Supporting InformationDuheron et al. 10.1073/pnas.1013054108SI Materials and MethodsAnimals. Mice were kept in a pathogen-free barrier facility fol-lowing faculty guidelines and within its animal bioethics accord(approval no. AL/01/20/11/08). The Rankl−/− mice were identi-fied by lack of teeth, smaller size, and genomic DNA PCR (TableS1). The Rank−/− mice skin samples were kindly provided byGraham Anderson (University of Birmingham, Birmingham,UK). The Rank-Tg mice were genotyped by PCR (Table S1). Forskin transplantation, hair was cut and skin was excised, trans-planted onto nude mice (Harlan), and sutured. A healing spraywas applied. Hair plucking was performed on anesthetized mice.At 8 wk, C57BL/6 mice received two s.c. injections of 100 μg ofRANKL-GST or control GST in the neck region with a 12-hinterval. Anti-RANKL mAb (IK22-5) (1) was injected s.c. intoTg mice every 3 d: 10 μg at P10, 25 μg from P13 to P28, and 50 μgfrom P31 to P45.

Histology/Immunofluorescence. Dorsal skin was fixed in formalinand embedded in paraffin. Sections (6 μm) were deparaffinizedand stained with hematoxylin/eosin or Masson’s trichrome(Sigma-Aldrich). Alternatively, skin was frozen in Tissue-TekO.C.T. Compound (Delta Microscopie), and sections were fixedin acetone, blocked with goat or donkey serum (Sigma-Aldrich),and then incubated overnight at 4 °C with primary Abs (TableS2) diluted in buffered saline. Fluorochrome-labeled secondaryAbs (Molecular Probes; Invitrogen) were incubated for 1 h atroom temperature. Frozen sections were fixed in formalin beforeDAPI staining (Molecular Probes; Invitrogen). Tyramide signalamplification (PerkinElmer) was used to visualize RANK andRANKL in WT mice. To reveal endogenous alkaline phospha-tase, the frozen sections were incubated with 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and nitroblue tetrasodium (Pierce;Thermo Scientific).

RT-PCR. RNA from sorted bulge and SHG cells (2) was extractedwith RNeasy Micro (Qiagen). The cDNA was synthesized andamplified by using the QuantiTect Whole Transcriptome protocol(Qiagen). For epidermal–dermal separation, hair was trimmedwith scissors and hair-removal cream (Nair) was applied. After5 min, the hair-cream emulsion was washed off, and the skin wasincubated for 4 h at 37 °C with 1 mg/mL dispase II (Roche Di-agnostics). The epidermis was then carefully removed with for-ceps. Snap-frozen IFE, HF-associated cells (dermis), or wholeskin were ground with a pestle and mortar, filled with liquidnitrogen, and placed in dry ice. RNA was extracted from theobtained powder with the Ambion TRI Reagent (Applied Bio-systems) and cleaned with RNeasy (Qiagen). The cDNA wassynthesized by using ImProm-II RT and oligo(dT)15 primer(Promega). Classic and real-time PCR were performed withgene-specific primers (Table S3). The real-time PCR reactionswere run using the Eurogentec qPCR MasterMix Plus Low ROXon a Stratagene MX4000 thermal cycler. The CT values of targetgenes were normalized to GAPDH and β-actin (Applied Bio-systems primers). The expression factor was calculated by usingthe Relative Expression Software Tool (REST; http://www.gene-quantification.de/rest.html).

Cell Proliferation. To visualize proliferating cells, mice wereinjected i.p. with 1 mg of BrdU (Sigma-Aldrich) at 3 h before theywere killed. Dorsal skin tissues were fixed in formalin and em-bedded in paraffin. Antigen retrieval was in boiling-hot citratebuffer, pH 6.0, for 10 min, and endogenous peroxidase was in-

hibited in 3% H2O2. The anti-BrdU Ab was incubated overnightat 4 °C. The sections were incubated with goat anti-rat IgGbiotin-conjugated secondary Ab at room temperature, followedby horseradish-conjugated ABC complex (Vector Labs). Label-ing was revealed with diaminobenzidine-Ni and stopped withdistilled water. Sections were counterstained with eosin.

ELISA.Dorsal mouse skin was excised and weighted. It was floatedon complete cell-culture medium for 24 h at 37 °C. The cell-freeculture medium was sterile-filtered, and soluble RANKL andOPG were measured by ELISA (DuoSet ELISA; R&D Sys-tems). The results were normalized to skin weight.

Flow Cytometry. HF cells were liberated from skin as previouslydescribed (2). They were stained for CD34, revealed by an AlexaFluor 647 goat anti-rat secondary Ab (Molecular Probes; In-vitrogen), fixed, permeabilized, and stained for keratin 14, re-vealed by a FITC donkey anti-rabbit secondary Ab (MolecularProbes; Invitrogen). The cells were analyzed with a FACSCali-bur (Becton Dickinson). For sorting, the cells were also labeledfor P-cadherin followed by allophycocyanin/streptavidin andsorted on a FACSAria II cell sorter (Becton Dickinson) intoCD34+ bulge and P-cadherin SHG cells. Further experimentaldetails for in situ hybridization, RANK signaling assay, skin cy-tokine production, primary keratinocyte culture, and epidermalbarrier test are available in SI Materials and Methods.

In Situ Hybridization. In situ hybridization of receptor activator ofNF-κB (RANK) and RANK ligand (RANKL) mRNA was per-formed by using digoxigenin-UTP–labeled sense and antisensemRNA probes, as previously described (1). The signal was de-veloped with 5-bromo-4-chloro-3-indolyl phosphate (BCIP) andnitroblue tetrasodium (Kirkegaard and Perry) for between 1 and2 d at room temperature in the dark.

RANK Signaling Assay. The murine endogenous and Tg RankcDNA was amplified from WT and Rank-Tg skin cDNA andcloned into pCR3.1 (Invitrogen) under the control of the CMVpromoter. HEK 293T cells were either transiently transfectedwith FuGENE (Roche), or a stable cell line was obtained underG418 selection. For the NF-κB signaling assay, the NF-κB1 lu-ciferase reporter vector (Panomics) was transiently transfected,and RANKL-GST was added 24 h later. Luciferase activity wasmeasured 24 h later by following the manufacturer’s instructions(Promega).

Skin Cytokine Production. Skin from WT and Rank-Tg mice wasweighed and floated, hairy side up, on cell-culture mediumcontaining 10% FCS (Invitrogen), antibiotics, and fungicides ina cell-culture incubator for 24 h at 37 °C. The cell-free culturemedium was sterile-filtered. TNFα and IL-1-β ELISA wereperformed with anti-TNFα Abs from BD Biosciences and theDuoSet ELISA kit (R&D Systems) for IL-1β.

Primary Keratinocyte Culture.Hair from 21-d-old WT and Rank-Tgmice was removed (Nair) and digested with dispase II (Roche)for 18 h at 4 °C. The epidermis was peeled off and trypsinized(Gibco-Invitrogen) for 30 min at room temperature to liberatebasal keratinocytes. These cells were then placed in culture inlow-calcium keratinocyte growth medium (CnT 57; CELLnTEC)at an initial cell density of 6 × 103 cells cm−2. Cultures were keptin 5% CO2/95% humidity at 37 °C for 15 d with medium changedevery 4 d. Cells were detached with trypsin and counted.

Duheron et al. www.pnas.org/cgi/content/short/1013054108 1 of 8

Epidermal Barrier Test. Killed 8-wk-old Tg and WT mice wereshaven, and their skin was cut with scissors at the dorsum. Theywere then dehydrated in successive steps in methanol and, after

rehydration, bathed in 0.01% toluidine blue for 1 min. Afterwashing in water, hair was completely removed with depilationcream (Nair), and mice were photographed.

1. Kamijo S, et al. (2006) Amelioration of bone loss in collagen-induced arthritis byneutralizing anti-RANKL monoclonal antibody. Biochem Biophys Res Commun 347:124–132.

2. Greco V, et al. (2009) A two-step mechanism for stem cell activation during hairregeneration. Cell Stem Cell 4:155–169.

3. Mueller CG, et al. (2001) Mannose receptor ligand-positive cells express themetalloprotease decysin in the B cell follicle. J Immunol 167:5052–5060.

Fig. S1. (A) RT-PCR of Rank, Rankl, Opg, and Gapdh transcripts in the skin of 5- and 15-d-old mice. (B) In situ hybridization for RANK and RANKL mRNA(antisense) or control (RANK sense) at postnatal day 5 (P5). (C) Normal hair follicle (HF) morphogenesis of Rankl−/− mice, displaying early anagen at P5 andnormal hair-cycle entry with catagen II at P15. (Scale bars, 100 μm.) (D) Presence of all four hair types (monotrich, awl, auchene, and zigzag) in a 45-d-oldRankl−/− mouse.

Duheron et al. www.pnas.org/cgi/content/short/1013054108 2 of 8

Fig. S3. (A) Immunofluorescence of RANKL and GATA-3 of an anagen HF. Nuclei were colored with DAPI. (Scale bar, 30 μm.) (B) In situ hybridization for RANKLmRNA (antisense) or control (sense) on P28 anagen skin. (C) Identification of a rare RANKL+ cell by anti-RANKL immunolabeling in P28 WT epidermis with DAPIcounterstaining. (Scale bars, 10 μm.) Asterisk indicates unspecific staining of the stratum corneum; dashed line indicates the dermo-epidermal junction. (D) Skinsections of P28 WT mice show CD34–RANK and integrin α6–RANK double-labeled HF bulge stem cells (arrows). Nuclei were colored with DAPI. Arrows point tothe bulge. (Scale bars, 20 μm.) (E) Skin section of a P21 WT mouse stained for osteoprotegerin (OPG) shows the protein in the bulge, secondary hair germ (SHG),and basal keratinocytes (arrow). Asterisk indicates unspecific labeling of the stratum corneum. ep, interfollicular epidermis (IFE). (Scale bars, 20 μm.)

Fig. S2. (A) Rankl−/− HFs fail to enter anagen at P40 or P45. WT HFs are in catagen VII at P40 and in the second telogen at P45 (with club hair present). (Scalebars, 100 μm.) (B) Rankl−/− HFs fail to enter anagen at P25. Back skin of Rankl−/− mouse and WT littermate were analyzed for initiation of HF renewal at an agewhen anagen II is apparent. (Scale bars, 200 μm.) The paraffin-embedded sections were stained with hematoxylin/eosin.

Duheron et al. www.pnas.org/cgi/content/short/1013054108 3 of 8

Fig. S4. (A) Overexpression of RANK (arrowhead) under control of the S100A8 gene promoter in the P-cadherin+ SHG. Nuclei were colored with DAPI. B,bulge. (Scale bar, 20 μm.) (B) Tg RANK induces NF-κB signaling. HEK 293T cells were transiently transfected with the Rank-Tg expression plasmid and a lucif-erase expression plasmid under NF-κB control. Cells were stimulated with recombinant RANKL. The NF-κB promoter activity is expressed as the fold increase ofluciferase units with respect to cells having received the NF-κB reporter plasmid only. The data are representative of three experiments. (C) Measures (mean ±SEM) of soluble RANKL and OPG protein by ELISA in skin-organ cultures, at the indicated ages in Rank-Tg and control (WT) mice. (D) Three-month-old Rank-Tgmice display mild alopecia compared with control littermates. (E) HEK 293T cells stably expressing RANK and transfected with the NF-κB reporter plasmid werestimulated with different concentrations of RANKL-GST. The data are expressed as the fold increase of luciferase units with respect to nonstimulated cells. Dataare the mean of triplicates and are representative of three experiments.

Duheron et al. www.pnas.org/cgi/content/short/1013054108 4 of 8

Fig. S5. (A) Immunolocalization of endogenous RANK to basal keratinocytes in WT and Rank-Tg mice. Control was antigen-unspecific goat Ig. Nuclei werecolored with DAPI. (Scale bars, 10 μm.) Asterisk indicates unspecific staining of the stratum corneum; dashed lines indicate the dermo-epidermal junction. (B)TNFα and IL-1β were measured by ELISA in supernatants of 24-h skin-organ cultures of Rank-Tg and WT mice at different ages. The cytokine levels werenormalized to skin weight. Each data point represents one mouse, and bars represent the mean value (± SD in vertical bars). **P < 0.01. (C) Immunolabeling ofCD3+ T cells (arrows) in skin of WT and Rank-Tg mice. Counterstaining was with DAPI. Asterisk indicates unspecific labeling of the stratum corneum; dashedlines indicate the dermo-epidermal junction. The images are representative of at least three mice of each group. (Scale bars, 20 μm.) (D) Increased cell recoveryof primary epidermal keratinocytes of 3-wk-old Rank-Tg mice compared with WT controls at 15 d after seeding into low-calcium keratinocyte growth medium.The data are the mean ± SD of duplicates and are representative of three experiments. **P < 0.01.

Duheron et al. www.pnas.org/cgi/content/short/1013054108 5 of 8

Fig. S6. Sequence of the mouse Rank-Tg construct.

Duheron et al. www.pnas.org/cgi/content/short/1013054108 6 of 8

Fig. S7. (A) Immunolocalization of cytokeratin 14, cytokeratin 10, loricrin, involucrin, filaggrin, and DAPI nuclear staining of the skin of Rankl−/−, WT, andRank-Tg mice. (Scale bars, 20 μm.) Dashed lines indicate the dermo-epidermal junction. ep, IFE. (B) Epidermal barrier test with toluidine blue. Killed 8-wk-old Tgand WT mice were shaven, and their skin was cut with scissors at the indicated site before the toluidine blue penetration test. Of note, the Tg mouse is inanagen at 8 wk, rendering the skin dark.

Table S1. Genotyping PCR primers

Primer Sequence (5′ to 3′)

Rankl−/− Forward: ccaagtagtggattctaaatcctgReverse 1: ggttggacacctgaatgctaatttc (345 bp)Reverse 2: attcgcagcgcatcgccttctatcg (575 bp)

Rank-Tg Forward: atggactacaaagacgatgacgacaReverse: tgccaggaatccaccgccaccag (264 bp)

Duheron et al. www.pnas.org/cgi/content/short/1013054108 7 of 8

Table S2. Primary antibodies

Target Species Clone or designation Conjugation Application Vendor Dilution factor

EndogenousRANK* Goat N20 SC-7626 Purified IF (Frozen) Santa Cruz, CliniSciences 1/200

TgRANK Goat AF 692 Purified IF (Frozen) R&D Systems 1/200RANKL* Goat AF 462 Purified IF(Frozen) R&D Systems 1/100OPG Mouse OPG4-1 Ascite IF(Frozen) Alexis, Axxora, Coger 1/2,000CD34 Rat 14-0341 Purified IF/FACS eBioscience, CliniSciences 1/150P-cadherin Goat BAF 761 Biotin IF/FACS R&D Systems 1/100

1/20,000GATA-3 Mouse HG3-31 SC-268 Purified IF Santa Cruz 1/200Integrin α6 Rat 19765 Purified IF Abcam 1/50Filaggrin Rabbit PRB-417P Purified IF Covance, Eurogentec 1/2,000Keratin 10 Rabbit PRB-159P Purified IF Covance 1/2,000Keratin 14 Rabbit PRB-155P Purified IF/FACS Covance 1/2,000Loricrin Rabbit PRB-145P Purified IF Covance 1/2,000Involucrin Rabbit PRB-140C Purified IF Covance 1/2,000BrdU Rat AbC117-7513 Purified IHC AbCys 1/100CD3ε Rat 145-2C11 Purified IHC BD Biosciences 1/200

IF, immunofluorescence; IHC, immunohistochemistry.*Signal enhancement with the Tyramide amplification system (Dupont) of endogenous RANK and endogenous RANKL in telogen HFsand epidermis.

Table S3. RT-PCR primers

Primer Sequence (5′ to 3′)

RANK Forward: tgc gtg ctg ctc gtt ccaReverse: tgc cag gat cca ccg cca cca g (262 bp)

RANKL Forward: agc atc gct ctg ttc ctg tReverse: tcg tgc tcc ctc ctt tca tc (592 bp)

Real-time PCR Forward: cag cat cgc tct gtt cct gtReverse: gca gtg agt gct gtc ttc tgaProbe: tcg agc gca gat gga tcc taa cag aa

OPG Forward: tga tga gtg tgt gta ttg cag cReverse: tct cta cac tct cgg cat tc (485 bp)

Real-time PCR Forward: cga gga cca caa tga aca agt gReverse: tgg gtt gtc cat tca atg atg tProbe: ctg tgc tgc gca ctc ctg gtg ct

GAPDH Forward: tcc atg aca act ttg gta tcg tggReverse: gtc gct gtt gaa gtc aga gga gac (695 bp)

Duheron et al. www.pnas.org/cgi/content/short/1013054108 8 of 8