus WT LMD PMbin description3 At5g07370-‐>inositol polyphosphate 6-‐/3-‐/5-‐kinase 2a (IPK2a), contains Pfam domain, PF03770: Inositol polyphosphate kinase or inositol polyphosphate 6-‐/3-‐/5-‐kinase 2a (IPK2a), contains Pfam domain, PF03770: Inositol polyphosphate kinase or inositol polyp3 At1g17160-‐>pfkB-‐type carbohydrate kinase family protein, contains Pfam profile: PF00294 pfkB family carbohydrate kinase3 At1g16340-‐>2-‐dehydro-‐3-‐deoxyphosphooctonate aldolase, putative / phospho-‐2-‐dehydro-‐3-‐deoxyoctonate aldolase, putative / 3-‐deoxy-‐D-‐manno-‐octulosonic acid 8-‐phosphate synthetase, putative, similar to Swiss-‐Prot:Q9AV97 2-‐dehydro-‐3-‐deoxyphosphooctonate aldola3 At1g79500-‐>2-‐dehydro-‐3-‐deoxyphosphooctonate aldolase / phospho-‐2-‐dehydro-‐3-‐deoxyoctonate aldolase / 3-‐deoxy-‐D-‐manno-‐octulosonic acid 8-‐phosphate synthetase (KDSA), identical to Swiss-‐Prot:Q9AV97 2-‐dehydro-‐3-‐deoxyphosphooctonate aldolase (EC 4.1.2.16) (Pho

MapMan bins: ics1 versus WT LMD PMbin description4 At2g22480-‐>phosphofructokinase family protein, similar to phosphofructokinase (Amycolatopsis methanolica) GI:17432243; contains Pfam profile PF00365: Phosphofructokinase4 At4g04040-‐>pyrophosphate-‐-‐fructose-‐6-‐phosphate 1-‐phosphotransferase beta subunit, putative / pyrophosphate-‐dependent 6-‐phosphofructose-‐1-‐kinase, putative, strong similarity to SP:Q41141 Pyrophosphate-‐-‐fructose 6-‐phosphate 1-‐phosphotransferase beta subunit4 At1g13440-‐>glyceraldehyde 3-‐phosphate dehydrogenase, cytosolic, putative / NAD-‐dependent glyceraldehyde-‐3-‐phosphate dehydrogenase, putative, very strong similarity to SP:P25858 Glyceraldehyde 3-‐phosphate dehydrogenase, cytosolic (EC 1.2.1.12) {Arabidopsis4 At3g04120-‐>GLYCERALDEHYDE-‐3-‐PHOSPHATE DEHYDROGENASE C SUBUNIT;glyceraldehyde-‐3-‐phosphate dehydrogenase, cytosolic (GAPC) / NAD-‐dependent glyceraldehyde-‐3-‐phosphate dehydrogenase, identical to SP:P25858 Glyceraldehyde 3-‐phosphate dehydrogenase, cytosolic (4 At2g36530-‐>enolase, identical to SWISS-‐PROT:P25696 enolase (EC 4.2.1.11) (2-‐phosphoglycerate dehydratase)(2-‐phospho-‐D-‐ glycerate hydro-‐lyase) (Arabidopsis thaliana)4 At5g63680-‐>pyruvate kinase, putative, similar to pyruvate kinase, cytosolic isozyme (Glycine max) SWISS-‐PROT:Q42806

MapMan bins: ics1 versus WT LMD PMbin description13 At5g19550-‐>aspartate aminotransferase, cytoplasmic isozyme 1 / transaminase A (ASP2), identical to SP:P46645 Aspartate aminotransferase, cytoplasmic isozyme 1 (EC 2.6.1.1) (Transaminase A) {Arabidopsis thaliana}13 At4g24830-‐>arginosuccinate synthase family, contains Pfam profile: PF00764 arginosuccinate synthase13 At1g31230-‐>AK-‐HSDH I;bifunctional aspartate kinase/homoserine dehydrogenase / AK-‐HSDH, nearly identical to gb:X71364 (PIR:S46497) aspartate kinase / homoserine dehydrogenase from Arabidopsis thaliana; contains ACT domain13 At5g26780-‐>glycine hydroxymethyltransferase, putative / serine hydroxymethyltransferase, putative / serine/threonine aldolase, putative, strong similarity to SP:P50433 Serine hydroxymethyltransferase, mitochondrial precursor (EC 2.1.2.1) (Serine methylase13 At3g61440-‐>encodes a cysteine synthase isomer. The isomer is however less effective in cysteine biosynthesis. It is involved in beta-‐cyanoalanine biosynthesis, a intermediate of cyanide detoxification pathway.13 At3g03630-‐>O-‐ACETYLSERINE (THIOL) LYASE;cysteine synthase, chloroplast, putative / O-‐acetylserine (thiol)-‐lyase, putative / O-‐acetylserine sulfhydrylase, putative, identical to SP:O22682 Probable cysteine synthase, chloroplast precursor {Arabidopsis thali13 At4g33510-‐>2-‐dehydro-‐3-‐deoxyphosphoheptonate aldolase 2 / 3-‐deoxy-‐D-‐arabino-‐heptulosonate 7-‐phosphate synthase 2 / DAHP synthetase 2 (DHS2), nearly identical to SP:Q0021813 At5g17990-‐>anthranilate phosphoribosyltransferase, identical to anthranilate phosphoribosyltransferase, chloroplast precursor (EC 2.4.2.18) SP:Q02166 from (Arabidopsis thaliana)13 At3g54640-‐>tryptophan synthase, alpha subunit (TSA1), identical to gi:61975313 At3g10850-‐>GLX2-‐2;GLY2;GLYOXALASE 2-‐2;GLYOXALASE II;hydroxyacylglutathione hydrolase, cytoplasmic / glyoxalase II (GLX2-‐2), identical to SP:O24496 Hydroxyacylglutathione hydrolase cytoplasmic (EC 3.1.2.6) (Glyoxalase II) (Glx II) {Arabidopsis thaliana}13 At2g43430-‐>GLX2-‐1;GLYOXALASE 2-‐1;GLYOXALASE II;hydroxyacylglutathione hydrolase, mitochondrial / glyoxalase II (GLX2-‐1), identical to SP:O24495 Hydroxyacylglutathione hydrolase, mitochondrial precursor (EC 3.1.2.6) (Glyoxalase II) (Glx II) {Arabidopsis th13 At1g79870-‐>oxidoreductase family protein, contains Pfam profile: PF02826 D-‐isomer specific 2-‐hydroxyacid dehydrogenase, NAD binding domain; similar to glyoxylate reductase from Thermococcus litoralis (gi:13515409)13 At2g20610-‐>ALF1;HLS3;RTY;RTY1;SUR1;ABERRANT LATERAL ROOT FORMATION 1;HOOKLESS 3;SUPERROOT 1;aminotransferase, putative, similar to nicotianamine aminotransferase from Hordeum vulgare (GI:6498122, GI:6469087); contains Pfam profile PF00155 aminotransferase

MapMan bins: ics1 versus WT LMD PMbin description16 At1g63970-‐>2C-‐METHYL-‐D-‐ERYTHRITOL 2,4-‐CYCLODIPHOSPHATE SYNTHASE;2C-‐methyl-‐D-‐erythritol 2,4-‐cyclodiphosphate synthase, putative, similar to 2C-‐methyl-‐D-‐erythritol 2,4-‐cyclodiphosphate synthase GI:7621712 from (Catharanthus roseus) or 2C-‐methyl-‐D-‐erythrito16 At5g60600-‐>1-‐hydroxy-‐2-‐methyl-‐2-‐(E)-‐butenyl 4-‐diphosphate synthase, putative / GcpE family protein, similar to GcpE (Plasmodium falciparum) GI:13094969; contains Pfam profile PF04551: GcpE protein; supporting cDNA gi:27462471:gb:AF434673.1 or 1-‐hydroxy-‐216 At1g17050-‐>SPS2;geranyl diphosphate synthase, putative / GPPS, putative / dimethylallyltransferase, putative / prenyl transferase, putative, similar to GI:11322965; Except for first 55 amino acids, 52% identical to Prenyl transferase (Cyanophora paradoxa)16 At2g21860-‐>violaxanthin de-‐epoxidase-‐related, contains weak similarity to violaxanthin de-‐epoxidase precursor gi:1438875:gb:AAC4937316 At1g66960-‐>lupeol synthase, putative / 2,3-‐oxidosqualene-‐triterpenoid cyclase, putative, similar to lupeol synthase GI:1762150 from (Arabidopsis thaliana), 2,3-‐oxidosqualene-‐triterpenoid cyclase (Arabidopsis thaliana) GI:273802716 At4g31910-‐>transferase family protein, low similarity to anthranilate N-‐hydroxycinnamoyl/benzoyltransferase Dianthus caryophyllus GI:3288180, 10-‐deacetylbaccatin III-‐10-‐O-‐acetyl transferase Taxus cuspidata GI:6746554; contains Pfam profile PF02458 transfe16 At5g48930-‐>transferase family protein, similar to anthranilate N-‐hydroxycinnamoyl/benzoyltransferase from Dianthus caryophyllus (GI:3288180, GI:2239091); contains Pfam profile PF02458 transferase family16 At4g34050-‐>caffeoyl-‐CoA 3-‐O-‐methyltransferase, putative, nearly identical to GI:2960356 (Populus balsamifera subsp. trichocarpa), GI:684942 (Medicago sativa subsp. sativa) isoform contains a GT-‐TG intron which removes an internal segment of the protein. o16 At5g54160-‐>quercetin 3-‐O-‐methyltransferase 1 / flavonol 3-‐O-‐methyltransferase 1 / caffeic acid/5-‐hydroxyferulic acid O-‐methyltransferase (OMT1), identical to O-‐methyltransferase 1 (Arabidopsis thaliana)(GI:2781394), SP:Q9FK25 Quercetin 3-‐O-‐methyltransfera16 At1g72680-‐>cinnamyl-‐alcohol dehydrogenase, putative, similar to cinnamyl-‐alcohol dehydrogenase GB:AAC35846 (Medicago sativa), SP:Q08350 (Picea abies)16 At3g51430-‐>strictosidine synthase, putative (YLS2), similar to hemomucin (Drosophila melanogaster)(GI:1280434), strictosidine synthase (Rauvolfia serpentina)(SP:P15324); contains strictosidine synthase domain PF03088; identical to cDNA YLS2 mRNA for stric16 At4g20840-‐>FAD-‐binding domain-‐containing protein, similar to SP:P30986 reticuline oxidase precursor (Berberine-‐bridge-‐forming enzyme) (BBE) (Tetrahydroprotoberberine synthase) (Eschscholzia californica); contains PF01565 FAD binding domain16 At2g29290-‐>tropinone reductase, putative / tropine dehydrogenase, putative, similar to tropinone reductase SP:P50165 from (Datura stramonium)16 At3g23490-‐>CYANASE;cyanate lyase family, contains Pfam profile: PF02560 cyanate lyase C-‐terminal domain16 At1g54030-‐>GDSL-‐motif lipase, putative, similar to myrosinase-‐associated proteins GI:1769968, GI:1769970, GI:1216391, GI:1216389 from (Brassica napus); contains Pfam profile PF00657: GDSL-‐like Lipase/Acylhydrolase16 At1g60130-‐>jacalin lectin family protein, similar to myrosinase-‐binding protein homolog (Arabidopsis thaliana) GI:2997767; contains Pfam profile PF01419 jacalin-‐like lectin domain16 At1g02205-‐>CER1;ECERIFERUM 1;POSSIBLE ALDEHYDE DECARBONYLASE;CER1 protein, identical to maize gl1 homolog (glossy1 locus) GI:1209703 and CER1 GI:1199467 from (Arabidopsis thaliana) or CER1 protein, identical to maize gl1 homolog (glossy1 locus) GI:12097016 At3g55970-‐>oxidoreductase, 2OG-‐Fe(II) oxygenase family protein, similar to leucoanthocyanidin dioxygenase, Malus domestica, SP:P51091; contains Pfam profile PF03171: oxidoreductase, 2OG-‐Fe(II) oxygenase family16 At4g16330-‐>oxidoreductase, 2OG-‐Fe(II) oxygenase family protein, similar to flavonone-‐3-‐hydroxylase (naringenin,2-‐oxoglutarate 3-‐dioxygenase) from Malus domestica (SP:Q06942), Pyrus communis (GI:20269881); contains Pfam domain PF03171, 2OG-‐Fe(II) oxygenase16 At5g24530-‐>oxidoreductase, 2OG-‐Fe(II) oxygenase family protein, similar to flavanone 3-‐hydroxylase (Persea americana)(GI:727410); contains PF03171 2OG-‐Fe(II) oxygenase superfamily domain16 At3g29630-‐>glycosyltransferase family protein, contains Pfam profile: PF00201 UDP-‐glucoronosyl and UDP-‐glucosyl transferase

MapMan bins: ics1 versus WT LMD PMbin description17 At3g44300,At3g44310 flag_XH2 -‐>nitrilase 2 (NIT2), identical to SP:P32962 Nitrilase 2 (EC 3.5.5.1) {Arabidopsis thaliana}The protein undergoes thiolation following treatment with the oxidant tert-‐butylhydroperoxide. or nitrilase 1 (NIT1), identical to S17 At1g54030-‐>GDSL-‐motif lipase, putative, similar to myrosinase-‐associated proteins GI:1769968, GI:1769970, GI:1216391, GI:1216389 from (Brassica napus); contains Pfam profile PF00657: GDSL-‐like Lipase/Acylhydrolase17 At1g60130-‐>jacalin lectin family protein, similar to myrosinase-‐binding protein homolog (Arabidopsis thaliana) GI:2997767; contains Pfam profile PF01419 jacalin-‐like lectin domain17 At1g51950-‐>auxin-‐responsive protein / indoleacetic acid-‐induced protein 18 (IAA18), identical to SP:O24408:AXII_ARATH Auxin-‐responsive protein IAA18 (Indoleacetic acid-‐induced protein 18) {Arabidopsis thaliana}17 At5g35735-‐>auxin-‐responsive family protein, similar to auxin-‐induced protein AIR12 GI:11357190 (Arabidopsis thaliana)17 At4g27450-‐>expressed protein, similar to auxin down-‐regulated protein ARG10 (Vigna radiata) GI:2970051, wali7 (aluminum-‐induced protein) (Triticum aestivum) GI:45119317 At5g07210,At2g27070 flag_XH2 -‐>two-‐component responsive regulator family protein / response regulator family protein, contains Pfam profile: PF00072 response regulator receiver domainARABIDOPSIS RESPONSE REGULATOR 13;two-‐component responsive regulator fam17 At1g10470-‐>ATRR1;IBC7;INDUCED BY CYTOKININ 7;RESPONSE REGULATOR 4;two-‐component responsive regulator / response regulator 4 (ARR4), identical to responce regulator1 GI:3273195 from (Arabidopsis thaliana); identical to cDNA ARR4 mRNA for response regulator17 At1g06650-‐>2-‐oxoglutarate-‐dependent dioxygenase, putative, similar to 2A6 (GI:599622) and tomato ethylene synthesis regulatory protein E8 (SP:P10967); contains Pfam profile: PF00671 Iron/Ascorbate oxidoreductase family or 2-‐oxoglutarate-‐dependent dioxyge17 At2g22810-‐>1-‐AMINOCYCLOPROPANE-‐1-‐CARBOXYLATE SYNTHASE;1-‐AMINOCYCLOPROPANE-‐1-‐CARBOXYLATE SYNTHASE 4;1-‐aminocyclopropane-‐1-‐carboxylate synthase 4 / ACC synthase 4 (ACS4), identical to gi:940370 (GB:U23481)17 At2g42680-‐>ATMBF1A;MULTIPROTEIN BRIDGING FACTOR 1A;ethylene-‐responsive transcriptional coactivator, putative, similar to ethylene-‐responsive transcriptional coactivator (Lycopersicon esculentum) gi:5669634:gb:AAD4640217 At1g02400-‐>ATGA2OX6;DTA1;gibberellin 2-‐oxidase, putative / GA2-‐oxidase, putative, similar to GA2ox2 (GI:4678368); similar to dioxygenase GI:1666096 from (Marah macrocarpus); contains PF03171 2OG-‐Fe(II) oxygenase superfamily domain17 At1g44090-‐>ATGA20OX5;gibberellin 20-‐oxidase family protein, similar to gibberellin 20-‐oxidase GI:4164141 from (Lactuca sativa); contains Pfam domain PF03171 2OG-‐Fe(II) oxygenase superfamily17 At5g11740-‐>arabinogalactan-‐protein (AGP15), identical to gi:10880507:gb:AAG2428317 At3g45140-‐>lipoxygenase (LOX2), identical to SP:P3841817 At1g72520-‐>lipoxygenase, putative, similar to lipoxygenase gi:1495804 (Solanum tuberosum), gi:1654140 (Lycopersicon esculentum), GB:CAB56692 (Arabidopsis thaliana)

MapMan bins: ics1 versus WT LMD PMbin description20 At4g00860-‐>stress-‐related ozone-‐induced protein (OZI1) / stress-‐related ozone-‐responsive protein, identical to stress-‐related ozone-‐induced protein AtOZI1 (mRNA corresponding to this gene accumulates in response to ozone stress and pathogen (bacterial) in20 At5g48770-‐>disease resistance protein (TIR-‐NBS-‐LRR class), putative, domain signature TIR-‐NBS-‐LRR exists, suggestive of a disease resistance protein.20 At5g46450-‐>disease resistance protein (TIR-‐NBS-‐LRR class), putative, domain signature TIR-‐NBS-‐LRR exists, suggestive of a disease resistance protein.20 At4g36140-‐>disease resistance protein (TIR-‐NBS-‐LRR class), putative, domain signature TIR-‐NBS-‐LRR exists, suggestive of a disease resistance protein.20 At1g66100-‐>thionin, putative, similar to thionin (Arabidopsis thaliana) GI:118153320 At2g26020-‐>PDF1.2B;plant defensin-‐fusion protein, putative (PDF1.2b), plant defensin protein family member, personal communication, Bart Thomma ([email protected]); similar to antifungal protein 1 preprotein (Raphanus sativus) gi:609322:gb:AA20 At1g55210-‐>disease resistance response protein-‐related/ dirigent protein-‐related, smimilar to dirigent protein (Thuja plicata) gi:6694699:gb:AAF25360; similar to pathogenesis-‐related protein (Pisum sativum) gi:4585273:gb:AAD2535520 At1g72260-‐>THI2.1.1;THIONIN 2.1;thionin (THI2.1), identical to thionin (Arabidopsis thaliana) gi:1181531:gb:AAC4167820 At1g72920-‐>disease resistance protein (TIR-‐NBS class), putative, domain signature TIR-‐NBS exists, suggestive of a disease resistance protein.20 At1g65390-‐>ATPP2-‐A5;disease resistance protein (TIR class), putative, domain signature TIR exists, suggestive of a disease resistance protein. or disease resistance protein (TIR class), putative, domain signature TIR exists, suggestive of a disease resis20 At1g51280-‐>disease resistance protein (TIR class), putative, domain signature TIR exists, suggestive of a disease resistance protein. or similar to Toll-‐Interleukin-‐Resistance (TIR) domain-‐containing protein [Arabidopsis thaliana] (TAIR:At5g45000.1); sim20 At2g32680-‐>disease resistance family protein, contains leucine rich-‐repeat (LRR) domains Pfam:PF00560, INTERPRO:IPR001611; similar to Cf-‐2.2 (Lycopersicon pimpinellifolium) gi:1184077:gb:AAC1578020 At5g60010-‐>ferric reductase-‐like transmembrane component family protein, similar to respiratory burst oxidase protein D RbohD from Arabidopsis thaliana, EMBL:AF055357 (gi:3242789), respiratory burst oxidase homolog from Solanum tuberosum (GI:16549089); co20 At2g47440-‐>DNAJ heat shock N-‐terminal domain-‐containing protein, contains Pfam profiles PF00226: DnaJ domain, PF00515: TPR Domain; similar to GP:2104534:AF001308 (T10M13.11)20 At5g43260-‐>chaperone protein dnaJ-‐related, similar to Chaperone protein dnaJ (SP:Q9WZV3) (Thermotoga maritima)20 At3g63350-‐>heat shock transcription factor family protein, contains Pfam profile: PF00447 HSF-‐type DNA-‐binding domain20 At3g62600-‐>DNAJ heat shock family protein, similar to DnaJ homolog subfamily B member 11 precursor (SP:Q99KV1){Mus musculus}; contains Pfam PF00226: DnaJ domain; contains PfaPF01556: DnaJ C terminal regionm20 At4g24190-‐>shepherd protein (SHD) / clavata formation protein, putative, nearly identical to SHEPHERD (Arabidopsis thaliana) GI:19570872; contains Pfam profiles PF02518: ATPase, histidine kinase-‐, DNA gyrase B-‐, and HSP90-‐like domain protein, PF00183: Hsp20 At4g18870-‐>heat shock transcription factor family protein, contains Pfam profile: PF00447 HSF-‐type DNA-‐binding domain20 At2g42750-‐>DNAJ heat shock N-‐terminal domain-‐containing protein, low similarity to GFA2 (Arabidopsis thaliana) GI:21429604; contains Pfam profile PF00226: DnaJ domain20 At3g17020-‐>universal stress protein (USP) family protein, similar to early nodulin ENOD18 (Vicia faba) GI:11602747; contains Pfam profile PF00582: universal stress protein family20 At1g34130-‐>STAUROSPORIN AND TEMPERATURE SENSITIVE 3-‐LIKE B;oligosaccharyl transferase STT3 subunit, putative, similar to SP:P39007 Oligosaccharyl transferase STT3 subunit {Saccharomyces cerevisiae}; contains Pfam profile PF02516: Oligosaccharyl transferas20 At3g23300-‐>dehydration-‐responsive protein-‐related, similar to early-‐responsive to dehydration stress ERD3 protein (Arabidopsis thaliana) GI:15320410; contains Pfam profile PF03141: Putative methyltransferase20 At3g07230-‐>wound-‐responsive protein-‐related, similar to wound-‐induced basic protein SP:Q09020 (Phaseolus vulgaris) (Plant Physiol. 101 (4), 1409 (1993))20 At2g47710-‐>universal stress protein (USP) family protein, similar to ER6 protein (Lycopersicon esculentum) GI:5669654; contains Pfam profile PF00582: universal stress protein family

MapMan bins: ics1 versus WT LMD PMbin locus description21 At1g06650 2-‐oxoglutarate-‐dependent dioxygenase, putative, similar to 2A6 (GI:599622) and tomato ethylene synthesis regulatory protein E8 (SP:P10967); contains Pfam profile: PF00671 Iron/Ascorbate oxidoreductase family or 2-‐oxoglutarate-‐dependent dioxyge21 At1g35620 ATPDIL5-‐2;PDI-‐LIKE 5-‐2;Encodes a protein disulfide isomerase-‐like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily.21 At1g43560 ATY2;thioredoxin family protein, contains Pfam profile: PF00085 Thioredoxin; similar to thioredoxin GI:142153 from (Synechococcus PCC6301)21 At1g45145 ATH5;THIOREDOXIN;thioredoxin H-‐type 5 (TRX-‐H-‐5) (TOUL), identical to SP:Q39241 Thioredoxin H-‐type 5 (TRX-‐H-‐5) {Arabidopsis thaliana}; identical to cDNA (TOUL) mRNA for thioredoxin GI:99296521 At1g77510 ATPDIL1-‐2;PDI-‐LIKE 1-‐2;Encodes a protein disulfide isomerase-‐like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily.21 At2g31570 GLUTATHIONE PEROXIDASE;GLUTATHIONE PEROXIDASE 2;glutathione peroxidase, putative21 At2g47470 ATPDIL2-‐1;PDI-‐LIKE 2-‐1;thioredoxin family protein, similar to protein disulfide isomerase (Dictyostelium discoideum) GI:2627440; contains Pfam profile: PF00085 Thioredoxin or Encodes a protein disulfide isomerase-‐like (PDIL) protein, a member21 At3g15360 ATM4;TRX-‐M4;thioredoxin M-‐type 4, chloroplast (TRX-‐M4), nearly identical to SP:Q9SEU6 Thioredoxin M-‐type 4, chloroplast precursor (TRX-‐M4) {Arabidopsis thaliana}21 At3g24170 ATGR1;glutathione reductase, putative, identical to GB:P48641 from (Arabidopsis thaliana) or similar to gluthatione reductase, chloroplast [Arabidopsis thaliana] (TAIR:At3g54660.1); similar to glutathione reductase [Mesembryanthemum crystallin21 At3g52880 monodehydroascorbate reductase, putative, monodehydroascorbate reductase (NADH), Lycoperison esculentum, PIR:T0640721 At3g54960 Encodes a protein disulfide isomerase-‐like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily.21 At3g63080 glutathione peroxidase, putative, phospholipid-‐hydroperoxide glutathione peroxidase, spinach, PIR:JC561921 At4g25100 superoxide dismutase (Fe), chloroplast (SODB) / iron superoxide dismutase (FSD1), identical to Fe-‐superoxide dismutase (Arabidopsis thaliana) gi:166700:gb:AAA32791; supported by cDNA, Ceres:32935 or superoxide dismutase (Fe), chloroplast (SODB21 At4g35090 catalase 2, identical to catalase 2 SP:P25819, GI:17865693 from (Arabidopsis thaliana) or similar to catalase 3 (SEN2) [Arabidopsis thaliana] (TAIR:At1g20620.2); similar to catalase 1 [Arabidopsis thaliana] (TAIR:At1g20630.1); similar to catal21 At5g08410 ferredoxin-‐thioredoxin reductase, putative, similar to ferredoxin-‐thioredoxin reductase, variable chain (FTR-‐V, Ferredoxin-‐ thioredoxin reductase subunit A, FTR-‐A) (Zea mays) SWISS-‐PROT:P8068021 At5g38630 cytochrome B561 family protein, contains Pfam domain, PF03188: Cytochrome b56121 At5g39950 thioredoxin H-‐type 2 (TRX-‐H-‐2) (Gif2), identical to SP:Q38879 Thioredoxin H-‐type 2 (TRX-‐H-‐2) {Arabidopsis thaliana}; identical to cDNA (Gif2) mRNA for thioredoxin GI:992963

MapMan bins: ics1 versus WT LMD PMbin description26 At5g66680-‐>dolichyl-‐diphosphooligosaccharide-‐protein glycosyltransferase 48kDa subunit family protein, similar to SP:Q05052 Dolichyl-‐diphosphooligosaccharide-‐-‐protein glycosyltransferase 48 kDa subunit precursor (EC 2.4.1.119) (Oligosaccharyl transferase26 At3g51000-‐>epoxide hydrolase, putative, similar to epoxide hydrolase (Glycine max) GI:2764806; contains Pfam profile PF00561: hydrolase, alpha/beta fold family26 At4g25720-‐>glutamine cyclotransferase family protein, contains Pfam profile: PF05096 glutamine cyclotransferase or similar to putative glutamine cyclotransferase precursor [Oryza sativa (japonica cultivar-‐group)] (GB:BAD67954.1); contains InterPro domain26 At3g23600-‐>dienelactone hydrolase family protein, similar to SP:Q9ZT66 Endo-‐1,3;1,4-‐beta-‐D-‐glucanase precursor (EC 3.2.1.-‐) {Zea mays}; contains Pfam profile: PF01738 Dienelactone hydrolase family or similar to dienelactone hydrolase family protein [Arab26 At1g79870-‐>oxidoreductase family protein, contains Pfam profile: PF02826 D-‐isomer specific 2-‐hydroxyacid dehydrogenase, NAD binding domain; similar to glyoxylate reductase from Thermococcus litoralis (gi:13515409)26 At2g26740,At2g26750 flag_XH2 -‐>EPOXIDE HYDROLASE;epoxide hydrolase, soluble (sEH), identical to ATsEH (Arabidopsis thaliana) GI:1109600epoxide hydrolase, putative, strong similarity to ATsEH (Arabidopsis thaliana) GI:110960026 At3g46680-‐>UDP-‐glucoronosyl/UDP-‐glucosyl transferase family protein, contains Pfam profile: PF00201 UDP-‐glucoronosyl and UDP-‐glucosyl transferase26 At4g34138-‐>UDP-‐glucoronosyl/UDP-‐glucosyl transferase family protein, contains Pfam profile: PF00201 UDP-‐glucoronosyl and UDP-‐glucosyl transferase26 At3g15350-‐>glycosyltransferase family 14 protein / core-‐2/I-‐branching enzyme family protein, contains Pfam profile: PF02485 Core-‐2/I-‐Branching enzyme or glycosyltransferase family 14 protein / core-‐2/I-‐branching enzyme family protein, contains Pfam profi26 At2g30140-‐>UDP-‐glucoronosyl/UDP-‐glucosyl transferase family protein, contains Pfam profile: PF00201 UDP-‐glucoronosyl and UDP-‐glucosyl transferase26 At3g26720-‐>glycosyl hydrolase family 38 protein, similar to lysosomal alpha-‐mannosidase GI:3522867 from (Homo sapiens)26 At4g13010-‐>oxidoreductase, zinc-‐binding dehydrogenase family protein, low similarity to probable NADP-‐dependent oxidoreductase (zeta-‐crystallin homolog) P1 (SP:Q39172)(gi:886428) and P2 (SP:Q39173)(gi:886430); contains Pfam profile PF00107: oxidoreductase26 At1g19250-‐>flavin-‐containing monooxygenase family protein / FMO family protein, low similarity to SP:P97501 Dimethylaniline monooxygenase (N-‐oxide forming) 3 (EC 1.14.13.8) (Hepatic flavin-‐containing monooxygenase 3) (FMO 3) {Mus musculus}; contains Pfam26 At1g62810-‐>copper amine oxidase, putative, similar to copper amine oxidase (Cicer arietinum) gi:3819099:emb:CAA0885526 At1g63340,At1g62580 flag_XH2 -‐>flavin-‐containing monooxygenase-‐related / FMO-‐related, low similarity to flavin-‐containing monooxygenase 2 (FMO2) from Homo sapiens (SP:Q99518)flavin-‐containing monooxygenase family protein / FMO family protein, low similari26 At4g20840-‐>FAD-‐binding domain-‐containing protein, similar to SP:P30986 reticuline oxidase precursor (Berberine-‐bridge-‐forming enzyme) (BBE) (Tetrahydroprotoberberine synthase) (Eschscholzia californica); contains PF01565 FAD binding domain26 At2g29290-‐>tropinone reductase, putative / tropine dehydrogenase, putative, similar to tropinone reductase SP:P50165 from (Datura stramonium)26 At2g02390-‐>GST18;GLUTATHIONE S-‐TRANSFERASE 18;glutathione S-‐transferase zeta 1 (GSTZ1) (GST18), identical to SP:Q9ZVQ3:GTZ1_ARATH Glutathione S-‐transferase zeta-‐class 1 (EC 2.5.1.18) (AtGSTZ1) (Maleylacetone isomerase) (EC 5.2.1.-‐) (MAI) {Arabidopsis thal26 At2g30860-‐>ATGSTF7;GLUTTR;glutathione S-‐transferase, putative, identical to GB:Y1229526 At4g15310-‐>similar to cytochrome P450 family protein [Arabidopsis thaliana] (TAIR:At4g15300.1); similar to putative cytochrome P450 [Oryza sativa (japonica cultivar-‐group)] (GB:CAD30852.1); contains InterPro domain Cytochrome P450 (InterPro:IPR001128); co26 At4g37360-‐>cytochrome P450 family protein, cytochrome P450 monooxygenase, Arabidopsis thaliana, PID:d102947826 At4g31500-‐>cytochrome P450 83B1 (CYP83B1), Identical to Cytochrome P450 (SP:O65782 )(Arabidopsis thaliana)26 At4g13770-‐>cytochrome P450 family protein26 At3g26310-‐>cytochrome P450 family protein, contains Pfam profile: PF00067 cytochrome P45026 At3g19270-‐>cytochrome P450 family protein, similar to Cytochrome P450 85 (SP:Q43147) {Lycopersicon esculentum};26 At3g26170,At3g26180 flag_XH2 -‐>cytochrome P450 71B19, putative (CYP71B19), Identical to cytochrome P450 71B19 (SP:Q9LTM4)(Arabidopsis thaliana);similar to cytochrome P450 GB:O65784 (Arabidopsis thaliana)cytochrome P450 71B20, putative (CYP71B2), identical26 At3g03470-‐>cytochrome P450, putative, similar to cytochrome P450 89A2 GB:Q42602 (Arabidopsis thaliana)26 At1g34540-‐>cytochrome P450 family protein, similar to Cytochrome P450 94A1 (P450-‐dependent fatty acid omega-‐hydroxylase) (SP:O81117) {Vicia sativa}; contains Pfam profile: PF00067 cytochrome P45026 At1g33730,At1g33720 flag_XH2 -‐>cytochrome P450, putative, Similar to cytochrome P450 76C2 (SP:O64637)(Arabidopsis thaliana); contains Pfam profile: PF00067 cytochrome P450cytochrome P450, putative, similar to SP:O64636 Cytochrome P450 76C1 (EC 1.14.-‐.-‐) {26 At2g30770-‐>cytochrome P450 71A13, putative (CYP71A13), Identical to Cytochrome P450 71A13 (SP:O49342) (Arabidopsis thaliana); similar to Cytochrome P450 (gi:5713172) (Nicotiana tabacum).26 At5g43940-‐>alcohol dehydrogenase class III / glutathione-‐dependent formaldehyde dehydrogenase / GSH-‐FDH (ADHIII), identical to gi:114338826 At3g01190-‐>peroxidase 27 (PER27) (P27) (PRXR7), identical to SP:Q43735 Peroxidase 27 precursor (EC 1.11.1.7) (Atperox P27) (PRXR7) (ATP12a) {Arabidopsis thaliana}26 At1g33660-‐>peroxidase family protein, similar to SP:Q05431 L-‐ascorbate peroxidase, cytosolic (EC 1.11.1.11) (AP) {Arabidopsis thaliana}; contains Pfam profile PF00141: Peroxidase26 At5g03350-‐>legume lectin family protein, contains Pfam domain, PF00139: Legume lectins beta domain26 At1g54030-‐>GDSL-‐motif lipase, putative, similar to myrosinase-‐associated proteins GI:1769968, GI:1769970, GI:1216391, GI:1216389 from (Brassica napus); contains Pfam profile PF00657: GDSL-‐like Lipase/Acylhydrolase26 At1g60130-‐>jacalin lectin family protein, similar to myrosinase-‐binding protein homolog (Arabidopsis thaliana) GI:2997767; contains Pfam profile PF01419 jacalin-‐like lectin domain26 At5g48485-‐>protease inhibitor/seed storage/lipid transfer protein (LTP) family protein, contains Pfam protease inhibitor/seed storage/LTP family domain PF0023426 At1g62500-‐>protease inhibitor/seed storage/lipid transfer protein (LTP) family protein, similar to auxin down regulated GB:X69640 GI:296442 from (Glycine max); contains Pfam profile PF00234: Protease inhibitor/seed storage/LTP family26 At2g37540-‐>short-‐chain dehydrogenase/reductase (SDR) family protein, contains INTERPRO family IPR002198 Short-‐chain dehydrogenase/reductase (SDR) superfamily26 At3g47810-‐>calcineurin-‐like phosphoesterase family protein, contains Pfam profile: PF00149 calcineurin-‐like phosphoesterase or calcineurin-‐like phosphoesterase family protein, contains Pfam profile: PF00149 calcineurin-‐like phosphoesterase or calcineuri26 At1g31550-‐>GDSL-‐motif lipase, putative, similar to lipase (Arabidopsis thaliana) GI:1145627; contains InterPro Entry IPR001087 Lipolytic enzyme, G-‐D-‐S-‐L family or similar to lipase, putative [Arabidopsis thaliana] (TAIR:At1g28600.1); similar to lipase-‐li26 At2g03980-‐>GDSL-‐motif lipase/hydrolase family protein, similar to Anther-‐specific proline-‐rich protein APG from Brassica napus (SP:P40603 ), Arabidopsis thaliana (GI:22599); contains Pfam profile PF00657: Lipase/Acylhydrolase with GDSL-‐like motif26 At2g04570-‐>GDSL-‐motif lipase/hydrolase family protein, similar to family II lipase EXL3 (GI:15054386), EXL1 (GI:15054382), EXL2 (GI:15054384) (Arabidopsis thaliana); contains Pfam profile PF00657: Lipase/Acylhydrolase with GDSL-‐like motif

MapMan bins: ics1 versus WT LMD PMbin description27 At5g44500-‐>small nuclear ribonucleoprotein associated protein B, putative / snRNP-‐B, putative / Sm protein B, putative, similar to SP:P27048 Small nuclear ribonucleoprotein associated protein B (snRNP-‐B) (Sm protein B) (Sm-‐B) (SmB) {Mus musculus} or simi27 At4g31200-‐>SWAP (Suppressor-‐of-‐White-‐APricot)/surp domain-‐containing protein, related to DAN26 (Homo sapiens) gi:1770394:emb:CAA69591 or SWAP (Suppressor-‐of-‐White-‐APricot)/surp domain-‐containing protein, related to DAN26 (Homo sapiens) gi:1770394:emb:CAA27 At3g19760-‐>eukaryotic translation initiation factor 4A, putative / eIF-‐4A, putative / DEAD box RNA helicase, putative, contains DEAD/DEAH helicase domain; similar to RNA helicase GB:CAA09195 from (Arabidopsis thaliana); identical to cDNA DEAD box RNA heli27 At3g11500-‐>small nuclear ribonucleoprotein G, putative / snRNP-‐G, putative / Sm protein G, putative, similar to SWISS-‐PROT:Q15357 small nuclear ribonucleoprotein G (snRNP-‐G, Sm protein G, Sm-‐G, SmG) (Homo sapiens)27 At2g03870-‐>small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative, similar to U6 snRNA-‐associated Sm-‐like protein LSm7 (Homo sapiens) SWISS-‐PROT:Q9UK45 or small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protei27 At1g03330-‐>small nuclear ribonucleoprotein D, putative / snRNP core SM-‐like protein, putative / U6 snRNA-‐associated Sm-‐like protein, putative, similar to SWISS-‐PROT:Q9Y333 U6 snRNA-‐associated Sm-‐like protein LSm2 (Small nuclear ribonuclear protein D homol27 At2g47640-‐>small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative, similar to small nuclear ribonucleoprotein Sm D2 (snRNP core protein D2) (Sm-‐D2) (Mus musculus) SWISS-‐PROT:P43330 or small nuclear ribonu27 At2g25850-‐>nucleotidyltransferase family protein, contains Pfam profiles: PF01909 nucleotidyltransferase domain, PF04926 poly(A) polymerase predicted RNA binding domain; identical to cDNA GI:31747890 or nucleotidyltransferase family protein, contains Pf27 At2g34750-‐>RNA polymerase I specific transcription initiation factor RRN3 family protein, contains Pfam PF05327: RNA polymerase I specific transcription initiation factor RRN3; similar to RRN3 (GI:7670100) (Homo sapiens) similar to RNA polymerase I speci27 At5g06160-‐>splicing factor-‐related, contains some similarity to splicing factor SP:Q12874 from (Homo sapiens)27 At4g37510-‐>ribonuclease III family protein, contains Pfam profile PF00636 RNase3 domain27 At1g14220-‐>ribonuclease T2 family protein, contains similarity to S-‐like ribonuclease PD1 GI:9957752 from (Prunus dulcis); contains ribonuclease T2 family histidine protein motif27 At5g41010-‐>DNA-‐directed RNA polymerases I, II, and III 7 kDa subunit, putative, similar to SP:P53803 DNA-‐directed RNA polymerases I, II, and III 7.0 kDa polypeptide (EC 2.7.7.6) (ABC10-‐alpha) (RPB7.0) (RPB10alpha) {Homo sapiens}; contains Pfam profile PF027 At4g20330-‐>transcription initiation factor-‐related, contains weak similarity to Transcription initiation factor IIE, beta subunit (TFIIE-‐beta) (Swiss-‐Prot:P29084) (Homo sapiens)27 At1g29940-‐>NRPA2;similar to DNA-‐directed RNA polymerase, putative [Arabidopsis thaliana] (TAIR:At5g45140.1); similar to hypothetical protein UM01133.1 [Ustilago maydis 521] (GB:EAK81692.1); similar to unnamed protein product [Debaryomyces hansenii CBS767]27 At2g01280-‐>transcription factor IIB (TFIIB) family protein, contains Pfam domain, PF00382: Transcription factor TFIIB repeat27 At5g52020-‐>encodes a member of the DREB subfamily A-‐4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY.27 At3g16770-‐>ATEBP;RAP2.3;RAP2.3;RELATED TO AP2 3;Encodes a member of the ERF (ethylene response factor) subfamily B-‐2 of the plant specific ERF/AP2 transcription factor family (RAP2.3). The protein contains one AP2 domain. There are 5 members in this subf27 At2g36450-‐>encodes a member of the DREB subfamily A-‐4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY.27 At1g22985-‐>encodes a member of the ERF (ethylene response factor) subfamily B-‐5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily.27 At5g07210,At2g27070 flag_XH2 -‐>two-‐component responsive regulator family protein / response regulator family protein, contains Pfam profile: PF00072 response regulator receiver domainARABIDOPSIS RESPONSE REGULATOR 13;two-‐component responsive regulator fam27 At1g10470-‐>ATRR1;IBC7;INDUCED BY CYTOKININ 7;RESPONSE REGULATOR 4;two-‐component responsive regulator / response regulator 4 (ARR4), identical to responce regulator1 GI:3273195 from (Arabidopsis thaliana); identical to cDNA ARR4 mRNA for response regulator27 At4g16430-‐>basic helix-‐loop-‐helix (bHLH) family protein, contains Pfam profile: PF00010 helix-‐loop-‐helix DNA-‐binding domain27 At5g39860-‐>bHLH protein, putative DNA-‐binding protein -‐ Arabidopsis thaliana, EMBL:AC01176527 At3g59060-‐>basic helix-‐loop-‐helix (bHLH) family protein, contains Pfam profile: PF00010 helix-‐loop-‐helix DNA-‐binding domain or basic helix-‐loop-‐helix (bHLH) family protein, contains Pfam profile: PF00010 helix-‐loop-‐helix DNA-‐binding domain or similar to27 At5g15840-‐>zinc finger protein CONSTANS (CO), identical to Zinc finger protein CONSTANS SP:Q39057 from (Arabidopsis thaliana) or similar to zinc finger protein CONSTANS-‐LIKE 1 (COL1) [Arabidopsis thaliana] (TAIR:At5g15850.1); similar to constans [Brassic27 At5g24930-‐>zinc finger (B-‐box type) family protein, similar to CONSTANS-‐like protein 1 GI:4091804 from (Malus x domestica)27 At5g57660-‐>zinc finger (B-‐box type) family protein, contains Pfam domain, PF00643: B-‐box zinc finger27 At1g68520-‐>zinc finger (B-‐box type) family protein, contains Pfam profile: PF00643 B-‐box zinc finger27 At1g06040-‐>SALT TOLERANCE;zinc finger (B-‐box type) family protein / salt-‐tolerance protein (STO), identical to SP:Q96288 Salt-‐tolerance protein (Arabidopsis thaliana); contains Pfam profile PF00643: B-‐box zinc finger or zinc finger (B-‐box type) family pr27 At5g66320-‐>zinc finger (GATA type) family protein or zinc finger (GATA type) family protein27 At4g24470-‐>zinc finger (GATA type) protein ZIM (ZIM), identical to zinc-‐finger protein expressed in Inflorescence Meristem, ZIM gi:8918533 from (Arabidopsis thaliana) or zinc finger (GATA type) protein ZIM (ZIM), identical to zinc-‐finger protein expresse27 At3g16870-‐>zinc finger (GATA type) family protein, contains Pfam profile:PF00320 GATA:GATA zinc finger27 At5g16470-‐>zinc finger (C2H2 type) family protein, contains Pfam profile: PF00096 zinc finger, C2H2 type27 At1g55110-‐>zinc finger (C2H2 type) family protein, contains Pfam domain, PF00096: Zinc finger, C2H2 type27 At1g49900-‐>zinc finger (C2H2 type) family protein, contains Pfam profile: PF00096 zinc finger, C2H2 type27 At5g07500-‐>zinc finger (CCCH-‐type) family protein, contains Pfam domain, PF00642: Zinc finger C-‐x8-‐C-‐x5-‐C-‐x3-‐H type (and similar)27 At1g72440-‐>CCAAT-‐box-‐binding transcription factor-‐related, similar to CCAAT-‐box-‐binding transcription factor (CCAAT-‐binding factor) (CBF) (Swiss-‐Prot:Q03701) (Homo sapiens), GB:P53569 (Mus musculus)27 At2g01060-‐>myb family transcription factor, contains Pfam profile: PF00249 myb-‐like DNA-‐binding domain or myb family transcription factor, contains Pfam profile: PF00249 myb-‐like DNA-‐binding domain27 At4g36870-‐>BEL1-‐like homeobox 2 protein (BLH2) or similar to BEL1-‐like homeobox 4 protein (BLH4) [Arabidopsis thaliana] (TAIR:At2g23760.1); similar to BEL1-‐like homeobox 4 protein (BLH4) [Arabidopsis thaliana] (TAIR:At2g23760.2); similar to BEL1-‐related27 At5g47370-‐>homeobox-‐leucine zipper protein 2 (HAT2) / HD-‐ZIP protein 2, identical to homeobox-‐leucine zipper protein HAT2 (HD-‐ZIP protein 2) (Arabidopsis thaliana) SP:P46601; contains Pfam profiles PF04618: HD-‐ZIP protein N terminus, PF02183: Homeobox ass27 At2g16400-‐>homeodomain-‐containing protein27 At3g63350-‐>heat shock transcription factor family protein, contains Pfam profile: PF00447 HSF-‐type DNA-‐binding domain27 At4g18870-‐>heat shock transcription factor family protein, contains Pfam profile: PF00447 HSF-‐type DNA-‐binding domain27 At1g12800-‐>S1 RNA-‐binding domain-‐containing protein, contains Pfam domain, PF00575: S1 RNA binding domain

27 At5g27960,At5g26650 flag_XH2 -‐>MADS-‐box protein (AGL90)similar to MADS-‐box protein (AGL90) [Arabidopsis thaliana] (TAIR:At5g27960.1); similar to putative MADS-‐box protein AGL35 [Oryza sativa (japonica cultivar-‐group)] (GB:BAD86857.1); contains InterPro do27 At3g23250-‐>myb family transcription factor (MYB15), similar to myb-‐related transcription factor GB:CAA66952 from (Lycopersicon esculentum) or similar to myb family transcription factor [Arabidopsis thaliana] (TAIR:At1g06180.1); similar to myb-‐related tra27 At3g01140-‐>similar to myb family transcription factor [Arabidopsis thaliana] (TAIR:At5g15310.1); similar to protein 1 [Petunia x hybrida] (GB:CAA78386.1); contains InterPro domain Myb DNA-‐binding domain (InterPro:IPR001005)27 At5g50820-‐>no apical meristem (NAM) family protein, contains Pfam PF02365: No apical meristem (NAM) domain; similar to unknown protein (pir::T07182)27 At5g39690,At3g56530 flag_XH2 -‐>no apical meristem (NAM) protein-‐related, contains Pfam PF02365 : No apical meristem (NAM) protein; similar to NAC domain protein NAC2 (GI:21554255) {Arabidopsis thaliana}no apical meristem (NAM) protein-‐related, contains P27 At3g44350-‐>no apical meristem (NAM) family protein, Tobacco elicitor-‐responsive gene (TERN), NAC-‐domain protein, Nicotiana tabacum, EMBL:AB02117827 At1g34190-‐>ANAC017;no apical meristem (NAM) family protein, contains Pfam PF02365: No apical meristem (NAM) protein; similar to NAM protein GI:6066595 (Petunia hybrida); nam-‐like protein 9 (GI:21105746) (Petunia x hybrida); NAC1 GI:7716952 (Medicago tru27 At2g43000-‐>ANAC042;no apical meristem (NAM) family protein, contains Pfam PF02365: No apical meristem (NAM) domain;27 At1g20980-‐>ATSPL14;FBR6;SPL1R2;SQUAMOSA PROMOTER BINDING PROTEIN-‐LIKE 14;SQUAMOSA PROMOTER BINDING PROTEIN-‐LIKE RELATED 2;SPL1-‐Related2 protein (SPL1R2), strong similarity to SPL1-‐Related2 protein (Arabidopsis thaliana) GI:6006427; contains Pfam profile P27 At2g42200-‐>squamosa promoter-‐binding protein-‐like 9 (SPL9), identical to squamosa promoter binding protein-‐like 9 (Arabidopsis thaliana) GI:5931673; contains Pfam profile PF03110: SBP domain or squamosa promoter-‐binding protein-‐like 9 (SPL9), identical t27 At4g31270-‐>expressed protein27 At1g76880-‐>trihelix DNA-‐binding protein, putative, similar to DNA-‐binding protein DF1 (Pisum sativum) GI:1364698627 At4g31800-‐>WRKY family transcription factor or similar to WRKY family transcription factor [Arabidopsis thaliana] (TAIR:At2g25000.1); similar to WRKY transcription factor 21 [Larrea tridentata] (GB:AAW30662.1); contains InterPro domain DNA-‐binding WRKY (27 At4g30935-‐>WRKY family transcription factor, contains Pfam profile: PF0310627 At1g80840-‐>ATWRKY40;WRKY family transcription factor, similar to WRKY transcription factor GB:BAA87058 GI:6472585 from (Nicotiana tabacum)27 At2g46400-‐>ATWRKY46;WRKY family transcription factor27 At3g16000-‐>MAR BINDING FILAMENT-‐LIKE PROTEIN 1;matrix-‐localized MAR DNA-‐binding protein-‐related, similar to matrix-‐localized MAR DNA binding protein MFP1 GI:1771158 from (Lycopersicon esculentum)27 At1g01510-‐>ANGUSTIFOLIA;C-‐terminal binding protein (ANGUSTIFOLIA), nearly identical to C-‐terminal binding protein ANGUSTIFOLIA (Arabidopsis thaliana) GI:15408535; contains Pfam profile PF02826: D-‐isomer specific 2-‐hydroxyacid dehydrogenase, NAD binding do27 At3g58120-‐>bZIP transcription factor family protein, contains Pfam profile: PF00170 bZIP transcription factor ;supported by cDNA gi:15100054:gb:AF401300.1:AF40130027 At1g51950-‐>auxin-‐responsive protein / indoleacetic acid-‐induced protein 18 (IAA18), identical to SP:O24408:AXII_ARATH Auxin-‐responsive protein IAA18 (Indoleacetic acid-‐induced protein 18) {Arabidopsis thaliana}27 At4g00416-‐>methyl-‐CpG-‐binding domain-‐containing protein, contains Pfam profile PF01429: Methyl-‐CpG binding domain27 At1g20693-‐>HMG BETA 1;NFD02;NFD2;HIGH MOBILITY GROUP B 2;high mobility group protein beta1 (HMGbeta1) / HMG protein beta1, nearly identical to HMG protein (HMGbeta1) (Arabidopsis thaliana) GI:2832359 or similar to high mobility group protein beta2 (HMGbe27 At1g66160-‐>U-‐box domain-‐containing protein, similar to immediate-‐early fungal elicitor protein CMPG1 (Petroselinum crispum) GI:14582200; contains Pfam profile PF04564: U-‐box domain or U-‐box domain-‐containing protein, similar to immediate-‐early fungal eli27 At5g53960-‐>expressed protein27 At5g49700-‐>DNA-‐binding protein-‐related, contains Pfam domain PF03479: Domain of unknown function (DUF296), found in AT-‐hook motifs Pfam:PF0217827 At1g44770-‐>expressed protein27 At1g56110-‐>NOP56-‐LIKE PROTEIN;nucleolar protein Nop56, putative, similar to XNop56 protein (Xenopus laevis) GI:14799394; contains Pfam profile PF01798: Putative snoRNA binding domain27 At1g68580-‐>agenet domain-‐containing protein / bromo-‐adjacent homology (BAH) domain-‐containing protein, contains Pfam profile PF01426: BAH domain and PF05641: Agenet domain or agenet domain-‐containing protein / bromo-‐adjacent homology (BAH) domain-‐contain27 At2g26780-‐>expressed protein, contains Pfam profile TBP (TATA-‐binding protein) -‐interacting protein 120 (TIP120); contains TIGRFAM profile TIGR01612: reticulocyte binding protein27 At5g22950-‐>SNF7 family protein, contains Pfam domain, PF03357: SNF7 family27 At1g73030-‐>SNF7 family protein, contains Pfam domain, PF03357: SNF7 family27 At3g09735-‐>DNA-‐binding S1FA family protein, contains Pfam profile: PF04689 DNA binding protein S1FA27 At5g13150-‐>exocyst subunit EXO70 family protein, leucine zipper-‐containing protein -‐ Lycopersicon esculentum, EMBL:Z12127 contains Pfam domain PF03081: Exo70 exocyst complex subunit;27 At5g25490-‐>zinc finger (Ran-‐binding) family protein, contains Pfam domain, PF00641: Zn-‐finger in Ran binding protein and others27 At5g63740-‐>zinc finger protein-‐related27 At5g54310-‐>ARF GAP-‐like zinc finger-‐containing protein ZIGA3 (ZIGA3), nearly identical to ARF GAP-‐like zinc finger-‐containing protein ZIGA3 GI:10441352 from (Arabidopsis thaliana); contains InterPro accession IPR001164: Human Rev interacting-‐like protein27 At5g07260-‐>homeobox protein-‐related, contains weak similarity to Homeobox protein FWA (Swiss-‐Prot:Q9FVI6) (Arabidopsis thaliana)27 At4g22750-‐>zinc finger (DHHC type) family protein, contains DHHC zinc finger domain PF0152927 At4g21610-‐>zinc finger protein, putative, similar to zinc-‐finger protein Lsd1 (Arabidopsis thaliana) gi:1872521:gb:AAC4966027 At1g18080-‐>WD-‐40 REPEAT PROTEIN ATARCA;WD-‐40 repeat family protein / auxin-‐dependent protein (ARCA) / guanine nucleotide-‐binding protein beta subunit, putative, identical to SP:O24456 Guanine nucleotide-‐binding protein beta subunit-‐like protein (WD-‐40 rep27 At3g18490-‐>aspartyl protease family protein, contains Pfam domain, PF00026: eukaryotic aspartyl protease27 At1g74120-‐>mitochondrial transcription termination factor-‐related / mTERF-‐related, contains Pfam profile PF02536: mTERF27 At1g07360-‐>zinc finger (CCCH-‐type) family protein / RNA recognition motif (RRM)-‐containing protein, similar to SP:O59800 Cell cycle control protein cwf5 {Schizosaccharomyces pombe}, RNA Binding Protein 47 (Nicotiana plumbaginifolia) GI:9663769; contains P27 At1g04140-‐>transducin family protein / WD-‐40 repeat family protein, contains 4 WD-‐40 repeats (PF00400); similar to neural cell adhesion molecule 2, large isoform precursor gb:M76710 from Xenopus laevis, and beta transducin from S. cerevisiae gb:Q05946. ES27 At2g01650-‐>PLANT UBX DOMAIN-‐CONTAINING PROTEIN 2;zinc finger (C2H2 type) family protein, contains Pfam domain, PF00096: Zinc finger, C2H2 type27 At2g19540-‐>transducin family protein / WD-‐40 repeat family protein, contains WD-‐40 repeats (PF00400); similar to Glutamate-‐rich WD repeat protein (GRWD) (SP:Q9BQ67)(Homo sapiens)27 At2g30520-‐>ROOT PHOTOTROPISM 2;RPT2;signal transducer of phototropic response (RPT2), identical to RPT2 (Arabidopsis thaliana) gi:6959488:gb:AAF33112 or similar to phototropic-‐responsive NPH3 family protein [Arabidopsis thaliana] (TAIR:At5g48800.1); simi

27 At3g03920-‐>Gar1 RNA-‐binding region family protein, contains Pfam profile PF04410: Gar1 protein RNA binding region27 At1g74230-‐>glycine-‐rich RNA-‐binding protein, similar to RNA-‐binding protein GB:S46286 from (Nicotiana sylvestris)27 At1g32790-‐>CID11;RNA-‐binding protein, putative, similar to RNA-‐binding protein GB:CAB40027 GI:4539439 from (Arabidopsis thaliana).Member of a family of PAB2 binding domain proteins. or similar to RNA-‐binding protein, putative [Arabidopsis thaliana] (TAIR

MapMan bins: ics1 versus WT LMD PMbin description28 At5g32440-‐>expressed protein28 At3g53110-‐>DEAD/DEAH box helicase, putative, RNA helicase, Mus musculus, PIR:I4973128 At4g31210-‐>DNA topoisomerase family protein, similar to DNA Topoisomerase I (SP:Q9X3X7) {Zymomonas mobilis}28 At1g75230-‐>HhH-‐GPD base excision DNA repair family protein, contains Pfam domain PF00730: HhH-‐GPD superfamily base excision DNA repair protein or HhH-‐GPD base excision DNA repair family protein, contains Pfam domain PF00730: HhH-‐GPD superfamily base exci28 At1g35530-‐>DEAD/DEAH box helicase, putative, low similarity to RNA helicase/RNAseIII CAF protein (Arabidopsis thaliana) GI:6102610; contains Pfam profiles PF00270: DEAD/DEAH box helicase, PF00271: Helicase conserved C-‐terminal domain28 At2g16440-‐>DNA replication licensing factor, putative, similar to SP:P49717 DNA replication licensing factor MCM4 (CDC21 homolog) {Mus musculus}, SP:P29458 Cdc21 protein {Schizosaccharomyces pombe}; contains Pfam profile PF00493: MCM2/3/5 family28 At1g60020-‐>copia-‐like retrotransposon family, has a 0. P-‐value blast match to GB:AAC02672 polyprotein (Ty1_Copia-‐element) (Arabidopsis arenosa)28 At2g03390-‐>uvrB/uvrC motif-‐containing protein, contains Pfam profile PF02151: UvrB/uvrC motif28 At2g18820-‐>non-‐LTR retrotransposon family (LINE), has a 2.7e-‐38 P-‐value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-‐element) (Mus musculus)28 At2g06110-‐>gypsy-‐like retrotransposon family (Athila), has a 6.4e-‐72 P-‐value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana)28 At5g41710-‐>Mutator-‐like transposase family, has a 6.2e-‐18 P-‐value blast match to GB:AAA21566 mudrA of transposon=""MuDR"" (MuDr-‐element) (Zea mays)28 At2g14320,At3g34299,At3g33377,At4g04393,At3g45340,At4g09410-‐>flag_XH6Mutator-‐like transposase family, has a 5.7e-‐45 P-‐value blast match to Q9SI25 /181-‐349 Pfam PF03108 MuDR family transposase (MuDr-‐element domain)28 At5g12910-‐>histone H3, putative, similar to histone H3 from Mus musculus GI:51301, Gallus gallus GI:211859, Medicago sativa GI:166384, Pisum sativum SP:P02300; contains Pfam profile PF00125 Core histone H2A/H2B/H3/H428 At3g45980-‐>histone H2B, identical to histone H2B Arabidopsis thaliana GI:2407802; contains Pfam profile PF00125 Core histone H2A/H2B/H3/H428 At4g40030-‐>histone H3.2, identical to Histone H3.2, minor Lolium temulentum SP:P11105, nearly identical to histone H3.2 Mus pahari GI:515005; contains Pfam profile PF00125 Core histone H2A/H2B/H3/H428 At4g40040-‐>histone H3.2, identical to Histone H3.2, minor Lolium temulentum SP:P11105, nearly identical to histone H3.2 Mus pahari GI:515005; contains Pfam profile PF00125 Core histone H2A/H2B/H3/H4 or similar to histone H3.2 [Arabidopsis thaliana] (TAIR28 At1g16190-‐>DNA repair protein RAD23, putative, similar to DNA repair by nucleotide excision (NER) RAD23 protein, isoform II GI:1914685 from (Daucus carota)28 At1g27410-‐>GIG3;DNA cross-‐link repair protein-‐related, contains weak similarity to Swiss-‐Prot:P30620 DNA cross-‐LINK repair protein PSO2/SNM1 (Saccharomyces cerevisiae)28 At3g51670-‐>SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein, similar to polyphosphoinositide binding protein Ssh2p (GI:2739046) {Glycine max};; contains Pfam PF00650 : CRAL/TRIO domain; contains Pfam PF03765 : CRAL/TRIO, N-‐28 At3g43050-‐>Mutator-‐like transposase family, has a 5.0e-‐39 P-‐value blast match to Q9SUF8 /145-‐308 Pfam PF03108 MuDR family transposase (MuDr-‐element domain)28 At2g07740-‐>zinc knuckle (CCHC-‐type) family protein, similar to zinc finger protein GB:AAA75253; some members of this protein family have a weak CCHC zinc fingers that is mostly from retroviral gag proteins (nucleocapsid)28 At1g72150-‐>PATL1;PATELLIN 1;SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein, similar to SEC14-‐like protein 2 (Alpha-‐tocopherol associated protein) (TAP) (bTAP) (Fragment) (SP:P58875) {Bos taurus}; similar to GI:807956 from28 At1g55840-‐>SEC14 cytosolic factor (SEC14) / phosphoglyceride transfer protein, similar to polyphosphoinositide binding protein SEC14 homolog Ssh1p (GB:AAB94598) (Glycine max); identified in Eur J Biochem 1998 Dec 1;258(2):402-‐10 as AtSEC14, characterized

MapMan bins: ics1 versus WT LMD PMbin description29 At3g60340-‐>palmitoyl protein thioesterase family protein, palmitoyl-‐protein thioesterase precursor, Mus musculus, EMBL:AF071025 or palmitoyl protein thioesterase family protein, palmitoyl-‐protein thioesterase precursor, Mus musculus, EMBL:AF07102529 At4g31180-‐>aspartyl-‐tRNA synthetase, putative / aspartate-‐-‐tRNA ligase, putative, similar to Aspartyl-‐tRNA synthetase (Aspartate-‐-‐tRNA ligase) (AspRS) (Homo sapiens) GI:20178330 or aspartyl-‐tRNA synthetase, putative / aspartate-‐-‐tRNA ligase, putative, si29 At4g26870-‐>aspartyl-‐tRNA synthetase, putative / aspartate-‐-‐tRNA ligase, putative, simialr to aspartate-‐tRNA ligase (EC 6.1.1.12) from Drosophila melanogaster GI:4512034, Homo sapiens SP:P14868, Rattus norvegicus SP:P15178; contains Pfam profile PF00152 tR29 At4g05050-‐>polyubiquitin (UBQ11), identical to GI:304117 or similar to polyubiquitin (UBQ14) [Arabidopsis thaliana] (TAIR:At4g02890.1); similar to polyubiquitin (UBQ3) [Arabidopsis thaliana] (TAIR:At5g03240.2); similar to polyubiquitin (UBQ4) [Arabidopsi29 At1g29880-‐>glycyl-‐tRNA synthetase / glycine-‐-‐tRNA ligase, identical to SP:O23627 Glycyl-‐tRNA synthetase (EC 6.1.1.14) (Glycine-‐-‐tRNA ligase) (GlyRS) {Arabidopsis thaliana}29 At1g66530-‐>arginyl-‐tRNA synthetase, putative / arginine-‐-‐tRNA ligase, putative, similar to SP:P37880 Arginyl-‐tRNA synthetase (EC 6.1.1.19) (Arginine-‐-‐tRNA ligase) (ArgRS) {Cricetulus longicaudatus}; contains Pfam profiles PF00750: arginyl-‐tRNA synthetase,29 AtCg01120-‐>encodes a chloroplast ribosomal protein S15, a constituent of the small subunit of the ribosomal complex29 AtCg00660-‐>encodes a chloroplast ribosomal protein L20, a constituent of the large subunit of the ribosomal complex29 AtCg00770-‐>chloroplast 30S ribosomal protein S829 At3g56010-‐>expressed protein29 At1g68590-‐>plastid-‐specific 30S ribosomal protein 3, putative / PSRP-‐3, putative, similar to SP:P82412 Plastid-‐specific 30S ribosomal protein 3, chloroplast precursor (PSRP-‐3) {Spinacia oleracea}; contains Pfam profile PF04839: Plastid and cyanobacterial29 At2g38140-‐>30S RIBOSOMAL PROTEIN S31;PLASTID-‐SPECIFIC RIBOSOMAL PROTEIN 4;chloroplast 30S ribosomal protein S31 (PSRP4)29 At5g20290-‐>40S ribosomal protein S8 (RPS8A), ribosomal protein S8 -‐ Zea mays, PIR:T0408829 At5g56670-‐>40S ribosomal protein S30 (RPS30C)29 At5g47320-‐>30S ribosomal protein S19, mitochondrial (RPS19)29 At5g23740-‐>40S ribosomal protein S11 (RPS11C)29 At3g60770-‐>40S ribosomal protein S13 (RPS13A), AtRPS13A mRNA for cytoplasmic ribosomal protein S13, Arabidopsis thaliana,AB03173929 At3g53890-‐>40S ribosomal protein S21 (RPS21B), ribosomal protein S21, cytosolic -‐ Oryza sativa, PIR:S3835729 At3g49010-‐>60S ribosomal protein L13 (RPL13B) / breast basic conserved protein 1-‐related (BBC1) or 60S ribosomal protein L13 (RPL13B) / breast basic conserved protein 1-‐related (BBC1) or similar to 60S ribosomal protein L13 (RPL13D) [Arabidopsis thalian29 At3g46040-‐>Regulated by TCP20.29 At4g33865-‐>40S ribosomal protein S29 (RPS29C)29 At4g29390-‐>40S ribosomal protein S30 (RPS30B), RIBOSOMAL PROTEIN S30 -‐ Arabidopsis thaliana,PID:e135818329 At4g27090-‐>60S ribosomal protein L14 (RPL14B), ribosomal protein L14 -‐ Human,PIR3:JC595429 At1g16740-‐>ribosomal protein L20 family protein, similar to ribosomal protein L20 GI:3603025 from (Guillardia theta)29 At2g33370-‐>60S ribosomal protein L23 (RPL23B)29 At2g40590,At2g40510 flag_XH2 -‐>40S ribosomal protein S26 (RPS26B)40S ribosomal protein S26 (RPS26A)29 At1g48830-‐>40S ribosomal protein S7 (RPS7A), similar to 40S ribosomal protein S7 homolog GI:5532505 from (Brassica oleracea) or 40S ribosomal protein S7 (RPS7A), similar to 40S ribosomal protein S7 homolog GI:5532505 from (Brassica oleracea)29 At3g18740-‐>60S ribosomal protein L30 (RPL30C), similar to 60S RIBOSOMAL PROTEIN L30 GB:O49884 from (Lupinus luteus)29 At3g02560-‐>40S ribosomal protein S7 (RPS7B), similar to ribosomal protein S7 GB:AAD26256 from (Secale cereale) or 40S ribosomal protein S7 (RPS7B), similar to ribosomal protein S7 GB:AAD26256 from (Secale cereale)29 At3g06700-‐>60S ribosomal protein L29 (RPL29A), similar to ribosomal protein L29 GI:7959366 (Panax ginseng) or similar to 60S ribosomal protein L29 (RPL29B) [Arabidopsis thaliana] (TAIR:At3g06680.1); similar to P0475H04.11 [Oryza sativa (japonica cultivar29 At3g10090-‐>40S ribosomal protein S28 (RPS28A), similar to ribosomal protein S28 GB:P34789 (Arabidopsis thaliana)29 At3g05560-‐>60S ribosomal protein L22-‐2 (RPL22B), identical to 60S ribosomal protein L22-‐2 SP:Q9M9W1 from (Arabidopsis thaliana) or 60S ribosomal protein L22-‐2 (RPL22B), identical to 60S ribosomal protein L22-‐2 SP:Q9M9W1 from (Arabidopsis thaliana)29 At3g11510-‐>40S ribosomal protein S14 (RPS14B), similar to 40S ribosomal protein S14 GB:P19950 (Zea mays)29 At2g43460-‐>60S ribosomal protein L38 (RPL38A)29 At1g14320-‐>60S ribosomal protein L10 (RPL10A) / Wilm's tumor suppressor protein-‐related, similar to tumor suppressor GI:575354 from (Oryza sativa)29 At1g33140,At1g33120 flag_XH2 -‐>60S ribosomal protein L9 (RPL90A/C), similar to RIBOSOMAL PROTEIN L9 GB:P49209 from (Arabidopsis thaliana)60S ribosomal protein L9 (RPL90B), similar to RIBOSOMAL PROTEIN L9 GB:P49209 from (Arabidopsis thaliana)29 At1g48350-‐>ribosomal protein L18 family protein, similar to ribosomal protein L18 GI:3980238 from (Thermotoga maritima)29 At1g70600,At1g23290 flag_XH2 -‐>60S ribosomal protein L27A (RPL27aC), identical to 60S ribosomal protein L27A GB:P49637 (Arabidopsis thaliana)RPL27AB;60S RIBOSOMAL PROTEIN L27A;Regulated by TCP20.29 At2g36160-‐>40S ribosomal protein S14 (RPS14A)29 At2g39390-‐>60S ribosomal protein L35 (RPL35B)29 At5g20920-‐>eukaryotic translation initiation factor 2 subunit 2, putative / eIF-‐2-‐beta, putative, similar to SP:P41035 Eukaryotic translation initiation factor 2 subunit (eIF-‐2-‐beta) {Oryctolagus cuniculus}; contains Pfam profile PF01873: Domain found in29 At5g36230-‐>eIF4-‐gamma/eIF5/eIF2-‐epsilon domain-‐containing protein, low similarity to SP:Q13144 Translation initiation factor eIF-‐2B epsilon subunit (eIF-‐2B GDP-‐GTP exchange factor) {Homo sapiens}; contains Pfam profile PF02020: eIF4-‐gamma/eIF5/eIF2-‐epsilo29 At5g54760-‐>eukaryotic translation initiation factor SUI1, putative, similar to SP:P32911 Protein translation factor SUI1 {Saccharomyces cerevisiae}; contains Pfam profile PF01253: Translation initiation factor SUI129 At4g33250-‐>eukaryotic translation initiation factor 3 subunit 11 / eIF-‐3 p25 / eIF3k (TIF3K1), identical to Swiss-‐Prot:Q9SZA3 eukaryotic translation initiation factor 3 subunit 11 (eIF-‐3 p25) (eIF3k) (Arabidopsis thaliana); identical to cDNA initiation fa29 At4g18040-‐>eukaryotic translation initiation factor 4E 1 / eIF-‐4E1 / mRNA cap-‐binding protein 1 (EIF4E1), identical to SP:O23252 Eukaryotic translation initiation factor 4E (eIF-‐4E) (eIF4E) (mRNA cap-‐binding protein) (eIF-‐4F 25 kDa subunit) (eIF-‐4F P26 su

29 At3g19760-‐>eukaryotic translation initiation factor 4A, putative / eIF-‐4A, putative / DEAD box RNA helicase, putative, contains DEAD/DEAH helicase domain; similar to RNA helicase GB:CAA09195 from (Arabidopsis thaliana); identical to cDNA DEAD box RNA heli29 At3g13920-‐>RH4;TIF4A1;eukaryotic translation initiation factor 4A-‐1 / eIF-‐4A-‐1, eIF-‐4A-‐1 gi:15293046, gi:15450485; contains Pfam profile PF00270: DEAD/DEAH box helicase; contains Pfam profile PF00271: Helicase conserved C-‐terminal domain or similar to eu29 At1g72340-‐>eukaryotic translation initiation factor 2B family protein / eIF-‐2B family protein, similar to SP:Q64270 Translation initiation factor eIF-‐2B alpha subunit {Rattus norvegicus}; contains Pfam profile PF01008: Initiation factor 2 subunit family29 At1g33040-‐>nascent polypeptide-‐associated complex (NAC) domain-‐containing protein, similar to alpha-‐NAC, non-‐muscle form (Mus musculus) GI:1666690; contains Pfam profile PF01849: NAC domain29 At1g07940,At1g07930,At5g60390,At1g07920-‐> flag_XH4 elongation factor 1-‐alpha / EF-‐1-‐alpha, identical to GB:CAA34456 from (Arabidopsis thaliana) (Plant Mol. Biol. 14 (1), 107-‐110 (1990)) or similar to elongation factor 1-‐alpha / EF-‐1-‐alpha [Arabidopsis th29 At4g02930-‐>elongation factor Tu, putative / EF-‐Tu, putative, similar to mitochondrial elongation factor Tu (Arabidopsis thaliana) gi:1149571:emb:CAA6151129 At1g57720,At1g09640 flag_XH2 -‐>elongation factor 1B-‐gamma, putative / eEF-‐1B gamma, putative, similar to elongation factor 1B gamma GI:3868758 from (Oryza sativa) or similar to elongation factor 1B-‐gamma, putative / eEF-‐1B gamma, putative [Arabidopsis th29 At4g27640-‐>importin beta-‐2 subunit family protein, low similarity to importin 4 GI:18700635 from (Homo sapiens)29 At1g27970-‐>nuclear transport factor 2 (NTF2), putative, similar to Swiss-‐Prot:P33331 nuclear transport factor 2 (NTF-‐2) (Nuclear transport factor P10) (Saccharomyces cerevisiae)29 At3g46560-‐>mitochondrial import inner membrane translocase (TIM9), identical to mitochondrial import inner membrane translocase subunit Tim9 (Arabidopsis thaliana) Swiss-‐Prot:Q9XGX9; contains Pfam domain, PF02953: Tim10/DDP family zinc finger29 At3g27080-‐>mitochondrial import receptor subunit TOM20-‐3 / translocase of outer membrane 20 kDa subunit 3 (TOM20-‐3), identical to mitochondrial import receptor subunit TOM20-‐3 SP:P82874 from (Arabidopsis thaliana)29 At3g25040-‐>ER lumen protein retaining receptor, putative / HDEL receptor, putative, similar to SP:P35402 ER lumen protein retaining receptor (HDEL receptor) {Arabidopsis thaliana}; contains Pfam profile PF00810: ER lumen protein retaining receptor29 At4g20110-‐>vacuolar sorting receptor, putative, similar to BP-‐80 vacuolar sorting receptor (Pisum sativum) GI:1737222; identical to vacuolar sorting receptor-‐like protein (GI:2827665) (Arabidopsis thaliana)29 At2g14720,At2g14740 flag_XH2 -‐>vacuolar sorting receptor, putative, identical to GB:U79960 GI:1737220; contains a calcium-‐binding EGF-‐like domain signature or vacuolar sorting receptor, putative, identical to GB:U79960 GI:1737220; contains a calcium-‐bind29 At5g61970-‐>signal recognition particle-‐related / SRP-‐related, low similarity to Signal recognition particle 68 kDa protein (SRP68) from Homo sapiens SP:Q9UHB9, Canis familiaris SP:Q0000429 At5g50460-‐>protein transport protein SEC61 gamma subunit, putative, similar to Swiss-‐Prot:Q19967 protein transport protein SEC61 gamma subunit (Caenorhabditis elegans)29 At3g62290-‐>Gene encoding ADP-‐ribosylation factor and similar to other ARFs and ARF-‐like proteins. Members of this family are known to be essential for vesicle coating and uncoating and functions in GTP-‐binding. The gene is shown to play a role in cell div29 At3g60540-‐>sec61beta family protein, similar to SP:P52870 Protein transport protein SEC61 beta 1 subunit {Saccharomyces cerevisiae}; contains Pfam profile PF03911: Sec61beta family or sec61beta family protein, similar to SP:P52870 Protein transport prote29 At4g24920-‐>protein transport protein SEC61 gamma subunit, putative, similar to Swiss-‐Prot:Q19967 protein transport protein SEC61 gamma subunit (Caenorhabditis elegans)29 At4g24550-‐>clathrin adaptor complexes medium subunit family protein, contains Pfam profile: PF00928 adaptor complexes medium subunit family or clathrin adaptor complexes medium subunit family protein, contains Pfam profile: PF00928 adaptor complexes medi29 At1g60970-‐>clathrin adaptor complex small chain family protein, contains Pfam profile: PF01217 clathrin adaptor complex small chain29 At1g48160-‐>signal recognition particle 19 kDa protein, putative / SRP19, putative, similar to signal recognition particle 19 kDa protein subunit SRP19 GI:624221 (Oryza sativa (japonica cultivar-‐group)); contains Pfam profile: PF01922 SRP19 protein29 At1g52600-‐>signal peptidase, putative, similar to SP:P13679 Microsomal signal peptidase 21 kDa subunit (EC 3.4.-‐.-‐) {Canis familiaris}; contains Pfam profile PF00461: Signal peptidase I29 At2g45070-‐>SEC 61 BETA SUBUNIT;sec61beta family protein, similar to SP:P52870 Protein transport protein SEC61 beta 1 subunit {Saccharomyces cerevisiae}; contains Pfam profile PF03911: Sec61beta family or similar to sec61beta family protein [Arabidopsis t29 At2g19790-‐>clathrin adaptor complex small chain family protein, contains Pfam profile: PF01217 clathrin adaptor complex small chain29 At2g27600-‐>AAA-‐type ATPase family protein / vacuolar sorting protein-‐related, similar to SP:P46467 SKD1 protein (Vacuolar sorting protein 4b) {Mus musculus}; contains Pfam profiles PF00004: ATPase AAA family, PF04212: MIT domain29 At5g16070-‐>chaperonin, putative, similar to SWISS-‐PROT:P80317 T-‐complex protein 1, zeta subunit (TCP-‐1-‐zeta) (Mus musculus); contains Pfam:PF00118 domain, TCP-‐1/cpn60 chaperonin family29 At5g18190-‐>protein kinase family protein, contains Pfam domains, PF00069: Protein kinase domain29 At5g10480-‐>protein tyrosine phosphatase-‐like protein, putative (PAS2), identical to PEPINO/PASTICCINO2 protein GI:24411193, GI:24575153 from (Arabidopsis thaliana); contains Pfam:04387: protein tyrosine phosphatase-‐like protein29 At5g01920-‐>protein kinase family protein, contains eukaryotic protein kinase domain, INTERPRO:IPR00071929 At3g46920-‐>protein kinase family protein, similar to MAP3K delta-‐1 protein kinase (Arabidopsis thaliana) GI:2253010; contains Pfam profile: PF00069 Eukaryotic protein kinase domain29 At4g08470-‐>mitogen-‐activated protein kinase, putative, similar to mitogen-‐activated protein kinase (Arabidopsis thaliana) gi:1255448:dbj:BAA09057; contains Pfam PF00069: Protein kinase domain29 At3g12620-‐>protein phosphatase 2C family protein / PP2C family protein, similar to Ser/Thr protein phosphatase 2C (PP2C6) (GI:15020818) (Arabidopsis thaliana); similar to protein phosphatase 2C (GI:3608412) (Mesembryanthemum crystallinum); contains Pfam P29 At3g13670-‐>protein kinase family protein, contains Pfam domains, PF00069: Protein kinase domain29 At3g19420-‐>expressed protein29 At3g09970-‐>calcineurin-‐like phosphoesterase family protein, contains Pfam profile: PF00149 Calcineurin-‐like phosphoesterase29 At3g25800-‐>serine/threonine protein phosphatase 2A (PP2A) 65 KDa regulatory subunit A, identical to protein phosphatase 2A 65 kDa regulatory subunit (pDF1) GI:683502 from (Arabidopsis thaliana) or similar to serine/threonine protein phosphatase 2A (PP2A)29 At1g68830-‐>STN7;STN7 protein kinase; required for state transitions, phosphorylation of the major antenna complex (LHCII) between PSII and PSI, and light adaptation29 At1g59830-‐>serine/threonine protein phosphatase PP2A-‐2 catalytic subunit (PP2A2), identical to SP:Q07099 Serine/threonine protein phosphatase PP2A-‐2 catalytic subunit (EC 3.1.3.16) {Arabidopsis thaliana}; contains Pfam profile PF00149: Ser/Thr protein pho29 At2g47170-‐>ADP-‐RIBOSYLATION FACTOR;ADP-‐RIBOSYLATION FACTOR 1;Gene encoding ADP-‐ribosylation factor and similar to other ARFs and ARF-‐like proteins. Members of this family are known to be essential for vesicle coating and uncoating and functions in GTP-‐bin29 At1g09160-‐>protein phosphatase 2C-‐related / PP2C-‐related, similar to GB:AAC16260 or protein phosphatase 2C-‐related / PP2C-‐related, similar to GB:AAC1626029 At1g24510-‐>T-‐complex protein 1 epsilon subunit, putative / TCP-‐1-‐epsilon, putative / chaperonin, putative, identical to SWISS-‐PROT:O04450-‐ T-‐complex protein 1, epsilon subunit (TCP-‐1-‐epsilon) (Arabidopsis thaliana); strong similarity to SP:P54411 T-‐comple29 At2g32510-‐>protein kinase family protein, contains protein kinase domain, Pfam:PF0006929 At2g23070-‐>casein kinase II alpha chain, putative, similar to casein kinase II, alpha chain (CK II) (Zea mays) SWISS-‐PROT:P28523; contains protein kinase domain, Pfam:PF0006929 At2g23080-‐>casein kinase II alpha chain, putative, identical to probable casein kinase II, alpha chain (Arabidopsis thaliana) SWISS-‐PROT:O64817; similar to casein kinase II, alpha chain 1 (Arabidopsis thaliana) SWISS-‐PROT:Q08467 or casein kinase II alpha29 At2g35050-‐>protein kinase family protein, contains Pfam profile: PF00069 Eukaryotic protein kinase domain29 At2g30410-‐>KIESEL;tubulin folding cofactor A (KIESEL), identical to cDNA tubulin folding cofactor A, GI:20514256, SP:O04350 Tubulin-‐specific chaperone A (Tubulin-‐folding cofactor A) (CFA) (TCP1-‐chaperonin cofactor A homolog) {Arabidopsis thaliana}

29 At4g35600-‐>protein kinase family protein, contains protein kinase domain, Pfam:PF0006929 At1g20650-‐>protein kinase family protein, contains Pfam domain PF00069: Protein kinase domain29 At1g67700-‐>expressed protein or expressed protein29 At4g36800-‐>RUB1-‐conjugating enzyme, putative (RCE1), this gene is frameshifted and may be a pseudogene; identical over first 79 amino acids to RUB1 conjugating enzyme (Arabidopsis thaliana) GI:663545729 At5g49980-‐>transport inhibitor response protein, putative, E3 ubiquitin ligase SCF complex F-‐box subunit; similar to F-‐box containing protein TIR1 GI:13249030 from (Populus tremula x Populus tremuloides)29 At5g42390-‐>metalloendopeptidase, identical to chloroplast processing enzyme metalloendopeptidase (Arabidopsis thaliana) gi:2827039:gb:AAC3948229 At5g09640-‐>sinapoylglucose:choline sinapoyltransferase (SNG2), GC donor splice site at exon 11 and 13; TA donor splice site at exon 10; similar to serine carboxypeptidase I precursor (SP:P37890) (Oryza sativa); wound-‐inducible carboxypeptidase, Lycopersic29 At4g17830-‐>peptidase M20/M25/M40 family protein, similar to acetylornithine deacetylase (Acetylornithinase, AO; N-‐acetylornithinase, NAO) (Dictyostelium discoideum) SWISS-‐PROT:P5463829 At3g27110-‐>peptidase M48 family protein, contains Pfam domain, PF01435: Peptidase family M48 or peptidase M48 family protein, contains Pfam domain, PF01435: Peptidase family M4829 At3g05230-‐>signal peptidase subunit family protein, contains Pfam profile: PF04573 signal peptidase subunit or similar to signal peptidase subunit family protein [Arabidopsis thaliana] (TAIR:At5g27430.1); similar to signal peptidase protein-‐like [Cucumi29 At1g50380-‐>prolyl oligopeptidase family protein, similar to oligopeptidase B (Leishmania major) GI:4581757; contains Pfam profiles PF00326: prolyl oligopeptidase family, PF02897: Prolyl oligopeptidase, N-‐terminal beta-‐propeller domain29 At1g32940-‐>subtilase family protein, contains similarity to subtilase; SP1 GI:9957714 from (Oryza sativa)29 At4g16520-‐>autophagy 8f (APG8f), identical to autophagy 8f (Arabidopsis thaliana) GI:19912161; contains Pfam profile PF02991: Microtubule associated protein 1A/1B, light chain 3 or autophagy 8f (APG8f), identical to autophagy 8f (Arabidopsis thaliana) GI29 At5g61500-‐>autophagy 3 (APG3), identical to autophagy 3 (Arabidopsis thaliana) GI:19912141; contains Pfam profiles PF03986: Autophagocytosis associated protein N-‐terminal domain, PF03987: Autophagocytosis associated protein C-‐terminal domain29 At3g60640-‐>autophagy 8g (APG8g), identical to autophagy 8g (Arabidopsis thaliana) GI:19912163; contains Pfam profile PF02991: Microtubule associated protein 1A/1B, light chain 3; supporting cDNA gi:19912162:dbj:AB073181.1:29 At4g21980-‐>autophagy 8a (APG8a), identical to autophagy 8a (Arabidopsis thaliana) GI:19912151; contains Pfam profile PF02991: Microtubule associated protein 1A/1B, light chain 329 At3g15580-‐>ATG8I;autophagy 8i (APG8i), identical to autophagy 8i (Arabidopsis thaliana) GI:19912167; contains Pfam profile PF02991: Microtubule associated protein 1A/1B, light chain 3; supporting cDNA gi:21636957:gb:AF492760.1:29 At1g62040-‐>ATG8C;AUTOPHAGY 8C;autophagy 8c (APG8c), identical to autophagy 8c (Arabidopsis thaliana) GI:19912155; contains Pfam profile PF02991: Microtubule associated protein 1A/1B, light chain 329 At3g19400-‐>cysteine proteinase, putative, non-‐consensus AT acceptor site at exon 3; contains similarity to cysteine protease CYP1 GI:2828252, TDI-‐65 GI:5726641 from (Lycopersicon esculentum) or cysteine proteinase, putative, non-‐consensus AT acceptor sit29 At1g02305-‐>cathepsin B-‐like cysteine protease, putative, similar to cathepsin B-‐like cysteine proteinase (Nicotiana rustica) GI:609175; contains Pfam profile PF00112: Papain family cysteine protease29 At5g49840-‐>ATP-‐dependent Clp protease ATP-‐binding subunit ClpX, putative, similar to CLP protease regulatory subunit CLPX GI:2674203 from (Arabidopsis thaliana); non-‐consensus splice donor GC at exon 4; non-‐consensus splice donor AA at exon 729 At1g43780-‐>SCPL44;serine carboxypeptidase S10 family protein, similar to serine carboxylase II-‐3 GB:CAA55478 GI:474392 from (Hordeum vulgare)29 At2g35770-‐>SCPL28;serine carboxypeptidase S10 family protein, similar to Serine carboxypeptidase II precursor (Carboxypeptidase D) (CP-‐MII) (SP:P08818) (Hordeum vulgare)29 At5g42320-‐>zinc carboxypeptidase family protein, contains Pfam domain, PF00246: Zinc carboxypeptidase29 At1g05140-‐>membrane-‐associated zinc metalloprotease, putative, similar to Hypothetical zinc metalloprotease All3971 (SP:Q8YQ64) (strain PCC 7120) {Anabaena sp.}; Similar to Synechocystis hypothetical protein (gb:D90908);contains Pfam PF00595: PDZ domain (29 At3g19740-‐>similar to AAA-‐type ATPase family protein [Arabidopsis thaliana] (TAIR:At1g50140.1); similar to spastin-‐like [Oryza sativa (japonica cultivar-‐group)] (GB:BAD37292.1); contains InterPro domain AAA ATPase (InterPro:IPR003593); contains InterPro d29 At2g27600-‐>AAA-‐type ATPase family protein / vacuolar sorting protein-‐related, similar to SP:P46467 SKD1 protein (Vacuolar sorting protein 4b) {Mus musculus}; contains Pfam profiles PF00004: ATPase AAA family, PF04212: MIT domain29 At5g15400-‐>U-‐box domain-‐containing protein, contains Pfam profile PF04564: U-‐box domain29 At4g26840-‐>ubiquitin-‐like protein (SMT3), identical to Ubiquitin-‐like protein SMT3 SP:P55852 from(Arabidopsis thaliana); identical to cDNA SMT3 protein GI:170737129 At4g03370-‐>ubiquitin family protein, contains INTERPRO:IPR000626 ubiquitin domain29 At5g56150-‐>ubiquitin-‐conjugating enzyme, putative, strong similarity to ubiquitin-‐conjugating enzyme UBC2 (Mesembryanthemum crystallinum) GI:5762457, UBC4 (Pisum sativum) GI:456568; contains Pfam profile PF00179: Ubiquitin-‐conjugating enzyme or ubiquitin29 At3g57870-‐>ubiquitin-‐conjugating enzyme, putative, strong similarity to SP:P50550 Ubiquitin-‐like protein SUMO-‐1 conjugating enzyme (EC 6.3.2.19) (SUMO-‐ 1-‐protein ligase) (Ubiquitin carrier protein) (Ubiquitin-‐conjugating enzyme UbcE2A) {Xenopus laevis}; c29 At3g17000-‐>ubiquitin-‐conjugating enzyme, putative, similar to Non-‐Canonical UBiquitin Conjugating Enzyme 1 (NCUBE1) from (Gallus gallus) GI:7362937, (Mus musculus) GI:7363050, (Homo sapiens) GI:7362973; contains Pfam profile PF00179: Ubiquitin-‐conjugating29 At1g14400-‐>ATUBC1;UBIQUITIN CARRIER PROTEIN 1;ubiquitin-‐conjugating enzyme 1 (UBC1), E2; identical to gi:431259, SP:P25865 or ubiquitin-‐conjugating enzyme 1 (UBC1), E2; identical to gi:431259, SP:P2586529 At1g57820-‐>zinc finger (C3HC4-‐type RING finger) family protein, low similarity to nuclear protein np95 (Mus musculus) GI:4220590; contains Pfam profiles PF02182: YDG/SRA domain, PF00097: Zinc finger, C3HC4 type (RING finger), PF00628: PHD-‐finger or zinc29 At5g43200-‐>zinc finger (C3HC4-‐type RING finger) family protein, low similarity to RING-‐H2 finger protein RHY1a (Arabidopsis thaliana) GI:3790593; contains Pfam profile PF00097: Zinc finger, C3HC4 type (RING finger)29 At3g46620-‐>zinc finger (C3HC4-‐type RING finger) family protein, contains Pfam domain, PF00097: Zinc finger, C3HC4 type (RING finger)29 At3g45510-‐>zinc finger (C3HC4-‐type RING finger) family protein, contains a zinc finger, C3HC4 type (RING finger), signature, PROSITE:PS0051829 At4g34100-‐>zinc finger (C3HC4-‐type RING finger) family protein, contains Pfam profile: PF00097 zinc finger, C3HC4 type (RING finger)29 At1g63900-‐>zinc finger (C3HC4-‐type RING finger) family protein, contains Pfam profile: PF00097 zinc finger, C3HC4 type (RING finger)29 At1g19310-‐>zinc finger (C3HC4-‐type RING finger) family protein, contains Pfam profile: PF00097 zinc finger, C3HC4 type (RING finger)29 At1g79380-‐>copine-‐related, low similarity to SP:Q99829 Copine I {Homo sapiens}29 At1g54150-‐>zinc finger (C3HC4-‐type RING finger) family protein, contains Pfam profile: PF00097 zinc finger, C3HC4 type (RING finger)29 At1g60610-‐>expressed protein or expressed protein29 At2g30580-‐>zinc finger (C3HC4-‐type RING finger) family protein, contains Pfam profile: PF00097 zinc finger, C3HC4 type (RING finger)29 At1g75950-‐>ASK1;ATSKP1;SKP1A;UIP1;ARABIDOPSIS SKP1 HOMOLOGUE;UFO INTERACTING PROTEIN 1;E3 ubiquitin ligase SCF complex subunit SKP1/ASK1 (At1), E3 ubiquitin ligase; skp1a; identical to Skp1a GI:3068807, Skp1p GI:1432083 and UIP1 GI:3719209 from (Arabidops29 At5g52460-‐>F-‐box family protein, contains F-‐box domain Pfam:PF00646

29 At4g33900-‐>kelch repeat-‐containing F-‐box family protein, contains F-‐box domain Pfam:PF00646 and Kelch motif Pfam:PF0134429 At3g20690-‐>F-‐box protein-‐related, ontains weak hit to TIGRFAM TIGR01640 : F-‐box protein interaction domain; contains weak hit to Pfam PF00646: F-‐box domain29 At4g14800-‐>20S proteasome beta subunit D2 (PBD2) (PRCGA), identical to SP:O24633 Proteasome subunit beta type 2-‐2 (EC 3.4.25.1) (20S proteasome alpha subunit D2) {Arabidopsis thaliana}, cDNA proteasome subunit prcga GI:251157129 At3g60820-‐>20S proteasome beta subunit F1 (PBF1) or similar to 20S proteasome beta subunit C1 (PBC1) (PRCT) [Arabidopsis thaliana] (TAIR:At1g21720.1); similar to beta 6 subunit of 20S proteasome [Oryza sativa (japonica cultivar-‐group)] (GB:BAA28276.1); c29 At4g29040-‐>26S proteasome AAA-‐ATPase subunit (RPT2a), almost identical to 26S proteasome AAA-‐ATPase subunit RPT2a (GI:6652880) {Arabidopsis thaliana}; Drosophila melanogaster 26S proteasome subunit 4 ATPase, PID:g106606529 At3g22110-‐>20S PROTEASOME SUBUNIT PAC1;20S proteasome alpha subunit C (PAC1) (PRC9), identical to GB:AAC32057 from (Arabidopsis thaliana) (Genetics (1998) 149 (2), 677-‐692); identical to cDNA proteasome subunit prc9 GI:251158329 At3g14290-‐>20S PROTEASOME SUBUNIT PAE2;20S proteasome alpha subunit E2 (PAE2), identical to 20S proteasome subunit PAE2 GB:AAC32061 from (Arabidopsis thaliana)29 At1g45000-‐>26S proteasome regulatory complex subunit p42D, putative, similar to 26S proteasome regulatory complex subunit p42D (Drosophila melanogaster) gi:6434958:gb:AAF0839129 At1g53780,At1g53750 flag_XH2 -‐>26S proteasome AAA-‐ATPase subunit, putative, similar to 26S proteasome AAA-‐ATPase subunit RPT1 SP:Q41365 from (Spinacia oleracea)26S PROTEASOME ATPASE SUBUNIT;26S proteasome AAA-‐ATPase subunit (RPT1a), similar to 26S protea29 At1g21720-‐>20S PROTEASOME BETA SUBUNIT PBC1;20S proteasome beta subunit C1 (PBC1) (PRCT), almost identical to GB:AAC32069 from (Arabidopsis thaliana), EST gb:T76747 comes from this gene; identical to cDNA proteasome subunit prct GI:251156729 At1g67250-‐>proteasome maturation factor UMP1 family protein, contains Pfam profile PF05348: Proteasome maturation factor UMP129 At2g27020-‐>20S PROTEASOME SUBUNIT PAG1;20S proteasome alpha subunit G (PAG1) (PRC8), identical to proteasome subunit alpha type 3 SP:O23715, GI:12644056 from (Arabidopsis thaliana); identical to cDNA proteasome subunit prc8 GI:251159129 At2g39990-‐>TRANSLATION INITIATION FACTOR EIF2 P47 SUBUNIT HOMOLOG;eukaryotic translation initiation factor 3 subunit 5 / eIF-‐3 epsilon / eIF3f (TIF3F1), identical to SP:O04202 Eukaryotic translation initiation factor 3 subunit 5 (eIF-‐3 epsilon) (eIF3 p3229 At5g43260-‐>chaperone protein dnaJ-‐related, similar to Chaperone protein dnaJ (SP:Q9WZV3) (Thermotoga maritima)29 At1g73655-‐>immunophilin / FKBP-‐type peptidyl-‐prolyl cis-‐trans isomerase family protein, similar to (Peptidyl-‐prolyl cis-‐trans isomerase) (PPiase) (Rotamase) (SP:Q26486) (Spodoptera frugiperda); contains Pfam PF00254: peptidyl-‐prolyl cis-‐trans isomerase, F29 At2g44650-‐>CPN10;CHLOROPLAST CHAPERONIN 10;chloroplast chaperonin 10 (cpn10), identical to chloroplast chaperonin 10 GI:14041813 from (Arabidopsis thaliana)29 At5g17170-‐>rubredoxin family protein, contains Pfam profile PF00301: Rubredoxin

MapMan bins: ics1 versus WT LMD PMbin description30 At5g64260-‐>phosphate-‐responsive protein, putative, similar to phi-‐1 (phosphate-‐induced gene) (Nicotiana tabacum) GI:3759184; contains Pfam profile PF04674: Phosphate-‐induced protein 1 conserved region30 At4g08950-‐>phosphate-‐responsive protein, putative (EXO), similar to phi-‐1 (phosphate-‐induced gene) (Nicotiana tabacum) GI:3759184; contains Pfam profile PF04674: Phosphate-‐induced protein 1 conserved region30 At5g59670-‐>leucine-‐rich repeat protein kinase, putative, similar to light repressible receptor protein kinase (Arabidopsis thaliana) gi:1321686:emb:CAA66376; contains leucine rich repeat (LRR) domains, Pfam:PF00560; contains protein kinase domain, Pfam:PF30 At3g28040-‐>leucine-‐rich repeat transmembrane protein kinase, putative, contains Pfam profiles: PF00560 leucine rich repeat, PF00069 eukaryotic protein kinase domain30 At1g75640-‐>leucine-‐rich repeat family protein / protein kinase family protein, contains protein kinase domain, Pfam:PF00069; contains leucine-‐rich repeats, Pfam:PF0056030 At5g54380-‐>protein kinase family protein, contains protein kinase domain, Pfam:PF0006930 At3g45860-‐>receptor-‐like protein kinase, putative, similar to receptor-‐like protein kinase 4 (gi:13506745), 5 (gi:13506747), and 6 (gi:13506749) from Arabidopsis thaliana; contains Pfam protein kinase domain PF0006930 At4g23140,At4g23160 flag_XH2 -‐>receptor-‐like protein kinase 5 (RLK5), identical to receptor-‐like protein kinase 5 (Arabidopsis thaliana) GI:13506747; contains Pfam domain PF00069: Protein kinase domain; identical to cDNA receptor-‐like protein kinase 5 (RL30 At4g11890-‐>protein kinase family protein, contains protein kinase domain, Pfam:PF00069 or protein kinase family protein, contains protein kinase domain, Pfam:PF00069 or protein kinase family protein, contains protein kinase domain, Pfam:PF0006930 At1g21250-‐>PRO25;CELL WALL-‐ASSOCIATED KINASE;SERINE THREONINE KINASE;wall-‐associated kinase 1 (WAK1), identical to wall-‐associated kinase 1 (Arabidopsis thaliana) GI:3549626; expressed in leaves and stems & induced by pathogen infection (PMID:10380805)30 At3g46370-‐>leucine-‐rich repeat protein kinase, putative, similar to light repressible receptor protein kinase (Arabidopsis thalian) gi:1321686:emb:CAA66376; contains leucine rich repeat (LRR) domains, Pfam:PF00560; contains protein kinase domain, Pfam:PF030 At3g46330,At3g45920 flag_XH2 -‐>leucine-‐rich repeat protein kinase, putative, similar to light repressible receptor protein kinase (Arabidopsis thaliana) gi:1321686:emb:CAA66376; contains leucine rich repeat (LRR) domains, Pfam:PF00560; contains protein ki30 At5g26920-‐>similar to calmodulin-‐binding protein [Arabidopsis thaliana] (TAIR:At4g25800.1); similar to putative calmodulin-‐binding protein [Oryza sativa (japonica cultivar-‐group)] (GB:BAD27989.1)30 At5g61790-‐>calnexin 1 (CNX1), identical to calnexin homolog 1, Arabidopsis thaliana, EMBL:AT08315 (SP:P29402)30 At3g51920-‐>calmodulin-‐9 (CAM9), identical to calmodulin 9 GI:5825602 from (Arabidopsis thaliana); contains Pfam profile PF00036: EF hand30 At1g73800-‐>calmodulin-‐binding protein, similar to calmodulin-‐binding protein TCB60 GI:1698548 from (Nicotiana tabacum)30 At1g73805-‐>calmodulin-‐binding protein, similar to calmodulin-‐binding protein TCB60 GI:1698548 from (Nicotiana tabacum)30 At1g21550-‐>calcium-‐binding protein, putative, contains similarity to calcium-‐binding protein GB:CAB63264 GI:6580549 from (Lotus japonicus)30 At1g08450-‐>CALRETICULIN 3;calreticulin 3 (CRT3), identical to similar to SP:O04153 Calreticulin 3 precursor {Arabidopsis thaliana} or calreticulin 3 (CRT3), identical to similar to SP:O04153 Calreticulin 3 precursor {Arabidopsis thaliana}30 At1g35670-‐>CPK11;CALCIUM-‐DEPENDENT PROTEIN KINASE 2;calcium-‐dependent protein kinase 2 (CDPK2), identical to calcium-‐dependent protein kinase (Arabidopsis thaliana) gi:604881:dbj:BAA04830; contains protein kinase domain, Pfam:PF00069; contains EF hand dom30 At1g64850-‐>calcium-‐binding EF hand family protein, contains INTERPRO:IPR002048 calcium-‐binding EF-‐hand domain30 At1g09210-‐>calreticulin 2 (CRT2), identical to SP:Q38858 Calreticulin 2 precursor {Arabidopsis thaliana}30 At2g41090-‐>calmodulin-‐like calcium-‐binding protein, 22 kDa (CaBP-‐22), identical to SP:P30187 22 kDa calmodulin-‐like calcium-‐binding protein (CABP-‐22) (Arabidopsis thaliana)30 At1g21920-‐>MORN (Membrane Occupation and Recognition Nexus) repeat-‐containing protein /phosphatidylinositol-‐4-‐phosphate 5-‐kinase-‐related, similar to phosphatidylinositol-‐4-‐phosphate 5-‐kinase AtPIP5K1 (Arabidopsis thaliana) GI:3702691; contains Pfam profil30 At1g71010-‐>phosphatidylinositol-‐4-‐phosphate 5-‐kinase family protein, low similarity to phosphatidylinositol 3,5-‐kinase (Candida albicans) GI:14571648; contains Pfam profile PF01504: Phosphatidylinositol-‐4-‐phosphate 5-‐Kinase30 At5g25490-‐>zinc finger (Ran-‐binding) family protein, contains Pfam domain, PF00641: Zn-‐finger in Ran binding protein and others30 At5g55190-‐>Ras-‐related GTP-‐binding protein (RAN3), identical to atran3 (Arabidopsis thaliana) GI:205828030 At5g39620-‐>Ras-‐related GTP-‐binding protein, putative, similar to GTP-‐binding protein RAB7A GI:1370182 from (Lotus japonicus)30 At3g60860-‐>guanine nucleotide exchange family protein, similar to guanine nucleotide exchange factor, Homo sapiens, GI:5456754; contains Pfam profile PF01369: Sec7 domain30 At3g54840-‐>Rab GTPase (ARA6), identical to small GTPase Ara6 (Arabidopsis thaliana) GI:1316060330 At3g43300-‐>guanine nucleotide exchange family protein, similar to SP:Q9Y6D5 Brefeldin A-‐inhibited guanine nucleotide-‐exchange protein 2 {Homo sapiens}; contains Pfam profile PF01369: Sec7 domain30 At1g02130-‐>ARA5;ARABIDOPSIS RAS 5;Ras-‐related protein (ARA-‐5) / small GTP-‐binding protein, putative, identical to Ras-‐related protein ARA-‐5 SP:P28188 from (Arabidopsis thaliana)30 At2g44100-‐>Rab GDP dissociation inhibitor (GDI1), identical to GDP dissociation inhibitor (Arabidopsis thaliana) GI:165542430 At5g65430-‐>14-‐3-‐3 protein GF14 kappa (GRF8), identical to 14-‐3-‐3 protein GF14 kappa GI:5802794, SP:P48348 from (Arabidopsis thaliana) or 14-‐3-‐3 protein GF14 kappa (GRF8), identical to 14-‐3-‐3 protein GF14 kappa GI:5802794, SP:P48348 from (Arabidopsis thal30 At5g18960-‐>far-‐red impaired responsive protein, putative, similar to far-‐red impaired response protein FAR1 (Arabidopsis thaliana) gi:5764395:gb:AAD5128230 At3g46370-‐>leucine-‐rich repeat protein kinase, putative, similar to light repressible receptor protein kinase (Arabidopsis thalian) gi:1321686:emb:CAA66376; contains leucine rich repeat (LRR) domains, Pfam:PF00560; contains protein kinase domain, Pfam:PF030 At2g30520-‐>ROOT PHOTOTROPISM 2;RPT2;signal transducer of phototropic response (RPT2), identical to RPT2 (Arabidopsis thaliana) gi:6959488:gb:AAF33112 or similar to phototropic-‐responsive NPH3 family protein [Arabidopsis thaliana] (TAIR:At5g48800.1); simi30 At1g22920-‐>CSN5A;JAB1;CSN5;PUTATIVE JUN KINASE ACTIVATOR;COP9 signalosome subunit 5B / CSN subunit 5B (CSN5B) / c-‐JUN coactivator protein AJH1, putative (AJH1), COP9 complex subunit CSN5-‐1; identical to Arabidopsis homologs of a c-‐Jun coactivator AJH1 GI:

MapMan bins: ics1 versus WT LMD PMbin description35 At2g41530-‐>esterase, putative, similar to SP:P10768 Esterase D (EC 3.1.1.1) {Homo sapiens}; contains Pfam profile: PF00756 putative esterase35 At2g45330,At5g23600 flag_XH2 -‐>EMB1067;EMBRYO DEFECTIVE 1067;similar to tRNA 2'phosphotransferase, putative [Arabidopsis thaliana] (TAIR:At5g23600.1); similar to unnamed protein product [Tetraodon nigroviridis] (GB:CAF90715.1); contains InterPro domain Ph35 At4g15470-‐>expressed protein, low similarity to N-‐methyl-‐D-‐aspartate receptor-‐associated protein (Drosophila melanogaster) GI:567104; contains Pfam profile PF01027: Uncharacterized protein family UPF000535 At4g15800-‐>rapid alkalinization factor (RALF) family protein, similar to RALF precursor (Nicotiana tabacum) GI:1656631635 At4g14420-‐>lesion inducing protein-‐related, similar to ORF, able to induce HR-‐like lesions (Nicotiana tabacum) gi:1762945:gb:AAC4997535 At1g25210,At1g24880,At1g24793,At1g25054,At1g25141 flag_XH5 -‐>UDP-‐3-‐O-‐acyl N-‐acetylglycosamine deacetylase family protein, contains Pfam domain PF03331: UDP-‐3-‐O-‐acyl N-‐acetylglycosamine deacetylase35 At1g32130-‐>similar to IWS1 C-‐terminus family protein [Arabidopsis thaliana] (TAIR:At4g19000.1); similar to P0416D03.25 [Oryza sativa (japonica cultivar-‐group)] (GB:XP_462790.1); contains InterPro domain IWS1, C-‐terminal (InterPro:IPR008654)35 At5g08290-‐>yellow-‐leaf-‐specific protein 8 (YLS8) / mitosis protein DIM1, putative, contains Pfam domain PF02966: Mitosis protein DIM1; identical to cDNA YLS8 mRNA for Dim1 homolog GI:1312229335 At5g20300-‐>chloroplast outer membrane protein, putative, similar to chloroplast protein import component Toc159 (Pisum sativum) GI:8489806, chloroplast outer envelope protein 86 (Pisum sativum) GI:599958, GTP-‐binding protein (Pisum sativum) GI:576509 or35 At4g36860-‐>LIM domain-‐containing protein, low similarity to LIM-‐domain protein (Branchiostoma floridae) GI:3360516, DRAL/Slim3/FHL2 (Homo sapiens) GI:7209525; contains Pfam profile PF00412: LIM domain or LIM domain-‐containing protein, low similarity to L35 At3g56710-‐>sigA-‐binding protein, identical to SigA binding protein (Arabidopsis thaliana) gi:6980074:gb:AAF34713; contains Pfam PF05678: VQ motif35 At3g44880-‐>Rieske (2Fe-‐2S) domain-‐containing protein, similar to lethal leaf-‐spot 1 from Zea mays (gi:1935909); contains Pfam PF00355 Rieske (2Fe-‐2S) domain35 At5g66640-‐>LIM domain-‐containing protein-‐related, contains low similarity to Pfam profile PF00412: LIM domain35 At5g65870-‐>phytosulfokines 5 (PSK5), identical to phytosulfokines 5 (PSK5) from (Arabidopsis thaliana)35 At5g66100-‐>La domain-‐containing protein, similar to SP:P40796 La protein homolog (La ribonucleoprotein) (La autoantigen homolog) {Drosophila melanogaster}; contains Pfam profile PF05383: La domain35 At5g65720-‐>cysteine desulfurase, mitochondrial (NIFS), identical to Cysteine desulfurase, mitochondrial precursor (SP:O49543) {Arabidopsis thaliana}; identical to cDNA GI:12656131; contains Pfam profile PF00266: aminotransferase, class V35 At5g62740-‐>band 7 family protein, strong similarity to hypersensitive-‐induced response protein (Zea mays) GI:7716470; contains Pfam profile PF01145: SPFH domain / Band 7 family; supporting cDNA gi:17065547:gb:AY062850.1:35 At5g55070-‐>2-‐oxoacid dehydrogenase family protein, similar to SP:Q01205 Dihydrolipoamide succinyltransferase component of 2-‐oxoglutarate dehydrogenase complex, mitochondrial precursor (EC 2.3.1.61) {Rattus norvegicus}; contains Pfam profiles PF00198: 2-‐ox35 At5g52740-‐>heavy-‐metal-‐associated domain-‐containing protein, contains Pfam profile PF00403: Heavy-‐metal-‐associated domain35 At5g50230-‐>similar to transducin family protein / WD-‐40 repeat family protein [Arabidopsis thaliana] (TAIR:At3g49660.1); similar to TipD [Dictyostelium discoideum] (GB:AAB70659.1); contains InterPro domain G-‐protein beta WD-‐40 repeat (InterPro:IPR001680)35 At5g45500-‐>expressed protein, weak similarity to resistance complex protein I2C-‐2 (Lycopersicon esculentum) GI:225831735 At5g45550-‐>mob1/phocein family protein, contains Pfam profile: PF03637 Mob1/phocein family35 At5g40300-‐>integral membrane protein, putative, MtN24 gene, Medicago truncatula, EMBL:MTY15290; contains Pfam PF04535 : Domain of unknown function (DUF588); contains 4 transmembrane domains; similar to putative ethylene responsive element binding protein35 At5g22620-‐>phosphoglycerate/bisphosphoglycerate mutase family protein, weak similarity to SP:P15259 Phosphoglycerate mutase, muscle form (EC 5.4.2.1 {Homo sapiens}; contains Pfam profile PF00300: phosphoglycerate mutase family35 At5g11560-‐>PQQ enzyme repeat-‐containing protein, contains Pfam profile PF01011: PQQ enzyme repeat35 At5g01650-‐>macrophage migration inhibitory factor family protein / MIF family protein, contains pfam profile: PF001187 Macrophage migration inhibitory factor35 At3g50830-‐>stress-‐responsive protein, putative, similar to cold acclimation WCOR413-‐like protein gamma form (Hordeum vulgare) gi:18449100:gb:AAL69988; similar to stress-‐regulated protein SAP1 (Xerophyta viscosa) gi:21360378:gb:AAM47505; identical to cDNA35 At3g50590-‐>transducin family protein / WD-‐40 repeat family protein, contains 3 WD-‐40 repeats (PF00400); some similarity to s-‐tomosyn isoform (GI:4689231)(Rattus norvegicus); contains non-‐consensus AT-‐AC splice sites at intron 1835 At3g44100-‐>MD-‐2-‐related lipid recognition domain-‐containing protein / ML domain-‐containing protein, contains Pfam profile PF02221: ML domain35 At3g43740-‐>leucine-‐rich repeat family protein, contains leucine rich-‐repeat (LRR) domains Pfam:PF00560, INTERPRO:IPR001611; contains similarity to somatic embryogenesis receptor-‐like kinase 2 (Arabidopsis thaliana) gi:14573457:gb:AAK68073 or leucine-‐rich35 At3g42580-‐>Ulp1 protease family protein, contains Pfam profile PF02902: Ulp1 protease family, C-‐terminal catalytic domain35 At4g37470-‐>hydrolase, alpha/beta fold family protein, low similarity to SP:Q59093 3-‐oxoadipate enol-‐lactonase I (EC 3.1.1.24) (Enol-‐lactone hydrolase I) (Beta-‐ketoadipate enol-‐lactone hydrolase I) {Acinetobacter calcoaceticus}; contains Pfam profile PF00535 At4g34700-‐>complex 1 family protein / LVR family protein, contains Pfam PF05347: Complex 1 protein (LYR family)35 At4g21830,At4g21840 flag_XH2 -‐>methionine sulfoxide reductase domain-‐containing protein / SeIR domain-‐containing protein, low similarity to pilin-‐like transcription factor (Homo sapiens) GI:5059062, SP:P14930 Peptide methionine sulfoxide reductase msrA/ms35 At4g21850-‐>methionine sulfoxide reductase domain-‐containing protein / SeIR domain-‐containing protein, low similarity to pilin-‐like transcription factor (Homo sapiens) GI:5059062, SP:P14930 Peptide methionine sulfoxide reductase msrA/msrB (EC 1.8.4.6) {Nei35 At4g21860-‐>methionine sulfoxide reductase domain-‐containing protein / SeIR domain-‐containing protein, low similarity to pilin-‐like transcription factor (Homo sapiens) GI:5059062, SP:P14930 Peptide methionine sulfoxide reductase msrA/msrB (EC 1.8.4.6) {Nei35 At4g21150-‐>ribophorin II (RPN2) family protein, contains Pfam domain PF05817: Ribophorin II (RPN2)35 At4g20260-‐>DREPP plasma membrane polypeptide family protein, contains Pfam profile: PF05558 DREPP plasma membrane polypeptide or DREPP plasma membrane polypeptide family protein, contains Pfam profile: PF05558 DREPP plasma membrane polypeptide or simila35 At4g11740-‐>ara4-‐interacting protein, putative (SAY1), similar to Ara4-‐interacting protein (Arabidopsis thaliana) GI:13160609; contains Pfam profiles PF00789: UBX domain, PF02809: Ubiquitin interaction motif35 At4g10500-‐>oxidoreductase, 2OG-‐Fe(II) oxygenase family protein, similar to hyoscyamine 6 beta-‐hydroxylase (Atropa belladona)(GI:4996123); contains PF03171 2OG-‐Fe(II) oxygenase superfamily domain35 At4g10100-‐>molybdenum cofactor synthesis family protein, similar to Molybdenum cofactor synthesis protein 2 small subunit (Molybdopterin-‐ synthase small subunit) (MOCS2A) (MOCO1-‐A) (Swiss-‐Prot:O96033) (Homo sapiens); contains TIGRFAM TIGR01682: molybdopte35 At4g02540-‐>DC1 domain-‐containing protein, contains Pfam profile PF03107: DC1 domain35 At5g01630,At4g00020 flag_XH2 -‐>BRCA2 repeat-‐containing protein, low similarity to breast cancer susceptibility protein (Gallus gallus) GI:19568157; contains Pfam profile PF00634: BRCA2 repeatBRCA2 repeat-‐containing protein, low similarity to SP:P51587 Bre35 At2g33470-‐>glycolipid transfer protein-‐related, similar to phosphoinositol 4-‐phosphate adaptor protein-‐2 (GI:14165198) (Homo sapiens); similar to Glycolipid transfer protein (GLTP) (Swiss-‐Prot:Q9JL62) (Mus musculus); similar to Glycolipid transfer protein35 At1g16880-‐>uridylyltransferase-‐related, similar to (Protein-‐PII) uridylyltransferase (PII uridylyl-‐ transferase) (Uridylyl removing enzyme) (UTase)(SP:Q9AC53) (Caulobacter crescentus) or uridylyltransferase-‐related, similar to (Protein-‐PII) uridylyltrans

35 At1g69526-‐>UbiE/COQ5 methyltransferase family protein, low similarity to SP:Q05197 Phosphatidylethanolamine N-‐methyltransferase (EC 2.1.1.17) (Rhodopseudomonas sphaeroides) {Rhodobacter sphaeroides}; contains Pfam profile PF01209: methlytransferase, UbiE/35 At1g66680-‐>AR401;S locus-‐linked protein, putative, similar to S locus-‐linked protein SLL2 (Brassica napus) GI:151811335 At3g10970-‐>haloacid dehalogenase-‐like hydrolase family protein, low similarity to genetic modifier (Zea mays) GI:10444400; contains InterPro accession IPR005834: Haloacid dehalogenase-‐like hydrolase or haloacid dehalogenase-‐like hydrolase family protein,35 At1g75220-‐>integral membrane protein, putative, strong similarity to integral membrane protein GI:1209756 from (Beta vulgaris); contains Pfam profile PF00083: major facilitator superfamily protein35 At3g27890-‐>NADPH-‐dependent FMN reductase family protein, contains Pfam profile: PF03358 NADPH-‐dependent FMN reductase35 At3g18480-‐>CCAAT displacement protein-‐related / CDP-‐related, similar to CCAAT displacement protein (CDP) (Cut-‐like 1) (Swiss-‐Prot:P39880) (Homo sapiens); contains Pfam:PF00904 Involucrin repeat35 At3g22845-‐>emp24/gp25L/p24 protein-‐related, contains weak similarity to transmembrane protein (GI:1212965) (Homo sapiens)35 At3g06530-‐>BAP28-‐related, similar to Protein BAP28 (Swiss-‐Prot:Q9H583) (Homo sapiens)35 At3g03990-‐>esterase/lipase/thioesterase family protein, low similarity to 3-‐oxoadipate enol-‐lactone hydrolase (Pseudomonas sp. B13) GI:17736948, esterase V (Pseudomonas sp.) GI:402521; contains Interpro entry IPR00037935 At3g06390-‐>integral membrane family protein, similar to hypothetical protein GB:CAB10339 (Arabidopsis thaliana); contains TIGRFAM TIGR01569 : plant integral membrane protein TIGR01569; contains Pfam PF04535 : Domain of unknown function (DUF588)35 At3g05000-‐>transport protein particle (TRAPP) component Bet3 family protein, similar to Transport protein particle 33 kDa subunit (TRAPP 33 kDa subunit) (Swiss-‐Prot:Q99394) (Saccharomyces cerevisiae); contains Pfam profile PF04051: Transport protein parti35 At3g05510-‐>phospholipid/glycerol acyltransferase family protein, similar to SP:Q16635 Tafazzin from Homo sapiens; contains Pfam profile: PF01553 Acyltransferase or phospholipid/glycerol acyltransferase family protein, similar to SP:Q16635 Tafazzin from H35 At3g09090-‐>DEFECTIVE IN EXINE FORMATION 1;defective in exine formation protein (DEX1), identical to defective in exine formation (Arabidopsis thaliana) gi:11138669:gb:AAG31444; contains Pfam domain PF01839: FG-‐GAP repeat35 At1g36380-‐>expressed protein, similar to vanilloid receptor-‐like protein GB:AAD26363 from (Homo sapiens)35 At1g53280-‐>DJ-‐1 family protein, similar to DJ-‐1 protein (Homo sapiens) GI:1780755; similar to DJ-‐1 beta (GI:18642508) (Drosophila melanogaster); contains Pfam profile: PF01965 ThiJ/PfpI family; TIGRFAM TIGR01383: DJ-‐1 family protein35 At1g48140-‐>dolichol-‐phosphate mannosyltransferase-‐related, contains weak similarity to Swiss-‐Prot:Q9P2X0 dolichol-‐phosphate mannosyltransferase subunit 3 (Dolichol-‐phosphate mannose synthase subunit 3, Dolichyl-‐phosphate beta-‐D-‐ mannosyltransferase subuni35 At1g18720-‐>expressed protein, similar to YGL010w-‐like protein GI:2982301 from (Picea mariana)35 At5g44890,At3g26530,At2g29240,At1g35650,At1g21030,At1g08740-‐>flag_XH6Ulp1 protease family protein, contains Pfam profile PF02902: Ulp1 protease family, C-‐terminal catalytic domain; similar to At1g21030, At2g29240, At1g08740, At1g0876035 At1g64750-‐>DSS1/SEM1 family protein, contains Pfam profile PF05160: DSS1/SEM1 family or DSS1/SEM1 family protein, contains Pfam profile PF05160: DSS1/SEM1 family35 At1g54320-‐>LEM3 (ligand-‐effect modulator 3) family protein / CDC50 family protein, Similar to GI:11994416; GI:4966357; GI:4835763; GI:9757735 from (Arabidopsis thaliana)35 At1g78620-‐>integral membrane family protein, contains Pfam domain PF01940: Integral membrane protein or integral membrane family protein, contains Pfam domain PF01940: Integral membrane protein35 At1g05720-‐>selenoprotein family protein, contains Prosite PS00190: Cytochrome c family heme-‐binding site signature; similar to 15 kDa selenoprotein (GI:12314088) {Homo sapiens}35 At2g17120-‐>peptidoglycan-‐binding LysM domain-‐containing protein, contains Pfam profile PF01476: LysM domain; supporting cDNA gi:16226688:gb:AF428464.1:AF42846435 At2g24550-‐>expressed protein, weak similarity to MTD1 (Medicago truncatula) GI:929481035 At2g22425-‐>expressed protein, weak similarity to Swiss-‐Prot:Q9Y6A9 microsomal signal peptidase 12 kDa subunit (SPase 12 kDa subunit, SPC12, HSPC033) (Homo sapiens)35 At2g21160-‐>translocon-‐associated protein alpha (TRAP alpha) family protein, contains Pfam profile: PF03896 translocon-‐associated protein (TRAP), alpha subunit35 At1g02140-‐>mago nashi family protein, similar to Mago Nashi, Genbank Accession Number U03559; contains Pfam PF02792: Mago nashi protein domain35 At1g54780-‐>thylakoid lumen 18.3 kDa protein, SP:Q9ZVL635 At1g03210-‐>phenazine biosynthesis PhzC/PhzF family protein, contains Pfam profile: PF02567 phenazine biosynthesis-‐like protein35 At1g61780-‐>postsynaptic protein-‐related, similar to postsynaptic protein CRIPT GI:3098551 from (Rattus norvegicus)35 At2g17740-‐>DC1 domain-‐containing protein35 At1g24090-‐>RNase H domain-‐containing protein, very low similarity to GAG-‐POL precursor (Oryza sativa (japonica cultivar-‐group)) GI:5902445; contains Pfam profiles PF00075: RNase H, PF04134: Protein of unknown function, DUF39335 At1g03830-‐>guanylate-‐binding family protein, contains Pfam domains PF02263: Guanylate-‐binding protein, N-‐terminal domain and PF02841: Guanylate-‐binding protein, C-‐terminal domain35 At2g32070-‐>CCR4-‐NOT transcription complex protein, putative, similar to SWISS-‐PROT:Q60809 CCR4-‐NOT transcription complex, subunit 7 (CCR4-‐associated factor 1, (CAF1) (Mus musculus)35 At2g03510-‐>band 7 family protein, contains Pfam profile PF01145: SPFH domain / Band 7 family35 At2g35730-‐>heavy-‐metal-‐associated domain-‐containing protein, contains PS1047 Heavy-‐metal-‐associated domain contains Pfam profile PF00403: Heavy-‐metal-‐associated domain35 At2g18500-‐>ATOFP7;ovate family protein, 69% similar to ovate protein (GI:23429649) (Lycopersicon esculentum); contains TIGRFAM TIGR01568 : uncharacterized plant-‐specific domain TIGR0156835 At2g38710-‐>AMMECR1 family, similar to AMMECR1 (GI:6063688) (Homo sapiens); contains Pfam profile PF01871: AMMECR1 or similar to DUF51 family protein [Dictyostelium discoideum] (GB:EAL65703.1); contains InterPro domain Protein of unknown function DUF51 (I35 At2g44440-‐>emsy N terminus domain-‐containing protein / ENT domain-‐containing protein, contains Pfam profile PF03735: ENT domain35 At2g35020-‐>UTP-‐-‐glucose-‐1-‐phosphate uridylyltransferase family protein, similar to SP:Q16222 UDP-‐N-‐acetylhexosamine pyrophosphorylase (Antigen X) {Homo sapiens}; contains Pfam profile PF01704: UTP-‐-‐glucose-‐1-‐phosphate uridylyltransferase35 At4g36030-‐>armadillo/beta-‐catenin repeat family protein, contains Pfam profile: PF00514 armadillo/beta-‐catenin-‐like repeat35 At5g39350-‐>pentatricopeptide (PPR) repeat-‐containing protein, contains Pfam profile PF01535: PPR repeat35 At1g62720-‐>pentatricopeptide (PPR) repeat-‐containing protein, contains multiple PPR repeats Pfam Profile: PF0153535 At2g28050-‐>pentatricopeptide (PPR) repeat-‐containing protein, contains Pfam profile PF01535: PPR repeat35 At2g30600-‐>BTB/POZ domain-‐containing protein, contains Pfam PF00651: BTB/POZ domain; contains Interpro IPR000210/ PS50097: BTBB/POZ domain; similar to MigA (GI:1841872) (Dictyostelium discoideum) or BTB/POZ domain-‐containing protein, contains Pfam PF006535 At2g30600-‐>BTB/POZ domain-‐containing protein, contains Pfam PF00651: BTB/POZ domain; contains Interpro IPR000210/ PS50097: BTBB/POZ domain; similar to MigA (GI:1841872) (Dictyostelium discoideum) or BTB/POZ domain-‐containing protein, contains Pfam PF006535 At1g01920-‐>SET domain-‐containing protein, low similarity to SP:Q43088 Ribulose-‐1,5 bisphosphate carboxylase/oxygenase large subunit N-‐ methyltransferase, chloroplast precursor (EC 2.1.1.127) {Pisum sativum}; contains Pfam profile PF00856: SET domain or s

35 At4g00700-‐>C2 domain-‐containing protein, contains INTERPRO:IPR000008 C2 domain35 At1g23140-‐>C2 domain-‐containing protein, similar to zinc finger and C2 domain protein GI:9957238 from (Arabidopsis thaliana)35 At2g43160-‐>epsin N-‐terminal homology (ENTH) domain-‐containing protein, contains Pfam PF01417: ENTH domain. ENTH (Epsin N-‐terminal homology) domain; similar to Af10-‐protein (GI:1724114) (Avena fatua) or epsin N-‐terminal homology (ENTH) domain-‐containing p35 At2g43090-‐>aconitase C-‐terminal domain-‐containing protein, contains Pfam profile PF00694: Aconitase C-‐terminal domain35 At5g07550-‐>glycine-‐rich protein (GRP19), oleosin; glycine-‐rich protein 19 (GRP19) PMID:1143156635 At3g25690-‐>hydroxyproline-‐rich glycoprotein family protein, Common family members: At4g18570, At4g04980, At5g61090 (Arabidopsis thaliana); identical to cDNA CHUP1 for actin binding protein GI:2807126435 At1g79730-‐>EARLY FLOWERING 7;hydroxyproline-‐rich glycoprotein family protein, contains proline-‐rich extensin domains, INTERPRO:IPR00296535 At5g07020-‐>proline-‐rich family protein35 At3g49840-‐>proline-‐rich family protein, contains proline rich extensin domains, INTERPRO:IPR00296535 At1g02110-‐>proline-‐rich family protein, contains proline-‐rich domain, INTERPRO:IPR00069435 At2g41420-‐>proline-‐rich family protein, contains proline rich extensin domains, INTERPRO:IPR00296535 At2g45380-‐>similar to expressed protein [Arabidopsis thaliana] (TAIR:At4g34070.1); similar to putative glycine-‐rich protein [Oryza sativa (japonica cultivar-‐group)] (GB:XP_479799.1) or similar to glycine-‐rich protein [Arabidopsis thaliana] (TAIR:At4g227435 At4g25550-‐>expressed protein35 At4g17420-‐>expressed protein, contains Pfam domain, PF01987: Protein of unknown function35 At4g17585-‐>hypothetical protein35 At4g17130-‐>expressed protein35 At1g56700-‐>pyrrolidone-‐carboxylate peptidase family protein, similar to Pyrrolidone-‐carboxylate peptidase (5-‐oxoprolyl-‐ peptidase) (Pyroglutamyl-‐peptidase I) (PGP-‐I) (Pyrase). (Swiss-‐Prot:O73944) (Pyrococcus furiosus); similar to Pyrrolidone-‐carboxylate p35 At1g32220-‐>expressed protein35 At5g09310-‐>expressed protein35 At5g20900-‐>expressed protein35 At3g51890-‐>expressed protein, protein At2g40060 -‐ Arabidopsis thaliana, EMBL:AF00210935 At5g15600-‐>expressed protein35 At5g15510-‐>expressed protein35 At5g35080-‐>expressed protein35 At5g28140-‐>hypothetical protein35 At5g27340-‐>hypothetical protein35 At5g27170-‐>expressed protein35 At5g66000-‐>expressed protein35 At5g63320-‐>similar to DNA-‐binding bromodomain-‐containing protein [Arabidopsis thaliana] (TAIR:At3g27260.1); similar to kinase-‐like protein [Oryza sativa] (GB:BAB41205.1)35 At5g61670-‐>expressed protein or expressed protein35 At5g58630-‐>expressed protein35 At5g58250-‐>expressed protein35 At5g52540-‐>expressed protein, contains PF05684: Protein of unknown function (DUF819)35 At5g49540-‐>expressed protein, contains Pfam profile PF05646: Protein of unknown function (DUF786)35 At5g48590-‐>expressed protein35 At5g47870-‐>expressed protein35 At5g45410-‐>expressed protein, similar to unknown protein (pir::T05524) or expressed protein, similar to expressed protein [Arabidopsis thaliana] (TAIR:At4g25030.1); similar to expressed protein [Arabidopsis thaliana] (TAIR:At4g25030.2); similar to unknow35 At5g44580-‐>expressed protein35 At5g44060-‐>expressed protein, similar to unknown protein (gb:AAD10670.1)35 At5g42520-‐>expressed protein35 At5g42030-‐>expressed protein, similar to unknown protein (emb:CAB66408.1)35 At5g38660-‐>expressed protein, similar to unknown protein (pir::S75762)35 At5g37050-‐>expressed protein, hypothetical protein T28J14.60 -‐ Arabidopsis thaliana, PIR:T4848335 At5g36770,At5g36680 flag_XH2 -‐>expressed protein, hypothetical proteins -‐ Arabidopsis thalianahypothetical protein, similar to unknown protein (emb CAB87684.1) contains Pfam profile PF03080: Arabidopsis proteins of unknown function35 At5g24660-‐>expressed protein35 At5g17280-‐>expressed protein, similar to unknown protein (pir::T41692)35 At5g15320-‐>expressed protein, predicted protein, Arabidopsis thaliana

35 At5g13030-‐>expressed protein, contains Pfam profile PF02696: Uncharacterized ACR, YdiU/UPF0061 family35 At5g13190-‐>expressed protein35 At5g11950-‐>expressed protein, contains Pfam profile PF03641: decarboxylase family protein or expressed protein, contains Pfam profile PF03641: decarboxylase family protein35 At5g08240-‐>expressed protein35 At5g06270-‐>expressed protein35 At5g05190-‐>expressed protein, similar to unknown protein (emb:CAB88044.1)35 At5g03920-‐>expressed protein35 At5g01750-‐>expressed protein, contains Pfam profile PF04525: Protein of unknown function (DUF567) or expressed protein, contains Pfam profile PF04525: Protein of unknown function (DUF567)35 At3g62320-‐>expressed protein35 At3g61780-‐>expressed protein, ; expression supported by MPSS35 At3g57090-‐>expressed protein35 At3g51130-‐>expressed protein, contains Pfam PF03676: Uncharacterised protein family (UPF0183)35 At3g50295-‐>pseudogene, hypothetical protein35 At3g49990-‐>expressed protein35 At3g46220-‐>expressed protein35 At3g43520-‐>expressed protein, contains Pfam profile PF03647: Uncharacterised protein family (UPF0136)35 At4g39670-‐>expressed protein35 At4g38260-‐>expressed protein, contains Pfam PF05742: Protein of unknown function (DUF833)35 At4g31280-‐>expressed protein35 At4g29790-‐>expressed protein35 At4g30010-‐>expressed protein35 At4g29520-‐>expressed protein35 At4g29770-‐>expressed protein35 At4g29735-‐>expressed protein, contains Pfam domain PF05251: Uncharacterised protein family (UPF0197)35 At4g28770-‐>expressed protein35 At4g28460-‐>expressed protein35 At4g27657-‐>expressed protein35 At4g22190-‐>expressed protein35 At4g21105-‐>expressed protein35 At4g20150-‐>expressed protein35 At4g20220-‐>expressed protein35 At4g12220-‐>expressed protein35 At4g05590-‐>expressed protein, contains Pfam domain, PF03650: Uncharacterized protein family (UPF0041) or similar to expressed protein [Arabidopsis thaliana] (TAIR:At4g22310.1); similar to light induced protein like protein [Oryza sativa (japonica cultiva35 At4g00585-‐>expressed protein35 At4g00310-‐>expressed protein or expressed protein35 At4g10300-‐>expressed protein35 At5g28550-‐>hypothetical protein35 At1g22140-‐>expressed protein or expressed protein35 At1g13670-‐>expressed protein35 At1g13610-‐>similar to expressed protein [Arabidopsis thaliana] (TAIR:At3g30380.1); similar to putative Cgi67 serine protease [Oryza sativa (japonica cultivar-‐group)] (GB:XP_464411.1); contains InterPro domain Esterase/lipase/thioesterase (InterPro:IPR000335 At1g72020-‐>expressed protein35 At1g75160-‐>expressed protein, contains Pfam profile PF04788: Protein of unknown function (DUF620)35 At3g32930-‐>expressed protein35 At3g22240-‐>expressed protein35 At3g52230-‐>expressed protein35 At3g22231-‐>PATHOGEN AND CIRCADIAN CONTROLLED 1;expressed protein35 At3g28630-‐>expressed protein, contains Pfam profile: PF04601 protein of unknown function (DUF569 or expressed protein, contains Pfam profile: PF04601 protein of unknown function (DUF569

35 At3g19190-‐>expressed protein35 At3g30820-‐>hypothetical protein35 At3g27310-‐>expressed protein35 At3g13175-‐>expressed protein35 At2g15110-‐>pseudogene, hypothetical protein, contains Pfam profile: PF04642 protein of unknown function, DUF60135 At1g62840-‐>expressed protein35 At3g26050-‐>expressed protein35 At3g29265-‐>hypothetical protein35 At3g13230-‐>expressed protein35 At3g13060-‐>ECT5;expressed protein, contains Pfam profile PF04146: YT521-‐B-‐like family or expressed protein, contains Pfam profile PF04146: YT521-‐B-‐like family35 At3g19800-‐>expressed protein35 At3g23590-‐>expressed protein35 At3g24560-‐>RASPBERRY 3;expressed protein, contains Pfam profile PF01171: PP-‐loop family or expressed protein, contains Pfam profile PF01171: PP-‐loop family or expressed protein, contains Pfam profile PF01171: PP-‐loop family35 At3g15840-‐>expressed protein or expressed protein or expressed protein35 At3g15810-‐>expressed protein, contains Pfam profile PF04525: Protein of unknown function (DUF567)35 At3g30510-‐>hypothetical protein35 At3g16040-‐>expressed protein35 At3g16750-‐>expressed protein, ; expression supported by MPSS35 At3g10770-‐>expressed protein or expressed protein35 At3g09980-‐>expressed protein, contains Pfam profile PF04949: Family of unknown function (DUF662)35 At3g03890-‐>expressed protein or expressed protein35 At1g27930-‐>expressed protein, contains Pfam profile PF04669: Protein of unknown function (DUF579)35 At1g55240-‐>expressed protein, contains Pfam profile PF04819: Family of unknown function (DUF716) (Plant viral-‐response family)35 At1g55220-‐>expressed protein35 At1g77710-‐>expressed protein, similar to hypothetical protein GB:P34661 (Caenorhabditis elegans)35 At1g74640-‐>expressed protein, contains Pfam profile: PF00561 alpha/beta hydrolase fold35 At1g72450-‐>expressed protein35 At1g72380-‐>expressed protein35 At1g10880-‐>expressed protein, contains Pfam profile PF03267: Arabidopsis protein of unknown function, DUF26635 At1g21370-‐>expressed protein or expressed protein35 At1g17490-‐>expressed protein35 At1g07280-‐>expressed protein or expressed protein, similar to expressed protein [Arabidopsis thaliana] (TAIR:At2g29670.1); similar to unknown protein [Oryza sativa (japonica cultivar-‐group)] (GB:AAU10760.1); contains domain SER_RICH (PS50324)35 At1g50080-‐>hypothetical protein35 At1g76200-‐>expressed protein35 At1g16000-‐>expressed protein35 At1g59650-‐>CW14;expressed protein, ; supporting cDNA gi:6520232:dbj:AB028233.1:35 At1g52460,At1g52440 flag_XH2 -‐>similar to phospholipase/carboxylesterase family protein [Arabidopsis thaliana] (TAIR:At1g52700.1); similar to putative lysophospholipase 2 [Oryza sativa (japonica cultivar-‐group)] (GB:XP_550302.1); similar to putative lysop35 At1g78030-‐>expressed protein35 At1g70900-‐>expressed protein35 At1g47640-‐>expressed protein, similar to seven transmembrane domain protein GI:3550427 from (Homo sapiens)35 At1g47420-‐>expressed protein, identical to hypothetical protein GB:AAD46040 GI:5668814 from (Arabidopsis thaliana)35 At1g13990-‐>expressed protein35 At1g65230-‐>expressed protein35 At1g32830,At2g14140 flag_XH2 -‐>hypothetical protein, similar to At2g04970, At2g15200, At2g14140, At3g30450, At4g03990, At5g34895, At3g47270, At2g02200hypothetical protein, similar to At2g04970, At2g15200, At1g32830, At3g30450, At4g03990, At5g34895, At3g4735 At2g31740-‐>expressed protein35 At2g16270-‐>expressed protein, and genefinder; expression supported by MPSS35 At1g60010-‐>expressed protein

35 At2g46390-‐>expressed protein35 At2g36835-‐>expressed protein35 At2g04360-‐>expressed protein35 At2g03680-‐>SKU6;SPIRAL1;expressed protein, Alternative splicing exists based on EST evidence35 At2g31190-‐>expressed protein, contains Pfam domain, PF04884: Protein of unknown function, DUF64735 At1g79160-‐>expressed protein35 At1g65270-‐>expressed protein or expressed protein or expressed protein35 At1g22750-‐>expressed protein or expressed protein or expressed protein, similar to unknown protein [Oryza sativa (japonica cultivar-‐group)] (GB:BAD68607.1)35 At2g25190-‐>expressed protein35 At1g27385-‐>expressed protein35 At1g27330,At1g27350 flag_XH2 -‐>expressed protein, similar to EST gb:AA650671 and gb:T20610expressed protein, contains 1 transmembrane domain; similar to ribosome associated membrane protein RAMP4 GI:4585827 (Rattus norvegicus); similar to ESTs gb:T20610 a35 At1g65490-‐>expressed protein35 At1g70160-‐>expressed protein, similar to hypothetical protein GI:4455225 from (Arabidopsis thaliana)35 At1g76960-‐>expressed protein35 At2g07713,AtMg00540 flag_XH2 -‐>expressed proteinhypothetical protein35 At2g18440-‐>GENE WITH UNSTABLE TRANSCRIPT 15;GUT15;expressed protein35 At2g20760-‐>expressed protein35 At2g20930-‐>expressed protein35 At2g20670-‐>expressed protein, contains Pfam profile PF04720: Protein of unknown function (DUF506)35 At2g46505-‐>expressed protein35 At2g46540-‐>expressed protein35 At2g15500-‐>hypothetical protein35 At2g25510-‐>expressed protein35 At2g32160-‐>expressed protein or expressed protein35 At2g17990-‐>expressed protein35 At2g42310-‐>expressed protein35 At2g40765-‐>expressed protein35 At2g27730-‐>expressed protein, contains 1 transmembrane domain; similar to Unknown mitochondrial protein At2g27730 (Swiss-‐Prot:Q9ZUX4) (Arabidopsis thaliana) similar to F1F0-‐ATPase inhibitor protein (GI:5821432) (Oryza sativa)35 At2g29620-‐>expressed protein35 At2g46900-‐>expressed protein, contains Pfam profile PF04910: Protein of unknown function, DUF65435 At2g44870-‐>expressed protein35 At2g38500-‐>expressed protein35 At2g40060-‐>expressed protein35 At2g44525-‐>expressed protein

SI Table S2E. Infection site specific changes in expression for redox and calcium categories from SI Table S2D..

I = Infected, UI= Uninfected, WT= wild type. Numbers in black are below

stringent selection criteria (2-fold change, p<= 0.05).

SI Table 2F. TAIR Statistical cis-acting regulatory element motif analysis: LMD I/UI ratio 5 dpi up-regulated genes

Motif aPLANT CARE (Arabidopsis motifs, unless specified) bPLACE p-value

AACTAT; ATAGTT ACA-motif, ATC-motif, GA-motif, TATA-box, Z-motif none Inf

ATATAG; CTATAT TATA-box, Sbp-CMA1c none Inf

ATATAC; GTATAT TATA-box, Z-motif, Chs-unit PHR1-binding site Inf

AGAGAG; CTCTCT CellCycle-1b, GAG-motif, Sbp-CMA1c none Inf

ATTAAT; ATTAAT GT1-motif, TATA-box, Ocs-element none Inf

ATAGAT; ATCTAT ATC-motif, ATCT-motif, Box I, GA-motif, TATA-box, Z-motif, Chs-unit 1, Ocs-element, Sbp-CMA1cnone Inf

AGACAA; TTGTCT AE-box, GA-motif, GATA-motif, Sbp-CMA1c none Inf

TATAGA; TCTATA TATA-box, Z-motif none Inf

AATCCA; TGGATT ATC-motif, ATCT-motif ARR1-binding element Inf

TTATAA; TTATAA TATA-box none Inf

TAGAGA; TCTCTA GA-motif, Gap-box, TATA-box, Sbp-CMA1c none Inf

CTTCTC; GAGAAG GATA-motif, I-box, LAMP element, Sbp-CMA1a none Inf

GAATTA; TAATTC TATA-box, Unnamed_1 EEC (Chlamydomonas reinhardtii) Inf

CAAATG; CATTTG Gap-box, MBS, OBP-1 site, Unnamed_4, Chs-unit 1, Chs-unit 1 m2E-box (Brassica napus), MYC consensus Inf

ATTAAC; GTTAAT GT1-motif, I-box, Unnamed_1 none Inf

ATGAGA; TCTCAT ATCT-motif, C-repeat/DRE, GATA-motif, I-box, LAMP element, Ocs-element, Sbp-CMA1cnone Inf

AGTTAA; TTAACT AC-I, GA-motif, GATA-motif, GT1-motif, TATA-box, Unnamed_1, Sbp-CMA1cnone Inf

AATAGT; ACTATT Box II, OBP-1 site, Unnamed_1, Z-motif none Inf

GATATA; TATATC TATA-box, Chs-unit 1, Ocs-element, Sbp-CMA1a, Sbp-CMA1c GATA-box, Element 1 (Glycine max) Inf

AGATGA; TCATCT ATCT-motif, Box I, C-repeat/DRE, CellCycle-1b, GA-motif, GATA-motif, Gap-box, Chs-unit 1, Chs-unit 1 m2, Ocs-element, Sbp-CMA1a, Sbp-CMA1cMYC recognition site Inf

AAGATG; CATCTT Box I, Box II, GATA-motif, GT1-motif, GTGGC-motif, I-box, LAMP element, TATA-box, Chs-unit 1, Chs-unit 1 m2, Sbp-CMA1aMYC recognition site Inf

ACTTAA; TTAAGT Box II, TATA-box, Unnamed_1, Ocs-element none Inf

AAAGCA; TGCTTT CAG-motif none Inf

AAGACA; TGTCTT CAG-motif, GATA-motif, Ocs-element, Sbp-CMA1a, Sbp-CMA1c 13 bp sequence of unknown funtion (Cucumis sativus)Inf

AGAACA; TGTTCT Sbp-CMA1a none Inf

GGATTT; AAATCC AC-II, ATC-motif, CAAT-box, Unnamed_4 ARR1-binding element Inf

CATTTC; GAAATG C-repeat/DRE, CAG-motif, Gap-box, Unnamed_4, Sbp-CMA1a MYC recognition site Inf

ATTCTA; TAGAAT ATCT-motif, C-repeat/DRE, LAMP element none Inf

CTTTCA; TGAAAG G-box, Sbp-CMA1c Core site required for binding of Dof proteins (Zea mays)Inf

AGTAAT; ATTACT Unnamed_1, Unnamed_4 CACT (Flaveria trinervia) Inf

TCAAGA; TCTTGA TATA-box, Chs-unit, Sbp-CMA1a none Inf

AAACCT; AGGTTT AE-box, Box I, Chs-unit 1 none Inf

ATTCTC; GAGAAT GAG-motif, I-box, LAMP element none Inf

AAGTAT; ATACTT AE-box, C-repeat/DRE, OBP-1 site, TATA-box, Z-motif CACT (Flaveria trinervia) Inf

AGTTAT; ATAACT ATC-motif, TATA-box, Sbp-CMA1a none Inf

AAAGAC; GTCTTT CAG-motif, TATA-box, Ocs-motif none Inf

ACTTTG; CAAAGT OBP-1 site Core site required for binding of Dof proteins (Zea mays), TboxInf

TACTAA; TTAGTA C-repeat/DRE, GT1-motif, Z-motif CACT (Flaveria trinervia), Core of "(CA)n element" (Brassica napus), Homeodomain (Petroselinum crispum)Inf

AAGTTG; CAACTT AC-II, AE-box, CAAT-box, MBS CAREs (Oryza sativa), MYC consensus site, RSE (Phaseolus vulgaris)Inf

ACCAAT; ATTGGT AC-II, ATC-motif, CAAT-box, Unnamed_1, Unnamed_4, Z-motif, Ocs-elementCAAT promoter consensus sequence (Pisum sativum), HSE (Glycine max), Core of "(CA)n element" (Brassica napus)Inf

TAGTAA; TTACTA C-repeat/DRE, GT1-motif, Unnamed_1 CACT (Flaveria trinervia) Inf

AAAACG; CGTTTT C-repeat/DRE none Inf

ATGATG; CATCAT Box II, GTGGC-motif, Unnamed_1, Chs-unit 1, Ocs-element none Inf

GAATCA; TGATTC AE-box, CellCycle-1b, LAMP element ARR1-binding element Inf

ATGTTG; CAACAT AE-box, Box II, C-repeat/DRE, DRE CAREs (Oryza sativa), RAV1 binding site Inf

AATGGA; TCCATT Box I, CAAT-box, Gap-box, Unnamed_1, Z-motif, Chs-unit 1, Chs-unit 1 msnone Inf

CTATAA; TTATAG Box II, I-box, TATA-box none Inf

TGCAAA; TTTGCA C-repeat/DRE none Inf

AACTTG; CAAGTT CAAT-box none Inf

GTTGAA; TTCAAC G-box, Chs-uni 1 CAREs (Oryza sativa) Inf

GAAATC; GATTTC C-repeat/DRE, TATA-box, Unnamed_4 ARR1-binding element Inf

TAACTA; TAGTTA AC-I, GA-motif, GT1-motif, MBS, TATA-box none Inf

CAATCA; TGATTG AC-II, ACA-motif, ATC-motif, CAAT-box, HD-Zip 1, HD-Zip 2, Ocs-elementARR1-binding element, CAAT promoter consensus sequence (Pisum sativum)Inf

AATACT; AGTATT C-repeat/DRE CACT (Flaveria trinervia) Inf

TAGATA; TATCTA AC-I, ATC-motif, ATCT-motif, Box I, GA-motif, GATA-motif, TATA-box, Chs-unit 1, Sbp-CMA1a, Sbp-CMA1cGATA box Inf

ATGAAG; CTTCAT Gap-box, TATA-box, Chs-unit 1, Ocs-element, Sbp-CMA1a, Sbp-CMA1cnone Inf

Annotation

AGATTC; GAATCT AE-box, ATCT-motif, LAMP element ARR1-binding element Inf

ACTTAT; ATAAGT Box II, C-repeat/DRE, GATA-motif, I-box, LAMP element, OBP-1 site, TATA-box, Z-motif, Ocs-elementnone Inf

AACTCT; AGAGTT AC-II, C-repeat/DRE, CAAT-box, CellCycle-1b, Sbp-CMA1c none Inf

GATTCA; TGAATC LAMP element, TATA-box ARR1-binding element Inf

ATGGTT; AACCAT AC-II, ACA-motif, AE-box, CAAT-box, GT1-motif, Unnamed_1 none Inf

CTGAAA; TTTCAG Sbp-CMA1a none Inf

CTTGAA; TTCAAG none none Inf

AAACGA; TCGTTT AE-box, GTGGC-motif, Gap-box, Z-motif none Inf

ATGGAA; TTCCAT Box I, C-repeat/DRE, G-box, Gap-box, Unnamed_1, Chs-unit 1, Chs-unit 1 m2none Inf

ATCTCA; TGAGAT ACA-motif, ATCT-motif, Box I, C-repeat/DRE, GATA-motif, I-box, LAMP element, Chs-unit 1, Ocs-element, Sbp-CMA1cnone Inf

ACTATA; TATAGT ACA-motif, C-repeat/DRE, I-box, TATA-box none Inf

AGAATC; GATTCT AE-box, I-box, LAMP element ARR1-binding element Inf

GATTGA; TCAATC AC-II, ATC-motif, Box I, G-box, NON-box, TATA-box, Chs-unit 1, Chs-unit 1 m2, Ocs-elementARR1-binding element, CAAT promoter consensus sequence (Pisum sativum)Inf

CTAATA; TATTAG ATCT-motif, Box II, CAAT-box, GT1-motif, Unnamed_4, Z-motif Cytokinin-enhanced Protein Binding (Cucumis sativus), Core of "(CA)n element" (Brassica napus), Homeodomain (Petroselinum crispum)Inf

ACACAT; ATGTGT ABRE, AE-box, Box II, C-repeat/DRE, G-box, OBP-1 site, Z-motif, Chs-unit 1Binding site for MYC, MYC recognition site Inf

CACTTT; AAAGTG CAAT-box, OBP-1 site CACT (Flaveria trinervia), Core site required for binding of Dof proteins (Zea mays), MYCInf

CTCTTC; GAAGAG Z-motif, Chs-unit 1, Sbp-CMA1a, Sbp-CMA1c Nodulin consensus sequence, putative (Glycine max), OSE (Vicia faba)Inf

AAGAGT; ACTCTT C-repeat/DRE, GAG-motif, GATA-motif, I-box, LAMP element, OBP-1 site, TATA-box, Sbp-CMA1cNodulin consensus sequence, putative (Glycine max), OSE (Vicia faba)Inf

AATTGG; CCAATT AC-II, ATC-motif, CAAT-box, Gap-box Core of "(CA)n element" (Brassica napus), MYC recognition site, CAAT promoter consensus sequence (Pisum sativum), HSE (Glycine max)Inf

AACTCA; TGAGTT AC-II, C-repeat/DRE, CAAT-box none Inf

AAAGCT; AGCTTT ATC-motif, TATA-box none Inf

CTTATA; TATAAG GATA-motif, I-box, LAMP element, TATA-box, Z-motif, Ocs-elementnone Inf

GTTATA; TATAAC Box I, TATA-box, Chs-unit 1 none Inf

ACAGAA; TTCTGT Box II, CellCycle-1b, LAMP element, Ocs-element DNase I protected sequence (Glycine max) Inf

CCCAAA; TTTGGG C-repeat/DRE, CAAT-box, OBP-1 site Core of "(CA)n element" (Brassica napus) Inf

ATCACA; TGTGAT ACA-motif, GT1-motif, Chs-unit 1, Chs-unit 1 m1, Ocs element GTGA motif (Nicotiana tabacum) Inf

ACAAGT; ACTTGT ABRE, Box II, G-box, OBP-1 site, Z-motif, Chs-unit 1 none Inf

TGACAA; TTGTCA ACA-motif, G-box, Z-motif, Ocs element BELL homeodomain transcription factor (Oryza sativa), core of TGAC-containing W-box binding site of Amy32b promotor or WRKY71 (Oryza sativa)Inf

CCAAAC; GTTTGG ATC-motif, C-repeat/DRE, GT1-motif, GTGGC-motif, OBP-1 site, Chs-unit 1, Chs-unit 1 m1Core of "(CA)n element" (Brassica napus) Inf

ACTCAA; TTGAGT C-repeat/DRE SORLIP Inf

TGTCAA; TTGACA G-box, W-box, Z-motif, Ocs-element BELL homeodomain transcription factor (Oryza sativa), W-box, core of TGAC-containing W-box binding site of Amy32b promotor or WRKY71 (Oryza sativa)Inf

ATGTGA; TCACAT ACA-motif, Box II, CellCycle-1b, Ocs-element, Sbp-CMA1a GTGA motif (Nicotiana tabacum), Binding site for MYC, MYC recognition siteInf

GATCAA; TTGATC C-repeat/DRE, NON-box, W-box, Chs-unit 1, Ocs-element, Sbp-CMA1cnone Inf

TACCAA; TTGGTA AC-I, AC-II, Box I, C-repeat/DRE, CAAT-box, DRE, G-box, Unnamed_1, Z-motif, Chs-unit 1Core of "(CA)n element" (Brassica napus) Inf

AATGGT; ACCATT ACA-motif, Gap-box, I-box, Unnamed_1 none Inf

GTATAA; TTATAC I-box, LAMP element, TATA-box, Unnamed_1, Z-motif PHR1-binding sequence Inf

AGTGAA; TTCACT G-box, Gap-box, OBP-1 site GTGA motif (Nicotiana tabacum), CACT (Flaveria trinervia)Inf

CTAAAC; GTTTAG ATCT-motif, Box I, Chs-unit 1 Core of "(CA)n element" (Brassica napus), homeodomain protein target (Petroselinum crispum)Inf

AAGTGA; TCACTT CellCycle-1b, G-box, Gap-box, OBP-1 site, Sbp-CMA1c CACT (Flaveria trinervia), GTGA motif (Nicotiana tabacum), MYC recognition siteInf

AAACTG; CAGTTT AE-box, CAAT box, MBS, OBP-1 site none Inf

ACTTTC; GAAAGT AE-box, CAG-motif, GAG-motif, OBP-1 site Core site required for binding of Dof proteins (Zea mays)Inf

AGATTG; CAATCT ATC-motif, ATCT-motif, Box I, CAAT-box, LAMP element, NON-box, Chs-unit 1ARR1-binding element, CAAT promoter consensus sequence (Pisum sativum)Inf

ATTGGA; TCCAAT ATC-motif, ATCT-motif, C-repeat/DRE, CAAT-box, GATA-motif, Gap-boxCore of "(CA)n element" (Brassica napus), CAAT promoter consensus sequence (Pisum sativum), HSE (Glycine max)Inf

CATGTT; AACATG Box II, C-repeat/DRE, GT1-motif none Inf

GTAATA; TATTAC Box II, C-repeat/DRE, GT1-motif, HD-Zip 3, TCT-motif, Unnamed_1none Inf

AGTCAA; TTGACT W box W-box, SURE [SUSIBA2 bind to W-box element] (Hordeum vulgare), core of TGAC-containing W-box binding site of Amy32b promotor or WRKY71 (Oryza sativa)Inf

CAATGA; TCATTG Gap-box, HD-Zip 1, HD-Zip 2, Ocs-element CAAT promoter consensus sequence (Pisum sativum)Inf

AGTTGA; TCAACT AC-II, CAAT-box, CellCycle-1b, Chs-unit 1, Chs-unit 1 m2 CAREs [CAACTC regulatory elements] (Oryza sativa), MYC recognition site, RSE [root-specific element] (Phaseolus vulgaris)Inf

ACATGA; TCATGT Box II, C-repeat/DRE, GTGGC-motif, Gap-box, Chs-unit 1, Chs-unit 1 m2, Ocs-element, Sbp-CMA1anone Inf

ATACTA; TAGTAT Box II, C-repeat/DRE, GT1-motif, Z-motif CACT (Flaveria trinervia) Inf

AACTTC; GAAGTT AC-II, CAAT-box, Chs-unit 1, Sbp-CMA1a none Inf

ACTTCT; AGAAGT CellCycle-1b, OBP-1 site, Unnamed_4, Sbp-CMA1a none Inf

AGTATA; TATACT C-repeat/DRE, I-box, OBP-1 site, TATA-box, Z-motif CACT (Flaveria trinervia), PHR1-binding sequence Inf

ATTTCC; GGAAAT C-repeat/DRE, CAAT-box, Unnamed_1, Unnamed_4 Consensus GT-1 binding site Inf

ACATCA; TGATGT Box II, C-box, C-repeat/DRE, CellCycle-1b, As1, Ocs-element none Inf

ATGCAA; TTGCAT CellCycle-1b, G-box, Unnamed_4 none Inf

ATAGTA; TACTAT Box II, C-repeat/DRE, GATA-motif, GT1-motif, Unnamed_1 CACT (Flaveria trinervia) Inf

AAACCC; GGGTTT none none Inf

TAAGTA; TACTTA AC-I, TATA-box CACT (Flaveria trinervia) Inf

TAACCA; TGGTTA AC-II, ACA-motif, ATC-motif, Box I, Box II, CAAT-box, GT1-motif, Unnamed_1, Chs-unit 1MYB recognition site in promotors of dehydration-responsive gene rd22 (Arabidopsis)Inf

AATCAC; GTGATT ACA-motif, GT1-motif, Unnamed_1, Ocs-element ARR1-binding element, GTGA motif (Nicotiana tabacum)Inf

TCTGAA; TTCAGA none none Inf

CATGAA; TTCATG C-repeat/DRE, Gap-box, Chs-unit 1, Ocs-element none Inf

CCTAAA; TTTAGG C-repeat/DRE, OBP-1 site, TATA-box Core of "(CA)n element" (Brassica napus), H-box (Phaseolus vulgaris), homeodomain (Petroselinum crispum)Inf

GACTTT; AAAGTC CAG-motif, OBP-1 site Core site required for binding of Dof proteins (Zea mays)Inf

ACAATG; CATTGT GTGGC-motif, Unnamed_1, Ocs-element CAAT promoter consensus sequence (Pisum sativum)Inf

ACGAAA; TTTCGT I-box, Unnamed_4, Z-motif none Inf

CATTGA; TCAATG Ocs-element CAAT promoter consensus sequence (Pisum sativum)Inf

AACGAA; TTCGTT AC-II, CAAT-box, Gap-box, Unnamed_4, Z-motif none Inf

TCAGAA; TTCTGA ACA-motif, LAMP element none Inf

GGAGAA; TTCTCC I-box, LAMP element, Sbp-CMA1a none Inf

ACTTGA; TCAAGT C-repeat/DRE none Inf

ATCTTG; CAAGAT GATA-motif, GTGGC-motif, I-box, LAMP element, TATA-box, Chs-unit 1, Ocs-element, Sbp-CMA1anone Inf

AATGTG; CACATT Box II, GT1-motif, OBP-1 site MYB recognition site in promotors of dehydration-responsive gene rd22 (Arabidopsis)Inf

GTTCAA; TTGAAC C-repeat/DRE, W box none Inf

GGAAGA; TCTTCC CAG-motif, TCT-motif, Unnamed_4, Chs-unit 1, Chs-unit 1 m2, Sbp-CMA1a, Sbp-CMA1cnone Inf

AAGTCA; TGACTT C-box, C-repeat/DRE, CAG-motif, CellCycle-1b, As1, Ocs-elementSURE [SUSIBA2 bind to W-box element] (Hordeum vulgare), W-box (Nicotiana tabacum), core of TGAC-containing W-box binding site of Amy32b promotor or WRKY71 (Oryza sativa)Inf

TGAACA; TGTTCA Gap-box, Chs-unit 1, Sbp-CMA1a none Inf

CAAACC; GGTTTG ATC-motif, Box I, Chs-unit 1 Core of "(CA)n element" (Brassica napus) Inf

AAAGGT; ACCTTT CAG-motif, CellCycle-1b, I-box, OBP-1 site, TATA-box, Unnamed_1none Inf

ATCCAT; ATGGAT ACA-motif, Box I, GA-motif, Gap-box, Z-motif, Chs-unit 1, Chs-unit 1 m2, DOCT, Ocs-elementnone Inf

ATTGTG; CACAAT ACA-motif, Box II, CAAT-box, GTGGC-motif, LAMP element, Unnamed_1CAAT promoter consensus sequence (Pisum sativum)Inf

AAGGTT; AACCTT ACA-motif, AE-box, Box I, GATA-motif, I-box, LAMP element, TATA-box, Chs-unit 1none Inf

ATCAAG; CTTGAT TATA-box, Chs-unit 1, Ocs-element, Sbp-CMA1c none Inf

CGAAAA; TTTTCG C-repeat/DRE, I-box, OBP-1 site, Unnamed_4, Z-motif none Inf

ACAACT; AGTTGT AC-II, ACA-motif, CAAT-box CAREs [CAACTC regulatory elements] (Oryza sativa), MYC recognition site, RSE [root-specific element] (Phaseolus vulgaris)Inf

AGTGTT; AACACT OBP-1 site CACT (Flaveria trinervia) Inf

TCTCCA; TGGAGA ATC-motif, Gap-box, Chs-unit 1, Sbp-CMA1a none Inf

ATTCCA; TGGAAT C-repeat/DRE, CellCycle-1b, G-box, Unnamed_4, Sbp-CMA1c none Inf

ATCAGA; TCTGAT ACA-motif, ATCT-motif, GATA-motif, I-box, LAMP element, Ocs-elementnone Inf

CAATTC; GAATTG AC-II, ATC-motif, CAAT-box, Unnamed_4, Z-motif CAAT promoter consensus sequence (Pisum sativum), EEC (Chlamydomonas reinhardtii), MYC consensus recognition siteInf

AATGAG; CTCATT C-repeat/DRE, Gap-box, Ocs-element none Inf

ATTTGC; GCAAAT ATC-motif, Chs-unit 1, Chs-unit 1 m2 none Inf

CATTCA, TGAATG Ocs-element none Inf

TACACA; TGTGTA GT1-motif, OBP-1 site none Inf

CTATTA; TAATAG Box II, CAAT-box, GT1-motif, TATA-box, Unnamed_1, Z-motif none Inf

GAGATA; TATCTC GA-motif, GATA-motif, Ocs-element, Sbp-CMA1a, Sbp-CMA1c GATA box Inf

AGATCA; TGATCT ATCT-motif, GA-motif, GATA-motif, NON-box, Chs-unit 1, Chs-unit 1 m2, Sbp-CMA1cnone Inf

ACAATC; GATTGT ACA-motif, ATC-motif, I-box, LAMP element ARR1-binding element, CAAT promoter consensus sequence (Pisum sativum)Inf

CTACAA; TTGTAG AC-I, Box I, CAAT-box, TATA-box, Chs-unit 1, Chs-unit 1 m1 none Inf

GATGTT; AACATC Chs-unit 1 none Inf

ACTTCA; TGAAGT C-box, CellCycle-1b, As1, Chs-unit 1, Sbp-CMA1a none Inf

GTATTA; TAATAC Box II, C-repeat/DRE, GT1-motif, Unnamed_4 none Inf

CCAATA; TATTGG ATC-motif, C-repeat/DRE, CAAT-box, OBP-1 site, TATA-box, Unnamed_1, Unnamed_4, Z-motifCAAT promoter consensus sequence (Pisum sativum), HSE (Glysine max), Core of (CA)n element (Brassica napus)Inf

AAGATC; GATCTT GATA-motif, I-box, LAMP element, TATA-box, Chs-unit 1, Sbp-CMA1anone Inf

GAATGA; TCATTC G-box, Gap-box, Ocs-element none Inf

CACCAA; TTGGTG AC-II, CAAT-box, Ocs-element Core of (CA)n element (Brassica napus) Inf

AATCTG; CAGATT ATCT-motif, Box II, GATA-motif, GT1-motif, I-box, LAMP element, TATA-box, Chs-unit 1, Chs-unit 1 m2ARR1-binding element Inf

GAGGAA; TTCCTC G-box, Unnamed_1, Chs-unit 1, Sbp-CMA1a none Inf

TGGTAA; TTACCA AC-I, Box I, GT1-motif, Unnamed_1, Chs-unit 1, Chs-unit 1 m1 none Inf

ATTCAC; GTGAAT ACA-motif, GT1-motif GTGA motif (Nicotiana tabacum) Inf

ACATTG; CAATGT CAAT-box, Ocs-element CAAT promoter consensus sequence (Pisum sativum), HSE (Glysine max), Core of (CA)n element (Brassica napus)Inf

CTCTAA; TTAGAG ATCT-motif, Box I, CAAT-box, TATA-box, Chs-unit 1 Core of (CA)n element (Brassica napus), homeodomain (Petroselinum crispum)Inf

CTTCTA; TAGAAG Box I, G-box, Chs-unit 1, Sbp-CMA1a, Sbp-CMA1c none Inf

AAGTGT; ACACTT ABRE, AE-box, Box II, G-box, I-box, OBP-1 site, Z-motif, Chs-unit 1CACT (Flaveria trinervia), MYC recognition site Inf

CAGAGA; TCTCTG CellCycle-1b, Sbp-CMA1c none Inf

AGAGGA; TCCTCT CellCycle-1b, G-box, GATA-motif, Chs-unit 1, Chs-unit 1 m2, Sbp-CMA1anone Inf

CACATA; TATGTG ABRE, Box II, GT1-motif, Z-motif, Chs-unit 1, Ocs-element MYB recognition site in promotors of dehydration-responsive gene rd22 (Arabidopsis), MYC recognition siteInf

ATTGAG; CTCAAT CAAT-box, Gap-box, Ocs-element SORLIP, CAAT promoter consensus sequence (Pisum sativum)Inf

CTCTTA; TAAGAG Box II, GATA-motif, I-box, LAMP element, Ocs-element, Sbp-CMA1cNodulin consensus sequence, putative (Glycine max), OSE (Vicia faba)Inf

AGAATG; CATTCT LAMP element, Unnamed_1 none Inf

AGGAGA; TCTCCT CellCycle-1b, Gap-box, I-box, Sbp-CMA1a, Sbp-CMA1c none Inf

GGTAAA; TTTACC AC-I, GT1-motif, Unnamed_1, W box, Sbp-CMA1c Consensus GT-1 binding site Inf

AATCAG; CTGATT ACA-motif ARR1-binding element Inf

AAGCAT; ATGCTT ACA-motif, AE-box none Inf

AACTGA; TCAGTT C-repeat/DRE, Gap-box none Inf

CCATAA; TTATGG Box II, C-repeat/DRE, I-box, OBP-1 site, TATA-box, Unnamed_1, Ocs-elementnone Inf

ATCTGA; TCAGAT ATCT-motif, Box I, GATA-motif, I-box, LAMP element, Chs-unit 1, Chs-unit 1 m2, Ocs-element, Sbp-CMA1anone Inf

AAGACT; AGTCTT GATA-motif, I-box, LAMP element, TATA-box none Inf

ATCATG; CATGAT Box II, C-repeat/DRE, GTGGC-motif, Unnamed_1 none Inf

CAACTA; TAGTTG AC-II, ACA-motif, Box I, CAAT-box, MBS, Chs-unit 1 CAREs [CAACTC regulatory elements] (Oryza sativa), MYC recognition site, RSE [root-specific element] (Phaseolus vulgaris)Inf

ACTGAA; TTCAGT Gap-box, LAMP element none Inf

CCATTA; TAATGG Box II, CAAT-box, Gap-box, I-box, TATA-box, Unnamed_1 none Inf

ATGTCA; TGACAT C-box, C-repeat/DRE, CellCycle-1b, DRE, G-box, Unnamed_4, Z-motif, As1, Ocs-elementBELL homeodomain transcription factor (Oryza sativa), core of TGAC-containing W-box binding site of Amy32b promotor or WRKY71 (Oryza sativa)Inf

ATGACA; TGTCAT ACA-motif, CellCycle-1b, G-box, Unnamed_4, Z-motif, Ocs-elementBELL homeodomain transcription factor (Oryza sativa), core of TGAC-containing W-box binding site of Amy32b promotor or WRKY71 (Oryza sativa)Inf

ATGATC; GATCAT C-repeat/DRE, I-box, Chs-unit 1 none Inf

AGTGAT; ATCACT ACA-motif, C-repeat/DRE, G-box, Ocs-element, Sbp-CMA1c CACT (Flaveria trinervia), GTGA motif (Nicotiana tabacum), MYC recognition siteInf

ATGAAC; GTTCAT Box I, GT1-motif, Gap-box, Chs-unit 1, Chs-unit 1 m2 none Inf

CCAAAG; CTTTGG C-repeat/DRE, OBP-1 site Core site required for binding of Dof proteins (Zea mays)Inf

CTTGTA; TACAAG none none Inf

ATGTTC; GAACAT AE-box, Chs-unit 1, Sbp-CMA1a none Inf

AAGTCT; AGACTT AE-box, OBP-1 site none Inf

ATATGG; CCATAT Box I, Box II, Gap-box, I-box, TATA-box, Chs-unit 1, Sbp-CMA1a MYC recognition site Inf

ATCGAA; TTCGAT ATCT-motif, Box I, NON-box, Chs-unit 1 none Inf

GTAAAC; GTTTAC AC-I, Z-motif none Inf

AATGCA; TGCATT CAG-motif, G-box, Gap-box, Unnamed_4 none Inf

GCATTT; AAATGC C-repeat/DRE, CAG-motif, G-box, Unnamed_4 none Inf

CTCCAA; TTGGAG C-repeat/DRE, CAAT-box, Gap-box Core of (CA)n element (Brassica napus) Inf

CTAAAG; CTTTAG OBP-1 site, TATA-box, Sbp-CMA1a, Sbp-CMA1c Core site required for binding of Dof proteins (Zea mays), TAAAG motif (Solanum tuberosum)Inf

CGATTT; AAATCG CAAT-box, Gap-box, NON-box ARR1-binding element Inf

CATATC; GATATG Box II, C-repeat/DRE, GATA-motif, GT1-motif, I-box, LAMP element, Unnamed_4, Sbp-CMA1aGATA box, MYC recognition site Inf

CTAATC; GATTAG ATC-motif, ATCT-motif, Box I, GATA-motif, I-box, LAMP element, Z-motif, Chs-unit 1ARR1-binding element, Core of (CA)n element (Brassica napus), homeodomain (Petroselinum crispum)Inf

CACTAA; TTAGTG none CACT (Flaveria trinervia), Core of (CA)n element (Brassica napus), homeodomain (Petroselinum crispum)Inf

AAGCTA; TAGCTT ATCT-motif, Box I, GATA-motif, NON-box, Chs-unit 1, Sbp-CMA1anone Inf

ACTCAT; ATGAGT C-repeat/DRE PRE (Pro- or hypoosmolarity-responsive element) Inf

AGACAT; ATGTCT AE-box, C-repeat/DRE, DRE, Unnamed_4, Ocs-element, Sbp-CMA1a, Sbp-CMA1cnone Inf

TCTACA; TGTAGA Box II, Gap-box, TATA-box, Chs-unit 1, Sbp-CMA1a none Inf

TCGAAA; TTTCGA C-repeat/DRE none Inf

GTAACA; TGTTAC AE-box, G-box, TCT-motif, Z-motif none Inf

GACCAA; TTGGTC AC-II, CAAT-box, Unnamed_4 none Inf

TATGGA; TCCATA ACA-motif, Box I, C-repeat/DRE, Gap-box, TATA-box, Chs-unit 1, Chs-unit 1 m2none Inf

AATCCT; AGGATT GATA-motif, I-box, LAMP element, TATA-box ARR1-binding element Inf

AAGGAT; ATCCTT I-box, TATA-box, DOCT none Inf

CCAACA; TGTTGG AC-II, C-repeat/DRE, CAAT-box, DRE, OBP-1 site RAV1 binding site, Core of (CA)n element (Brassica napus), CAREs [CAACTC regulatory elements] (Oryza sativa)Inf

ACATCT; AGATGT Box I, Box II, CellCycle-1b, Chs-unit 1, Chs-unit 1 m2, Sbp-CMA1aMYC recognition site Inf

ATTGAC; GTCAAT ATC-motif, Box I, CAAT-box, G-box, GT1-motif, NON-box, Chs-unit 1, Chs-unit 1 m2, Ocs-elementCAAT promoter consensus sequence (Pisum sativum), W-box, core of TGAC-containing W-box binding site of Amy32b promotor or WRKY71 (Oryza sativa)Inf

GGTTAA; TTAACC AC-II, Box I, GT1-motif, I-box, LAMP element, W box, Chs-unit 1 Critical for GT-1 binding to box II of rbcS (Pisum sativum)Inf

AGAAGC; GCTTCT AE-box, C-repeat/DRE, LAMP element, Sbp-CMA1a none Inf

CAAGTA; TACTTG ABRE, Box II, Z-motif, Chs-unit 1 CACT (Flaveria trinervia) Inf

GTAAGA; TCTTAC AC-I, Box I, GATA-motif, I-box, LAMP element, TCT-motif, Chs-unit 1, Ocs-element, Sbp-CMA1cnone Inf

ACCATA; TATGGT ABRE, ACA-motif, GT1-motif, I-box, Unnamed_1, Chs-unit 1, Chs-unit 1 m1none Inf

AATGTC; GACATT C-repeat/DRE, G-box, Unnamed_4, Ocs-element none Inf

ACATTC; GAATGT LAMP element none Inf

GTTACA; TGTAAC Box I, C-repeat/DRE, G-box, Z-motif, Chs-unit 1 none Inf

CATACA; TGTATG GT1-motif none Inf

AATGAC; GTCATT ACA-motif, G-box, Gap-box, Unnamed_1, Unnamed_4, Ocs-elementcore of TGAC-containing W-box binding site of Amy32b promotor or WRKY71 (Oryza sativa)Inf

TATCCA; TGGATA ATC-motif, Box II, GA-motif, GT1-motif, Gap-box, I-box PHR1-binding sequence, TATCCA element (Oryza sativa), GATA box, Core motif of MybSt1 (Solanum tuberosum)Inf

GCTAAA; TTTAGC Sbp-CMA1c none Inf

GTTGTA; TACAAC ACA-motif, Box I, C-repeat/DRE, G-box, Chs-unit 1, Chs-unit 1 m1CAREs [CAACTC regulatory elements] (Oryza sativa) Inf

CAACCA; TGGTTG AC-I, AC-II, ACA-motif, Box I, CAAT-box, GT1-motif, Chs-unit 1, Chs-unit 1 m1CAREs [CAACTC regulatory elements] (Oryza sativa) Inf

AAGTAG; CTACTT Box II, Chs-unit 1, Sbp-CMA1a CACT (Flaveria trinervia) Inf

ACCCAA; TTGGGT AC-II, CAAT-box Core of (CA)n element (Brassica napus) Inf

AGAGTA; TACTCT ATCT-motif, OBP-1 site CACT (Flaveria trinervia) Inf

ATTGTC; GACAAT ATC-motif, CAAT-box, I-box CAAT promoter consensus sequence (Pisum sativum)Inf

GAGTAA; TTACTC G-box CACT (Flaveria trinervia) Inf

CTTATC; GATAAG AC-I, ATCT-motif, GATA-motif, I-box, LAMP element, Ocs-element, Sbp-CMA1a, Sbp-CMA1cGATA box, I-box Inf

AAACGT; ACGTTT ABRE, AE-box, Box II, G-box, OBP-1 site, Z-motif, Chs-unit 1 ACGT sequence Inf

ATTTCG; CGAAAT C-repeat/DRE, DRE, Unnamed_4 none Inf

GAAGAC; GTCTTC CAG-motif, Unnamed_4, Chs-unit 1, Ocs-element, Sbp-CMA1a, Sbp-CMA1c13 bp sequence of unknown function (Cucumis sativus)Inf

AGTCAT; ATGACT C-repeat/DRE, Ocs-element SURE [SUSIBA2 bind to W-box element] (Hordeum vulgare), W-box (Nicotiana tabacum), core of TGAC-containing W-box binding site of Amy32b promotor or WRKY71 (Oryza sativa)Inf

AACTGT; ACAGTT OBP-1 site none Inf

AATGGG; CCCATT CAAT-box, Gap-box, Unnamed_1 none Inf

TGGGCC; GGCCCA C-repeat/DRE SORLIP, Site II element 2.5E-19

ATGGGC; GCCCAT ATC-motif, Box I, Unnamed_1, Chs-unit 1, Chs-unit 1 m2 none 8.5E-16

AGGCCC; GGGCCT Unnamed_1 SORLIP 1.5E-13

TGGGCT; AGCCCA none Site II element 4.3E-10

GCCCAA; TTGGGC none none 5.8E-09

ACGTCA; TGACGT C-box, CellCycle-1b, As1, Ocs-element ACGT sequence, ASF-1 binding site, hexamer motif (Triticum aestivum), TGACGT motif (Vigna mungo), core of TGAC-containing W-box binding site of Amy32b promotor or WRKY71 (Oryza sativa)3.6E-08

TAGGGA; TCCCTA AC-I H-box (Phaseolus vulgaris), Binding site of KAP-1 and KAP-2 (Phaseolus vulgaris)7.0E-08

AACCGA; TCGGTT AC-II, Box I, C-repeat/DRE, CAAT-box, DRE, Chs-unit 1 none 3.3E-06

CGTCAG; CTGACG C-box, CellCycle-1b, Ocs-element, Sbp-CMA1a ASF-1 binding site, core of TGAC-containing W-box binding site of Amy32b promotor or WRKY71 (Oryza sativa)5.3E-06

CGTTGA; TCAACG AC-II, Box II, G-box, NON-box, Unnamed_4, Chs-unit 1, Ocs-elementnone 1.3E-05

CTTTTC; GAAAAG C-repeat/DRE, CAG-motif, GATA-motif, I-box, LAMP element, OBP-1 site, Unnamed_4, Z-motif, Sbp-CMA1cCore site required for binding of Dof proteins (Zea mays)1.3E-05

ACCGAT; ATCGGT C-repeat/DRE, DRE, DOCT none 1.4E-05

ACGACG; CGTCGT G-box, GTGGC-motif, NON-box, Ocs-element CGACG element (Oryza sativa) 3.7E-05

GACGAC; GTCGTC C-box, C-repeat/DRE, Unnamed_4, As1, Ocs-element none 5.2E-05

ACCCGG; CCGGGT none none 6.3E-05

GGTCAA; TTGACC GT1-motif, W box ElRE [Elicitor Responsive Element] (Petroselinum crispum), W-box, core of TGAC-containing W-box binding site of Amy32b promotor or WRKY71 (Oryza sativa)7.8E-05

CGACGA; TCGTCG G-box, NON-box. Unnamed_4, Ocs-element CGACG element (Oryza sativa) 7.8E-05

CCCTAA; TTAGGG I-box Core of (CA)n element (Brassica napus), H-box (Phaseolus vulgaris), Binding site of KAP-1 and KAP-2 (Phaseolus vulgaris), homeodomain (Petroselinum crispum)9.3E-05

AAGCCC; GGGCTT Unnamed_1 none 9.9E-05

CTCCCC; GGGGAG Chs-unit 1, Chs-unit 1 m2 none 1.1E-04

CAATAA; TTATTG C-repeat/DRE, CAAT-box, HD-Zip 1, HD-Zip 2, I-box, TATA-box, Ocs-elementCAAT promoter consensus sequence (Pisum sativum)1.1E-04

AGGGAC; GTCCCT Box I, G-box, Unnamed_1, Chs-unit 1, Chs-unit 1 m2 none 1.1E-04

GTCGTA; TACGAC Box I, C-repeat/DRE, G-box, Z-motif, Chs-unit 1, Chs-unit 1 m1, Ocs-elementnone 1.1E-04

AGGGAG; CTCCCT CAG-motif, GAG-motif, Gap-box none 1.4E-04

AAGGCC; GGCCTT CAG-motif, G-box, Unnamed_4 none 1.5E-04

ACCTCA; TGAGGT C-box, C-repeat/DRE, CellCycle-1b, GT1-motif, As1, Chs-unit 1, Chs-unit 1 m1, Ocs-elementnone 1.6E-04

ATAGAG; CTCTAT CellCycle-1b, GA-motif, GAG-motif, Gap-box, TATA-box, Z-motif, Sbp-CMA1cnone 1.6E-04

TCCCCA; TGGGGA Gap-box none 2.0E-04

GTGACG; CGTCAC C-box, CellCycle-1b, G-box, Z-motif, Ocs-element ASF-1 binding site, GTGA motif (Nicotiana tabacum), TGAC-containing W-box of Myb and binding site of WRKY71 (Oryza sativa)2.2E-04

CCGGAA; TTCCGG none none 2.2E-04

CAGGCC; GGCCTG none none 2.3E-04

CGTGGA; TCCACG ABRE, Box II, CellCycle-1b, G-box, NON-box, OCT, Unnamed_4, Chs-unit 1none 2.6E-04

ATGACG; CGTCAT C-box, C-repeat/DRE, CellCycle-1b, DRE, Chs-unit 1, Ocs-elementASF-1 binding site, core of TGAC-containing W-box binding site of Amy32b promotor or WRKY71 (Oryza sativa)2.7E-04

ACGTGG; CCACGT ABRE, Box II, CellCycle-1b, G-box, Unnamed_4, Z-motif, Chs-unit 1ABRE-like sequence, ACGT sequence 2.7E-04

AAACCG; CGGTTT JERE none 2.8E-04

CCACGC; GCGTGG ABRE, CellCycle-1b, G-box, GT1-motif, GTGGC-motif, Unnamed_4, Chs-unit 1, Chs-unit 1 m1none 3.4E-04

GGGCCC; GGGCCC none SORLIP 3.4E-04

ATCCGG; CCGGAT OCT, DOCT none 3.7E-04

AAAATT; AATTTT AE-box, GATA-motif, I-box, LAMP element, OBP-1 site, TATA-box, Unnamed_1none 3.7E-04

AGGGTG; CACCCT none none 3.7E-04

CGGTTC; GAACCG OCT, DOCT none 3.8E-04

ATTGGG; CCCAAT ATC-motif, CAAT-box Core of (CA)n element (Brassica napus), CAAT promoter consensus sequence (Pisum sativum), CCAAT box (Glysine max)4.0E-04

TAATAA; TTATTA Box II, GT1-motif, HD-Zip 3, TATA-box none 4.0E-04

GTTGAT; ATCAAC AC-II, CAAT-box, GT1-motif, NON-box, Chs-unit 1, Ocs-element CAREs [CAACTC regulatory elements] (Oryza sativa )4.1E-04

CGATAG; CTATCG ATC-motif, C-repeat/DRE, CAAT-box, I-box GATA box 4.1E-04

AGTACT; AGTACT none CACT (Flaveria trinervia), GTAC is the core of a CuRE [copper-response elemen] (Chlamydomonas reinhardtii)4.4E-04

CACGTC; GACGTG ABRE, Box II, C-box, C-repeat/DRE, CellCycle-1b, G-box, Unnamed_4, Z-motif, As1, Chs-unit 1, Chs-unit 1 m2ABRE-like sequence, ACGT sequence 4.5E-04

CAGCGA; TCGCTG none none 4.7E-04

GGTCCA; TGGACC C-repeat/DRE, Unnamed_4, W box, Chs-unit 1, Chs-unit 1 m2 none 5.1E-04

AATAGA; TCTATT ATCT-motif, Box II, Gap-box, TATA-box, Z-motif, Sbp-CMA1c none 5.1E-04

GGCCTA; TAGGCC C-repeat/DRE, Unnamed_1 none 5.1E-04

AGATAG; CTATCT ATC-motif, Box I, GA-motif, GAG-motif, GATA-motif, NON-box, TATA-box, Chs-unit 1, Sbp-CMA1a, Sbp-CMA1cGATA box 5.6E-04

ACACGT; ACGTGT ABRE, Box II, CellCycle-1b, G-box, GTGGC-motif, OBP-1 site, Unnamed_4, Z-motif, Chs-unit 1ABRE-like sequence, ACGT sequence 5.7E-04

GTATGA; TCATAC TCT-motif, Sbp-CMA1a none 5.8E-04

AGGGGG; CCCCCT Unnamed_1 none 6.0E-04

CATGCA; TGCATG none RY repeat in RY/G box [the complex containing the two RY repeats and the G-box] of napA gene (Brassica napus)6.0E-04

GGGAGA; TCTCCC CAG-motif, Gap-box, Chs-unit 1, Chs-unit 1 m2, Sbp-CMA1c none 6.1E-04

ACGTTC; GAACGT ABRE ACGT sequence 6.1E-04

AAGGTA; TACCTT AC-I, CAG-motif, GATA-motif, Unnamed_1, Sbp-CMA1a none 6.2E-04

AGACCA; TGGTCT JERE none 6.2E-04

CGTGTA; TACACG ABRE, G-box, GTGGC-motif, OBP-1 site, Unnamed_4, Z-motif none 6.8E-04

AAAAGT; ACTTTT C-repeat/DRE, OBP-1 site, TATA-box Core site required for binding of Dof proteins (Zea mays)7.0E-04

ATGAGG; CCTCAT Box II, C-repeat/DRE, G-box, I-box, Chs-unit 1, Ocs-element none 7.1E-04

CCGACC; GGTCGG AC-I, Box I, C-repeat/DRE, CCGTCC-box, DRE, Chs-unit 1, Chs-unit 1 m1, Chs-unit 1 m2, Ocs-elementCore of low temperature responsive element (LTRE)7.2E-04

CGATGA; TCATCG G-box, I-box, Chs-unit 1, Chs-unit 1 m2, Ocs-element none 7.5E-04

CTTTGA; TCAAAG Ocs-element Core site required for binding of Dof proteins (Zea mays)7.7E-04

GTCCAC; GTGGAC Box I, G-box, Unnamed_4, Chs-unit 1, Chs-unit 1 m2 none 7.9E-04

CGTTAG; CTAACG Box I, C-box, C-repeat/DRE, Chs-unit 1 none 8.2E-04

AGGTAC; GTACCT AC-I GTAC is the core of a CuRE [copper-response element] (Chlamydomonas reinhardtii)8.2E-04

AGGGAT; ATCCCT DOCT, Sbp-CMA1c none 8.3E-04

GTGAAC; GTTCAC Unnamed_4 GTGA motif (Nicotiana tabacum) 8.3E-04

AATACG; CGTATT Box II, GT1-motif, Z-motif none 8.4E-04

ATTACG; CGTAAT Box II, Unnamed_1, Ocs-element none 8.4E-04

AAGTTC; GAACTT AE-box, C-repeat/DRE, Chs-unit 1 none 8.9E-04

GCGCCC; GGGCGC none none 9.6E-04

ACCAAA; TTTGGT AC-II, ACA-motif, C-repeat/DRE, CAAT-box, GT1-motif, Chs-unit 1, Chs-unit 1 m1Core of (CA) element (Brassica napus) 9.8E-04

CGGTCA; TGACCG C-repeat/DRE, JERE, Chs-unit 1, Chs-unit 1 m2 W-box (Nicotiana tabacum), core of TGAC-containing W-box binding site of Amy32b promotor or WRKY71 (Oryza sativa)9.8E-04

GGGAAA; TTTCCC none none 9.8E-04

Performed on 1 kB promoter upstream of translational start site with p-value from binomial distribution as in Chandran et al. 2009. aPlantCare database (Lescot et al., 2002); bPLACE datatabase (Higo et al., 1999).

TAIR Statistical cis-acting regulatory element motif analysis: LMD I/UI ratio 5 dpi Down-regulated genes

Motif aPLANT CARE (Arabidopsis motifs, unless specified) bPLACE p-value

ACACGT; ACGTGT ABRE, Box II, CellCycle-1b, G-box, GTGGC-motif, OBP-1 site, Unnamed_4, Z-motif, Chs-unit 1ABRE-like, ACGT 6.2E-06

CACGTG; CACGTG ABRE, Box II, CellCycle-1b, G-box, unnamed_4, Z-motif, Chs-unit 1ABRE-like, ACGT, G-box, Myc 1.1E-05

ACGTGG; CCACGT ABRE, Box II, CellCycle-1b, G-box, Unnamed_4, Z-motif, Chs-unit 1ABRE-like, ACGT 2.3E-05

CGTGGC; GCCACG ABRE, Box II, CAT-box, CellCycle-1b, G-box, GTGGC-motif, OBP-1 site, Unnamed_4, Z-motif, box SSORLIP1 8.0E-05

ACAATC; GATTGT ACA-motif, ATC-motif, I-box, LAMP element, ARR1-binding element 1.2E-04

AGGAGA; TCTCCT CellCycle-1b, Gap-box, I-box, Sbp-CMA1a, Sbp-CMA1c none 1.4E-04

CGTGTC; GACACG ABRE, C-repeat/DRE, CellCycle-1b, G-box, GTGGC-motif, Unnamed_4, Z-motifnone 1.4E-04

TATCCA; TGGATA ATC-motif, Box II, GA-motif, GT1-motif, Gap-box, I-box PHR1-binding, GATA box 1.9E-04

ACGCTA; TAGCGT I-Box none 2.3E-04

TACCTA; TAGGTA AC-I, Box I, C-repeat/DRE, DRE, GA-motif, Chs-unit 1 none 2.5E-04

CCACGC; GCGTGG ABRE, CellCycle-1b, G-box, GT1-motif, GTGGC-motif, Unnamed_4, Chs-unit 1none 3.9E-04

CATATA; TATATG Box I, Box II, GT1-motif, TATA-box, Z-motif, Chs-unit 1, Spb-CMA1aMYC 4.0E-04

CGTGGA; TCCACG ABRE, Box II, CellCycle-1b, G-box, NON-box, OCT, Unnamed_4, Chs-unit 1none 4.8E-04

ACCCTG; CAGGGT I-Box, Unnamed_1 none 5.4E-04

GACATC; GATGTC C-Box, C-repeat/DRE, CellCycle-1b, As1, Ocs-element none 5.9E-04

CACGTC; GACGTG ABRE, Box II, C-Box, C-repeat/DRE, CellCycle-1b, G-box, Unnamed_4, Z-motif, As1, Chs-unit 1ABRE-like, ACGT 6.1E-04

AGATTC; GAATCT AE-box, ATCT-motif, LAMP element ARR1-binding element 6.3E-04

TGTAAA; TTTACA TATA-box, Unnamed_1 none 6.3E-04

ATCGAG; CTCGAT GTGGC-motif, Gap-box, NON-box none 7.0E-04

GTTCAA; TTGAAC C-repeat/DRE, W box none 7.3E-04

GACCTA; TAGGTC AC-I, Box I, Chs-unit 1, Ocs-element none 8.4E-04

ATAAGA; TCTTAT ATCT-motif, Box II, GATA-motif, I-box, LAMP element, TATA-box, TCT-motif, Z-motif, Ocs-element, Sbp-CMA1anone 8.5E-04

AAGCTG, CAGCTT none none 9.2E-04

AAACCC; GGGTTT none none 9.5E-04

GACTCA; TGAGTC C-repeat/DRE none 9.7E-04

Performed on 1 kB promoter upstream of translational start site with p-value from binomial distribution. aPlantCare database (Lescot et al., 2002); bPLACE datatabase (Higo et al., 1999).

Annotation

Mdscan MotifaPLANT CARE (Arabidopsis motifs, unless specified) bPLACE p-value

Motif 1:

TGGGCC; GGCCCA C-repeat/DRE SORLIP, Site II element 2.5E-19


Motif 2:

AAACCC; GGGTTT none none <E-20

AAGCCC; GGGCTT Unnamed_1 none 9.9E-05

AATCCC; GGGATT ACA-motif, G-box, Unnamed_4 ARR1-binding element 4.9E-03

AACCCC; GGGGTT AC-II, CAAT-box, GT1-motif none 3.0E-02

AGACCC; GGGTCT JERE none 3.3E-02

AGGCCC; GGGCCT Unnamed_1 SORLIP 1.5E-13

AGTCCC; GGGACT C-repeat/DRE none 3.9E-03

AGCCCC; GGGGCT Box II, GCC box, Unnamed_1, box S none 2.1E-02

Motif 3:

ACCCGG; CCGGGT none none 6.3E-05

ATCCGG; CCGGAT OCT, DOCT none 3.7E-04

AACCGG; CCGGTT none none 1.0E-03

AGCCGG; CCGGCT GCC box none 5.6E-03

Motif 4:

GCGACG; CGTCGC ABRE, CellCycle-1b, G-box, NON-box, Unnamed_4 CGACG element (Oryza sativa) 2.3E-02

GTGACG; CGTCAC C-box, CellCycle-1b, G-box, Z-motif, Ocs-element ASF-1 binding site, GTGA motif (Nicotiana tabacum), TGAC-containing W-box of Myb and binding site of WRKY71 (Oryza sativa)2.2E-04

Motif 5:

CGGCGA; TCGCCG C-repeat/DRE, NON-box none 1.7E-02

CAGCGA; TCGCTG none none 4.7E-04

CGGCGG; CCGCCG none none 4.2E-02

CAGCGG; CCGCTG CellCycle-1b, Unnamed_1 none 3.8E-02

Performed on 1 kB promoter upstream of translational start site with p-value from binomial distribution as in Chandran et al. 2009. aPlantCare database (Lescot et al., 2002); bPLACE datatabase (Higo et al., 1999).

Annotation

Statistical cis-acting regulatory element motif analysis using motifs identified from Mdscan motif analysis: LMD I/UI

ratio 5 dpi Up-regulated genes

MDScan MotifaPLANT CARE (Arabidopsis motifs, unless specified) bPLACE p-value

Motif 1:

TGGGCC; GGCCCA C-repeat/DRE Site II element, SORLIP 1.2E-03


TGGGTC; GACCCA none none 1.1E-02

TGGGTT; AACCCA AC-II, Box I, C-repeat/DRE, CAAT-box, Chs-unit 1 SEF2 binding site (Glycine max) 3.9E-03

TAGGCC; GGCCTA C-repeat/DRE, Unnamed_1 none 2.9E-02

TAGGCT; AGCCTA Box I, Chs-unit 1, none 3.9E-02

TAGGTC; GACCTA AC-I, Box I, Chs-unit 1, Ocs-element none 8.4E-04

TAGGTT; AACCTA AC-I, AC-II, ATCT-motif, Box I, CAAT-box, Chs-unit 1 H-box (Phaseolus vulgaris) 3.5E-02

Motif 2:

CGGCGG; CCGCCG none none 2.1E-02

TGGTGG; CCACCA AC-I, AC-II, ACA-motif, Box I, CAAT-box, G-box, Chs-unit 1, Chs-unit 1 m1none 3.7E-02

TGGCGG; CCGCCA C-repeat/DRE, DRE none 4.6E-02

CGGTGG; CCACCG C-repeat/DRE none 1.8E-03

CGGCGA; TCGCCG C-repeat/DRE, NON-box none 9.7E-03

TGGTGA; TCACCA ACA-motif, CellCycle-1b, GT1-motif, Gap-box, Unnamed_1, Ocs-elementGTGA-motif (Nicotiana tabacum) 2.7E-02

TGGCGA; TCGCCA Box II, Gap-box, Ocs-element none 3.2E-02

CGGTGA; TCACCG CellCycle-1b GTGA-motif (Nicotiana tabacum) 9.5E-03

Motif 3:

CACGTG; CACGTG ABRE, Box II, CellCycle-1b, G-box, unnamed_4, Z-motif, Chs-unit 1ABRE-like, ACGT, G-box, E-box of napA storage protein (Brassica napus), Myc1.1E-05

Motif 4:

GCAGCG; CGCTGC none none 3.0E-02

Motif 5:

CGTCGC; GCGACG ABRE, CellCycle-1b, G-box, NON-box, Unnamed_4 CGACG element (Oryza sativa) 3.0E-02

CGTCTC; GAGACG ABRE, CellCycle-1b, G-box, Z-motif SURE 4.0E-02

Performed on 1 kB promoter upstream of translational start site with p-value from binomial distribution. aPlantCare database (Lescot et al., 2002); bPLACE datatabase (Higo et al., 1999).

Annotation

TAIR Statistical cis-acting regulatory element motif analysis using motifs identified from Mdscan motif

analysis: LMD I/UI ratio 5 dpi Down-regulated genes

Supplemental Information Part 3. Process network construction for Photosynthesis and

Cold/drought response.

A. Photosynthesis Network

Photosynthesis-associated genes were down-regulated at the PM infection site [1]). Predicted

site-specific response network associated with (A) Photosynthesis is shown in Fig 3C with gene

list below. TXFs with known roles in a process are in filled boxes and are connected to other

TXFs and genes in functional categories by lines with arrows (positive regulation) or bars

(negative regulation) at end. TXFs in open boxes were identified as highly co-expressed, as

indicated by dashed lines. Tables detail genes in above functional categories. Red= enhanced

expression and green= decreased expression with !2-fold change and p " 0.05; Numbers in black

did not meet our selection criteria; I= infected, UI= uninfected.

The MYB-like TF has been shown to interact in vitro with the hexokinase I (HXK1) nuclear

complex involved in glucose-mediated repression of chlorophyll a/b binding genes [2]), which

we found had reduced expression at the infection site. Thirty-eight of the top 300 genes

correlated with At3g11280 expression exhibited altered (almost exclusively induced) expression

at the PM infection site, including the bHLH transcription factor At4g14410. We also identified

a known positive transcriptional regulator of chlorophyll (Chl) synthesis, Sigma factor B (SIGB)

[3]), with reduced expression at the PM infection site. Sixty-three of the top 300 genes

correlated with SIGB exhibited reduced expression at the site of infection, including numerous

genes encoding Chl biosynthetic proteins and plastidic ribosomal proteins. For simplicity, our

photosynthesis network does not include three additional photosynthesis-associated TFs:

phytochrome interacting factor 5 (PIF5), golden2-like 1 (GLK1) and constans like 5 (COL5).

Co-expression analyses found these three TFS to be highly co-regulated and to be associated

with decreased expression of photosynthesis-associated genes at the PM infection site. Though

specific cis-acting regulatory elements bound by MYB-like At3g11280 and SigB have not been

identified, we observed an enrichment of the G-box motif bound by G-Box binding TFs

including GLK1 [4] and PIFs [5].

1. Thimm, O., et al., MAPMAN: a user-driven tool to display genomics data sets onto diagrams of metabolic

pathways and other biological processes. Plant J, 2004. 37(6): p. 914-39.

2. Cho, Y.H., S.D. Yoo, and J. Sheen, Regulatory functions of nuclear hexokinase1 complex in glucose

signaling. Cell, 2006. 127(3): p. 579-89.

3. Kanamaru, K., et al., An Arabidopsis sigma factor (SIG2)-dependent expression of plastid-encoded tRNAs

in chloroplasts. Plant Cell Physiol, 2001. 42(10): p. 1034-43.

4. Waters, M. T. et al. GLK Transcription Factors Coordinate Expression of the Photosynthetic Apparatus in

Arabidopsis. Plant Cell 21, 1109-28 (2009).

5. Castillon, A., Shen, H. & Huq, E. Phytochrome Interacting Factors: central players in phytochrome-

mediated light signaling networks. Trends Plant Sci 12, 514-21 (2007).

SI Part 3: Process network construction

A. Process: Photosynthesis

Regulator

MYB-like At3g11280 Locus Gene Description (38 genes)

LMD 5 dpi

I/UI ratio

AT4G14410 basic helix-loop-helix (bHLH) family protein 3.7

AT2G02930 glutathione S-transferase, putative 102.7

AT1G14870 expressed protein 87.7

AT1G05010 1-aminocyclopropane-1-carboxylate oxidase / ACC oxidase 34.9

AT1G35720 annexin 1 (ANN1) 27.9

AT1G10340 ankyrin repeat family protein 25.4

AT3G01290 band 7 family protein 24.9

AT1G13110 cytochrome P450 71B7 (CYP71B7) 21.3

AT3G51920 calmodulin-9 (CAM9) 19.2

AT3G13790 beta-fructosidase (BFRUCT1) / beta-fructofuranosidase / cell wall invertase16.5

AT3G45860 receptor-like protein kinase, putative 12.7

AT5G60950 phytochelatin synthetase-related 12.3

AT3G63080 glutathione peroxidase, putative 9.8


AT4G20110 vacuolar sorting receptor, putative 8.2

AT4G26970 aconitate hydratase, cytoplasmic, putative / citrate hydro-lyase/aconitase, puta7.1



AT1G75130 cytochrome P450 family protein 6.0

AT5G66040 senescence-associated family protein 5.3

AT1G67940 ABC transporter family protein 4.9

AT3G27890 NADPH-dependent FMN reductase family protein 4.8

AT2G39550 geranylgeranyl transferase type I beta subunit (GGT-IB) 4.8

AT4G29350 profilin 2 (PRO2) (PFN2) (PRF2) 4.4

AT1G79380 copine-related 4.3

AT1G06650 2-oxoglutarate-dependent dioxygenase, putative 4.0



AT5G53550 transporter, putative 3.5

AT1G28580 GDSL-motif lipase, putative 3.2

AT1G07610 metallothionein-like protein 1C (MT-1C) 3.0

AT2G31880 leucine-rich repeat transmembrane protein kinase, putative 3.0

AT1G64850 calcium-binding EF hand family protein 2.6

AT2G17130 isocitrate dehydrogenase subunit 2 / NAD+ isocitrate dehydrogenase subunit 22.2

AT4G32150 synaptobrevin family protein 2.0

AT3G05900 neurofilament protein-related 0.4

AT5G20470 myosin, putative 0.4

AT5G44020 acid phosphatase class B family protein 0.2

Co-regulation analysis: Intersect of

ATTED-II top 300 correlated genes with specific regulator and LMD 5 dpi I/UI data

(LMD dataset)

Locus Gene Description

LMD 5 dpi

I/UI ratio

AT1G15820 chlorophyll A-B binding protein 0.4

AT1G19150 chlorophyll A-B binding protein putative / LHCI type II 0.1

AT1G29910 chlorophyll A-B binding protein 2 chloroplast / LHCII type I 0.4

AT1G44575 photosystem II 22kDa protein 0.3

AT3G08940 chlorophyll A-B binding protein (LHCB4.2) 0.5

AT3G27690 chlorophyll A-B binding protein (LHCB2:4) 0.1

AT4G17600 lil3 protein 0.2

AT5G01530 chlorophyll A-B binding protein CP29 (LHCB4) 0.5

AT5G54270 chlorophyll A-B binding protein / LHCII type III (LHCB3) 0.5

Reference: Cho et al. (2006) Cell 127, 579-89

Known targets of MYB-like in LMD dataset

Regulator

SIGB (At1g08540) AGI Gene Title (63 genes)

LMD 5 dpi

I/UI ratio

AT5G57030 lycopene epsilon cyclase 5.0

AT3G16000 matrix-localized MAR DNA-binding protein-related 0.5

AT4G00370 sugar transporter family protein 0.5

AT3G63490 ribosomal protein L1 family protein 0.5

AT2G27680 aldo/keto reductase family protein 0.5

AT2G45770 signal recognition particle receptor protein, chloroplast (FTSY) 0.4

AT1G08520 magnesium-chelatase subunit chlD, chloroplast, putative / Mg-protoporphyrin IX c0.4


AT1G64510 ribosomal protein S6 family protein 0.4


AT4G27600 pfkB-type carbohydrate kinase family protein 0.4

AT4G02790 GTP-binding family protein 0.4





AT1G07320 50S ribosomal protein L4, chloroplast (CL4) 0.3

AT1G03630 protochlorophyllide reductase C, chloroplast / PCR C / NADPH-protochlorophyllide0.3


AT1G74970 ribosomal protein S9 (RPS9) 0.3


AT5G55220 trigger factor type chaperone family protein 0.3

AT3G19480 D-3-phosphoglycerate dehydrogenase, putative / 3-PGDH, putative 0.3

AT5G35170 adenylate kinase family protein 0.3

AT5G14910 heavy-metal-associated domain-containing protein 0.3




AT5G54600 50S ribosomal protein L24, chloroplast (CL24) 0.3

AT3G01480 peptidyl-prolyl cis-trans isomerase, putative / cyclophilin, putative / rotamase0.3


AT5G36170 peptide chain release factor, putative 0.3

AT2G24060 translation initiation factor 3 (IF-3) family protein 0.3






AT4G09650 ATP synthase delta chain, chloroplast, putative / H(+)-transporting two-sector A0.2

Co-regulation analysis: Intersect of ATTED-II top 300 correlated genes with

specific regulator and LMD 5 dpi I/UI data (LMD dataset)

AT1G71500 Rieske (2Fe-2S) domain-containing protein 0.2

AT5G08650 GTP-binding protein LepA, putative 0.2


AT3G23700 S1 RNA-binding domain-containing protein 0.2

AT5G45680 FK506-binding protein 1 (FKBP13) 0.2

AT4G29060 elongation factor Ts family protein 0.2

AT3G62910 peptide chain release factor, putative 0.2


AT1G51110 plastid-lipid associated protein PAP / fibrillin family protein 0.2


AT4G17600 lil3 protein 0.2


AT5G14660 peptide deformylase, chloroplast / polypeptide deformylase 1B (PDF1B)0.2

AT5G03940 signal recognition particle 54 kDa protein, chloroplast / 54 chloroplast protein0.2

AT5G23120 photosystem II stability/assembly factor, chloroplast (HCF136) 0.2


AT3G63140 mRNA-binding protein, putative 0.2


AT3G16250 ferredoxin-related 0.1

AT4G25080 magnesium-protoporphyrin O-methyltransferase, putative / magnesium-protoporphyri0.1

AT1G19150 chlorophyll A-B binding protein, putative / LHCI type II, putative 0.1



AT2G18710 preprotein translocase secY subunit, chloroplast (CpSecY) 0.1

Regulator

PIF5 (At3g59060) Locus Gene Description

LMD 5 dpi

I/UI ratio

At2g20570 GLK1,GPRI1 (GOLDEN2-LIKE 1) 3.6

At5g57660 zinc finger family protein CONSTANS-like 5 (COL5) 2.7

At1g63880 disease resistance protein (TIR-NBS-LRR class), putative 2.1

At1g67860 unknown protein 3.0

At5g19140 auxin/aluminum-responsive protein, putative 3.2



At3g26280 CYP71B4,CYP71B4 (cytochrome P450, family 71, subfamily B, polypeptide 4); oxygen binding6.1


At3g51920 CAM9,CAM9 (CALMODULIN 9); calcium ion binding 19.2

At2g21330 fructose-bisphosphate aldolase,fructose-bisphosphate aldolase, putative0.3

At1g58290 HEMA1,HEMA1; glutamyl-tRNA reductase 0.3

At3g59400 GUN4,GUN4 (Genomes uncoupled 4) 0.4

At3g27690 LHCB2:4,LHCB2:4 (Photosystem II light harvesting complex gene 2.3); chlorophyll binding0.1

At1g15820 LHCB6,LHCB6 (LIGHT HARVESTING COMPLEX PSII); chlorophyll binding0.4

At3g50820 PSBO2,PSBO-2,PSBO-2/PSBO2 (PHOTOSYSTEM II SUBUNIT O-2); oxygen evolving0.5

At3g08940 LHCB4.2,LHCB4.2 (LIGHT HARVESTING COMPLEX PSII),LHCB4.2 (LIGHT HARVESTING COMPLEX PSII); chlorophyll binding0.5

At5g01530 chlorophyll A-B binding protein CP29 (LHCB4) 0.5

At5g54270 LHCB3,LHCB3 (LIGHT-HARVESTING CHLOROPHYLL BINDING PROTEIN 3)0.5

At3g46780 PTAC16,PTAC16 (PLASTID TRANSCRIPTIONALLY ACTIVE18) 0.1

At4g35250 vestitone reductase-related 0.2

At2g42220 rhodanese-like domain-containing protein 0.2

At3g61080 fructosamine kinase family protein 0.2


At1g57770 amine oxidase family 0.2

At5g58870 FTSH9,FTSH9 (FtsH protease 9); ATP-dependent peptidase/ ATPase/ metallopeptidase0.2

At5g08650 GTP-binding protein LepA, putative 0.2

At5g19940 plastid-lipid associated protein PAP-related / fibrillin-related 0.3

At2g46820 TMP14,TMP14 (THYLAKOID MEMBRANE PHOSPHOPROTEIN OF 14 KDA)0.3



At1g64720 CP5 0.3


At3g19480 D-3-phosphoglycerate dehydrogenase, putative / 3-PGDH, putative 0.3

At2g30600 BTB/POZ domain-containing protein,protein binding 0.3

At2g29670 binding 0.3

At4g22890 PGR5-LIKE A,unknown protein 0.4



At5g04140 GLU1,GLU1 (FERREDOXIN-DEPENDENT GLUTAMATE SYNTHASE 1)0.4

At1g79790 haloacid dehalogenase-like hydrolase family protein 0.4

At2g18700 ATTPS11,ATTPS11 (Arabidopsis thaliana trehalose phosphatase/synthase 11); transferase, transferring glycosyl groups0.5





p-value Term Genes

1.0E-09 photosynthesis At5g54270|At5g01530|

At3g50820|At1g15820|

At2g46820|At4g22890|

At3g08940|At3g27690

1.7E-04 photosynthesis, light reaction At3g50820|At2g46820|

At3g08940|At4g22890

2.8E-04 photosynthetic electron transport chain At3g50820|At2g46820|

At4g22890

1.6E-03 photosynthetic electron transport in photosystem I At2g46820|At4g22890

2.8E-03 electron transport chain At3g50820|At2g46820|

At4g22890

2.8E-03 oxidation reduction At3g50820|At2g46820|

At4g22890

4.8E-03 generation of precursor metabolites and energy At3g50820|At2g46820|

At3g08940|At4g22890

assessed using BioMaps in Virtual Plant

Enriched functional processes in "Intersect of PIF5 top 300 correlated genes with LMD dataset"

Regulator

GLK1 (At2g20570) Locus Gene Description

LMD 5 dpi

I/UI ratio

At1g68520 COL6, zinc finger (B-box type) family protein 3.0

At3g59060 PIL6,PIL6 (PHYTOCHROME-INTERACTING FACTOR 5); DNA binding / transcription factor2.1

At3g45860 receptor-like protein kinase, putative 12.7

At2g41090 calmodulin-like calcium-binding protein, 22 kDa (CaBP-22) 8.5

At2g05520 GRP-3,GRP-3 (GLYCINE-RICH PROTEIN 3),unknown protein 6.4



At1g21270 WAK2,WAK2 (wall-associated kinase 2); protein serine/threonine kinase2.6

At1g63880 disease resistance protein (TIR-NBS-LRR class), putative 2.1


At3g50820 PSBO2,PSBO-2,PSBO-2/PSBO2 (PHOTOSYSTEM II SUBUNIT O-2); oxygen evolving0.5


At2g27680 aldo/keto reductase family protein 0.5


At1g19150 LHCA6,LHCA6 (Photosystem I light harvesting complex gene 6); chlorophyll binding0.4

At1g14150 oxygen evolving enhancer 3 (PsbQ) family protein 0.4



At5g04140 GLU1,GLU1 (FERREDOXIN-DEPENDENT GLUTAMATE SYNTHASE 1)0.4


At1g74880 NDH-O,NDH-O (NAD(P)H:PLASTOQUINONE DEHYDROGENASE COMPLEX SUBUNIT O)0.4


At3g19480 D-3-phosphoglycerate dehydrogenase, putative / 3-PGDH, putative 0.3

At2g47910 CRR6,CRR6 (CHLORORESPIRATORY REDUCTION 6) 0.3





At3g08920 rhodanese-like domain-containing protein 0.3

At1g35420 dienelactone hydrolase family protein 0.3

At5g01920 STN8,STN8 (state transition 8); kinase 0.2

At3g63140 mRNA-binding protein, putative 0.2



At3g61080 fructosamine kinase family protein 0.2

At1g51110 plastid-lipid associated protein PAP / fibrillin family protein 0.2

At5g08650 GTP-binding protein LepA, putative 0.2

At3g54050 fructose-1,6-bisphosphatase, putative / D-fructose-1,6-bisphosphate 1-phosphohydrolase, putative / FBPase, putative0.1


At3g46780 PTAC16,PTAC16 (PLASTID TRANSCRIPTIONALLY ACTIVE18) 0.1



p-value Term Genes


At3g50820|At1g14150|

At3g08940

4.3E-04 photosystem II stabilization At5g01920|At3g50820

4.6E-03 photosynthesis, light reaction At5g01920|At3g50820

|At3g08940

4.7E-03 regulation of photosynthesis At5g01920|At3g50820

4.7E-03 regulation of photosynthesis, light reaction At5g01920|At3g50820

4.7E-03 regulation of generation of precursor metabolites and energy At5g01920|At3g50820

4.7E-03 regulation of generation of precursor metabolites and energy At5g01920|At3g50820

5.6E-03 regulation of photosynthesis, light reaction At5g01920|At3g50820

6.5E-03 regulation of photosynthesis At5g01920|At3g50820

Assessed using BioMaps in Virtual Plant.

Enriched functional processes in "Intersect of GLK1 top 300 correlated genes with LMD dataset"

Regulator

COL5 (At5g57660) Locus Gene Description

LMD 5 dpi

I/UI ratio

At5g57660 COL5, zinc finger (B-box type) family protein 2.7

At3g59060 PIL6,PIL6 (PHYTOCHROME-INTERACTING FACTOR 5); DNA binding / transcription factor2.1

At2g39400 hydrolase, alpha/beta fold family protein 33.8


At3g51920 CAM9,CAM9 (CALMODULIN 9); calcium ion binding 19.2



At4g30270 MERI5B,MERI5B (MERISTEM-5); hydrolase, acting on glycosyl bonds5.0


At4g21810 DER2.1,Der1-like family protein / degradation in the ER-like family protein3.3

At5g19140 auxin/aluminum-responsive protein, putative 3.2

At5g63800 BGAL6,BGAL6 (beta-galactosidase 6); beta-galactosidase 3.2


At5g54270 LHCB3,LHCB3 (LIGHT-HARVESTING CHLOROPHYLL BINDING PROTEIN 3)0.5


At3g47340 ASN1,ASN1 (DARK INDUCIBLE 6) 0.5

At2g18700 ATTPS11,ATTPS11 (Arabidopsis thaliana trehalose phosphatase/synthase 11); transferase, transferring glycosyl groups0.5

At1g15820 LHCB6,LHCB6 (LIGHT HARVESTING COMPLEX PSII); chlorophyll binding0.4




At1g58290 HEMA1,HEMA1; glutamyl-tRNA reductase 0.3


At1g64720 CP5 0.3

At2g29670 binding 0.3

At2g30600 BTB/POZ domain-containing protein,protein binding 0.3

At3g61060 ATPP2-A13 0.2

At3g27690 LHCB2:4,LHCB2:4 (Photosystem II light harvesting complex gene 2.3); chlorophyll binding0.1

At1g73920 lipase family protein 0.1



p-value Term Genes


At3g08940|At3g27690

Assessed using BioMaps in Virtual Plant

Enriched functional processes in "Intersect of COL5 top 300 correlated genes with LMD dataset"

TAIR Statistical cis-acting regulatory element motif analysis: Photosynthesis-related genes (down-regulated)

Motif aPLANT CARE (Arabidopsis motifs, unless specified) bPLACE

Query

Set Genomic Set Query Set Genomic Set p-value

Chlorophyll a/b binding proteins

CCGAGG; CCTCGGCellCycle-1b, G-box, GC-repeat (O. sativa), CellCycle-1a (T. aestivum), GC-motif (Z.

mays) None 5 3337 5/9 2844/33282 4.0E-04

Chlorophyll biosynthesis

TCGTCA; TGACGA C-box, CellCycle-1b, Chs Unit1, Ocs-element, G-box (B. napus) None 9 10924 7/9 8986/33282 2.0E-03

Calvin cycle genes

CTCCTC; GAGGAG GT1-Motif, CellCycle-1b, Sbp-CMA1c, TCA-element (B. oleracea), AUXRE (G. max),

Chs-unit1 (H. vulgare), I-box (L. esculentum) None 13 15683 10/12 10808/33282 3.9E-04

CACAGG; CCTGTGCellCycle-1b, GTGGC-motif, GATA-box (D. carota), CE1 (H. vulgare), G-box (H.

vulgare) None 8 3899 6/12 3596/33282 7.4E-04

Performed on 1 kB promoter upstream of translational start site with p-value from binomial distribution.

aPlantCare database (Lescot et al., 2002); bPLACE datatabase (Higo et al., 1999).

No. of motifs No. of promoters with motifAnnotation

SI Part 3B. Cold/drought response network.

Repression of abscisic acid (ABA) biosynthesis and dehydration-responsive gene expression is

also associated with the PM penetration resistance of non-host plants [1]. We found genes

responsive to cold/dehydration stress exhibited a statistically significant change in gene

expression at the PM infection site (p-value = 7E-06) using BioMaps in Virtual Plant [2]. Five

TFs associated with cold/drought tolerance, but with no previous reported functional role in a

PM interaction, exhibited altered expression at the site of PM infection. In Fig. 3D (manuscript)

with gene lists included in SI Part 3 (page 1), we integrate four of these into a model depicting

the down-regulation of cold/dehydration responsive genes at the site of infection.

DREB1A/CBF3 is a cold inducible-specific transcription factor, which regulates expression of

target genes by binding ABRE and/or DRE cis-acting promoter elements, resulting in enhanced

tolerance of cold and dehydration stress [3, 4]. DREB1A direct targets include KIN1, ERD10,

HVA22d and COR47 [4], all of which display reduced expression at the site of PM infection, and

ABRE and DRE/C-repeat cis-acting elements were enriched in the promoters of these

cold/dehydration associated genes. Two known negative regulators of DREB1A, MYB15 [5] and

ZAT12/RHL41 [6], were induced at the PM infection site by 7.6- and 6.3- fold, respectively,

consistent with the observed decreased expression of DREB1A. Furthermore, expression of

NFXL1, a positive regulator of osmotic stress tolerance [7] was reduced at the PM infection site

with co-regulated genes with altered PM expression associated with response to cold. We then

identified an additional 7 TFs whose expression was highly correlated with DREB1A, MYB15,

ZAT12 and/or NFXL1 and exhibited altered PM site-specific expression. These included ERF2,

a known positive regulator of JA-mediated defensive responses [8]. Furthermore, co-regulated

genes with MYB15 and ZAT12 with increased expression at the infection site were statistically

enriched in JA-mediated signaling and have been shown to be induced in response to methyl JA

[9]).

1. Jensen, M.K., et al., Transcriptional regulation by an NAC (NAM-ATAF1,2-CUC2) transcription factor

attenuates ABA signalling for efficient basal defence towards Blumeria graminis f. sp. hordei in

Arabidopsis. Plant J, 2008. 56(6): p. 867-80.

2. Katari, M.S., et al., VirtualPlant: A software platform for integrating, visualizing and analyzing genomic

data. 2009.

3. Liu, Q., et al., Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA binding domain

separate two cellular signal transduction pathways in drought- and low-temperature-responsive gene

expression, respectively, in Arabidopsis. Plant Cell, 1998. 10(8): p. 1391-406.

4. Maruyama, K., et al., Identification of cold-inducible downstream genes of the Arabidopsis DREB1A/CBF3

transcriptional factor using two microarray systems. Plant J, 2004. 38(6): p. 982-93.

5. Agarwal, M., et al., A R2R3 type MYB transcription factor is involved in the cold regulation of CBF genes

and in acquired freezing tolerance. J Biol Chem, 2006. 281(49): p. 37636-45.

6. Vogel, J.T., et al., Roles of the CBF2 and ZAT12 transcription factors in configuring the low temperature

transcriptome of Arabidopsis. Plant J, 2005. 41(2): p. 195-211.

7. Lisso, J., T. Altmann, and C. Mussig, The AtNFXL1 gene encodes a NF-X1 type zinc finger protein

required for growth under salt stress. FEBS Lett, 2006. 580(20): p. 4851-6.

8. McGrath, K.C., et al., Repressor- and activator-type ethylene response factors functioning in jasmonate

signaling and disease resistance identified via a genome-wide screen of Arabidopsis transcription factor

gene expression. Plant Physiol, 2005. 139(2): p. 949-59.

9. Jung, C., et al., Microarray-based screening of jasmonate-responsive genes in Arabidopsis thaliana. Plant

Cell Rep, 2007. 26(7): p. 1053-63.

SI Part 3: Process network construction

B. Process: Cold/drought tolerance

Regulator

DREB1A (At4g25480) AGI Gene Description (28 genes)

LMD 5 dpi

I/UI ratio

AT5G59820 ZAT12 6.3

AT4G17230 Scarecrow-like transcription factor 13 (SCL13) 3.6

AT2G46400 WRKY46 2.2

AT1G67970 HSF5 heat shock transcription factor 2.1

AT4G23040 UBX domain-containing protein 3.3

AT3G12980 histone acetyltransferase 5 (HAC5) 3.0

AT1G12710 F-box family protein / SKP1 interacting partner 3-related 2.7

AT1G67360 rubber elongation factor (REF) family protein 2.5

AT5G11110 sucrose-phosphate synthase, putative 2.1


AT3G46620 zinc finger (C3HC4-type RING finger) family protein 2.1


AT2G43500 RWP-RK domain-containing protein 0.5

AT1G56300 DNAJ heat shock N-terminal domain-containing protein 0.5


AT3G05030 sodium proton exchanger, putative (NHX2) 0.4

AT3G56880 VQ motif-containing protein 0.4

AT5G46710 zinc-binding family protein 0.4


AT5G63330 DNA-binding bromodomain-containing protein 0.3

AT1G20450 dehydrin (ERD10) 0.3

AT1G20440 dehydrin (COR47) 0.2

AT4G36010 pathogenesis-related thaumatin family protein 0.1

AT5G52310 low-temperature-responsive protein 78 (LTI78) / desiccation-responsive protein 2 0.1

AT5G62360 invertase/pectin methylesterase inhibitor family protein 0.1

AT1G29395 stress-responsive protein, putative 0.1

AT4G18280 glycine-rich cell wall protein-related 0.0

AT4G24960 ABA-responsive protein (HVA22d) 0.0

Co-regulation analysis: Intersect of ATTED-II top 300 correlated genes with specific regulator

and LMD 5 dpi I/UI data (LMD dataset)


LMD 5 dpi

I/UI ratio

At2g43510 trypsin inhibitor, putative 12.2

At4g38580 heavy-metal-associated domain-containing protein / copper chaperone (CCH)-relate9.6

At5g17460 expressed protein 0.5

At5g15960 KIN1 0.4

At2g28900 mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family0.4

At1g20440 COR47 0.2

At1g20450 ERD10 0.3

At4g24960 ABA-responsive protein (HVA22d) 0.0

At5g52310 LTI78 (low-temperature-responsive protein 78) 0.1

Reference: Maruyama et al. (2004) Plant J 38, 982-993

Known targets of DREB1A regulator in LMD dataset

Regulator

ZAT12/RHL41 (At5g59820)Locus Gene Description (35 genes)

LMD 5 dpi

I/UI ratio

AT3G23250 MYB15 7.6


AT2G46400 WRKY46 2.2

AT1G42990 bZIP60 2.1

AT5G22250 CCR4-NOT transcription complex protein, putative 20.0

AT3G02840 immediate-early fungal elicitor family protein 17.6




AT2G35930 U-box domain-containing protein 11.3




AT1G72520 lipoxygenase, putative 7.4

AT1G28480 glutaredoxin family protein 5.5


AT3G22370 alternative oxidase 1a, mitochondrial (AOX1A) 4.9

AT2G05940 protein kinase, putative 3.9

AT2G41410 calmodulin, putative 3.7

AT3G52400 syntaxin, putative (SYP122) 3.5

AT5G26030 ferrochelatase I 3.5

AT4G28460 hypothetical protein 3.3


AT4G30490 AFG1-like ATPase family protein 3.0

AT3G10640 SNF7 family protein 2.9

AT4G20830 FAD-binding domain-containing protein 2.6

AT3G13310 DNAJ heat shock N-terminal domain-containing protein 2.5


AT2G23810 senescence-associated family protein 2.4

AT5G20230 plastocyanin-like domain-containing protein 2.3




AT3G56880 VQ motif-containing protein 0.4

AT5G46710 zinc-binding family protein 0.4




LMD 5 dpi

I/UI ratio

AT4G25480 DREB1A (CBF3) 0.3

AT1G56650 MYB75 0.3



AT2G02930 glutathione S-transferase, putative 102.7

AT2G14610 pathogenesis-related protein 1 (PR-1) 137.2

AT2G17740 DC1 domain-containing protein 3.3

AT2G43510 trypsin inhibitor, putative 12.2

AT3G51660 macrophage migration inhibitory factor family protein / MIF family protein10.8

AT3G62150 multidrug resistant (MDR) ABC transporter, putative 3.9

AT4G23260 protein kinase family protein 2.7


AT4G33050 calmodulin-binding family protein 14.9

AT5G10760 aspartyl protease family protein 13.7


Reference: Vogel et al. (2005) Plant J 41, 195-211

Known targets of ZAT12 regulator in LMD dataset

Regulator

MYB15 (At3g23250) Locus Gene Description (37 genes)

LMD 5 dpi

I/UI ratio

AT5G59820 ZAT12 6.3


AT5G47220 ERF2 3.5

AT5G24110 WRKY30 9.7

AT2G46400 WRKY46 2.2

AT4G31800 WRKY18 0.3

AT5G22250 CCR4-NOT transcription complex protein, putative 20.0

AT3G02840 immediate-early fungal elicitor family protein 17.6


AT1G16670 protein kinase family protein 14.5






AT2G35930 U-box domain-containing protein 11.3



AT4G39830 L-ascorbate oxidase, putative 6.9

AT1G28480 glutaredoxin family protein 5.5


AT5G26920 calmodulin-binding protein 4.5

AT4G36030 armadillo/beta-catenin repeat family protein 4.0

AT4G39640 gamma-glutamyltranspeptidase family protein 3.9

AT2G05940 protein kinase, putative 3.9

AT5G26030 ferrochelatase I 3.5



AT4G20830 FAD-binding domain-containing protein 2.6





AT5G66640 LIM domain-containing protein-related 2.0

AT3G21070 ATP-NAD kinase family protein 0.5

AT5G42650 allene oxide synthase (AOS) / hydroperoxide dehydrase / cytochrome P450 74A (CYP0.3

AT4G39890 Ras-related GTP-binding family protein 0.1

Co-regulation analysis: Intersect of ATTED-II top 300 correlated genes with specific

regulator and LMD 5 dpi I/UI data (LMD dataset)

p-value Term Genes

0.00084 jasmonic acid mediated signaling pathway At3g52400|At1g28480|At5g47220

0.00106 response to chemical stimulus At1g42990|At3g23250|At1g28480|At4g39640|At5g47220|At3g52400|At1g63840|At5g20230|At5g59820|At5g26030

0.00388 response to jasmonic acid stimulus At3g23250|At3g52400|At1g28480|At5g47220

0.00723 response to stress At1g42990|At3g23250|At3g22370|At4g39640|At5g47220|At3g52400|At5g20230|At1g72520|At5g59820|At5g26030

Identification of enriched functional processes using Biomaps (Virtual plant)

Enriched functional processes in "Intersect of ZAT12 and MYB15 300 correlated genes with LMD up-regulated genes (5 dpi I/UI ratio)"

Regulator

NFXL1 (At1g10170) Locus Gene Description (12 genes)

LMD 5 dpi

I/UI ratio

At1g42990 ATBZIP60 transcription factor 2.1

At5g59820 ZAT12/RHL41 6.3

At3g22370 AOX1A,AOX1A (alternative oxidase 1A); alternative oxidase 4.9


At3g12980 HAC5,ATHPCAT4,histone acetyltransferase 5 (HAC5) 3.0


At2g43500 RWP-RK domain-containing protein 0.5

At1g67580 protein kinase family protein 0.4

At4g03430 STA1,EMB2770,STA1 (STABILIZED1); RNA splicing factor, transesterification mechanism0.3

At4g33905 peroxisomal membrane protein 22 kDa, putative 0.2


At2g42270 U5 small nuclear ribonucleoprotein helicase, putative 0.1



p-value Term

0.00109 response to cold At4g03430|At3g22370|At5g59820

0.00376 response to temperature stimulus At4g03430|At3g22370|At5g59820

Identification of enriched functional processes using Biomaps (Virtual plant) in the

following gene list: Intersect of NFXL1 top 300 correlated genes with LMD dataset

Genes

TAIR Statistical cis-acting regulatory element motif analysis: Cold/dehydration-responsive genes

MotifaPLANT CARE (Arabidopsis motifs, unless specified) bPLACE

Query

Set

Genomic

Set Query Set Genomic Set p-value

GTGGGA; TCCCAC Box I, CellCycle-1b, G-box, MSA-like (C. roseus) None 14 8758 14/23 7513/33282 7.3E-05

GACTCA; TGAGTC C-repeat/DRE None 21 11161 15/23 9238/33282 1.6E-04

ACGTGG; CCACGTH-box (A. majus), GT1-motif (A. sativa), RE1 (A. sativa), ABRE, Box I, CellCycle-1b None 19 9133 12/23 6993/33282 7.5E-04

Up-regulated genes

GCCCAA; TTGGGC CAAT-box (D. carota), Alpha4 (G. max), P-box (P. sativum) None 23 13797 15/22 9748/33282 1.5E-04

ACTTGA; TCAAGT H-box (A. majus), GT1-motif (A. sativa), C-repeat/DRE, HSE (B. oleracea) None 3 24000 3/22 16550/33282 4.0E-04

GGCCCA; TGGGCC C-repeat/DRE, Alpha4 (G. max), Box I (H. vulgare) None 25 12539 13/22 8218/33282 4.9E-04

Performed on 1 kB promoter upstream of translational start site with p-value from binomial distribution.

aPlantCare database (Lescot et al., 2002); bPLACE datatabase (Higo et al., 1999).

No. of motifs No. of promoters with motif

Down-regulated genes

Annotation

Motif Element Query Set

Genomic

Set p-value*

YCYAACGGYY Mitosis specific activator (MSA) element 57 646 0.013

* based on a Poisson model

For Figure 4G (above), Putative targets of MYB3R4 were identified as mitosis associated genes from (1) and/or

Arabidopsis best hits (expect values <E-10) to tobacco genes with enhanced expression when hyperactivated

NtMYBA2!C was overexpressed in tobacco cells (2) that exhibited altered expression at the PM infection site

and contain the MSA core element AACGG in the 500 bp upstream promoter. Red= enhanced expression,

Green= decreased expression. Values in black fell just below our stringent selection criteria

(2-fold change in expression and p<=0.05).

References

1. Menges, M., de Jager, S. M., Gruissem, W. & Murray, J. A. (2005) Global analysis of the core cell cycle regulators

of Arabidopsis identifies novel genes, reveals multiple and highly specific profiles of expression and provides a coherent

model for plant cell cycle control. Plant J 41, 546-66.

2. Kato, K. et al. (2009) Preferential up-regulation of G2/M phase-specific genes by overexpression of the

hyperactive form of NtmybA2 lacking its negative regulation domain in tobacco BY-2 cells. Plant Physiol 149, 1945-57.

No. of motifs

MSA element is enriched in promoters of genes with altered expression at the PM infection site. cis-acting

regulatory element motif analysis on LMD I /UI (5 dpi) dataset:

SI Part 4. Powdery mildew infection of WT and myb3r4 mutants

Text: Detailed Experimental Design and Methods (supplement to manuscript)

Figure S4A. Uninfected 4 week old WT and myb3r4 plants

Figure S4B. myb3r4 mutants exhibit reduced visible PM growth and reproduction

Figure S4C. PM-infected WT and myb3r4 mutants do not exhibit cell death

Figure S4D. Endoreduplication occurs at site of PM infection not distal to infection

Figure S4E. Ploidy correlates with nuclear size.

SI Part 4 Text: Materials and Methods

Plant lines, growth conditions and powdery mildew infection. Arabidopsis thaliana ecotype

Columbia-0 (Col-0), and mybr3r4 mutants in the Col-0 background were grown, evenly spaced

in boxes containing Metro mix 200 (Scotts Sierra Horticultural Products; Marysville, OH) in

Percival AR66L growth chambers at 22ºC, 70% RH and a 12 h photoperiod with

photosynthetically active radiation = 180 !mol m-2

s-1

. For direct comparisons of mutant vs. WT,

mutant and WT plants were alternated in the same box. Seeds for homozygous myb3r4-1

(SALK_059819c) and myb3r4-3 (SALK_116974c) T-DNA insertion lines were obtained from

the Arabidopsis Biological Resource Center (The Ohio State University) (1). myb3r4-1 was

previously characterized as a lack-of-function T-DNA mutant with an insertion in Exon 2 (2); the

myb3r4-3 T-DNA insertion is located in Exon 1. At 4 weeks, a subset of boxes were infected

with conidia from 2 half-infected leaves (10-14 dpi) per box of Golovinomyces orontii MGH

isolate (3) using a settling tower and mesh screen as in (4) to maximize reproducibility. Boxes

containing G. orontii-infected plants were placed in a separate Percival AR66L growth chamber

under the same conditions as those used for uninfected samples. Whole leaf PM scores were

assessed as described in (5). Visualization of fungal structures and cell death was performed as

described in (4). All experiments were repeated at least twice.

Nuclear DNA quantitation at G. orontii infection sites. Mature leaves from infected and

uninfected plants (above) were harvested and stored in 95% ethanol at 4˚C. To stain nuclei, leaf

edges were removed, and trimmed leaves were vacuum infiltrated with 1 !g/ml 4',6-diamidino-

2-phenylindole (DAPI) for 20 min. Leaves were then mounted in 100 !l 1X SYTO to stain

fungal hyphae and observed under a 40X objective on a Zeiss 510 UV/Vis meta laser scanning

confocal microscope (Carl Zeiss, Inc., Germany) using UV and Argon lasers. 3D-images of

infected and uninfected sites were captured using identical settings and analyzed using Imaris 6.3

(3D image analysis software, Bitplane, Inc., MN). Infections near leaf margins and midrib

regions were avoided, as was the case for LMD-isolation. Fluorescence values from 30 DAPI-

stained mesophyll cell nuclei of WT and mutant leaves underlying infected and uninfected sites

were quantitated and normalized to that of nuclei of reference diploid guard cells from the same

image after subtraction of background from each measurement (6). All experiments were

performed at least twice.

Cell division. We did not observe microscopic evidence of enhanced cell division or enhanced

expression of cell division reporters (7). Cell division reporter lines (pCyclinB1::GUS and

pCyclinB1::CyclinB1-GFP) were kindly provided by Dr. Lew Feldman (University of

California, Berkeley) with original lines from Dr. Peter Doerner (The University of Edinburgh,

Scotland). Reporter constructs were visualized at 8 hpi, and 1,3, 5, and 7 dpi. All experiments

were performed at least twice.

References

1. Alonso, J. M. et al. Genome-wide insertional mutagenesis of Arabidopsis thaliana.

Science 301, 653-7 (2003).

2. Haga, N. et al. R1R2R3-Myb proteins positively regulate cytokinesis through activation

of KNOLLE transcription in Arabidopsis thaliana. Development 134, 1101-10 (2007).

3. Plotnikova, J. M., Reuber, T. L. & Ausubel, F. M. Powdery mildew pathogenesis of

Arabidopsis thaliana. Mycologia 90, 1009-1016 (1998).

4. Chandran, D. et al. Temporal Global Expression Data Reveals Known and Novel

Salicylate-Impacted Processes and Regulators Mediating Powdery Mildew Growth and

Reproduction on Arabidopsis. Plant Physiol 149, 1435-51 (2009).

5. Reuber, T. L. et al. Correlation of defense gene induction defects with powdery mildew

susceptibility in Arabidopsis enhanced disease susceptibility mutants. Plant J 16, 473-85

(1998).

6. Vanacker, H., Lu, H., Rate, D. N. & Greenberg, J. T. (2001) A role for salicylic acid and

NPR1 in regulating cell growth in Arabidopsis. Plant J 28, 209-16.

7. Colon-Carmona, A., You, R., Haimovitch-Gal, T. & Doerner, P. (1999) Technical

advance: spatio-temporal analysis of mitotic activity with a labile cyclin-GUS fusion

protein. Plant J 20, 503-8.

SI Figure S4A. Four-week-old, uninfected Col-0 and myb3r4 mutant plants are similar in

size, coloration, and leaf morphology. Scale bar= 1 cm. Average rosette diameters (± standard

deviation) of four-week-old WT (Col-0) (3.9 ± 0.86) and myb3r4-3 (3.3 ± 0.81) and myb3r4-1

(3.1 ± 0.45) plants were not significantly different. We also noted no difference in flowering

time or other obvious developmental differences.

Col-0 myb3r4-3 myb3r4-1

A

B Col-0

myb3r4-3

myb3r4-1

C

SI Figure S4B. myb3r4 mutants exhibit reduced PM growth and reproduction on whole

leaves at 10 dpi compared to wild type. Col-0. Scale bar= 0.5 cm. See Fig. 4 (manuscript) for

disease scores of PM-infected leaves.

SI Figure S4C. myb3r4 mutants exhibit reduced reproduction at 5 dpi without cell death.

Trypan Blue stained cells, indicative of cell death, are not observed. Arrow points to initial

germinated conidium (c). Scale bar=100 !m. Independent experiments gave similar results.

SI Figure S4D. Endoreduplication at 5 dpi occurs in mesophyll cells underlying the

infected epidermal cells and not in mesophyll cells distal from infection site in wild type

Col-0 plants. A. Nuclear DNA quantitation of mesophyll cells underlying infected epidermal

cell (black) or distal from infected epidermal cell (gray) using DAPI fluorescence. RFU is

relative fluorescence unit. C-values correspond to log2 (RFU mesophyll cell nuclei/RFU guard cell nuclei) as

follows: 0-1 is 4C; 1-2 is 8C; 2-3 is 16C; 3-4 is 32C and 4-5 is 64C. A total of 30 mesophyll cell

nuclei were quantitated for each sample type. Independent experiments showed similar results.

SI Figure S4E. Nuclear size is correlated with ploidy. Correlation of mesophyll cell nuclear

volume and DAPI fluorescence intensity values for Col-0 5 dpi, distal, and UI samples.

Independent experiments showed similar results.

D

E

supporting information (si) appendix

Documents