supporting information catalase involved in oxidative
TRANSCRIPT
![Page 1: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/1.jpg)
S1
Supporting Information
Catalase Involved in Oxidative Cyclization of the Tetracyclic
Ergoline of Fungal Ergot Alkaloids
Yongpeng Yao,†,§ Chunyan An,†,§ Declan Evans,‡ Weiwei Liu,† Wei Wang,†,#
Guangzheng Wei,†,# Ning Ding,⊥ K. N. Houk,*,‡ Shu-Shan Gao*,†
†State Key Laboratory of Microbial Resources, Institute of Microbiology, Chinese
Academy of Sciences, Beijing 100101, P. R. China
‡Department of Chemistry and Biochemistry, University of California, Los Angeles,
California 90095, United States.
#University of Chinese Academy of Sciences, Beijing 100049, P. R. China
⊥School of Food Science and Technology, Jiangnan University, Wuxi, Jiangsu
214122, P. R. China.
§These authors contributed equally to this work.
*e-mail: [email protected], [email protected].
![Page 2: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/2.jpg)
S2
TABLE OF CONTENTS
Experimental Procedures ..................................................................................................... S5
1. General materials and methods ....................................................................................... S5
2. In sillico genomic analysis. ............................................................................................. S5
3. Strains and culture conditions. ........................................................................................ S5
4. A. fumigatus DNA, RNA preparation and reverse transcription‐PCR (RT‐PCR). .......... S6
5. Plasmid construction. ...................................................................................................... S6
6. Construction of the dmaW-knockout mutant of A. fumigatus. ....................................... S7
7. Heterologous production in A. nidulans A1145 ∆ST∆EM. ............................................. S7
8. Chemical analysis and compounds isolation. .................................................................. S8
9. Chemical complementation and feeding studies. ............................................................ S8
10. HPLC analysis. .............................................................................................................. S9
11. LCMS analysis. ............................................................................................................. S9
12. Expression and purification of EasC from E. coli strain BL21 (DE3). ......................... S9
13. In vitro assay of the catalatic activity of EasC. ........................................................... S10
14. In vitro conversion of compound 4 into 2 and 5 by EasC. .......................................... S10
15. Effect of H2O2 on EasC activity. ................................................................................. S10
16. Enzymatic generation of compound 2 and 5. .............................................................. S11
17. In vitro activity assay for interconversion of compound 2 into compound 5 by EasC.
........................................................................................................................................... S11
18. In vitro inhibition of EasC activity by DMPO, 5-HTP and L-AA. ............................. S11
19. In vitro conversion of compound 2 into compound 5 by hydroxyl radical. ................ S11
20. Computational details .................................................................................................. S12
21. Phylogenetic analysis of EasC and its homologues ............................................. S12
Supplementary Tables ........................................................................................................ S13
Table S1. Primers used in this study. ................................................................................ S13
Table S2. Plasmids used in this study. .............................................................................. S14
Table S3. S. cerevisiae and A. nidulans strains used in this study. ................................... S15
Table S4. Functions of the ORFs in ergot alkaloids gene cluster. ..................................... S16
Table S5. 1H NMR (500 MHz) and 13C NMR (125 MHz) data of compound 1, 4, 2, and 5
in DMSO-d6. ...................................................................................................................... S17
Table S6. EasC homologues and catalases used for phylogenetic analysis. ..................... S19
![Page 3: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/3.jpg)
S3
Supplementary Figures ....................................................................................................... S24
Figure S1. Clinically used natural and semi-synthetic ergot alkaloids. ............................. S24
Figure S2. Biosynthetic gene clusters of ergot alkaloid in A. fumigatus. .......................... S25
Figure S3. LCMS analysis of product profiles of A. fumigatus ∆dmaW strain and chemical
complementation studies. .................................................................................................. S26
Figure S4. Gene knock-out of dmaW in A. fumigatus. ..................................................... S27
Figure S5. UV and MS spectra of compound 1. ................................................................ S28
Figure S6. Alignment of amino acid sequences of EasE homologous proteins with FAD-
linked protein. .................................................................................................................... S29
Figure S7. UV and MS spectra of compound 4. ................................................................ S30
Figure S8. Confirmation the function of EasE by whole cell biotransformation. ............. S31
Figure S9. Alignment of amino acid sequences of the small subunit size catalases (SSCs)
with EasC homologues. ..................................................................................................... S32
Figure S10. Predicted structure of EasC. ........................................................................... S34
Figure S11. SDS-PAGE of purified EasC and catalase activity assay. ............................. S35
Figure S12. UV spectra of EasC. ....................................................................................... S36
Figure S13. HPLC analysis of the binding NADPH in EasC proteins. ............................. S37
Figure S14. UV and MS spectra of compound 2. .............................................................. S38
Figure S15. HPLC analysis of deoxygenated and nitrogen-saturated EasC reactions with
the presence of H2O2.......................................................................................................... S39
Figure S16. HPLC analysis of deoxygenated and nitrogen-saturated EasC reactions. ..... S40
Figure S17. Effect of H2O2 on EasC activity. .................................................................... S41
Figure S18. HR-ESI-MS analysis of compound 2 generated from EasC reaction in H218O
prepared buffer. ................................................................................................................. S42
Figure S19. EasC reaction without NADPH. .................................................................... S43
Figure S20. UV and MS spectra of compound 5. .............................................................. S44
Figure S21. HPLC analysis of in vitro interconversion of compound 2 into compound 5 by
EasC................................................................................................................................... S45
Figure S22. In vitro conversion of compound 2 to 5 by hydroxyl radicals generated via the
Fenton reaction. ................................................................................................................. S46
Figure S23. Computed reaction mechanism for the conversion of 6 to 9. ........................ S47
Figure S24. Consumption of substrate 4 in EasC reaction mixture with the presence of
radial scavenger. ................................................................................................................ S48
Figure S25. The homologues of EasC. .............................................................................. S49
![Page 4: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/4.jpg)
S4
Figure S26. 1H-NMR of compound 1 in DMSO-d6 (500 MHz). ....................................... S51
Figure S27. 13C NMR and DEPT spectrum of compound 1 in DMSO-d6 (125 MHz). ..... S52
Figure S28. 1H-NMR of compound 4 in CD3OD (500 MHz). .......................................... S53
Figure S29. 13C-NMR of compound 4 in CD3OD (125 MHz). ......................................... S54
Figure S30. HSQC spectrum of compound 4 in CD3OD. ................................................. S55
Figure S31. HMBC spectrum of compound 4 in CD3OD. ................................................ S56
Figure S32. NOESY spectrum of compound 4 in CD3OD. ............................................... S57
Figure S33. 1H-NMR of compound 2 in DMSO-d6 (500 MHz). ....................................... S58
Figure S34. 13C-NMR and DEPT of compound 2 in DMSO-d6 (500 MHz). .................... S59
Figure S35. HSQC spectrum of compound 2. ................................................................... S60
Figure S36. COSY spectrum of compound 2. ................................................................... S61
Figure S37. HMBC spectrum of compound 2. .................................................................. S62
Figure S38. ROESY spectrum of compound 2.................................................................. S63
Figure S39. 1H-NMR of compound 5 in DMSO-d6 (500 MHz). ....................................... S64
Figure S40. 13C NMR spectrum of compound 5 in DMSO-d6 (125 MHz). ...................... S65
Figure S41. HSQC spectrum of compound 5. ................................................................... S66
Figure S42. COSY spectrum of compound 5. ................................................................... S67
Figure S43. HMBC spectrum of compound 5. .................................................................. S68
Figure S44. NOESY spectrum of compound 5. ................................................................ S69
Supplementary Computational Information ................................................................ S70
Supplementary References ............................................................................................. S75
![Page 5: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/5.jpg)
S5
Experimental Procedures
1. General materials and methods
Fumigaclavine C was a kind gift from Prof. Zhang Yonghui, Huazhong University of
Science and Technology (Wuhan, China). Potato dextrose agar (PDA) and Potato
Dextrose Broth (PDB) were purchased from Becton, Dickinson and Company (USA).
Restriction enzymes and Q5 DNA polymerase were purchased from New England
Biolabs (USA). Aspergillus fumigatus CGMCC 3.772 was obtained from China
General Microbiological Culture Collection Center (CGMCC). DMPO (5,5-Dimethyl-
1-Pyrroline N-oxide) was obtained from APExBIO (USA). 5-Hydroxytryptophan (5-
HTP) and L-ascorbic acid (L-AA) were purchased from Sigma Aldrich (Shanghai,
China). All other chemicals and solvents were of analytical grade and used as purchased.
All buffers and solutions were prepared in Milli-Q water. Primers for cloning were
synthesized by Synbio Technologies (Beijing, China). DNA sequencing was performed
by Majorbio corporation (Beijing, China). High Performance Liquid Chromatography
(HPLC) analysis was performed on a Waters 2695 (USA) system using C18 analytical
column (Sepax GP-C18, 250×4.6 mm, particle size 5 μm; Sepax Technologies). LCMS
analysis was performed on the AGILENT-1200HPLC/6520QTOFMS (USA) system
using C18 analytical column (Gemini 150×2.0 mm, particle size 3 μm; Phenomenex).
Acetonitrile was HPLC grade and was purchased from Sigma-Aldrich (St. Louis, MO,
USA).
2. In sillico genomic analysis.
Gene predictions of the coding sequences were performed via FGENESH program
(www.softberry.com) or 2ndFind platform (http://biosyn.nih.go.jp/2ndFind/) and
manually checked based on homologous gene/proteins in the NCBI database. A
BLASTP search was used to predict protein functions
(https://blast.ncbi.nlm.nih.gov/Blast.cgi).
3. Strains and culture conditions.
Both the wild-type and the mutant of A. fumigatus strains were grown on PDA medium
(dextrose 20 g/L, potato extract 4 g/L, agar 15 g/L) at 28°C. For gene knock‐out in A.
fumigatus, PDA with 1.2 M sorbitol and 700 μg/mL hygromycin was used for protoplast
regeneration and antibiotic resistance selection. Saccharomyces cerevisiae strain
BJ5464‐NpgA (MATα ura3‐52 his3‐Δ200 leu2‐Δ1 trp1pep4::HIS3 prb1Δ1.6R can1
GAL) was used in vivo yeast DNA recombination cloning and the yeast heterologous
expression host.1 YPD (yeast extract 10 g/L, peptone 20 g/L, dextrose 20 g/L) liquid
medium was used for routine growth of yeast strain BJ5464‐NpgA and its derivatives
at 28°C. Uracil dropout medium (UDMS, solid, 5 g/L casamino acids and 20 g/L
dextrose, 20 g/L agar) were used for selection of plasmids constructed by yeast
homologous recombination. Filter-sterilized 10 × nitrogen base stock (10 mL/100 mL),
1 mL Tryptophan stock (2 mg/mL) and 1 mL Adenine stock (2 mg/mL) were added
after autoclaving. The yeast transformants were grown on the solid UDMS medium for
2−4 days. For gene expression under ADH2 promoter (ADH2p) and pathway
![Page 6: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/6.jpg)
S6
reconstitution in S. cerevisiae, the appropriate plasmids were introduced into yeast cells
as described in Table S2. The yeast transformants were initially grown in the Uracil
dropout liquid medium for one day and then transferred to the liquid YPD medium for
further culture for 3 days. A. nidulans A1145 (∆ST∆EM) was used for heterologous
expression of the early genes of the biosynthetic pathway of ergot alkaloids. The A.
nidulans transformants were incubated in liquid CD-ST production medium (starch 20
g/L, peptone 20 g/L, nitrate salts 50 mL/L, 1 mL/L trace elements) for 3 days at 37 °C
at 250 rpm for the heterologous production of ergot alkaloid genes. LB medium
(Tryptone 10 g/L, Yeast extract 5 g/L, NaCl 10 g/L) were used for culturing Escherichia
coli. E. coli strain Top10 was the host for routine plasmid sub‐cloning and E. coli strain
BL21(DE3) was used for protein expression and purification for in vitro assay.
4. A. fumigatus DNA, RNA preparation and reverse transcription‐PCR (RT‐PCR).
For gnomonic DNA extraction, mycelia of A. fumigatus were inoculated in PDB
medium at 30 °C, 200 rpm for 3 days, and collected for lyophilization. The mycelia
were grinded after freezing with liquid nitrogen, and then the gnomonic DNA was
extracted by fugal gnomonic DNA extraction kit (OMEGA) according to the instruction
of the manufacturer. For RNA extraction, mycelia of A. fumigatus were inoculated in
PDA medium at 37 °C for 3 days, and collected for lyophilization. The mycelia were
grounded after freezing with liquid nitrogen, and solubilized in Trizol (Invitrogen).
Then the total RNA was extracted by fugal RNA extraction kit (OMEGA) according to
the instruction of the manufacturer. RNA integrity was confirmed by electrophoresis on
the TAE (Tris‐acetate‐EDTA) agarose gel (1.2%), and the concentration was
determined by Nanodrop (Thermo Scientific). cDNA was prepared from 500 ng of total
RNA by FastQuant RT Kit (Tiangen) with random primers as described by the
manufacturer. PCR was performed with Q5 DNA Polymerase. Primers were listed in
Table S1.
5. Plasmid construction.
Primers and plasmids were listed in Tables S1 and S2, respectively. For heterologous
expression in A. nidulans A1145, plasmids pYTU, pYTP, pYTR were used as
backbones to insert genes which contain auxotrophic markers for uracil (pyrG),
pyridoxine (pyroA), and riboflavin (riboB), respectively. Genes to be expressed were
amplified through PCR using the gDNA of A. fumigatus as a template. For dmaW and
easF expression, primers dmaW-F and dmaW-R were used to amplify the DNA
fragment of dmaW gDNA, primers gpdA-F and gpdA-R were used to amplify the
promoter gpdA fragments, primers easF-F and easF-R were used to amplify the DNA
fragment of easF gDNA. The pieces were mixed with NotI/SwaI-digested pYTU
backbone and assembled using yeast homologous recombination to create the plasmid
pYYP-1. Primer pair of easE-F and easE-R were used to amplify the DNA fragment of
easE gDNA, and inserted into BamHI/SwaI-digested pYTP using yeast homologous
recombination to create the plasmid pYYP-2. Primer pair of easC-F and easC-R were
used to amplify easC gDNA, and inserted into BamHI/SwaI-digested pYTR using yeast
homologous recombination to create the plasmid pYYP-3. Q5 DNA Polymerase was
![Page 7: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/7.jpg)
S7
used for all PCR amplification. Yeast competent cell preparation and transformation
were performed with Frozen-EZ Yeast Transformation II kit (Zymo Research)
according to the manufacture’s protocols. Yeast plasmids were prepared by
Zymoprep™ Yeast Plasmid Miniprep I kit (Zymo Research) and transformed into E.
coli strain Top10 for propagation.
Yeast expression plasmids pXW55 (URA3 marker) and pYYP-4 were used for
construction of the heterologous expression plasmids. For easE expression, primers 55-
easE-F and 55-easE-R were used to amplify the cDNA fragment of easE, and
transformed into SpeI/PmlI-digested pXW55 to create the plasmid pYYP-4 using
Gibson assembly method.2 EasE protein was expressed under ADH2p promoter and
ADH2t terminator. Q5 DNA Polymerase was used for all PCR amplification.
The split-marker approach was used for targeted gene knockout via homologous
recombination.1 The hygromycin-resistance gene (hph) was used as marker. The two
overlapping hygromycin resistance gene fragments were cloned into T-vector pTA2
(TOYOBO) to form plasmids pHPH-up and pHPH-dn. The pairs of primers
KODmaWupF/R, KODmaWdnF/R were used for amplification of the upstream and
downstream regions and knockout of DmaW. These PCR products were ligated into
plasmids containing partial fragments of hph-up and hph-dn accordingly. The pairs of
primers KODmaWupF/S2, S3/KODmaWdnR were used to amplify the gene knock-out
cassettes, yielding two DNA fragments for DmaW knockout. The two DNA fragments
for DmaW knockout were lyophilized together after purification. Q5 DNA Polymerase
was used for all PCR amplification.
To construct the plasmid for the protein expression and purification of EasC from E.
coli BL21 (DE3), the cDNA of easC was amplified using the primers 28a-easC-F and
28a-easC-R, and inserted into NdeI/XhoI-digested pET28a using Gibson assembly
method2 to create the plasmid pET28a-easC.
6. Construction of the dmaW-knockout mutant of A. fumigatus.
The constructed gene knock-out cassettes were transformed into wild-type of A.
fumigatus by polyethylene glycol (PEG) mediated protoplast transformation. The
lyophilized DNA fragments were incubated with 100 μL of the protoplasts for 50 min
on ice, then 1.25 mL of PEG solution (60% PEG 4000, 50 mM CaC12, 50 mM Tris-
HCI, pH 7.5) was added and gently mixed. After incubation at room temperature for 20
min, the mixture was plated on the PDA medium containing 700 μg/mL hygromycin B
and 1.2 M sorbitol. The screening and confirmation of the mutants were carried out by
PCR and illustrated in Figure S4. The primers used in the gene knock-out were listed
in Table S1 and the scheme is shown in Figure S4.
7. Heterologous production in A. nidulans A1145 ∆ST∆EM.
Protoplasts were generated by scraping spores from a solid CD medium (10 g/L glucose,
50 mL/L 20× nitrate salts, 1 mL/L trace elements, 2% agar) plate. The spores were
![Page 8: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/8.jpg)
S8
transferred to 100 mL of liquid CD medium (10 g/L glucose, 50 mL/L 20× nitrate salts,
1 mL/L trace elements) and incubated for 7-8 hours at 37 °C at 250 rpm. After
incubation, the germlings were harvested by centrifugation and washed twice with 10
mL of Osmotic medium (1.2 M MgSO4, 10 mM NaPO4, pH 5.8). The germlings were
then transferred into 10 mL of Osmotic medium containing 30 mg of lysing enzyme
from Trichoderma and 20 mg of Yatalase, and incubated for 12 hours at 28 °C at 80
rpm for protoplast formation. The cells were poured into a 50 mL Falcon tube and
overlaid with 10 mL of Trapping buffer (0.6 M Sorbitol, 0.1 M Tris-HCl, pH 7.0). The
tube was centrifuged at 5,000 rpm. The protoplasts were then removed from the
interface of the two buffers and washed using 20 mL of STC buffer (1.2 M sorbitol, 10
mM CaCl2, 10 mM Tris-HCl, pH 7.5). After protoplasts collection by centrifugation at
4000 rpm, 1 mL of fresh STC buffer was added to suspend the protoplasts. Then 100
μL of protoplasts was sub-packaged into 1.5 mL sterile tubes. DNA were added to the
protoplast solution and incubated on ice for 1 h, then 1.25 mL of 60% PEG4000 solution
was added, and further incubated at room temperature for 20 min. The cells were then
plated onto solid CD-sorbitol medium (10 g/L glucose, 50 mL/L 20× nitrate salts, 1
mL/1 L trace elements, 2% agar, 1.2 M sorbitol) with corresponding nutrient element,
and incubated at 37 °C for 3 days. Until transformants being seen, the spores were re-
streaked onto liquid CD-ST production medium (20 g/L starch, 20 g/L peptone, 50
mL/L nitrate salts, 1 mL/L trace elements, pH 6.5), and incubated for 3 days at 37 °C
at 250 rpm for the heterologous production of ergot alkaloids.
8. Chemical analysis and compounds isolation.
To obtain compound 1, 2, the plasmids pYYP-1 and pYYP-2 (Table S2) were
transformed into A. nidulans A1145 ∆ST∆EM. To obtain compound 3, the plasmids
pYYP-1, pYYP-2 and pYYP-3 (Table S2) were transformed into A. nidulans A1145
∆ST∆EM. The fungus was cultured in 4 L CD-starch liquid medium, shaking at 250
rpm and 37 oC for 3 days. The culture was extracted thrice with ethyl acetate and the
organic phase was evaporated to dryness to yield the crude extract. The crude extract
was subjected to Sephadex-LH20 eluted with MeOH:CH2Cl2 1:1 to get a sub-fraction.
Then the sub-fraction was further subjected to semi-prepared HPLC chromatography
on Welch column (250×10 mm, 5 μm, 25 ºC, flow 2.5 mL/min) with isocratic wash of
22% ACN in water with 0.1% formic acid for 25 min. The purified fraction was cooled
immediately on ice. The solvent and water were quickly removed under reduced
pressure to yield 15 mg of compound 1, 10 mg of compound 4, and 7.5 mg of compound
2. The purity of each compound was checked by LCMS, and the structure was
confirmed by NMR measurement and comparing with the literatures.3
9. Chemical complementation and feeding studies.
For chemical complementation of ΔdmaW strain of A. fumigatus with compounds
(solubilized in DMSO), spores of ΔdmaW were inoculated in PDA plate together with
10 μg/mL compounds 1, 2, 4 and 5, and further cultured for 3 days at 37 °C. The mycelia
and medium were extracted for LCMS analysis.
![Page 9: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/9.jpg)
S9
To test the function of easE gene in vivo, spores of A. nidulans harboring plasmid
pYYP-2 were inoculated in liquid CD-ST medium without pyridoxine together with 10
μg/mL compound 1, and further cultured for 3 days at 37 °C. The mycelia and medium
were extracted for HPLC and LCMS analysis.
The function of easE gene was also confirmed by yeast feeding experiment. EasE was
expressed in yeast and compound 1 was fed to yeast for in vivo transformation. Yeast
harboring plasmid pYYP-4 was initially cultured in 5 mL liquid drop out medium
overnight, and 1 mL of yeast cells was transferred to 10 mL of liquid YPD medium for
additional 2‐day culture. Then the cells were harvested by centrifugation, and
resuspended by 1 mL fresh YPD medium with 10 μg compound 1 added. After another
one day’s incubation, extracted samples from 1 mL of culture were loaded for HPLC
and LCMS analysis.
10. HPLC analysis.
Cultures of A. nidulans, yeast, wild type strain, or deletant mutants of A. fumigatus cells
were extracted with acetone: ethyl acetate (1 : 4). Organic extracts were then
concentrated by rotary evaporation to give a crude mycelial extract. Then the extracts
were dissolved in methanol and filtrated by 0.22 μM filter for HPLC analysis. HPLC
analysis were performed on a Waters 2695 system (USA) using C18 analytical column
(Sepax GP-C18, 4.6×250 mm, particle size 5 μm; Sepax Technologies) with a linear
gradient of 10-100% acetonitrile (MeCN)‐H2O (v/v, 0.1% formic acid) in 25 minutes
followed by 100% MeCN (v/v, 0.1% formic acid) for 5 minutes with a flow rate of 1
mL/min.
11. LCMS analysis.
LCMS analysis was performed on the AGILENT-1200HPLC/6520QTOFMS (USA)
system using C18 analytical column (Gemini 150×2.0 mm, particle size 3 μm;
Phenomenex) with a linear gradient of 5-95% acetonitrile (MeCN)‐H2O (v/v, 0.1%
formic acid) in 15 minutes followed by 95% MeCN (v/v, 0.1% formic acid) for 5
minutes with a flow rate of 0.3 mL/min. Mass spectrometry was performed in the
positive ion mode.
12. Expression and purification of EasC from E. coli strain BL21 (DE3).
The expression plasmid pET28a-easC was transformed into E. coli strain BL21 (DE3)
for expression of EasC. Cells were grown in LB medium supplemented with kanamycin
(50 mg/L) to an OD600 of 0.8. Protein expression was then induced by 5 μM IPTG
(isopropyl-β-D-thiogalactoside) and grown for 48 h at 16 °C and 160 rpm prior to
harvesting. All the protein purification steps were performed at 4 °C using Nickel-NTA
affinity chromatography (Solarbio, Beijing, China) following standard protocols.
Purified N-His6-EasC was concentrated and exchanged with ultrafiltration buffer (50
mM Tris–HCl, 50 mM NaCl, and 10% (v:v) glycerol, pH 7.5) using 30 kDa Amicon
Ultra (Merck Millipore). The protein was demonstrated by 12% SDS–PAGE. Protein
![Page 10: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/10.jpg)
S10
concentration was determined by Bradford assay using bovine serum albumin (BSA)
as a standard. The protein was stored at -20 °C.
13. In vitro assay of the catalatic activity of EasC.
EasC catalatic activity was assayed by monitoring the conversion of H2O2 into H2O and
O2. The reaction contained 20 mM PBS buffer (pH 7.0), 16 mM H2O2, and different
concentrations of EasC. The reactions were performed in 96-well plate at room
temperature. And the absorbance of reaction mixtures was recorded at a wavelength of
240 nm within 30 min using an Epoch multi-volume spectrophotometer system (BioTek,
USA).
14. In vitro conversion of compound 4 into 2 and 5 by EasC.
To test whether the EasC uses H2O2 as the oxidant to generate Compound I to initiate
the subsequent oxidative cy-clization, a typical 50 μL assay solution contained 50 mM
Tris-HCl buffer (pH 7.5), 10 μM EasC, 2 mM NADPH, 1 mM H2O2 and 1 mM substrate
4. The reactions were performed in an anerobic glove box at 28 °C for 4 hours and
quenched with 100 μL methanol. Protein precipitate from the reactions was removed
by centrifugation. The supernatant was then analyzed on HPLC and LCMS.
To study whether O2 was used as the oxidant to generate Compound I to initiate the
subsequent oxidative cy-clization, a typical 50 μL assay solution contained 50 mM Tris-
HCl buffer (pH 7.5), 10 μM EasC, 2 mM NADPH and 1 mM substrate 4. For the no
oxygen reactions, the EasC reactions were performed in nitrogen-saturated glove box.
For the oxygen reactions, the EasC reactions were exposed to oxygen. Then the EasC
reaction was also conducted in the 18O2 saturated buffer with the absence of O2. To study
whether H2O was the co-substrate for EasC, the components of reaction were the same
as above with the exception that the H218O was used to prepare Tris-HCl buffer. All the
reactions were performed at 28 °C for an hour and quenched with 100 μL methanol.
Protein precipitate from the reactions was removed by centrifugation. The supernatant
was then analyzed on HPLC and LCMS.
For the time course of enzyme reactions, the reactions were quenched with 100 μL
methanol at 20, 40 and 60 min, respectively.
15. Effect of H2O2 on EasC activity.
To study the effect of H2O2 on EasC activity, the reaction mixture contained 20 mM
PBS buffer (pH 7.5), 2 mM NADPH, 2.5 μM EasC, 1 mM substrate 4, and different
concentrations (0, 5, 10, 15, 20, 25 and 30 mM) of H2O2. Negative control was
performed with boiled EasC and removal of H2O2 as other components remained as
above. All the reactions were performed at 28 °C for 30 min and quenched with 100 μL
methanol. Protein precipitate from the reactions was removed by centrifugation. The
supernatant was then analyzed on HPLC. The amount of substrate 4 in boiled EasC
mixture, and the production of compound 2 and 5 in reaction mixture without H2O2
were defined as 100%, respectively. Then the relative amount of substrate 4, compound
![Page 11: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/11.jpg)
S11
2 and compound 5 in reaction mixtures with the presence of H2O2 were calculated
accordingly. The consumption of substrate 4 in reaction mixtures with the presence of
H2O2 was also calculated.
16. Enzymatic generation of compound 2 and 5.
The biocatalytic reaction was set up as follows: 20 µM EasC, 3.5 mM compound 2 (10
mg), 5 mM NADPH, 2.5% DMSO, 50 mM Tris-HCl pH 7.5, 5% glycerol. Two 5 mL
reactions were run in 50 mL Falcon tube for 1 h at 28 °C. Equal volume of EtOAc was
added and stirred thoroughly to stop the reaction and extract for three times. The
combined organic fractions were dried with Na2SO4 and concentrated by rotary
evaporation to remove solvent. The product was filtrated and subjected to semi-
prepared HPLC chromatography on Welch column (250×10 mm, 5 μm, 25 ºC, flow 2.5
mL/min) with gradient wash from 10% to 40% MeCN in water with 0.1% formic acid
for 25 min. The purified fraction was cooled immediately on ice. The solvent was
quickly removed under reduced pressure to yield 1.5 mg of compound 2 and 4 mg of
compound 5. The purity of each compound was checked by LCMS, and the structure
was confirmed by NMR measurement and comparison with those reported3. NMR
spectra were obtained using DMSO-d6 or CD3OD as solvent on Bruker AV500
spectrometer.
17. In vitro activity assay for interconversion of compound 2 into compound 5 by
EasC.
For the conversion of compound 2 into compound 5 by EasC, the 50 μL reaction
mixture contained 50 mM Tris-HCl buffer (pH 7.5), 2 mM NAD/NADPH, with or
without 1 mM H2O2, 10 μM EasC and 1 mM compound 2. For the conversion of
compound 5 into compound 2 by EasC, the 50 μL reaction mixture contained 50 mM
Tris-HCl buffer (pH 7.5), 2 mM NAD/NADPH, with or without 1 mM H2O2, 10 μM
EasC and 1 mM compound 5. The reactions were performed at 28 °C for 4 hours and
quenched with 100 μL methanol. Protein precipitate from the reactions was removed
by centrifugation. The supernatant was then analyzed on HPLC as the method
mentioned above.
18. In vitro inhibition of EasC activity by DMPO, 5-HTP and L-AA.
To study whether the conversion of chanoclavine-I into chanoclavine-I aldehyde was
triggered by hydroxyl radical, we used hydroxyl radical scavengers to remove the
hydroxyl radical produced in catalytic process. The 50 μL reaction mixture contained
20 mM PBS buffer (pH 7.5), 2 mM NADPH, 10 μM EasC, 1 mM compound 4 and 10
mM of different hydroxyl radical scavengers (DMPO, 5-HTP and L-AA, respectively).
The reactions were performed at 28 °C for an hour and quenched with 100 μL methanol.
Protein precipitate from the reactions was removed by centrifugation. The supernatant
was then analyzed on HPLC as the method mentioned above.
19. In vitro conversion of compound 2 into compound 5 by hydroxyl radical.
To study whether the conversion of chanoclavine-I into chanoclavine-I aldehyde was
![Page 12: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/12.jpg)
S12
triggered by hydroxyl radical, we used Feton reaction4,5 to produce hydroxyl radical in
virto. 50 μL reaction mixture contained 50 mM Tris-HCl buffer (pH 7.5), 2 mM Fe2+,
1 mM H2O2, 2 mM L-AA and 2 mM compound 2. The reactions were performed at
28 °C for 4 hours and quenched with 100 μL methanol. Protein precipitate from the
reactions was removed by centrifugation. The supernatant was then analyzed on HPLC
as the method mentioned above.
20. Computational details
Conformations of each species were generated using Maestro with the OPLS3 force
field and water solvation model. Geometry optimization and frequency calculations
were performed with Gaussian09 at the uB3LYP-D3/6-31G(d) level of theory before
single point energy corrections at the uB3LYP-D3(BJ)/6-311+G(d,p) level of theory. In
all calculations, the PCM solvation model for water was used and free energies were
corrected with Truhlar’s rigid-rotor harmonic oscillator treatment6,7 through
Goodvibes.8
21. Phylogenetic analysis of EasC and its homologues
Catalases were aligned with ClustalW, and the tree was constructed with the Maximum
likelihood method. Scale bar, 0.3 substitutions per site. EasC is indicated with a red line.
PDB:1U2K, a catalase-peroxidase, is used as an outgroup in the phylogenetic analysis.
The protein sequences used are shown in Table S6.
![Page 13: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/13.jpg)
S13
Supplementary Tables
Table S1. Primers used in this study.
Primers Sequence (5’-3’) Function
For gene expression in A. nidulans
easF-F GCATCATTACACCTCAGCATTAATTAAggcggccgcatgacgatttcag
ctcctcccat
easF cloning
easF-R agtttaggccctaatgattgggttg easF cloning
gpdA-eF-F ggtatatattcaacccaatcattagggcctaaactactccggtgaattgatttgggtga gpdA promoter cloning
gpdA-eF-R gcactggaggcattggctgccttcatgagagtcattgtttagatgtgtctatgtggcgg gpdA promoter cloning
dmaW-F atgactctcatgaaggcagccaat dmaW cloning
dmaW-R GGAGGACATACCCGTAATTTTCTGGGCATTTAAATatatgattatc
ttagtgttctgga
dmaW cloning
easE-F TAAACCCCACAGAAGGCATTTTTAATTAAggatccatgccatttgttttc
agctttcta
easE cloning
easE-R GAGACCCAACAACCATGATACCAGGGGATTTAAATgtgctgaat
tcccttcgtgctgta
easE cloning
easC-F ccacatagacacatctaaacaTTAATTAAggatccatgctaattgagcgtgggttattg easC cloning
easC-R AGGGTATCATCGAAAGGGAGTCATCCAATTTAAATagtgatcttt
ataagcattagtta
easC cloning
For gene expression in S. cerevisiae
55-easE-F ctagcgattataaggatgatgatgataagactagtatgccatttgttttcagctttcta easE cloning
55-easE-R tcatttaaattagtgatggtgatggtgatgcacgtgttagcggtatacccgctggg easE cloning
For protein expression in E. coli
28a-easC-F agcagcggcctggtgccgcgcggcagccatatgctaattgagcgtgggttattgt EasC expression
28a-easC-R atctcagtggtggtggtggtggtgctcgagtcagagcctggaaagagagacttgt EasC expression
For dmaW knockout
KODmaWupF GGCGAATTGGGTACCGGGCCCCCCCTCGAGcacctggaggccaga
gtgaagggaa
dmaW knockout
KODmaWupR tacgactttgatggtcgttgtagcggccgcgagagtcatcttggataagggcata dmaW knockout
S2 GTCTGCTGCTCCATACAAGCCAAC dmaW knockout
KODmaWdnF acacttgtttagaggtaatcctGCGGCCGCtgaacagctcgggacttacttccgg DmaW knockout
KODmaWdnR GGCGAATTGGGTACCGGGCCCCCCCTCGAGtgaagccgagatcgg
gagcttcggc
dmaW knockout
S3 tcggagggcgaagaatctcgt dmaW knockout
test1F atgttccaactgcttggccagatg dmaW knockout
test1R gctcggtataagctctccacctatc dmaW knockout
test2F caatagtaaccatgcatggttgcct dmaW knockout
test2R tattggaaggggagaaggccagttg dmaW knockout
![Page 14: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/14.jpg)
S14
Table S2. Plasmids used in this study.
Name Gene expressed Backbone Restriction sites Selection markers
pYYP-1 dmaW, easF pYTU NotI/SwaI uracil (pyrG)
pYYP-2 easE pYTP BamHI/SwaI pyridoxine (pyroA)
pYYP-3 easC pYTR BamHI/SwaI riboflavin (riboB)
pYYP-4 easE pXW55 SpeI/PmlI uracil (URA3)
pET28a-easC easC pET28a NdeI/XhoI Kanamycin (Kan)
![Page 15: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/15.jpg)
S15
Table S3. S. cerevisiae and A. nidulans strains used in this study.
Genotype Description Description
A. nidulans + DmaW + EasF A. nidulans A1145 ∆ST∆EM + pYYP-1
A. nidulans + DmaW + EasF + EasE A. nidulans A1145 ∆ST∆EM + pYYP-1 + pYYP-2
A. nidulans + DmaW + EasF + EasE + EasC A. nidulans A1145 ∆ST∆EM + pYYP-1 + pYYP-2 + pYYP-3
A. nidulans + EasE A. nidulans A1145 ∆ST∆EM + pYYP-2
Yeast + EasE S. cerevisiae BJ5464-NpgA + pYYP-4
![Page 16: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/16.jpg)
S16
Table S4. Functions of the ORFs in ergot alkaloids gene cluster.
Gene Function Coverage/
identity
Organism Accession no.
easA NADPH dehydrogenase Oye3, putative 100/99 A. fumigatus B5233 XM_751040.1
easG festuclavine synthase 89/99 A. fumigatus B5233 GU929210.1
easK cytochrome P450 monooxygenase 75/100 A. fumigatus Af293 XM_751042.1
easL reverse prenyl transferase 100/100 A. fumigatus NRRL6113 JN651499.1
easD short chain dehydrogenase 92/100 A. fumigatus Af293 XM_751044.1
easM cytochrome P450 monooxygenase 84/99 A. fumigatus Af293 XM_751045.1
easN O-acetyltransferase, putative 100/100 A. fumigatus Af293 XM_751046.1
easC catalase 96/100 A. fumigatus Af293 XM_751047.1
dmaW dimethylallyl tryptophan synthase 98/100 A. fumigatus Af293 XM_751048.2
easE FAD binding oxidoreductase 90/100 A. fumigatus Af293 XM_751049.1
easF 4-dimethylallyltryptophan
methyltransferase
94/99 A. fumigatus B5233 EU827256.1
![Page 17: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/17.jpg)
S17
Table S5. 1H NMR (500 MHz) and 13C NMR (125 MHz) data of compound 1, 4, 2, and 5 in DMSO-d6.
1 4a 2 5
Position δH (J in Hz) δC δH (J in Hz) δC δH (J in Hz) δC δH (J in Hz) δC
1-NH 10.94 (1H, br d) - - - - - 10.78 (1H, br s) -
2 7.25 (1H, d, 1.85) 124.64 7.25 (1H, s) 126.19 7.07 (1H, s) 119.89 7.07 (1H, s) 119.83
3 - 110.44 - 110.09 - 108.29 - 109.69
4 3.47 (1H, dd, 4.29, 15.44)
3.11 (1H, dd, 8.8, 15.44)
28.97 3.82 (1H, m)
3.27 (1H, dd, 11.17, 16.52)
30.32 3.21 (1H, dd, 14.9, 3.6)
2.89 (1H, dd, 14.1, 8.0)
24.08 3.25 (1H, dd, 15.2, 3.3)
2.76 (1H, dd, 14.9, 8.2)
25.72
5 3.71 (1H, t, 6.19) 64.84 3.80 (1H, br s) 65.87 3.16 (1H, m) 60.25 3.07 (1H, m) 60.83
5-CO2H - 169.69 - 173.40 - - - -
6-NH - - - - - - - -
6-CH3 2.37 (1H, 3H, s) 33.06 2.49 (3H, s) 33.13 2.52 (3H, s) 31.97 2.41 (3H, s) 33.30
7 1.73 (3H, s) 26.04 5.06 (1H, s)
5.11 (1H, s)
117.19 3.93 (2H, br s) 66.72 9.51 (1H, s) 196.03
8 - 137.56 - 144.26 - 140.22 - 140.46
9 5.31 (1H, t, 6.80) 124.46 6.86 (1H, d, 15.77) 134.63 5.32 (1H, d, 9.6) 122.98 6.66 (1H, d, 9.8) 155.25
10 3.41 (2H, dd, 4.44, 8.57) 31.99 7.36 (1H, d, 15.77) 128.61 4.05 (1H, t, 8.2, 8.2) 40.91 4.23, (1H, t, 8.8) 43.56
11 - 131.69 - 132.46 - 130.55 - 129.23
12 7.18 (1H, d, 8.04) 119.14 7.21 (1H, d, 7.31) 118.10 6.62 (1H, d, 7.0) 115.57 7.19 (1H, d, 8.05) 110.03
![Page 18: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/18.jpg)
S18
13 6.96 (1H, t, 7.62) 121.52 7.10 (1H, d, 7.73) 123.16 7.02 (1H, t, 7.6) 122.55 7.00 (1H, t, 7.58) 122.50
14 6.71 (1H, d, 7.15) 109.96 7.27 (1H, d, 8.02) 112.07 7.18 (1H, d, 8.1) 109.66 6.52 (1H, d, 7.04) 115.47
15 - 134.03 - 139.42 - 134.08 - 134.24
16 - 125.30 - 125.67 - 126.00 - 126.19
17 1.72 (3H, s) 18.38 2.12 (3H, s) 19.24 1.78 (3H, s) 14.57 1.87 (3H, s) 9.94
a Detected in CD3OD.
![Page 19: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/19.jpg)
S19
Table S6. EasC homologues and catalases used for phylogenetic analysis.
Accession GB/
PDB number Organism Clade Note
1U2K Escherichia coli K12 out group catalase-peroxidase
AAG45152.2 Emericella nidulans Clade III fungal catalases
AAK15159.1 Pleurotus sajur caju Clade III fungal catalases
AAL34518.2 Paracoccidioides brasiliensis Clade III fungal catalases
AAN28380.1 Ajellomyces capsulatus Clade III fungal catalases
AAS54235.1 Ashbya gossypii Clade III fungal catalases
CAG85670.1 Debaryomyces hanseii Clade III fungal catalases
CAG89167.1 Debaryomyces hanseii Clade III fungal catalases
CAH00677.1 Kluyveromyces lactis Clade III fungal catalases
CAH00807.1 Kluyveromyces lactis Clade III fungal catalases
CAC35154.1 Glomerella cingulata Clade III fungal catalases
CAA94095.1 Saccharomyces cerevisiae Clade III fungal catalases
EAS33312.3 Coccidioides immitis Clade III fungal catalases
NP_011602.2 Saccharomyces cerevisiae Clade III fungal catalases
ACM47224.1 Epichloe festucae EasC homologues
AET10046.1 Epichloe glyceriae EasC homologues
AET10058.1 Epichloe brachyelytri EasC homologues
AET79197.1 Claviceps paspali EasC homologues
AEV21226.1 Periglandula ipomoeae EasC homologues
AFO67562.1 Epichloe inebrians EasC homologues
AGN90632.1 Epichloe funkii EasC homologues
![Page 20: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/20.jpg)
S20
AGS31986.1 Epichloe canadensis EasC homologues
AGS31996.1 Epichloe mollis EasC homologues
AGS32020.1 Epichloe coenophiala EasC homologues
AGS32037.1 Epichloe canadensis EasC homologues
ATJ44714.1 Epichloe bromicola EasC homologues
EGD89816.2 Trichophyton rubrum EasC homologues
GAD93028.1 Byssochlamys spectabilis EasC homologues
GAQ03948.1 Aspergillus lentulus EasC homologues
GBF63861.1 Trichophyton mentagrophytes EasC homologues
KFG79549.1 Metarhizium anisopliae EasC homologues
KHN97496.1 Metarhizium album EasC homologues
KID83105.1 Metarhizium guizhouense EasC homologues
KXG48662.1 Penicillium griseofulvum EasC homologues
PYI33860.1 Aspergillus indologenus EasC homologues
Q6ZXC2.1 Claviceps purpurea EasC homologues
W6QJS4.1 Penicillium roqueforti EasC homologues
XP_003017762.1 Trichophyton benhamiae EasC homologues
XP_003023997.1 Trichophyton verrucosum EasC homologues
XP_003171364.1 Nannizzia gypsea EasC homologues
XP_007813324.1 Metarhizium acridum EasC homologues
XP_016600810.1 Penicillium expansum EasC homologues
XP_025554347.1 Aspergillus homomorphus EasC homologues
XP_756140.1 Aspergillus fumigatus EasC in this study
CRL19774.1 Penicillium camemberti EasC homologues
A8C7R6.1 Claviceps fusiformis EasC homologues
![Page 21: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/21.jpg)
S21
AAL46177.1 Agrobacterium tumefasciens Clade II bacterial catalases
YP_426444.1 Rhodospirillum rubrum Clade II bacterial catalases
YP_533479.1 Rhodopseudomonas palustris Clade II bacterial catalases
YP_567756.1 Rhodopseudomonas palustris Clade II bacterial catalases
AAW60905.1 Gluconobacter oxydans Clade II bacterial catalases
ABA78538.1 Rhodobacter sphaeroides Clade II bacterial catalases
BAB49315.1 Mesorhizobium loti Clade II bacterial catalases
CAC48410.1 Sinorhizobium meliloti Clade II bacterial catalases
WP_145777976.1 Escherichia coli Clade II bacterial catalases
YP_001165949.1 Novosphingobium aromaticivorans Clade II bacterial catalases
YP_745419.1 Granulibacter bethesdensis Clade II bacterial catalases
YP_761162.1 Hyphomonas neptunium Clade II bacterial catalases
ZP_00629992.1 Paracoccus denitrificans Clade II bacterial catalases
ZP_01001222.1 Oceanicola batsensis Clade II bacterial catalases
ZP_01227619.1 Aurantimonas sp Clade II bacterial catalases
AAO72713.1 Melopsittacus undulatus Clade III
AAQ85160.1 Tetrahymena thermophila Clade III
AAR90327.1 Anopheles gambiae Clade III
AAU44617.1 Oplegnathus fasciatus Clade III
AAZ35494.1 Pseudomonas syringae Clade III
AAZ69791.1 Methanosarcina barkeri Clade III
ABA76790.1 Pseudomonas fluorescens Clade III
ABE51505.1 Methanococcoides burtonii Clade III
ABF12458.1 Ralstonia metallidurans Clade III
CAA52796.1 Streptomyces venezuelae Clade III
![Page 22: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/22.jpg)
S22
CAA71618.1 Ascarix suum Clade III
CAC28086.1 Methanobrevibacter arboriphilus Clade III
CAG22159.1 Photobacterium profundum Clade III
EAP83846.1 Sulfitobacter sp Clade III
EAP95416.1 Vibrio splendidus Clade III
EAR06324.1 Alteromonas macleodii Clade III
NP_536731.1 Drosophila melanogaster Clade III
NP_630307.1 Streptomyces coelicolor Clade III
NP_999466.2 Sus scrofa Clade III
YP_003198102.1 Desulfohalobium retbaense Clade III
YP_003709029.1 Waddlia chondrophila Clade III
YP_003806764.1 Desulfarculus baarsii Clade III
YP_832557.1 Arthrobacter sp. Clade III
ZP_00989482.1 Vibrio splendidus Clade III
ZP_01109273.1 Alteromonas macleodii Clade III
ZP_07016679.1 Desulfonatronospira thiodismutans Clade III
ZP_07332429.1 Desulfovibrio fructosovorans Clade III
EFA82574.1 Polysphondylium pallidum Clade III
YP_131959.1 Photobacterium profundum Clade III
YP_289707.1 Thermobifida fusca Clade III
XP_002671483.1 Naegleria gruberi Clade III
YP_004370212.1 Desulfobacca acetoxidans Clade III
YP_587727.1 Ralstonia metallidurans Clade III
YP_788883.1 Pseudomonas aeruginosa Clade III
AAD45528.2 Toxoplasma gondii Clade III
![Page 23: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/23.jpg)
S23
AAF40672.1 Neisseria meningitidis Clade III
AAN76688.1 Apis mellifera Clade III
AAO67502.1 Edwardsiella tarda Clade I
AAO67504.1 Edwardsiella tarda Clade I
BAA09937.1 Deinococcus radiodurans Clade I
CAI89248.1 Pseudoalteromonas haloplanktis Clade I
EAS45409.1 Photobacterium profundum Clade I
NP_295721.1 Deinococcus radiodurans Clade I
YP_002787790.1 Deinococcus deserti Clade I
YP_004169988.1 Deinococcus maricopensis Clade I
YP_004264025.1 Deinococcus proteolyticus Clade I
YP_004668966.1 Myxococcus fulvus Clade I
YP_341694.1 Pseudoalteromonas haloplanktis Clade I
YP_594235.1 Deinococcus geothermalis Clade I
YP_793072.1 Pseudomonas aeruginosa Clade I
ZP_01217816.1 Photobacterium profundum Clade I
![Page 24: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/24.jpg)
S24
Supplementary Figures
Figure S1. Clinically used natural and semi-synthetic ergot alkaloids (the central C
ring is marked in red).
![Page 25: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/25.jpg)
S25
easA G K L D NM C dmaW E F
2 kb
Reductase P450 Prenyltransferase Oxidase FAD-linked oxidoreductase Acetyltransferase Catalase Methyltransferase
Figure S2. Biosynthetic gene clusters of ergot alkaloid in A. fumigatus.
![Page 26: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/26.jpg)
S26
15.0 16.0 17.0 18.0 19.014.0
EIC ([M+H]+): m/z 367
Retention time (min)
dmaW+1∆
dmaW∆
dmaW+4∆
∆dmaW+2
dmaW+5∆
WT
Fumigaclavine C standard
3
i
ii
iii
iv
v
vi
vii
13.0 20.0 21.0
Figure S3. LCMS analysis of product profiles of A. fumigatus ∆dmaW strain and
chemical complementation studies.
![Page 27: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/27.jpg)
S27
WT
dmaW
php
∆dmaW
test1F
test1R
test2F
test2R
∆dm
aW
∆dm
aW
WT
test1F/test1R
WT
test2F/test2R
1 2 3 4 5
a b
Figure S4. Gene knock-out of dmaW in A. fumigatus. (a) Scheme of hygromycin-
resistance split-marker approach for gene knock-out of dmaW. (b) Confirmation of the
dmaW mutant by PCR.
![Page 28: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/28.jpg)
S28
Intensity (x 106)
Figure S5. UV and MS spectra of compound 1.
AU
0.00
0.10
0.20
0.30
0.40
0.50
0.60
0.70
0.80
0.90
1.00
1.10
纳米
200.00 220.00 240.00 260.00 280.00 300.00 320.00 340.00 360.00 380.00 400.00
![Page 29: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/29.jpg)
S29
Figure S6. Alignment of amino acid sequences of EasE homologous proteins with
FAD-linked protein. EasE homologous proteins PYI33859.1 (Aspergillus
indologenus), XP_025554349.1 (Aspergillus homomorphus), AFO67564.1 (Epichloe
inebrians), AEV21224.1 (Periglandula ipomoeae), AET10036.1 (Epichloe festucae),
AGS31974.1 (Epichloe amarillans), AET79192.1 (Claviceps purpurea), EasE-Aj
(EasE from Aspergillus japonicus)3, EasE-Af (EasE from Aspergillus fumigatus) and
PDB 4PZF (a FAD-linked protein from Eschscholzia californica) were used to perform
the homologous alignment. The histidine and cysteine involved in the bi-covalently
binding of FAD, are indicated by inverted triangle.
![Page 30: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/30.jpg)
S30
Intensity (× 106)
Figure S7. UV and MS spectra of compound 4.
AU
0.00
0.05
0.10
0.15
0.20
0.25
0.30
0.35
0.40
0.45
0.50
0.55
0.60
纳米
200.00 220.00 240.00 260.00 280.00 300.00 320.00 340.00 360.00 380.00 400.00
![Page 31: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/31.jpg)
S31
Figure S8. Confirmation the function of EasE by whole cell biotransformation. (a)
HPLC analysis of product profiles of compound 1 fed to A. nidulans expressing easE.
Trace i and ii were product profiles of compound 1 fed to A. nidulans with easE and
without easE, respectively. (b) HPLC analysis of product profiles of compound 1 fed
to S. cerevisiae expressing easE. Trace i and ii were product profiles of compound 1 fed
to S. cerevisiae with easE and without easE, respectively.
time (min)
i
ii
13.012.011.0 12.011.010.0
i
ii
time (min)
a b1 144
280 nm 280 nm
![Page 32: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/32.jpg)
S32
![Page 33: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/33.jpg)
S33
Figure S9. Alignment of amino acid sequences of the small subunit size catalases (SSCs) with EasC and its homologues. The conserved residues
112T, 114L, and 202M of EasC are labeled with black triangle, but switch to V, G, and P in SSCs, respectively.
![Page 34: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/34.jpg)
S34
Figure S10. Predicted structure of EasC. (a) Cartoon representation of predicted
structure of EasC. The predicted structure was assembled using the RaptorX web server
(http://raptorx.uchicago.edu). The crystal structure of catalase from Saccharomyces
cerevisiae (PDB entry: 1A4E) was used as template for simulation (P-value: 1.65e-20).
(b) Stereo view of EasC active sites. Heme (red) was localized at the bottom of a
channel (surrounded with active sites His71, Ser110, Asn145, Phe157 and Phe149
shown in green) ending with a water molecule (blue). Active site Tyr361 was bonded
with heme. (c) Localization of NADPH. Residues His190, Ser197, Trp299 and Leu301
(green) perhaps formed interaction with NADPH (purple). The structure was rendered
using the PyMOL Version 2.2.3 software.
![Page 35: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/35.jpg)
S35
ba
Figure S11. SDS-PAGE of purified EasC and catalase activity assay. (a) EasC
containing an N-terminal His6-Tag (~61 kDa) was purified from E. coli BL21 (DE3).
(b) Catalase activity of expressed EasC. The reaction contained 20 mM PBS buffer (pH
7.0), 16 mM H2O2, and different concentrations of EasC. The reactions were performed
in 96-well plate at room temperature. And the absorbance of reaction mixtures was
recorded at a wavelength of 240 nm within 30 min. The lines show the loss in
absorbance at 240 nm, corresponding to disproportionation of 16 mM H2O2 by different
amount of EasC.
![Page 36: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/36.jpg)
S36
Figure S12. UV spectra of EasC. Purified EasC exhibited the characteristic heme
absorbance at 406 nm in UV-Vis spectra.
![Page 37: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/37.jpg)
S37
Figure S13. HPLC analysis of the binding NADPH in EasC proteins.
0 1.0 2.0 3.0 4.0
time (min)
Boiled EasC
NADPH standardi
ii
nm200 225 250 275 300 325 350 375
mAU
0
10
20
30
40
nm200 225 250 275 300 325 350 375
mAU
0
200
400
600
800
![Page 38: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/38.jpg)
S38
Intensity (x 105)
Figure S14. UV and MS spectra of compound 2.
AU
0.000
0.010
0.020
0.030
0.040
0.050
0.060
0.070
0.080
0.090
纳米
200.00 220.00 240.00 260.00 280.00 300.00 320.00 340.00 360.00 380.00 400.00
![Page 39: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/39.jpg)
S39
Figure S15. HPLC analysis of deoxygenated and nitrogen-saturated EasC reactions
with the presence of H2O2. The reaction mixture contained 50 mM Tris-HCl buffer (pH
7.5), 2 mM NADPH, 10 μM EasC, 1 mM H2O2, and 1 mM substrate 4. For the no
oxygen reactions, the EasC reactions were performed in nitrogen-saturated glove box.
Boiled EasC was used as negative control. All the reactions were performed at 28 °C
for 4 hours and quenched with 100 μL methanol.
4
280 nm
52
EasC+4+H2O2
+no oxygen
i
ii
Boiled EasC+4
+H2O2 + no oxygen
time (min)
9.08.07.0 12.011.010.0 13.0
![Page 40: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/40.jpg)
S40
Figure S16. HPLC analysis of deoxygenated and nitrogen-saturated EasC reactions.
The reaction mixture contained 50 mM Tris-HCl buffer (pH 7.5), 2 mM NADPH, 10
μM EasC, 1 mM substrate 4. For the no oxygen reactions, the EasC reactions were
performed in nitrogen-saturated glove box. Boiled EasC and active EasC reactions
exposed to oxygen were used as negative and positive control, respectively. All the
reactions were performed at 28 °C for an hour and quenched with 100 μL methanol.
time (min)
9.08.07.0 12.011.010.0
4
280 nm
13.0
52
Boiled EasC+4
EasC+4+oxygen
EasC+4+no oxygen
i
ii
iii
![Page 41: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/41.jpg)
S41
Figure S17. Effect of H2O2 on EasC activity.
(a) In vitro reconstitution of the activity of EasC under varying concentrations of
H2O2. Reaction conditions are 20 mM PBS buffer (pH 7.5), 2 mM NADPH, 2.5 μM
EasC, 1 mM substrate 4, and different concentrations (0, 5, 10, 15, 20, 25 and 30 mM)
of H2O2, 28 °C for 30 min. The amount of substrate 4 in boiled EasC mixture, and the
production of compound 2 and 5 in reaction mixture without H2O2 were defined as
100%, respectively. Then the relative amount of substrate 4, compound 2 and
compound 5 in reaction mixtures with the presence of H2O2 were calculated accordingly.
The experiments were performed thrice, and data were expressed as mean ± standard.
(b) Effect of H2O2 on the consumption of substrate 4 in EasC reaction. The reaction
mixture contained 20 mM PBS buffer (pH 7.5), 2 mM NADPH, 2.5 μM EasC, 1 mM
substrate 4, and different concentrations (0, 5, 10, 15, 20, 25 and 30 mM) of H2O2. All
the reactions were performed at 28 °C for 30 min and quenched with 100 μL methanol.
The amount of substrate 4 in the boiled EasC reaction was defined as 100%. The
consumption of substrate 4 in EasC reaction mixture with different concentrations of
H2O2 was calculated accordingly. The experiments were performed thrice, and data
were expressed as mean ± standard.
![Page 42: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/42.jpg)
S42
Figure S18. HR-ESI-MS analysis of compound 2 generated from EasC reaction in
H218O prepared buffer. LC-HRMS data: chanoclavine-I 2 [M + H]+ m/z: calculated
257.1654, observed 257.1647
x10
0
0.5
1
1.52
2.5
3
3.5
4
4.5
5
5.5
6
6.5
257.1647
50 100 150 200 250 300 350 400 450 500 550 600
m/z
5
![Page 43: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/43.jpg)
S43
Figure S19. EasC reaction without NADPH. The reaction mixture contained 50 mM
Tris-HCl buffer (pH 7.5), 10 μM EasC, 1 mM compound 4. All the reactions were
performed at 28 °C for 2 hours and quenched with 100 μL methanol.
time (min)
42 5
12.07.0 8.0 9.0 10.0 11.0
4+Boiled EasC
4+EasC: 2 h
280 nmi
ii
![Page 44: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/44.jpg)
S44
Intensity (× 105)
Figure S20. UV and MS spectra of compound 5.
AU
0.00
0.05
0.10
0.15
0.20
0.25
0.30
0.35
纳米
200.00 220.00 240.00 260.00 280.00 300.00 320.00 340.00 360.00 380.00 400.00
![Page 45: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/45.jpg)
S45
5+NAD+NADPH
5+NADPH+EasC
a
i
ii
iii
iv
v
2 Standard
5 Standard
5+NADPH+H2O2+EasC
8.07.0 9.0
time (min)
280 nm
52 b
7.0
time (min)
i
ii
iii
iv
5 Standard
2 Standard
2+NAD+NADPH
8.0 9.0
2+NADPH+EasC
v
280 nm
52
2+NADPH+H2O2+EasC
Figure S21. HPLC analysis of in vitro interconversion of compound 2 into compound
5 by EasC. (a) In vitro reactions of EasC enzyme using compound 5 as substrate. (b) In
vitro reactions of EasC enzyme using compound 2 as substrate. The reaction mixture
contained 50 mM Tris-HCl buffer (pH 7.5), 2 mM NAD/NADPH, with or without 1
mM H2O2, 10 μM EasC, 1 mM compound 2 or 5. All the reactions were performed at
28 °C for 4 hours and quenched with 100 μL methanol.
![Page 46: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/46.jpg)
S46
Figure S22. In vitro conversion of compound 2 to 5 by hydroxyl radicals generated via
the Fenton reaction. The reaction mixture contained 50 mM Tris-HCl buffer (pH 7.5),
2 mM Fe2+, 1 mM H2O2, 2 mM L-AA and 2 mM compound 2.
2+Fe2+
+H2O2+L-AA
2 standard
280 nm
time (min)
i
ii
iii
2+Fe2+
+H2O2
8.07.0 10.09.06.0
52
![Page 47: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/47.jpg)
S47
Figure S23. Computed reaction mechanism for the conversion of 6 to 9 at B3LYP-
D3BJ/6‐311++G(d,p)−PCM(diethylether)//B3LYP/6-31G(d)−PCM(diethylether)
level. All electronic (E) and Gibbs (G) energy values are given in kcal mol-1
6
ΔH = 0.0 kcal/mol
ΔG = 0.0 kcal/mol
TS1
ΔH = -0.5 kcal/mol
ΔG = -0.9 kcal/mol
7
ΔH = +2.6 kcal/mol
ΔG = -8.7 kcal/mol
TS2
ΔH = +7.3 kcal/mol
ΔG = -2.6 kcal/mol
9
ΔH = -10.1 kcal/mol
ΔG = -19.6 kcal/mol
![Page 48: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/48.jpg)
S48
Figure S24. Consumption of substrate 4 in EasC reaction mixture with the presence of
radial scavenger. 10 mM of 5-HTP, L-AA and DMPO was added in the EasC reaction mixture,
respectively. The reactions were performed at 28 ℃ for an hour. The amount of substrate 4 in
the boiled EasC reaction was defined as 100%. The consumption of substrate 4 in EasC
reaction mixture with or without radial scavenger was calculated accordingly. The
experiments were performed thrice, and data were expressed as mean ± standard.
![Page 49: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/49.jpg)
S49
Figure S25. The homologues of EasC. The homologues of EasC have been found using
the Basic Local Alignment Search Tool (BLAST), and over hundreds of amino acid
sequences with an overall sequence identity of >40%.
![Page 50: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/50.jpg)
S50
Continued Figure S25.
![Page 51: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/51.jpg)
S51
Figure S26. 1H-NMR of compound 1 in DMSO-d6 (500 MHz).
H3-17
6-CH3
DMSO-d6
![Page 52: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/52.jpg)
S52
Figure S27. 13C NMR and DEPT spectrum of compound 1 in DMSO-d6 (125 MHz).
d6-DMSO
![Page 53: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/53.jpg)
S53
Figure S28. 1H-NMR of compound 4 in CD3OD (500 MHz).
![Page 54: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/54.jpg)
S54
Figure S29. 13C-NMR of compound 4 in CD3OD (125 MHz).
![Page 55: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/55.jpg)
S55
Figure S30. HSQC spectrum of compound 4 in CD3OD.
H3-17 6-CH3
H-4a
CD3OD
H-5
H-4b
H-7a,7b H-9 H-13
H-10, 14, 2, 12
C17
C4 6-CH3
C5
C3 C14C7C12C13 C16C2
C11C9
C10
C15C8
5-COOH
H2O
![Page 56: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/56.jpg)
S56
Figure S31. HMBC spectrum of compound 4 in CD3OD.
H3-17 H3-6
H-4a
CD3OD
H-5
H-4b
H-7a,7b H-13 H-9
H-10, 14, 2, 12
C17
C4 6-CH3
C5
C3 C14
C7 C12 C13 C16 C2 C10
C11 C9
C15 C8
5-COOH
![Page 57: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/57.jpg)
S57
Figure S32. NOESY spectrum of compound 4 in CD3OD.
![Page 58: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/58.jpg)
S58
Figure S33. 1H-NMR of compound 2 in DMSO-d6 (500 MHz).
H2-7
H3-17
H-4a H-4b
H-10
H-9
H-12 H-13
H-2
H-14
H-1
6-CH3
DMSO -d6
H-5
![Page 59: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/59.jpg)
S59
Figure S34. 13C-NMR and DEPT of compound 2 in DMSO-d6 (500 MHz).
C17
C4 6-CH3
C5
C7
C3
C14 C12 C2 C13
C9 C16
C11
C15
C8
C10
![Page 60: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/60.jpg)
S60
Figure S35. HSQC spectrum of compound 2.
H3-17
H-4a H-4b
H2-7
H-10 H-9
H-12 H-14, 2, 13 H-1
C17
C4
6-CH3
6-CH3
6-CH3
C7
C5
C3 C14 C12 C2
C13, C9 C16
C11
C8 C15
H-5
![Page 61: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/61.jpg)
S61
Figure S36. COSY spectrum of compound 2.
H3-17
H3-6
H-4a H-4b
H2-7
H-10 H-9 H-12
H-14, 2, 13
H3-17
H3-6
H-4a
H-4b
H2-7 H-10
H-9
H-12
H-14, 2, 13
H-5
H-5
(9, 10)
(10, 5)
(4b, 4a) (5, 4a)
(13, 12)
(13, 14)
![Page 62: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/62.jpg)
S62
Figure S37. HMBC spectrum of compound 2.
H3-17 6-CH3
H-4a H-4b
H-5 H2-7
H-10 H-9
H-12 H-14, 2, 13 H1
C17
C4
6-CH3
C10
C5
C7
C3, C14
C12 C2
C13, C9 C16 C11
C15 C8
![Page 63: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/63.jpg)
S63
Figure S38. ROESY spectrum of compound 2.
![Page 64: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/64.jpg)
S64
Figure S39. 1H-NMR of compound 5 in DMSO-d6 (500 MHz).
H3-17 6-CH3
DMSO-d6
H-4a H-5
H-4a
××
×
×
H-10
H-14
H-9
H-13
H-2
H-12 H-7
H-1
![Page 65: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/65.jpg)
S65
Figure S40. 13C NMR spectrum of compound 5 in DMSO-d6 (125 MHz).
C17
C4
× ×
6-CH3
×
×
× C10
C5
×
×
C3
C12 C14 C2
C16
C13
C11
×
C15 C8 C9
C7
![Page 66: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/66.jpg)
S66
Figure S41. HSQC spectrum of compound 5.
H3-17
6-CH3
H-4a
H-5 H-4b
H-10 H-14
H-9
H-13 H-2
H-12 H-7
C17
C4
6-CH3
C10
C5
C3, C12 C14 C2
C13 C16 C11
C15 C8
C9
C7
![Page 67: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/67.jpg)
S67
Figure S42. COSY spectrum of compound 5.
H-4a
H3-17
6-CH3 H-4b
H-5
H-10
H-14
H-9
H-13
H-2
H-12
H3-17
6-CH3
H-4a
H-5 H-4b
H-10
H-14 H-9
H-13 H-2
H-12
(9, 10)
(10, 5)
(4b, 4a)
(4a, 5)
(13, 14)
(12, 13)
![Page 68: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/68.jpg)
S68
Figure S43. HMBC spectrum of compound 5.
H3-17
6-CH3
H-4a H-4b
H-5
H-10
H-14
H-9
H-13 H-2
H-12 H-7
H-1
C17
C4
6-CH3
C10
C5
C3 C12 C14 C2
C13 C16 C11
C15 C8
C9
C7
(H-7, C17)
(H-7, C8)
![Page 69: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/69.jpg)
S69
Figure S44. NOESY spectrum of compound 5.
H3-17
6-CH3
H-4a H-5
H-4b H-10
H3-17
6-CH3
H-4a
H-5
H-4b
H-10
H-14 H-9
H-13
H-2
H-12
H-14
H-9
H-13
H-2
H-12
(9, 5) (9, 4b)
(10, 17)
(10, 4a)
(10, 6-CH3)
![Page 70: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/70.jpg)
S70
Supplementary Computational Information
Computed Energies (Hartree)
Structure Electronic Energy Zero Point Energy Enthalpy Free Energy Quazi-Harmonic Free
Energy
6 -919.50679 0.321514 -919.16306 -919.23733 -919.23228
TS1 -919.50547 0.319182 -919.16384 -919.23978 -919.23376
7 -730.848698 0.307015 -730.522648 -730.589130 -730.585480
TS2 -730.83974 0.306674 -730.51521 -730.57749 -730.57575
9 -730.86992 0.309334 -730.54292 -730.60518 -730.60297
CO2 -188.651127 0.011241 -188.636274 -188.660614 -188.660614
Cartesian Coordinates
6
C -0.67140 1.42160 0.37410
C -1.61700 2.41760 -0.02120
C -1.25200 3.64280 -0.58670
C 0.10600 3.88000 -0.76660
C 1.06390 2.92090 -0.39810
C 0.71530 1.68420 0.16360
C -1.44320 0.31360 0.90500
C -2.76680 0.68080 0.80750
H -2.00250 4.37610 -0.86670
H 0.43540 4.82470 -1.19000
H 2.11570 3.15660 -0.53050
N -2.87510 1.93390 0.25670
H -3.64570 0.11990 1.09260
H -3.74020 2.42660 0.08970
C -1.01380 -1.02660 1.44840
H -0.13590 -0.92950 2.10140
H -1.81320 -1.42780 2.07610
C -0.71250 -2.08380 0.39780
H -0.58480 -3.09820 0.77670
C -2.59130 -2.42960 -0.42900
N 0.14870 -1.76510 -0.60380
H 0.11740 -0.80550 -0.93160
C 0.63110 -2.73880 -1.56800
H 1.54150 -2.35520 -2.03530
H 0.86500 -3.67410 -1.05230
H -0.12360 -2.93450 -2.33920
O -3.30300 -2.70600 0.50910
O -2.50550 -2.27880 -1.62310
C 1.73590 0.68610 0.50220
H 1.46980 -0.01990 1.28000
![Page 71: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/71.jpg)
S71
C 2.93440 0.54290 -0.10480
H 3.20240 1.21510 -0.91920
C 3.91740 -0.49260 0.21330
C 5.08380 -0.54120 -0.45960
H 5.83090 -1.30270 -0.25350
C 3.58460 -1.50470 1.28560
H 4.39270 -2.23070 1.41140
H 3.41040 -1.01600 2.25250
H 2.66610 -2.05040 1.03490
H 5.32350 0.18160 -1.23610
TS1
C 1.28880 -1.05540 -0.41630
C 2.59370 -1.55590 -0.12750
C 2.82060 -2.81820 0.43070
C 1.70390 -3.59880 0.71020
C 0.40490 -3.13430 0.43960
C 0.16050 -1.87100 -0.11720
C 1.46650 0.27550 -0.95740
C 2.82120 0.51050 -0.97370
H 3.82810 -3.17000 0.63280
H 1.83530 -4.59070 1.13380
H -0.43780 -3.78910 0.64200
N 3.50060 -0.58310 -0.48380
H 3.35520 1.39270 -1.29870
H 4.50270 -0.65500 -0.39030
C 0.42240 1.27310 -1.38110
H 0.92190 2.13360 -1.84940
H -0.22310 0.84830 -2.17060
C -0.41220 1.75990 -0.22600
H -0.61560 1.07760 0.59440
C 1.47640 2.93150 1.05490
N -1.43130 2.65170 -0.49670
H -1.22450 3.31610 -1.23660
C -2.19430 3.21770 0.60830
H -2.57510 2.40300 1.23260
H -1.59090 3.88610 1.24170
H -3.04590 3.77790 0.21400
O 1.79160 3.66720 0.18790
O 1.37710 2.33460 2.06680
C -1.20340 -1.40070 -0.38670
H -1.30570 -0.68530 -1.19490
C -2.31320 -1.75310 0.29840
H -2.22300 -2.43900 1.14050
![Page 72: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/72.jpg)
S72
C -3.66070 -1.24930 0.03030
C -4.69420 -1.65750 0.79270
H -5.70550 -1.29730 0.62460
C -3.85840 -0.26160 -1.09760
H -4.90640 0.04070 -1.17930
H -3.24940 0.63950 -0.94910
H -3.55270 -0.69480 -2.05870
H -4.55640 -2.36470 1.60740
7
C 1.45670 -0.23410 -0.32300
C 2.77700 -0.66560 0.01060
C 3.07280 -1.95620 0.46000
C 2.01020 -2.84510 0.57900
C 0.69910 -2.45430 0.26020
C 0.38380 -1.16180 -0.18580
C 1.56600 1.15640 -0.72430
C 2.89810 1.48340 -0.61600
H 4.09160 -2.24740 0.69900
H 2.19530 -3.86260 0.91230
H -0.09540 -3.19090 0.33510
N 3.62720 0.39880 -0.18590
H 3.38420 2.42780 -0.81980
H 4.62250 0.39150 -0.01920
C 0.50390 2.13950 -1.16050
H 1.02070 3.08800 -1.39980
H 0.04410 1.82020 -2.10750
C -0.59740 2.35560 -0.15880
N -0.27960 2.41910 1.19790
H 0.49210 1.80040 1.43540
C -1.38290 2.31500 2.14750
H -1.91310 1.35180 2.08130
H -1.00360 2.44300 3.16560
H -2.10670 3.11400 1.95050
C -0.99560 -0.78050 -0.50610
H -1.10750 0.04170 -1.20230
C -2.11100 -1.33670 0.01870
H -2.01470 -2.12750 0.76220
C -3.47960 -0.93070 -0.29750
C -4.52200 -1.53870 0.30380
H -5.54910 -1.25240 0.09430
C -3.68950 0.19010 -1.28940
H -3.16560 1.09780 -0.96370
H -3.28240 -0.07220 -2.27430
![Page 73: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/73.jpg)
S73
H -4.75120 0.42400 -1.40900
H -4.37510 -2.34150 1.02290
H -1.45760 2.95140 -0.45790
TS2
C 1.69140 0.03530 -0.12810
C 3.06920 -0.30190 -0.05030
C 3.50600 -1.63140 0.01950
C 2.52380 -2.61740 0.02060
C 1.15170 -2.29870 -0.06770
C 0.70300 -0.97640 -0.16140
C 1.59730 1.46910 -0.10110
C 2.88380 1.94450 -0.03140
H 4.56200 -1.87910 0.07960
H 2.81940 -3.66200 0.07630
H 0.42110 -3.10220 -0.09990
N 3.77290 0.88330 -0.01580
H 3.24570 2.96230 0.02110
H 4.77520 0.96750 0.06390
C 0.30290 2.23080 -0.07010
C -0.73280 -0.64250 -0.32680
H -0.98310 -0.08880 -1.23010
C -1.72810 -1.36120 0.31270
H -1.43780 -1.94370 1.18820
H -0.07950 2.39510 -1.08820
H 0.46680 3.23850 0.35010
C -0.71970 1.46850 0.73200
H -0.37130 0.99820 1.64770
N -2.01860 1.92740 0.80210
H -2.65850 1.24970 1.20670
C -2.60080 2.72360 -0.26940
H -3.65130 2.91170 -0.03560
H -2.08850 3.68810 -0.34190
H -2.54780 2.23790 -1.25600
C -3.13770 -1.34180 0.00360
C -4.04900 -1.91450 0.83780
H -3.74720 -2.37600 1.77550
H -5.10840 -1.93780 0.59790
C -3.59180 -0.72600 -1.30420
H -3.08620 -1.20180 -2.15400
H -4.67180 -0.83390 -1.44270
H -3.35380 0.34070 -1.35840
9
![Page 74: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/74.jpg)
S74
C 2.74530 0.63170 -0.14540
C 1.41930 0.15350 -0.22020
C 0.38560 0.65340 0.57900
C 0.71340 1.66780 1.47270
C 2.03980 2.15980 1.54560
C 3.07270 1.66130 0.74890
C 2.63380 -1.05110 -1.65990
C 1.35710 -0.90670 -1.17530
H -0.05030 2.09230 2.12060
H 2.26340 2.95470 2.25260
H 4.08270 2.05320 0.82870
H 3.03810 -1.73890 -2.39010
C -0.98780 0.04340 0.34650
C 0.03650 -1.59130 -1.40110
H 0.15510 -2.65170 -1.64690
H -0.50570 -1.12310 -2.23390
H -1.54270 0.03220 1.29050
C -0.83380 -1.47060 -0.11990
H -1.84220 -1.83160 -0.35580
C -1.76330 0.84090 -0.66330
H -1.19220 1.26760 -1.48660
N -0.29190 -2.36310 0.90590
H 0.65140 -2.06160 1.14520
C -1.08940 -2.48210 2.12380
H -1.19980 -1.55080 2.70480
H -0.63210 -3.23060 2.77980
H -2.09560 -2.83230 1.86400
C -3.15330 1.02390 -0.66490
C -3.77250 1.73890 -1.67820
H -4.84740 1.89110 -1.69350
C -3.99630 0.44250 0.45750
H -5.06170 0.62280 0.28760
H -3.84930 -0.63960 0.55340
H -3.73130 0.88700 1.42480
H -3.19790 2.17240 -2.49280
N 3.47100 -0.11870 -1.04880
H 4.46050 -0.03240 -1.22710
CO2
C 0.00000 0.00000 0.00000
O 0.00000 0.00000 1.16910
O 0.00000 0.00000 -1.16910
![Page 75: Supporting Information Catalase Involved in Oxidative](https://reader034.vdocuments.us/reader034/viewer/2022050612/6273dcedad63045da91a0c78/html5/thumbnails/75.jpg)
S75
Supplementary References
(1) Gao, S.-S.; Zhang, T.; Garcia-Borràs, M.; Hung, Y.-S.; Billingsley, J. M.; Houk, K. N.; Hu, Y.;
Tang, Y. J. Am. Chem. Soc. 2018, 140, 6991.
(2) Gibson, D. G.; Young, L.; Chuang, R. Y.; Venter, J. C.; Hutchison, C. A., 3rd; Smith, H. O.
Nat. Methods 2009, 6, 343.
(3) Nielsen, C. A.; Folly, C.; Hatsch, A.; Molt, A.; Schroder, H.; O'Connor, S. E.; Naesby, M.
Microbial cell factories 2014, 13, 95.
(4) Jansson, P. J.; Hawkins, C. L.; Lovejoy, D. B.; Richardson, D. R. J. Inorg. Biochem. 2010, 104,
1224.
(5) Jansson, P. J. Painosalama Oy – Turku 2006.
(6) Alecu, I. M.; Zheng, J.; Zhao, Y.; Truhlar, D. G. J. Chem. Theory Comput. 2010, 6, 2872.
(7) Ribeiro, R. F.; Marenich, A. V.; Cramer, C. J.; Truhlar, D. G. J. Phys. Chem. B 2011, 115,
14556.
(8) Paton Lab, J. R.-G., JingTao Chen, & IFunes. Zenodo 2018, bobbypaton/GoodVibes:
GoodVibes v2.0.2 (Version 2.0.2).