www.sciencemag.org/content/346/6210/748/suppl/DC1

Supplementary Materials for

Targeting and plasticity of mitochondrial proteins revealed by proximity-specific ribosome profiling

Christopher C. Williams, Calvin H. Jan, Jonathan S. Weissman*

*Corresponding author. E-mail: jonathan.weissman@ucsf.edu

Published 7 November 2014, Science 346, 748 (2014)

DOI: 10.1126/science.1257522

This PDF file includes:

Materials and Methods Figs. S1 to S6 Tables S2 to S5 References Caption for Additional Data table S1

Other Supporting Online Material for this manuscript includes the following: (available at www.sciencemag.org/content/346/6210/748/suppl/DC1)

Additional Data table S1

2

Materials and Methods

1 Experimental A complete list of all yeast strains, plasmids, and primers used in this study are

listed in Tables S2-4, respectively.

1.1 Strain construction Yeast strains expressing tagged ribosomal proteins and Om45-BirA are described in

(7). Hap1 was chromosomally tagged at its C-terminus with yeast optimized GFP::HIS5 (28) in W303-1A, which lacks the Ty-insertion present in S288C. This strain was crossed to W303-1B expressing Su9-TagBFP (29). For glycosylation analysis, Osm1 was chromosomally tagged at its C-terminus with 3xFLAG::KAN using pJW1514. The genomic copy of OSM1 in W303 was replaced with WT, M1A, or M32A variants of an Osm1-yoEGFP::LEU2 cassette, cloned from (28). Chromosomal integrants were verified with Sanger sequencing. Genomic variants of Osm1 were crossed to ero1-1 (23) and sporulated at 25°C to obtain haploids of the desired genotypes. Similarly, deletion of FRD1 was performed in Osm1 and Ero1 variant diploids and sporulated at 25°C.

1.2 Media, proximity-specific ribosome profiling

Growth and biotin induction were performed as described in (7). Biotinylation was allowed to proceed for two minutes before harvesting, in the presence or absence of CHX as dictated by the experiment. 1.3 Microscopy

Black 96 well glass (#1.5) bottom plates were treated with 0.1 mg/mL Concanavalin A for 10 minutes. The ConA was aspirated and plates were allowed to dry. 200 µL of yeast cells grown to OD < 0.2 in SD media were applied to each well and allowed to adhere for approximately 15 minutes before imaging. The localization of Hap1 was assessed by live cell microscopy on a widefield epifluorescence microscope illuminated by a SPECTRA X light engine (lumencor). Samples were imaged through a 100X Nikon Plan Apo VC 1.4 oil objective onto a Zyla sCMOS camera (Andor). GFP was measured at 475(ex)/521(em) and BFP measured at 390(ex)/440(em). Om45-BirA and Osm1 localization was determined by live cell Spinning-Disc confocal microscopy. Plates were imaged with a 100X Nikon Apo TIRF 1.49 oil objective onto Photometrics Evolve EMCCD attached to a Nikon Ti-E microscope equipped with a Yokogawa CSU-22 spinning disc in micromanager. GFP and mVenus were excited by a 491 nm Cobalt Calypso DPSS laser line, emission measured at 525 nm. mCherry fluorescence was excited by a 561 nm Coherent Sapphire DPSS laser line, emission measured at 610 nm. 1.4 Glycosylation analysis

Yeast cells expressing Osm1-3XFLAG (yJW1799) were grown to an OD600 of 0.6. 1 mL was pelleted at 20,000xg for one minute, then resuspended in 80 µL 1X LDS buffer (Invitrogen) supplemented with 100 mM DTT and 1x complete protease inhibitors (Roche) pre-warmed to 95°C. The lysate was incubated at 95°C for five minutes, vortexed and pelleted at 20,000xg for eight minutes. Five microliters of clarified lysate were supplemented with 4 µL of 0.5M Sodium Citrate (pH 5.5), 10 µL water and 1 µL

3

EndoH (Roche) or water (negative control). The reaction was incubated at 37°C for one hour, then stopped by addition of 6 µL 4X LDS buffer. Proteins were separated on 4-12% NuPAGE bis-tris gels, transferred to PVDF and blotted with mouse anti-FLAG M2 (Sigma) or rabbit anti-PDI. Binding was detected with goat anti-Mouse IgG IR800 and goat anti-Rabbit IgG Alexa680 and imaged on an Odyssey IR scanner (Licor). 1.5 Anaerobic growth

For anaerobic growth experiments, liquid cultures were grown at 25°C in YEPD under aerobic conditions and plated dilutions transferred to an anaerobic jar (Thermo) filled with an anaerobic gas mixture consisting of 85% N2, 5% CO2, and 10% H2. This chamber was then incubated at 25°C (ero1-1 background) or 30°C. To support anaerobic growth, YEPD media was supplemented with 6 mL of 2 mg/mL ergosterol in a 2:1 mixture of tween-80:EtOH, per 1 L of media.

2 Computational analyses Alignment of ribosome protected fragments, gene enrichments, positional

enrichments, and gene ontology analysis were performed as described (7). 2.1 Gene annotations a. Mitop2 The manually curated mitochondrial reference set was downloaded from the mitop2 database (http://www.mitop2.de/) (1). Mitochondrial sub-localizations were extracted from the mitop2 reference set when available. b. GO GO-slim terms were downloaded from the Saccharomyces Genome Database (http://yeastgenome.org) and mined for any gene that included the search term “mito” as a cellular component. c. GFP Tabular data from the yeast GFP collection was downloaded from (http://yeastgfp.yeastgenome.org/) (11). d. Secretome The secretome was defined in (7, 30). e. Non-mitochondrial genes The set of non-mitochondrial genes was defined as those absent from the mitop2 reference set, lacking a mitochondrial GO slim cellular component annotation and lacking a mitochondrial localization in the yeast GFP collection. f. Whole genome duplication paralogs (Ohnologs) Paralogs annotated as Ohnologs were downloaded from the Yeast Gene Order Browser (http://ygob.ucd.ie/) (21). g. MTS prediction

4

The probabilities of mitochondrial protein localization were determined using the Mitoprot webserver (http://ihg.gsf.de/ihg/mitoprot.html) (9). 2.2 Determination of enrichment thresholds by Receiver operator characteristic

For ROC analyses, the mitop2 reference set was used as the true positive dataset. True negatives were defined as the set of genes that lacked any evidence of mitochondrial localization in mitop2, GO and GFP-localization datasets. The enrichment cutoff was determined that maximized accuracy. Genes at or above this threshold are indicated in Table S1 for both minus and plus CHX datasets. Significance testing for differences in enriched gene proportions for each mitochondrial sub-localization compared to the non-mitochondrial genes (as defined for true negatives above) was performed using Fisher’s exact test. 2.3 Gaussian mixture modeling

The qualitatively bimodal gene enrichments for each mitochondrial sub-compartment were fit to a mixture of two Gaussian distributions using the expectation maximization procedure from the “mixtools” R package. The intersection of these distributions was taken as the cutoff separating the enriched and un-enriched gene sets to obtain an enrichment contingency table for all sub-compartments. Fisher’s exact test was used to test the significance of enrichment partitioning between each compartment pair, and p-values were corrected for multiple comparisons using the Bonferroni method before interpreting significance. 2.4 Data visualization

All plots were generated by Python scripts using the matplotlib and seaborn libraries, or R scripts using the “ggplot2” package.

5

References 28. S. Lee, W. A. Lim, K. S. Thorn, Improved Blue, Green, and Red Fluorescent Protein

Tagging Vectors for S. cerevisiae. PLoS ONE. 8, e67902 (2013).

29. V. Okreglak, P. Walter, The conserved AAA-ATPase Msp1 confers organelle specificity to tail-anchored proteins. Proc. Natl. Acad. Sci., 201405755 (2014).

30. T. Ast, G. Cohen, M. Schuldiner, A Network of Cytosolic Factors Targets SRP-Independent Proteins to the Endoplasmic Reticulum. Cell. 152, 1134–1145 (2013).

31. C. Camarasa, V. Faucet, S. Dequin, Role in anaerobiosis of the isoenzymes for Saccharomyces cerevisiae fumarate reductase encoded by OSM1 and FRDS1. Yeast Chichester Engl. 24, 391–401 (2007).

6

Fig. S1 Gene enrichment analysis. (A) Receiver operator characteristic (ROC) curves were used to evaluate enrichment threshold classification of mitop2 reference set genes (used as the true positive set). The threshold that maximized accuracy was used to classify genes as enriched for downstream analyses. Enrichment of GO-slim cellular component terms in the genes above threshold is shown to the right. (B) As in (A), for experiments performed with CHX pre-treatment. (C) Log2 enrichments versus expression levels for profiling performed with CHX pre-treatment, demonstrating sensitivity for detecting enrichment independent of expression level. (D) The cumulative distributions of MitoProt predictions scores are shown for mitop2 reference genes, enriched genes with no prior mitochondrial annotations and all other genes.

7

Fig. S2 Gaussian enrichment mixtures for mitochondrial sub-compartments. (A) Shown are log2 enrichment distributions for genes annotated to reside in the indicated mitochondrial sub-compartments. Each distribution was fit to a mixture of two normal distributions and the intersection of the resulting mixture models was used as an enrichment threshold separating the enriched and un-enriched gene sets. The resulting contingency table and p-values from Fisher’s exact test comparing the association between sub-compartment and enrichment are shown. Highlighted p-values indicate significance at the p < 0.05 level after Bonferroni (n=6) correction. (B) as in (A) for samples pre-treated with CHX, without significance testing.

8

Fig. S3 Position-specific enrichment analysis of mitop2 genes. Shown is a colormap of enrichment at each codon (columns) for each mitop2 gene (rows) sorted by length. Only genes longer than 179 codons were plotted. The geometric mean enrichment and standard deviation are shown above.

9

Fig. S4 Consistency of dual localization across ER BirA fusions. Scatter plots of ER enrichments for the indicated BirA fusion compared to mitochondrial enrichments. Points are colored by their annotated localization.

10

Fig. S5 Genetic interactions between Osm1 signal mutants and an Ero1 hypomorph. (A) The indicated Osm1 signal mutants were grown with or without oxygen in an ero1-1 temperature sensitive allele background, at the permissive temperature of 25°C (all ero1-1 mutants failed to grow under anaerobic conditions at 30°C). Under anaerobic conditions, the ER form of Osm1 is required for growth. (B) As in (A), in a frd1∆ background. These data suggest that the residual growth of strains lacking an ER-form of Osm1 in (A) may be due to partially redundancy between OSM1 and its ohnolog FRD1, which is predicted to contain a N-terminal ER signal sequence (SS) and is known to be transcriptionally upregulated under anaerobic conditions (31). Together these data demonstrate that fumarate reductase functions with Ero1 during oxidative folding in the ER. The ER-localized form of Osm1 is the primary source of this activity and Frd1 provides partially redundant functionality. Consistent with this, under anaerobic conditions (i.e. when fumarate is the only available oxidant) the ER form of Osm1 is essential when Frd1 is deleted (Fig. 4F).

11

Fig. S6. Multiple sequence alignment of fumarate reductase homologs. The N-terminal region of the multiple sequence alignment of Frd1/Osm1 homologs from the Yeast Gene Order Browser is shown. Homology to Osm1/Frd1 is indicated in the leftmost column. Signal predictions by Phobius and MTS predictions by mitoprot are shown on the right.

12

Table S2. Yeast strains Yeast strains used in this study. name description background MAT genotype

yJW1788 Rpl16a/b AVI + Om45-mVenus-BirA

BY4741 a om45::OM45-mVenus-BirA::HIS5 rpl16a::RPL16a-HA-TEV-AVI rpl16b::RPL16b-HA-TEV-AVI ura3Δ0 met15Δ0 his3Δ1 leu2Δ0

yJW1795 Rpl16a/b AVI + Om45-mVenus-BirA + Su9-tagBFP

BY4741 a om45::OM45-mVenus-BirA::HIS5 rpl16a::RPL16a-HA-TEV-AVI rpl16b::RPL16b-HA-TEV-AVI pJW1513(pRS316-pTDH3-su9-TagBFP) ura3Δ0 met15Δ0 his3Δ1 leu2Δ0

yJW1796 Rps2 AVI + Om45-mVenus-BirA

BY4741 a om45::OM45-mVenus-BirA::HIS5 rps2::RPS2-HA-TEV-AVI ura3Δ0 met15Δ0 his3Δ1 leu2Δ0

yJW1797 Hap1-yoEGFP W303-1B α hap1::HAP1-yoEGFP::HIS5 leu2-3,112 trp1-1 can1-100 ura3

yJW1798 Hap1-yoEGFP; Su9-BFP

W303 α/a HAP1/hap1::HAP1-yoEGFP::HIS5 leu2-3,112/leu2-3,112 trp1-1/trp1-1 can1-100/can1-100 ura3/ura3 pJW1513 (pRS316-pTDH3-su9-TagBFP)

yJW1799 Osm1-3xFLAG BY4741 a osm1::OSM1-3xFLAG::KanMX leu2Δ0 ura3Δ0 met15Δ0 his3Δ1

yJW1800 WT Osm1-GFP W303-1B α osm1::OSM1-yoEGFP::LEU2 sec63::sec63-mCherry-BirA::HIS5 pJW1513 (pRS316-pTDH3-su9-TagBFP) leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15

yJW1801 M1A Osm1-GFP W303-1A a osm1::OSM1(M1A)-yoEGFP::LEU2 sec63::sec63-mCherry-BirA::HIS5 pJW1513 (pRS316-pTDH3-su9-TagBFP) leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15

yJW1802 M32A Osm1-GFP W303-1B α osm1::OSM1(M32A)-yoEGFP::LEU2 sec63::sec63-mCherry-BirA::HIS5 pJW1513 (pRS316-pTDH3-su9-TagBFP) leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15

yJW1803 WT Osm1-GFP + Ero1 ts

W303 spore osm1::OSM1-yoEGFP::LEU2 ero1::ero1-1::HIS leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15

yJW1804 M1A Osm1-GFP + Ero1 ts

W303 spore osm1::OSM1(M1A)-yoEGFP::LEU2 ero1::ero1-1::HIS leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15

yJW1805 M32A Osm1-GFP + Ero1 ts

W303 spore osm1::OSM1(M32A)-yoEGFP::LEU2 ero1::ero1-1::HIS leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15

yJW1806 osm1Δ + Ero1 ts W303 spore osm1Δ::URA ero1::ero1-1::HIS leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15

yJW1807 WT Osm1-GFP + frd1Δ

W303 spore osm1::OSM1-yoEGFP::LEU2 frd1Δ::NAT leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15

yJW1808 M1A Osm1-GFP + frd1Δ

W303 spore osm1::OSM1(M1A)-yoEGFP::LEU2 frd1Δ::NAT leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15

yJW1809 M32A Osm1-GFP + frd1Δ

W303 spore osm1::OSM1(M32A)-yoEGFP::LEU2 frd1Δ::NAT leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15

yJW1810 osm1Δ + frd1Δ W303 spore osm1Δ::URA frd1Δ::NAT leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15

13

Table S3. Plasmids Plasmids used in this study name description pJW1513 pRS316-pTDH3-Su9-TagBFP pJW1514 pCR2.1 linker-tev-linker-3X-FLAG::KanMX pJW1515 pFA6a Osm1-yoEGFP::LEU2 pJW1516 pFA6a Osm1(M1A)-yoEGFP::LEU2 pJW1517 pFA6a Osm1(M32A)-yoEGFP::LEU2

pJW1518 pFA6a -mCherry-BirA::HIS5

14

Table S4. Primers Primers used in this study. name purpose sequence (5' to 3') oGAB11 28mer size standard agucacuuagcgauguacacugacugug/3phos/ oCJ200 Primer for reverse transcription of

sequencing libraries 5'/5phos/GATCGTCGGACTGTAGAACTCTGAACCTGTCG/isp18/CAAGCAGAAGACGGCATACGAGATATTGATGGTGCCTACAG

oNTI231 Amplification of sequencing libraries, paired with indexing primer

caagcagaagacggcatacga

indexing-primer

Amplification of sequencing libraries, NNNNNN = barcode position

aatgatacggcgaccaccgagatctacacgatcggaagagcacacgtctgaactccagtcacNNNNNNcgacaggttcagagttc

Linker 1 3' Cloning adaptor for RNA footprints appctgtaggcaccatcaat/3ddc oCW102 C-terminally tag OM45 with -

mVenus-BirA::HIS5, fwd tgataagggtgatggtaaattctggagctcgaaaaaggacATCGGTGACGGTGCTGGTTT

oCW103 C-terminally tag OM45 with -mVenus-BirA::HIS5, reverse primer

gagaaacatgtgaatatgtatatatgttatgcgggaaccaTGGATGGCGGCGTTAGTATC

oCJ491 OSM1 C-TERM 3XFLAG FWD CTT TGG AAA GAC AGC TGC GGA TAA CAT AGC AAA ATT GTA CGG AGG TTC AGG TTC AGG

oCJ492 OSM1 C-TERM 3XFLAG REV CGT TGC AAA AAT ATC TTT TAT TTC CCT ATA AAT TCT CAA TCG ATG AAT TCG AGC TCG

oCW500 OSM1 C-term EGFP (WT, M32A) fwd

taccttaataattctatatcatcccgagtcttaggaaaATGATTAGATCTGTGAGAAGGG

oCW501 OSM1 C-term EGFP (M1A, ATG-->GCT) fwd

taccttaataattctatatcatcccgagtcttaggaaaGCTATTAGATCTGTGAGAAGGG

oCW503 OSM1 C-term EGFP (WT, M1A, M32A) rev

agtacgttgcaaaaatatcttttatttccctataaattcATGCGAATGCACAAGCTAATA

oCW481 OSM1 (K. lactis URA) delete fwd aataccttaataattctatatcatcccgagtcttaggaaaCACAGGAAACAGCTATGACC

oCW482 OSM1 (K. lactis URA) delete rev aagtacgttgcaaaaatatcttttatttccctataaattcGTTGTAAAACGACGGCCAGT

oCW518 FRD1 delete (NAT MX) fwd tcttatcttcacttcaacaacccctcatccgtaattgtaaGACATGGAGGCCCAGAATAC

oCW519 FRD1 delete (NAT MX) rev attaaaaaatcgtttagaaatgattcatttataaaattcgTGGATGGCGGCGTTAGTATC

oCJ486 HAP1 C-term GFP tag fwd ACTAGTAGATTTTTATAGAGCAGATTTTCCAATATGGGAGggtgacggtgctggttta

oCJ487 HAP1 C-term GFP tag rev TAAAAATATGTCCCTTTCTATTTATACATAAACAAACCGCAtcgatgaattcgagctcg

15

Additional Data Table S1 (separate file) Comprehensive yeast data and annotation table. This table contains relevant yeast annotations, classifications, raw counts and expression levels (RPKM) for all input and pulldown samples, and log2 enrichments for all samples.

References and Notes 1. M. Elstner, C. Andreoli, T. Klopstock, T. Meitinger, H. Prokisch, The mitochondrial proteome

database: MitoP2. Methods Enzymol. 457, 3–20 (2009). Medline doi:10.1016/S0076-6879(09)05001-0

2. T. D. Fox, Mitochondrial protein synthesis, import, and assembly. Genetics 192, 1203–1234 (2012). Medline doi:10.1534/genetics.112.141267

3. R. E. Kellems, V. F. Allison, R. A. Butow, Cytoplasmic type 80S ribosomes associated with yeast mitochondria. IV. Attachment of ribosomes to the outer membrane of isolated mitochondria. J. Cell Biol. 65, 1–14 (1975). Medline doi:10.1083/jcb.65.1.1

4. M. Suissa, G. Schatz, Import of proteins into mitochondria. Translatable mRNAs for imported mitochondrial proteins are present in free as well as mitochondria-bound cytoplasmic polysomes. J. Biol. Chem. 257, 13048–13055 (1982). Medline

5. P. Marc, A. Margeot, F. Devaux, C. Blugeon, M. Corral-Debrinski, C. Jacq, Genome-wide analysis of mRNAs targeted to yeast mitochondria. EMBO Rep. 3, 159–164 (2002). Medline doi:10.1093/embo-reports/kvf025

6. Y. Saint-Georges, M. Garcia, T. Delaveau, L. Jourdren, S. Le Crom, S. Lemoine, V. Tanty, F. Devaux, C. Jacq, Yeast mitochondrial biogenesis: A role for the PUF RNA-binding protein Puf3p in mRNA localization. PLOS ONE 3, e2293 (2008). Medline doi:10.1371/journal.pone.0002293

7. C. H. Jan, C. C. Williams, J. S. Weissman, Principles of ER co-translational translocation revealed by proximity-specific ribosome profiling. Science 346, 1257521 (2014).

8. O. Brandman, J. Stewart-Ornstein, D. Wong, A. Larson, C. C. Williams, G. W. Li, S. Zhou, D. King, P. S. Shen, J. Weibezahn, J. G. Dunn, S. Rouskin, T. Inada, A. Frost, J. S. Weissman, A ribosome-bound quality control complex triggers degradation of nascent peptides and signals translation stress. Cell 151, 1042–1054 (2012). Medline doi:10.1016/j.cell.2012.10.044

9. M. G. Claros, P. Vincens, Computational method to predict mitochondrially imported proteins and their targeting sequences. Eur. J. Biochem. 241, 779–786 (1996). Medline doi:10.1111/j.1432-1033.1996.00779.x

10. J. M. Cherry, E. L. Hong, C. Amundsen, R. Balakrishnan, G. Binkley, E. T. Chan, K. R. Christie, M. C. Costanzo, S. S. Dwight, S. R. Engel, D. G. Fisk, J. E. Hirschman, B. C. Hitz, K. Karra, C. J. Krieger, S. R. Miyasato, R. S. Nash, J. Park, M. S. Skrzypek, M. Simison, S. Weng, E. D. Wong, Saccharomyces Genome Database: The genomics resource of budding yeast. Nucleic Acids Res. 40, D700–D705 (2012). Medline

11. W.-K. Huh, J. V. Falvo, L. C. Gerke, A. S. Carroll, R. W. Howson, J. S. Weissman, E. K. O’Shea, Global analysis of protein localization in budding yeast. Nature 425, 686–691 (2003). Medline doi:10.1038/nature02026

12. L. Guarente, B. Lalonde, P. Gifford, E. Alani, Distinctly regulated tandem upstream activation sites mediate catabolite repression of the CYC1 gene of S. cerevisiae. Cell 36, 503–511 (1984). Medline doi:10.1016/0092-8674(84)90243-5

16

13. A. M. Nargund, M. W. Pellegrino, C. J. Fiorese, B. M. Baker, C. M. Haynes, Mitochondrial import efficiency of ATFS-1 regulates mitochondrial UPR activation. Science 337, 587–590 (2012). Medline

14. K. Wolfe, Robustness—it’s not where you think it is. Nat. Genet. 25, 3–4 (2000). Medline doi:10.1038/75560

15. B. Kornmann, E. Currie, S. R. Collins, M. Schuldiner, J. Nunnari, J. S. Weissman, P. Walter, An ER-mitochondria tethering complex revealed by a synthetic biology screen. Science 325, 477–481 (2009). Medline doi:10.1126/science.1175088

16. H. Muratsubaki, K. Enomoto, One of the fumarate reductase isoenzymes from Saccharomyces cerevisiae is encoded by the OSM1 gene. Arch. Biochem. Biophys. 352, 175–181 (1998). Medline doi:10.1006/abbi.1998.0583

17. K. Enomoto, Y. Arikawa, H. Muratsubaki, Physiological role of soluble fumarate reductase in redox balancing during anaerobiosis in Saccharomyces cerevisiae. FEMS Microbiol. Lett. 215, 103–108 (2002). Medline doi:10.1111/j.1574-6968.2002.tb11377.x

18. M. Costanzo, A. Baryshnikova, J. Bellay, Y. Kim, E. D. Spear, C. S. Sevier, H. Ding, J. L. Koh, K. Toufighi, S. Mostafavi, J. Prinz, R. P. St Onge, B. VanderSluis, T. Makhnevych, F. J. Vizeacoumar, S. Alizadeh, S. Bahr, R. L. Brost, Y. Chen, M. Cokol, R. Deshpande, Z. Li, Z. Y. Lin, W. Liang, M. Marback, J. Paw, B. J. San Luis, E. Shuteriqi, A. H. Tong, N. van Dyk, I. M. Wallace, J. A. Whitney, M. T. Weirauch, G. Zhong, H. Zhu, W. A. Houry, M. Brudno, S. Ragibizadeh, B. Papp, C. Pál, F. P. Roth, G. Giaever, C. Nislow, O. G. Troyanskaya, H. Bussey, G. D. Bader, A. C. Gingras, Q. D. Morris, P. M. Kim, C. A. Kaiser, C. L. Myers, B. J. Andrews, C. Boone, The genetic landscape of a cell. Science 327, 425–431 (2010). Medline doi:10.1126/science.1180823

19. D. F. Zielinska, F. Gnad, K. Schropp, J. R. Wiśniewski, M. Mann, Mapping N-glycosylation sites across seven evolutionarily distant species reveals a divergent substrate proteome despite a common core machinery. Mol. Cell 46, 542–548 (2012). Medline doi:10.1016/j.molcel.2012.04.031

20. N. Stern-Ginossar, B. Weisburd, A. Michalski, V. T. Le, M. Y. Hein, S. X. Huang, M. Ma, B. Shen, S. B. Qian, H. Hengel, M. Mann, N. T. Ingolia, J. S. Weissman, Decoding human cytomegalovirus. Science 338, 1088–1093 (2012). Medline doi:10.1126/science.1227919

21. K. P. Byrne, K. H. Wolfe, The Yeast Gene Order Browser: Combining curated homology and syntenic context reveals gene fate in polyploid species. Genome Res. 15, 1456–1461 (2005). Medline doi:10.1101/gr.3672305

22. E. Gross, C. S. Sevier, N. Heldman, E. Vitu, M. Bentzur, C. A. Kaiser, C. Thorpe, D. Fass, Generating disulfides enzymatically: Reaction products and electron acceptors of the endoplasmic reticulum thiol oxidase Ero1p. Proc. Natl. Acad. Sci. U.S.A. 103, 299–304 (2006). Medline doi:10.1073/pnas.0506448103

23. B. P. Tu, J. S. Weissman, The FAD- and O2-dependent reaction cycle of Ero1-mediated oxidative protein folding in the endoplasmic reticulum. Mol. Cell 10, 983–994 (2002). Medline doi:10.1016/S1097-2765(02)00696-2

17

24. Z. Liu, T. Österlund, J. Hou, D. Petranovic, J. Nielsen, Anaerobic α-amylase production and secretion with fumarate as the final electron acceptor in Saccharomyces cerevisiae. Appl. Environ. Microbiol. 79, 2962–2967 (2013). Medline doi:10.1128/AEM.03207-12

25. J. M. Thomson, E. A. Gaucher, M. F. Burgan, D. W. De Kee, T. Li, J. P. Aris, S. A. Benner, Resurrecting ancestral alcohol dehydrogenases from yeast. Nat. Genet. 37, 630–635 (2005). Medline doi:10.1038/ng1553

26. D. Akopian, K. Shen, X. Zhang, S. O. Shan, Signal recognition particle: An essential protein-targeting machine. Annu. Rev. Biochem. 82, 693–721 (2013). Medline doi:10.1146/annurev-biochem-072711-164732

27. M. del Alamo, D. J. Hogan, S. Pechmann, V. Albanese, P. O. Brown, J. Frydman, Defining the specificity of cotranslationally acting chaperones by systematic analysis of mRNAs associated with ribosome-nascent chain complexes. PLOS Biol. 9, e1001100 (2011). Medline doi:10.1371/journal.pbio.1001100

28. S. Lee, W. A. Lim, K. S. Thorn, Improved blue, green, and red fluorescent protein tagging vectors for S. cerevisiae. PLOS ONE 8, e67902 (2013). Medline doi:10.1371/journal.pone.0067902

29. V. Okreglak, P. Walter, The conserved AAA-ATPase Msp1 confers organelle specificity to tail-anchored proteins. Proc. Natl. Acad. Sci. U.S.A. 111, 8019–8024 (2014). Medline doi:10.1073/pnas.1405755111

30. T. Ast, G. Cohen, M. Schuldiner, A network of cytosolic factors targets SRP-independent proteins to the endoplasmic reticulum. Cell 152, 1134–1145 (2013). Medline doi:10.1016/j.cell.2013.02.003

31. C. Camarasa, V. Faucet, S. Dequin, Role in anaerobiosis of the isoenzymes for Saccharomyces cerevisiae fumarate reductase encoded by OSM1 and FRDS1. Yeast 24, 391–401 (2007). Medline doi:10.1002/yea.1467

18