supplementary materials for · 10/23/2019 · fig. s10. flow cytometric histograms showing...

stm.sciencemag.org/cgi/content/full/11/515/eaav8826/DC1

Supplementary Materials for

A green tea–triggered genetic control system for treating

diabetes in mice and monkeys

Jianli Yin, Linfeng Yang, Lisha Mou, Kaili Dong, Jian Jiang, Shuai Xue, Ying Xu, Xinyi Wang, Ying Lu, Haifeng Ye*

*Corresponding author. Email: [email protected]

Published 23 October 2019, Sci. Transl. Med. 11, eaav8826 (2019)

DOI: 10.1126/scitranslmed.aav8826

The PDF file includes:

Materials and Methods Fig. S1. Assessment of PCA-mediated toxicity on HEK-293 cells. Fig. S2. Optimization of the PCAON system in HEK-293 cells. Fig. S3. PCA analog-mediated SEAP expression in pJY14/pJY29-transgenic HEK-293 cells. Fig. S4. PCAON-dependent SEAP expression kinetics in HEK-293 cells. Fig. S5. Design, construction, and optimization of the PcaR-mediated inhibition device (PcaRi) for gene inhibition. Fig. S6. Design, construction, and optimization of the PcaR-mediated activation device (PcaRa) for gene activation. Fig. S7. Schematics of a synthetic PcaR-mediated gene deletion device (PcaRdel). Fig. S8. Controls with constitutively active CRISPR-dCas9 device-mediated genome repression and activation. Fig. S9. PCA- and VA-controlled programmable biocomputers in mammalian cells. Fig. S10. Flow cytometric histograms showing input-triggered single-cell d2EYFP expression of all programmed logic circuits. Fig. S11. Validation of the VAON and the VAOFF system in mammalian cells. Fig. S12. Validation of the PCAOFF system in mammalian cells. Fig. S13. Construction and characterization of the stable cell lines. Fig. S14. PCAON-2.0 switch-controlled treatment in type 1 diabetic mice by oral delivery of PCA. Fig. S15. Hypoglycemic effect on type 1 and type 2 diabetic mice by oral administration of PCA or tea drinking. Table S1. The CBC and blood biochemistry tests in type 1 diabetic monkeys. Table S2. The CBC and blood biochemistry tests in type 2 diabetic monkeys. Table S3. Plasmids designed and used in this study. Table S4. The primers used for qPCR analysis. Table S5. The primers used for PCR amplification.

Table S6. The expression vectors and mixtures for logic gates in mice. Table S7. The expression vectors and mixtures for logic gates in mammalian cells. References (53–64)

Other Supplementary Material for this manuscript includes the following: (available at stm.sciencemag.org/cgi/content/full/11/515/eaav8826/DC1)

Data file S1 (Microsoft Excel format). DNA sequence information of plasmids used in this study. Data file S2 (Microsoft Excel format). Individual subject-level data.

Materials and Methods

Cell lines and cell culture

Human embryonic kidney cells (HEK-293, ATCC: CRL-11268), human cervical adenocarcinoma

cells (HeLa, ATCC: CCL-2), human telomerase-immortalised mesenchymal stem cells (hMSC-TERT),

mouse myoblast cells (C2C12, ATCC: CRL-1772), and HEK-293-derived Hana3A cells stably

expressing RTP1, RTP2, REEP1, and Gαoλϕ were cultured in Dulbecco’s modified Eagle’s medium

(DMEM; Gibco; Cat. no. 31600-083) supplemented with 10% (v/v) fetal bovine serum (FBS,

Biological Industries; Cat. no. 04-001-1C) and 1% (v/v) penicillin/streptomycin solution (Biowest;

Cat. no. L0022-100) at 37°C in a humidified atmosphere containing 5% CO2 and were regularly tested

for the absence of Mycoplasma and bacterial contamination.

Generation of various stable cell lines

The HEK-293PCA-ON-SEAP cell line, transgenic for PCA-inducible SEAP expression, was constructed by

co-transfecting HEK-293 cells with pJY29 (PhEF1α-PcaR-pA), pJY14 (PPcaR7-SEAP-pA), and pJY60

(PhCMV-PuroR-pA) at a ratio of 10:10:1 and selected with 1 μg/ml puromycin for two weeks. The

surviving population was picked for further cultivation and stimulated with 500 µM PCA for 72 h. The

monoclonal HEK-293PCA-ON-SEAP cell line that showed the highest sensitivity to PCA was used for the

following studies. The HEK-293PCA-ON-1.0-SEAP-P2A-mINS cell line, transgenic for PCA-inducible SEAP

and mouse insulin expression, was constructed by co-transfecting HEK-293 cells with pJY39

(ITR-PhEF1α-PcaR-pA: PmPGK-PuroR-pA-ITR), pJY40 (ITR-PPcaR6-SEAP-P2A-mINS-pA:

PmPGK-ZeoR-pA-ITR), and sleeping beauty transposase expression vector pCMV-T7-SB100

(PhCMV-SB100X-pA) (53) at a ratio of 9:9:1. After selection with 1 μg/ml puromycin and 100 µg/ml

zeocin (Life Technologies, cat. no. R25001) for two weeks, the surviving population was picked for

further cultivation and stimulated with 500 µM PCA for 72 h. The monoclonal

HEK-293PCA-ON-1.0-SEAP-P2A-mINS cell line that showed the highest sensitivity to PCA was used for the

following studies. The HEK-293PCA-ON-1.0-shGLP-1-P2A-SEAP cell line, transgenic for PCA-inducible

shGLP-1 and SEAP expression, was constructed by co-transfecting HEK-293 cells with pJY39

(ITR-PhEF1α-PcaR-pA: PmPGK-PuroR-pA-ITR), pJY41 (ITR-PPcaR6-shGLP-1-P2A-SEAP-pA:

PmPGK-ZeoR-pA-ITR), and pCMV-T7-SB100 at a ratio of 9:9:1. After selection with 1 μg/ml

puromycin and 100 µg/ml zeocin for two weeks, the surviving population was picked for further

cultivation and stimulated with 500 µM PCA for 72 h. The monoclonal HEK-293PCA-ON-1.0-shGLP-1

-P2A-SEAP cell line that showed the highest sensitivity to PCA was used for the following studies.

The HEK-293PCA-ON-2.0-SEAP-P2A-mINS cell line, transgenic for the constitutive PCA transporter

protein (PcaK) expression, PCA-inducible SEAP, and mouse insulin expression, was constructed by

co-transfecting HEK-293 cells with pJY39 (ITR-PhEF1α-PcaR-pA: PmPGK-PuroR-pA-ITR), pJY325

(ITR-PPcaR7-SEAP-P2A-mINS-pA: PhCMV-PcaK: PmPGK-ZeoR-pA-ITR), and the sleeping beauty

transposase expression vector pCMV-T7-SB100 (PhCMV-SB100X-pA) at a ratio of 9:9:1. After

selection with 1 μg/ml puromycin and 100 µg/ml zeocin (Life Technologies, cat. no. R25001) for two

weeks, the surviving population was picked for further cultivation and stimulated with 50 µM PCA for

72 h. The monoclonal HEK-293PCA-ON-2.0-SEAP-P2A-mINS cell line that showed the highest sensitivity to

PCA was used for the following studies. The HEK-293PCA-ON-2.0-shGLP-1-P2A-SEAP cell line, transgenic for

the constitutive PcaK expression, PCA-inducible shGLP-1 and SEAP expression, was constructed by

co-transfecting HEK-293 cells with pJY39 (ITR-PhEF1α-PcaR-pA: PmPGK-PuroR-pA-ITR), pJY326

(ITR-PPcaR7-shGLP-1-P2A-SEAP-pA: PhCMV-PcaK: PmPGK-ZeoR-pA-ITR), and pCMV-T7-SB100 at a

ratio of 9:9:1. After selection with 1 μg/ml puromycin and 100 µg/ml zeocin for two weeks, the

surviving population was picked for further cultivation and stimulated with 50 µM PCA for 72 h. The

monoclonal HEK-293PCA-ON-2.0-shGLP-1-P2A-SEAP cell line that showed the highest sensitivity to PCA was

used for the following studies. All stable cell lines were regularly tested for the absence of

Mycoplasma and bacterial contamination.

Processing of green tea and quantification of the tea polyphenols

Dried green tea leaves (Longjing tea, Camellia sinensis L., Xianghui Tea Co., Ltd.) were ground with

a hammer mill and passed through a 5 mm mesh. 10 g of the green tea powder was extracted with 35 ml

distilled water in a 50 ml centrifuge tube for 4 h at 25°C. After centrifugation (15,000×g, 5 min), the

concentrated green tea supernatant was collected for further experiments.

The total tea polyphenols in the prepared green tea supernatant were quantified by the

Folin-Ciocalteu method, as described previously (54). Briefly, 40 μl tea polyphenols standards or

green tea solution was mixed with 40 μl ferrous tartrate solution containing 3.6 mM FeSO4·7H2O and

17.8 mM rochelle salt. 120 μl phosphate buffer (16.8 mM Na2HPO4.12H2O, 32 mM NaH2PO4.2H2O,

pH=7.5) was added to the mixture and shaken vigorously. The absorbance was measured at 540 nm at

20°C by using a Synergy H1 hybrid multi-mode microplate reader (BioTek Instruments, Inc.) with

Gen5 software (version: 2.04). The amount of tea polyphenols was calculated from the standard curve

drawn between the varied amount of tea polyphenols and absorbance. According to the calculation,

100 µl of the prepared green tea supernatant contains 0.7 mg total tea polyphenols. The dosage of 900

μl/mouse/day in the study was equivalent to 6.3 mg/mouse/day of total tea polyphenols.

MTT assay

In brief, 7x103

HEK-293 cells were seeded per well of a 96-well plate and cultured for 72 h in the

presence of various concentrations of PCA. 20 µL MTT (5 mg/ml in PBS) was then added to each well

and incubated for 4 h at 37°C in a humidified atmosphere containing 5% CO2. After incubation, 150

µL DMSO was added into each well. After complete solubilization of the purple formazan crystals,

the plate was read with a Synergy H1 microplate reader (BioTek Instruments Inc.) at 490 nm.

Insulin ELISA

Insulin in mouse or monkey serum were quantified with the mouse insulin ELISA Kit (Mercodia AB;

Cat. no. 10-1247-01) according to manufacturer’s instructions.

GLP-1 ELISA

shGLP-1 in mouse or monkey serum were profiled with a High-Sensitivity GLP-1 Active ELISA kit

(Merck Millipore; Cat. no. EGLP-35K) according to manufacturer’s instructions.

Fluorescence microscopy

Fluorescence image of d2EYFP was performed with an inverted fluorescence microscope (Olympus

IX71, TH4-200, Olympus Corporation) equipped with an Olympus digital camera (Olympus DP71,

Olympus Corporation), a 20×objective, a 495/535-nm (B/G/R) excitation/emission filter set and

Image-Pro Express C software (version ipp6.0). Identical settings including exposure times for

d2EYFP were used for all fluorescence micrographs.

Flow cytometric analysis

All engineered cells were analysed with a Becton Dickinson FACSCalibur Flow Cytometer (BD

Biosciences) quipped for d2EYFP [488 nm laser, 505 nm longpass filter, 530/30 emission filter

(passband centred on 530 nm; passband width 30 nm)] detection and set to exclude dead cells and cell

doublets. At least 10,000 cells were recorded in each data set and analysed with BD CellQuest Pro

software (version no. 6.0). To score digital expression profiles of the PCA-/VA-controlled biocomputer

devices, transfected HEK-293 cell populations were gated for cells with high d2EYFP fluorescence

beyond a threshold of 103 arbitrary fluorescence units. The percentage of gated cells was multiplied by

their median fluorescence, resulting in a weighted d2EYFP expression profile that correlated

fluorescence intensity with cell number.

Animals

Twelve-week-old male wild-type C57BL/6J mice were obtained from the East China Normal

University Laboratory Animal Centre. Twelve-week-old male db/db mice (BKS.Cg-Dock7m

+/+

Leprdb

/J) were purchased from Charles River Laboratory. The mice were housed in a 12 h light/dark

cycle (light between 06:00 and 18:00) in a temperature-controlled room (around 22°C) with free

access to water and food. Mice were randomly assigned to experimental and control groups.

The experiments with pathogen-free female wild-type cynomolgus monkeys (Macaca

fascicularis, 4-7 years old, 3-5 kg) and subsequent STZ-induced type 1 diabetic in non-human

primates (NHPs) were conducted at Guangdong Landao Biotechnology Co. Ltd. These monkeys were

housed individually in a room that was maintained at a temperature of about 22°C and a relative

humidity of 22-65%.

The experiments with spontaneous type 2 diabetic cynomolgus monkeys (Macaca fascicularis,

male, 13-21 years old, 6.7-8 kg) were collected from the monkey farms in China and then conducted at

Crown Bioscience Inc. (55, 56). The type 2 diabetic monkeys were individually housed at room

temperature 21-23°C and 7:00-19:00 light and dark cycle with free access to water and twice daily

with a complete nutritionally balanced diet (Beijing Keao Xieli Feed Co., LTD) enriched with seasonal

low-sugar vegetables or fruits in accordance with the Association for Assessment and Accreditation of

Laboratory Animal Care (AAALAC) regulations and guidelines. All the procedures for sample or data

collection used in this study were approved by the Institutional Animal Care and Use Committee

(IACUC) (Crown Bioscience, Inc.).

Construction of type 1 diabetic mouse model

The type 1 diabetic mouse model (T1D) was created as described previously (57). Briefly,

Ten-week-old male mice (C57BL/6J, East China Normal University Laboratory Animal Centre) were

fasted for 18 h and received single intraperitoneal injection of alloxan monohydrate (160 mg/kg in

citrate buffer, pH=4.5). 5 days after injection, fasted mice with hyperglycemia over 15 mmol/L were

used in the following study.

Intraperitoneal glucose tolerance test (IPGTT) in mice

Mice were fasted for 16 h and then received an intraperitoneal injection of aqueous 1.5 g/kg

D-glucose. The glycemic profile of each mouse was monitored via tail-vein blood samples at 0, 30,

60, 90, and 120 min after glucose administration using a Contour Glucometer (Exactive Easy III,

MicroTech Medical Co., Ltd.).

Insulin tolerance test (ITT) in mice

Mice were fasted for 4 h and then received an intraperitoneal injection of aqueous 1 U/kg

recombinant human insulin. The glycemic profile of each mouse was monitored via tail-vein blood

samples at 0, 30, 60, 90, and 120 min after insulin administration using a Contour Glucometer.

Homeostatic model assessment (HOMA-IR) in mice and monkeys

The approximation equation for insulin resistance index was calculated with the formula: HOMA-IR

= [fasting glucose (mmol/L) × fasting insulin (mU/L)]/22.5.

Construction of type 1 diabetic monkey model

The type 1 diabetic monkey model was created as described previously (58). In brief, pathogen-free

female cynomolgus monkeys (Macaca fascicularis, 4-7 years old, 3-5 kg, Guangdong Landau

Biotechnology Co. Ltd.) received a single intravenous injection of streptozotocin (STZ; 100 mg/kg in

citrate buffer, pH=4.5). Five days after injection, monkeys with a fasting blood glucose level over 15

mmol/L were used in the following study. Before the experiment, the diabetic monkeys were injected

with insulin twice daily to avoid hyperglycemia and severe metabolic dysfunction. Insulin doses

were determined using a previously determined scale, as follows: glucose <11.1 mM, no insulin;

glucose between 11.1-16.6 mM, 1-2 U of insulin; glucose between 16.6-22.2 mM, 2-4 U of insulin;

glucose >22.2 mM, 4-6 U of insulin. During the course of the experiment, the diabetic monkeys were

not treated with any additional insulin injection.

Intravenous glucose tolerance test (IVGTT) in type 1 and type 2 diabetic monkeys

Briefly, type 1 diabetic monkeys were fasted for 12 h and then received an intravenous injection of

aqueous 0.5 g/kg D-glucose. Blood glucose was recorded via tail-vein blood samples at 0, 15, 30, 60,

and 90 min after glucose administration using a Contour Glucometer (OneTouch UltraEasy). The

trapezoidal rule was used to determine the area under the curve (AUC) for IVGTT.

Similar to IVGTT in type 1 diabetic monkeys, type 2 diabetic monkeys were fasted for 12 h and

then received an intravenous injection of aqueous 0.25 g/kg D-glucose. Indwelling venous needle is

left in the extremities’ veins (cephalic vein or saphenous vein) for blood collection. Blood glucose

was recorded immediately before glucose injection at 0, 3, 5, 7, 10, 15, 20, 30 and 60 min after

glucose administration using a Roche Accuchek Performa handheld glucometer by disposable strips

dipped with a drop of blood. The trapezoidal rule was used to determine the area under the curve

(AUC) for IVGTT (59).

Fig. S1. Assessment of PCA-mediated toxicity on HEK-293 cells. (A) Viability of HEK-293 cells

after exposure to various concentrations of PCA. 7x103 HEK-293 cells were cultivated in medium

containing various PCA concentrations for 72 h before cell viability was scored by MTT assay. Data

represented are mean ± SD; n = 6 independent experiments. (B) Reporter SEAP quantification assay

for PCA on HEK-293 cells. 5x104 HEK-293 cells were transfected with 0.2 µg pSEAP2-control

(PSV40-SEAP-pA) and cultivated in medium containing various PCA concentrations for 72 h before

SEAP in the culture supernatants was profiled. The data represented are mean ± SD; n = 3 independent

experiments.

Fig. S2. Optimization of the PCAON system in HEK-293 cells. (A-E) HEK-293 cells were

co-transfected with 100 ng pJY18 (PSV40-PcaR-pA) and 100 ng PCA-inducible SEAP expression

vector variants either (A) pJY1 (PPcaR1, PSV40-OPcaV), (B) pJY2 [PPcaR2, PSV40-(OPcaV)2], (C) pJY3

[PPcaR3, PSV40-(OPcaV)3], (D) pJY4 [PPcaR4, PSV40-(OPcaV)4] or (E) pJY5 [PPcaR5, PSV40-(OPcaV)5] differing

in the number of PSV40-fused OPcaV-operator tandem repeats and cultivated in medium containing

various PCA concentrations for 48 h before SEAP in the culture supernatants was profiled. (F-J)

HEK-293 cells were co-transfected with 100 ng pJY29 (PhEF1ɑ-PcaR-pA) and 100 ng PCA-inducible

SEAP expression vector variants either (F) pJY13 (PPcaR6, PhCMV-OPcaV), (G) pJY14 [PPcaR7,

PhCMV-(OPcaV)2], (H) pJY15 [PPcaR8, PhCMV-(OPcaV)3], (I) pJY16 [PPcaR9, PhCMV-(OPcaV)4] or (J) pJY17

[PPcaR10, PhCMV-(OPcaV)5] differing in the number of PhCMV-fused OPcaV-operator tandem repeats and

cultivated in medium containing various PCA concentrations for 48 h before SEAP in the culture

supernatants was profiled. All the data represent the mean ± SD; n = 3 independent experiments.

Fig. S3. PCA analog-mediated SEAP expression in pJY14/pJY29-transgenic HEK-293 cells.

(A and B) 5x104 HEK-293 cells were co-transfected with 100 ng pJY14 and 100 ng pJY29 and

cultivated in medium containing various trigger compounds either (A) 3,5-dihydroxybenzoate

(3,5-DHB) or (B) 3-hydroxybenzoate (3-HB). SEAP in the culture supernatants was profiled after 48 h.

The data represented are mean ± SD; n = 3 independent experiments.

Fig. S4. PCAON-dependent SEAP expression kinetics in HEK-293 cells. (A) SEAP expression

kinetics of pJY14/pJY29-trangenic HEK-293 cells cultivated for various durations with PCA (500

µM). Different color bars represent different PCA incubation time. The X-axis indicates the time for

profiling SEAP expression. (B) Reversibility of PCAON switch-mediated SEAP expression. HEK-293

cells were co-transfected with 100 ng pJY29 and 100 ng pJY14 and cultivated for 72 h while varying

the PCA concentrations from 0 to 500 μM. SEAP in the culture supernatants was profiled every 6 h.

The data represent the mean ± SD; n = 3 independent experiments.

Fig. S5. Design, construction, and optimization of the PcaR-mediated inhibition device (PcaRi)

for gene inhibition. (A) Schematic of a synthetic PcaR-mediated inhibition device version 1

(PcaRi-v1). PcaRi-v1 device consists of a PCA-inducible gRNA expression circuit and a constitutive

expression circuit for dCas9-KRAB expression. Supplementation of PCA induces the expression of

gRNA capable of recruiting the constitutively expressed dCas9-KRAB to assemble into a repressive

complex (gRNA-dCas9-KRAB), which targets a specific DNA sequence at 3’ site of the PSV40

promoter and inhibits reporter SEAP expression. (B) PCA-repressible SEAP expression with the

synthetic PcaRi-v1 device. HEK-293 cells were co-transfected with pJY19 (PCAG-PcaR-pA), pJY84

(PhCMV-dCas9-KRAB-pA), pJY109 (PgRNA1-SEAP-pA), and pJY53 [PPcaR13-gRNAASCL1; PPcaR13,

(OPcaV)5-PU6-OPcaV] or pJY54 [PPcaR14-gRNAASCL1; PPcaR14, (OPcaV)5-PU6-(OPcaV)2] at a 2:1:1:1 ratio

(w/w/w/w) and cultivated in the presence or absence of PCA. SEAP in the culture supernatants was

profiled after 48 h. The data represented are mean ± SD; n = 3 independent experiments. (C)

Schematics of a synthetic PcaRi-v2 device. PcaRi-v2 device consists of a PCA-inducible gRNA

expression circuit and a PCA-inducible dCas9-KRAB expression circuit. In the presence of PCA,

gRNA, and dCas9-KRAB are induced to assemble into a repressive complex (gRNA-dCas9-KRAB),

which targets a specific DNA sequence at 3’ site of PSV40 and inhibits reporter SEAP expression. (D)

PCA-repressible SEAP expression with the synthetic PcaRi-v2 device. HEK-293 cells were

co-transfected with pJY19 (PCAG-PcaR-pA), pJY131 (PPcaR12-dCas9-KRAB-pA), pJY109

(PgRNA1-SEAP-pA), and pJY53 or pJY54 at a 2:1:1:1 ratio (w/w/w/w) and cultivated in the presence or

absence of PCA. SEAP in the culture supernatants was profiled after 48 h. The data represent the mean

± SD; n = 3 independent experiments.

Fig. S6. Design, construction, and optimization of the PcaR-mediated activation device (PcaRa)

for gene activation. (A) Schematic of a synthetic PcaR-mediated activation device version 1

(PcaRa-v1). The PcaRa-v1 device consists of a PCA-inducible gRNA expression circuit and a

constitutive dCas9-VP64 expression circuit. Treatment with PCA induces the expression of gRNA

capable of recruiting the constitutively expressed dCas9-VP64 to assemble into a transcriptional

activation complex (gRNA-dCas9-VP64), which targets a specific DNA sequence at 5’ of a minimal

promoter PhCMVmin and activates reporter SEAP expression. (B) PCA-inducible SEAP expression with

the synthetic PcaRa-v1 device. HEK-293 cells were co-transfected with pJY19, pWS52

(PhCMV-dCas9-VP64-pA), pJY110 (PgRNA2-SEAP-pA), and pJY53 [PPcaR13-gRNAASCL1; PPcaR13,

(OPcaV)5-PU6-OPcaV], or pJY54 [PPcaR14-gRNAASCL1; PPcaR14, (OPcaV)5-PU6-(OPcaV)2], or pJY61

[PPcaR15-gRNAASCL1; PPcaR15, (OPcaV)5-PU6-(OPcaV)5] at a 2:1:1:1 ratio (w/w/w/w) and cultivated in the

presence or absence of PCA. SEAP in the culture supernatants was profiled after 48 h. The data

represent the mean ± SD; n = 3 independent experiments. (C) Schematic of a synthetic PcaRa-v2

device. The PcaRa-v2 device consists of a PCA-inducible gRNA expression circuit and a

PCA-inducible dCas9-VP64 expression circuit. In the presence of PCA, gRNA and dCas9-VP64 are

induced to assemble into a transcriptional activation complex (gRNA-dCas9-VP64), which targets a

specific DNA sequence at 5’ of a minimal promoter PhCMVmin and activates reporter SEAP expression.

(D) PCA-inducible SEAP expression with the synthetic PcaRa-v2 device. HEK-293 cells were

co-transfected with pJY19, pJY36 [PPcaR5-dCas9-VP64-pA; PPcaR5, PSV40-(OPcaV)5], pJY110

(PgRNA2-SEAP-pA), and pJY53, or pJY54 or pJY61 at a 2:1:1:1 ratio (w/w/w/w) and cultivated in the

presence or absence of PCA. SEAP in the culture supernatants was profiled after 48 h. The data

represented are mean ± SD; n = 3 independent experiments. (E) Schematic of a synthetic PcaRa-v3

device. The PcaRa-v3 device consists of the PCA-inducible gRNAMS2 (gRNA with MS2 loop) and

MS2-p65-HSF1 expression circuits, and a constitutive dCas9 expression circuit. In the presence of

PCA, the gRNAMS2 and the transactivator MS2-p65-HSF1 are produced to recruit the constitutive

expressed dCas9, and assemble into a transcriptional activation complex

(gRNAMS2-dCas9-MS2-p65-HSF1), which enables target gene activation. (F) PCA-inducible SEAP

expression with the synthetic PcaRa-v3 device. HEK-293 cells were co-transfected with pJY19,

pSZ69 (PhCMV-dCas9-pA), pJY137 [PPcaR2-MS2-p65-HSF1-P2A-EGFP-pA; PPcaR2, PSV40-(OPcaV)2],

pJY110 (PgRNA2-SEAP-pA), and pJY56 [PPcaR13-gRNAASCL1(MS2); PPcaR13, (OPcaV)5-PU6-OPcaV], or

pJY57 [PPcaR14-gRNAASCL1(MS2); PPcaR14, (OPcaV)5-PU6-(OPcaV)2], or pJY62 [PPcaR15-gRNAASCL1(MS2);

PPcaR15, (OPcaV)5-PU6-(OPcaV)5] at a 2:1:1:1 ratio (w/w/w/w) and cultivated in the presence or absence of

PCA. SEAP in the culture supernatants was profiled after 48 h. The data represent the mean ± SD; n =

3 independent experiments.

Fig. S7. Schematics of a synthetic PcaR-mediated gene deletion device (PcaRdel). The PcaRdel

device consists of a PCA-inducible gRNA expression circuit and a constitutive Cas9 expression circuit.

In the presence of PCA, gRNA is induced to recruit the constitutively expressed Cas9 to assemble an

active complex, which cleaves the PhCMV-driven frameshift EGFP with a gRNA-target site and repairs

the EGFP reporter back to in-frame via non-homologous end joining (NHEJ).

Fig. S8. Controls with constitutively active CRISPR-dCas9 device-mediated genome repression

and activation. (A) CRISPR-dCas9 device-mediated inhibition of SEAP expression. HEK-293 cells

were co-transfected with pJY84 (PCMV-dCas9-KRAB-pA), pJY109 (PgRNA1-SEAP-pA), and empty

vector pcDNA3.1 (+) or pJY49 (PU6-gRNAASCL1). SEAP was profiled after 48 h. (B and C)

CRISPR-dCas9 device-mediated inhibition of endogenous gene expression. HEK-293 cells were

co-transfected with pJY84 (PCMV-dCas9-KRAB-pA), pcDNA3.1 (+), and pWL65 (PU6-gRNACXCR4)

(B), or pWL64 (PU6-gRNATP53) (C). The relative mRNA expression of CXCR4 (B) and TP53 (C) were

quantified by qPCR. (D) CRISPR-dCas9 device-mediated activation of SEAP expression. HEK-293

cells were co-transfected with pSZ69 (PhCMV-dCas9-pA), pJY137

(PPcaR2-MS2-p65-HSF1-P2A-EGFP-pA), pJY110 (PgRNA2-SEAP-pA), and pcDNA3.1 (+) or pJY57

[PPcaR14-gRNAASCL1(MS2)]. SEAP was profiled after 48 h. (E and F) CRISPR-dCas9 device-mediated

activation of endogenous gene expression. HEK-293 cells were co-transfected with pSZ69

(PhCMV-dCas9-pA), pJY137 (PPcaR2-MS2-p65-HSF1-P2A-EGFP-pA), pcDNA3.1 (+), and pJY47

[PU6-gRNAASCL1(MS2)] (E) or pJY48 [PU6-gRNApDX1(MS2)] (F). The relative mRNA expression of (E)

ASCL1 and PDX1 (F) were quantified by qPCR. The data represent the mean ± SD; n = 3 independent

experiments.

Fig. S9. PCA- and VA-controlled programmable biocomputers in mammalian cells. (A) Design

and performance of a synthetic A NIMPLY B logic gate. HEK-293 cells were co-transfected pJY29,

pJY179 (PSV40-VanA5-pA), and pDL35 (PPV2-d2EYFP-pA) at a 1:1:1 ratio (w/w/w) and cultivated in

the presence (1) or absence (0) of PCA or VA. d2EYFP was quantified by fluorescence microscopy

and FACS analysis at 48 h after administration of inputs. (B) Design and performance of a synthetic

B NIMPLY A logic gate. HEK-293 cells were co-transfected pJY12 (PSV40-PcaA-pA), pCK189

(PhCMV-VanA4-pA), and pDL34 (PPV1-d2EYFP-pA) at a 1:1:1 ratio (w/w/w) and cultivated in the

presence (1) or absence (0) of PCA or VA. d2EYFP was quantified by fluorescence microscopy and

FACS analysis at 48 h after administration of inputs. (C) Design and performance of a synthetic

mammalian AND logic gate. HEK-293 cells were co-transfected pJY29, pCK189, and pJY306

(PPV4-d2EYFP-pA) at a 1:1:1 ratio (w/w/w) and cultivated in the presence (1) or absence (0) of PCA

or VA. d2EYFP was quantified by fluorescence microscopy and FACS analysis at 48 h after

administration inputs. (D) Design and performance of a synthetic mammalian OR logic gate.

HEK-293 cells were co-transfected pJY29, pDL24 (PPcaR5-GV-P2A-N-peptide-mCherry-HHR-pA;

GV, Gal4-VP16), pCK189, pDL30 (PVanON8-GV-P2A-N-peptide-mCherry-HHR-pA; GV, Gal4-VP16),

and pDL46 (PUAS-d2EYFP-pA) at a 5:5:5:5:1 ratio (w/w/w/w/w) and cultivated in the presence (1) or

absence (0) of PCA or VA. d2EYFP was quantified by fluorescence microscopy and FACS analysis

at 48 h after administration of inputs. (E) Design and performance of a synthetic mammalian NOR

logic gate. HEK-293 cells were co-transfected pJY12, pJY201 (PPcaA5-TetR-DocS-pA), pJY179,

pJY200 (P1VanO2-Coh2-VP16-pA), and pJY202 (PhCMV*-1-d2EYFP-pA) at a 2:2:2:2:1 ratio

(w/w/w/w/w) and cultivated in the presence (1) or absence (0) of PCA or VA. d2EYFP was

quantified by fluorescence microscopy and FACS analysis at 48 h after administration of inputs. b.t.,

below the e threshold 103 fluorescence units. All the data represent the mean ± SD; n = 3 independent

experiments. See table S3 for detailed description of genetic components and table S7 for the detailed

transfection mixture for each logic gate.

Fig. S10. Flow cytometric histograms showing input-triggered single-cell d2EYFP expression of

all programmed logic circuits. The data sets show different input (no input, PCA, VA, VA and

PCA)-dependent d2EYFP fluorescence distributions with the following logic gates: A NIMPLY B (A),

B NIMPLY A (B), AND (C), OR (D), and NOR (E). The d2EYFP fluorescence threshold (>103

arbitrary FU) was used for the computational analysis.

Fig. S11. Validation of the VAON and the VAOFF system in mammalian cells. (A) Schematic of the

VA-inducible transcription-control switch VAON. The synthetic vanillic acid-responsive transrepressor

VanA4 (VanR-KRAB) was designed by fusing VanR C-terminally to the KRAB transrepressor domain,

which is driven by the constitutive promoter PhCMV. In the absence of VA, VanA4 binds to the synthetic

VA-inducible promoter PVanON8 containing eight VanO-operator sites 3’ of PhCMV and represses SEAP

expression. In the presence of VA, VanA4 is released from PVanON8 and initiates SEAP expression. (B)

Dose-dependent VA-inducible SEAP expression kinetics. HEK-293 cells were co-transfected with

pCK189 (PhCMV-VanA4-pA) and pCK191 (PVanON8-SEAP-pA) at a 1:1 ratio (w/w) and cultivated for 48

h in culture medium containing various VA concentrations. SEAP in the culture supernatants was

profiled after 48 h. The data represent the mean ± SD; n = 3 independent experiments. (C) Schematics

of the VA-repressible transcription-control switch VAOFF. VanR (Caulobacter crescentus repressor)

was fused to a synthetic transactivator VPR (VP64-p65-Rta) to assemble into a vanillic

acid-responsive transactivator VanA5 (VanR-VPR), which is driven by the human cytomegalovirus

immediate early promoter PSV40. In the absence of VA, VanA5 binds to the chimeric target promoter

P1VanO2 (VanO2-PhCMVmin) containing two copies of VanO-operator motif upstream of a minimal

promoter PhCMVmin and activates SEAP expression. In the presence of VA, VanA5 is released from

P1VanO2, resulting in the termination of SEAP expression. (D) Dose-dependent VA-repressible SEAP

expression kinetics. HEK-293 cells were co-transfected with pJY179 (PSV40-VanA5-pA) and pDL20

(P1VanO2-SEAP-pA) at a 1:1 ratio (w/w) and cultivated for 48 h in culture medium containing various

VA concentrations. SEAP in the culture supernatants was profiled after 48 h. The data represent the

mean ± SD; n = 3 independent experiments.

Fig. S12. Validation of the PCAOFF system in mammalian cells. (A) Schematic of the

PCA-repressible transcription-control switch PCAOFF. PcaV (Streptomyces coelicolor repressor) was

fused to the Herpes simplex virus-derived transactivation domain VP16 to create a protocatechuic

acid-dependent transactivator PcaA (PcaV-VP16), which is driven by the simian virus 40 promoter

PSV40. In the absence of PCA, PcaA binds to a chimeric target promoter PPcaA5 [(OPcaV)5-PhCMVmin]

harboring five copies of the OpcaV-operator motif upstream of a minimal promoter PhCMVmin and

activates SEAP expression. In the presence of PCA, PcaA is released from PPcaA5, resulting in the

termination of SEAP expression. (B) Dose-dependent PCA-repressible SEAP expression kinetics.

HEK-293 cells were co-transfected with pJY10 (PPcaA5-SEAP-pA) and pJY12 (PSV40-PcaA-pA) at a

1:1 ratio (w/w) and cultivated for 48 h in culture medium containing various PCA concentrations.

SEAP in the culture supernatants was profiled after 48 h. The data represent the mean ± SD; n = 3

independent experiments.

Fig. S13. Construction and characterization of the stable cell lines. (A and B) PCA-inducible

SEAP expression of different PCAON-transgenic cell clones including (A)

HEK-293PCA-ON-1.0-SEAP-P2A-mINS and (B) HEK-293PCA-ON-1.0-shGLP-1-P2A-SEAP. Six randomly selected cells

clones were profiled for their PCA-inducible SEAP regulation performance by cultivating them for 72

h in the presence or absence of 500 μM PCA. The data represent the mean ± SD; n = 3 independent

experiments.

Fig. S14. PCAON-2.0 switch-controlled treatment in type 1 diabetic mice by oral delivery of PCA.

Type 1 diabetic mice were intraperitoneally implanted with 4×106 microencapsulated

HEKPCA-2.0-SEAP-P2A-mINS cells, and received oral administration of various concentrations of PCA

(0-500 mg/kg/day). (A) Blood insulin and (B) glucose were profiled for 15 days after implantation.

Pink area represents normal blood glucose range. (C) Intraperitoneal glucose tolerance test (IPGTT)

was conducted on day 15 after implantation. All the data represent the mean ± SEM; two-tailed

Student’s t-test, n =5 mice. *P < 0. 05, **P < 0.01, ***P < 0.001 versus control.

Fig. S15. Hypoglycemic effect on type 1 and type 2 diabetic mice by oral administration of PCA

or tea drinking. Diabetic mice were received oral administration of the concentrated green tea (900

μl/mouse/day) or PCA (500 mg/kg/day) and control mice were received water. Blood glucose of type 1

(A) and type 2 (B) diabetic mice was quantified for 15 days. All the data represent the mean ± SEM;

two-tailed Student’s t-test, n =5 mice.

SUPPLEMENTARY TABLES

Table S1. The CBC and blood biochemistry tests in type 1 diabetic monkeys. The CBC assay and blood biochemistry assay of the two type 1

diabetic monkeys (No.1 and No.2) were performed on day 0, 3, 15, and 27 after implantation.

NO.1 NO.2

Index Normal

range

Day 0 Day 3 Day 15 Day 27 Day 0 Day 3 Day 15 Day 27

Blood Element

White cell count (109/L)

(4-10) 25.72 11.02 18.36 13.95

12.67 7.95 9.09

11.41

Red cell count (1012

/L) (4-5.5) 4.78

4.63 4.13 5.18 5.1

3.92 4.04 3.24

Mean platelets volume (fL) (11-15) 13.9

13.7 11.6 12.5 13.6

12.3 11.5 12.9

Lymphocytes (0.8-5.5) 8.77

5.8 7.47 7.59 5.06

2.92 2.86 6.08

Monocytes (0.12-0.8) 0.79

0.67 1.14 0.5 1.04

0.5 0.45 0.51

Eosinophils (0.02-0.5) 0.13

0.14 0.18 0.13 0.06

0.05 0 0.06

Basophils (0-0.1) 0.002

0.02 0.01 0 0.02

0.01 0 0

Liver function index

Total protein (g/L) (65-85) 65.9

71.1 74.7 73.5 70.3

68.5 58.7 61.5

Globulin (g/L) (20-40) 26.6

30.7 34.5 36.5 21.5

23.5 23.5 29.4

Direct bilirubin (umol/L) (0-6.8) 0.8

1 0.9 0.8 1

2.6 4.5 0.6

Total bile acid (umol/L) (0-12) 8

4.5 4.3 7 27.1

4.8 8.8 25

Kidney function index

Urea nitrogen (mmol/L) (1.8-9.5) 6.5

7.7 6.1 6.8 8.3

13 7.8 5.8

Carbon dioxide

combining power

(mmol/L)

(15-30) 21.7 22.7 29.6 21.8 11.1 15.1 28.9 28.4

Cystatin C (mg/L) (0-1.4) 1.27 1.3 1.23 1.2 0.9 0.8 0.7 0.58

http://www.baidu.com/link?url=IL2yVSzMw8Iw8wABoKl6oaejUi30XmxCpNHFgvACbJSf4nRdUj00_KOLebAtyiPcthl0Ck9ZEozBgDh50Z7hWa

Table S2. The CBC and blood biochemistry tests in type 2 diabetic monkeys. The CBC assay and blood biochemistry assay of the two type 2

diabetic monkeys (No.1 and No.2) were performed on day 0, 5, 15, and 30 after implantation.

NO.1 NO.2

Index Normal

range

Day 0 Day5 Day 15 Day 30 Day 0 Day 5 Day 15 Day 30

Blood Element

White cell count (109/L)

(4-10) 6.1 6.2 8.1 6.9

17.2 15.0 20.2 14.0

Red cell count (1012

/L) (4-5.5)

5.7 5.5 5.3 5.4

5.8 4.8 4.7 5.7

Mean platelets volume (fL) (11-15)

10.7 11.3 10.6 10.0

11.6 11.7 10.7 11.7

Lymphocytes (0.8-5.5)

3.0 1.7 1.7 2.3

5.8 2.4 7.8 6.6

Monocytes (0.12-0.8)

0.4 0.3 0.4 0.5

1.0 0.4 1.5 1.2

Eosinophils (0.02-0.5)

0.1 0.0 0.0 0.1

0.2 0.1 0.2 0.2

Basophils (0-0.1)

0.2 0.0 0.1 0.3

0.1 0.1 0.2 0.1

Liver function index

Total protein (g/L) (65-85) 1.7 67.8 66.3 68.9

2.5 1.9 1.2 2.3

Globulin (g/L) (20-40) 36.1 34.2 32.5 35.6

36.4 30.9 37.1 37.7

Direct bilirubin (umol/L) (0-6.8) 0.5 0.6 0.4 0.3

0.9 0.7 0.4 0.6

Total bile acid (umol/L) (0-12) 1.7 2.0 1.1 1.1

2.5 1.9 1.2 2.3

Kidney function index

Urea nitrogen (mmol/L) (1.8-9.5) 6.5 7.2 7.0 6.0

6.5 3.9 3.9 5.6

Carbon dioxide

combining power

(mmol/L)

(15-30)

30.2 27.2 29.0 33.6

29.0 28.8 27.6 29.2

Cystatin C (mg/L) (0-1.4) 0.9 0.9 0.9 1.0

1.7 1.6 2.0 1.8

http://www.baidu.com/link?url=IL2yVSzMw8Iw8wABoKl6oaejUi30XmxCpNHFgvACbJSf4nRdUj00_KOLebAtyiPcthl0Ck9ZEozBgDh50Z7hWa

Table S3. Plasmids designed and used in this study.

Plasmids Description and Cloning Strategy Reference

pcDNA3.1(+) Constitutive PhCMV-driven mammalian expression vector (PhCMV-MCS-pA). Invitrogen, CA

pSEAP2-

control

Constitutive PSV40-driven SEAP expression vector (PSV40-SEAP-pA). Clontech, CA

pd2EYFP Constitutive PhCMV-driven d2EYFP expression vector (PhCMV-d2EYFP-pA). Clontech, CA

pHP187 Constitutive PCAG-driven EGFP and Cre expression vector (PCAG-EGFP-IRES-Cre-pA). ObiO,

Shanghai

pCMV-T7-

SB100

Constitutive PhCMV-driven SB100X expression vector (PhCMV-SB100X-pA) (Addgene no. 34879). (53)

pSimpleII Constitutive PhEF1α-driven Cas9 expression vector (PhEF1α-Cas9-pA) (Addgene no. 47872). (60)

pMS2-gRNA sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2, containing BbsI site for insertion of

spacer sequences (Addgene no. 61424).

(34)

pHP1 Mammalian vector containing constitutive expression units for gRNA and Cas9 (PU6-gRNA: PCBh-Cas9-pA)

(Addgene no. 42230).

(61)

pHP69 dCas9-VP64 unit on a Gateway donor vector pCR8/GW/TOPO (Addgene no. 48219). (62)

pCK189 Constitutive PhCMV-driven VanA4 expression vector (PhCMV-VanA4-pA). (18)

pCK191 PVanON8-driven SEAP expression vector (PVanON8-SEAP-pA). (18)

pMF111 PhCMV*-1-driven SEAP expression vector (PhCMV*-1-SEAP-pA). (63)

pHY73 PhCMV*-1-driven shGLP-1 expression vector (PhCMV*-1-shGLP-1-pA). (7)

pHY101 PCRE-driven SEAP and mINS expression vector (PCRE-SEAP-P2A-mINS-pA). (7)

pHY118 SB100X derivative containing a tetracycline-responsive bicistronic Fc-adiponectin and EGFP expression unit

and a constitutive PuroR expression unit (ITR-PhCMV*-1-Fc-adiponectin-P2A-EGFP-pA:PmPGK-PuroR-pA-ITR).

(64)

pHY121 SB100X derivative containing a constitutive bicistronic IR and TetR-Elk1 expression unit and a constitutive

ZeoR expression unit (ITR-PhCMV-IR-P2A-TetR-Elk1-pA:PmPGK-ZeoR-pA-ITR).

(64)

pXY62 FRTA-specific far-red light (FRL)-inducible shGLP-1 and SEAP expression vector (PFRL2.13a-

shGLP-1-P2A-SEAP-pA).

(8)

pWS52 Constitutive PhCMV-driven dCas9-VP64 expression vector (PhCMV-dCas9-VP64-pA). dCas9-VP64 was excised

from pHP69 with AflII/XbaI and cloned into the corresponding sites (AflII/XbaI) of pcDNA3.1(+).

This work

pSZ69 Constitutive PhCMV-driven dCas9 expression vector (PhCMV-dCas9-pA). dCas9 was PCR-amplified from pWS52

using oligonucleotides OSZ69-1 (5’-

TTTAAACTTAAGCTTGGTACGCCACCATGTACCCATACGATGTTCCAG-3’) and OSZ69-2 (5’-

GGTTTAAACGGGCCCTCTAGTTAGCTGGCCTCCACCTTTCTCTTCTTC-3’) and cloned into the

corresponding sites (KpnI/XbaI) of pcDNA3.1(+) by homologous recombination using the GeneArt®

Seamless

Cloning and Assembly Kit.

This work

pYW54 Constitutive PhCMV-driven Cas9 expression vector (PhCMV-Cas9-pA). Cas9 was PCR-amplified from pHP1 using

oligonucleotides OYW54-3 (5’-CCCaagcttCCGGTGCCACCATGGACTATAAGGAC-3’) and OYW54-4

(5’-CCGctcgagGTCGAGGCTGATCAGCGAGCTCTAG-3’), restricted with HindIII/XhoI and cloned into the

corresponding sites (HindIII/XhoI) of pcDNA3.1(+).

This work

pJY1 Protocatechuic acid-responsive SEAP expression vector (PPcaR1-SEAP-pA; PPcaR1, PSV40-OPcaV).

Oligonucleotides OJY1-1 (5’-agcttATACTCAGTGCCCTGACTATg-3’) and OJY1-2 (5’-

aattcATAGTCAGGGCACTGAGTATa-3’) were annealed and cloned into the corresponding sites

(HindIII/EcoRI) of pSEAP2-control.

This work

pJY2 Protocatechuic acid-responsive SEAP expression vector [PPcaR2-SEAP-pA; PPcaR2, PSV40-(OPcaV)2].

Oligonucleotides OJY2-1 (5’-agcttATACTCAGTGCCCTGACTATATACTCAGTGCCCTGACTATg-3’) and

OJY2-2 (5’-aattcATAGTCAGGGCACTGAGTATATAGTCAGGGCACTGAGTATa-3’) were annealed and

cloned into the corresponding sites (HindIII/EcoRI) of pSEAP2-control.

This work


Oligonucleotides OJY3-1

(5’-agcttATACTCAGTGCCCTGACTATATACTCAGTGCCCTGACTATATACTCAGTGCCCTGACTATg

-3’) and OJY3-2 (5’-

aattcATAGTCAGGGCACTGAGTATATAGTCAGGGCACTGAGTATATAGTCAGGGCACTGAGTATa-3

’) were annealed and cloned into the corresponding sites (HindIII/EcoRI) of pSEAP2-control.

This work


Oligonucleotides OJY4-1 (5’-

agcttATACTCAGTGCCCTGACTATATACTCAGTGCCCTGACTATATACTCAGTGCCCTGACTATATA

This work

CTCAGTGCCCTGACTATg-3’) and OJY4-2 (5’-

aattcATAGTCAGGGCACTGAGTATATAGTCAGGGCACTGAGTATATAGTCAGGGCACTGAGTATAT

AGTCAGGGCACTGAGTATa-3’) were annealed and cloned into the corresponding sites (HindIII/EcoRI) of

pSEAP2-control.



agcttATACTCAGTGCCCTGACTATATACTCAGTGCCCTGACTATATACTCAGTGCCCTGACTATATA

CTCAGTGCCCTGACTATATACTCAGTGCCCTGACTATg-3’) and OJY5-2 (5’-


AGTCAGGGCACTGAGTATATAGTCAGGGCACTGAGTATa-3’) were annealed and cloned into the

corresponding sites (HindIII/EcoRI) of pSEAP2-control.

This work

pJY6 Protocatechuic acid-responsive SEAP expression vector (PPcaA1-SEAP-pA; PPcaA1, OPcaV-PhCMVmin).

MCS-PhCMVmin-SEAP-pA was PCR-amplified from pMF111 using oligonucleotides OJY6-1 (5’-

GGCcctgcaggTCGAGCTCGGTACCCGGGTCG-3’) and OJY6-2 (5’-

CCGCgacgtcAGGTGGCACTTTTCGGGGAA-3’) and ligated with corresponding AatII/SbfI-compatible

overhangs of OPcaV generated by annealing oligonucleotides OJY6-3 (5’-

cATACTCAGTGCCCTGACTATcctgca-3’) and OJY6-4 (5’-ggATAGTCAGGGCACTGAGTATgacgt-3’).

This work

pJY7 Protocatechuic acid-responsive SEAP expression vector [PPcaA2-SEAP-pA; PPcaA2, (OPcaV)2-PhCMVmin].

Oligonucleotides OJY7-1 (5’-cATACTCAGTGCCCTGACTATATACTCAGTGCCCTGACTATcctgca-3’)

and OJY7-2 (5’-ggATAGTCAGGGCACTGAGTATATAGTCAGGGCACTGAGTATgacgt-3’) were annealed

and cloned into the corresponding sites (AatII/SbfI) of pJY6.

This work



cATACTCAGTGCCCTGACTATATACTCAGTGCCCTGACTATATACTCAGTGCCCTGACTATcctgca-3’

) and OJY8-2 (5’-

ggATAGTCAGGGCACTGAGTATATAGTCAGGGCACTGAGTATATAGTCAGGGCACTGAGTATgacgt

-3’) were annealed and cloned into the corresponding sites (AatII/SbfI) of pJY6.

This work



This work

cATACTCAGTGCCCTGACTATATACTCAGTGCCCTGACTATATACTCAGTGCCCTGACTATATACT

CAGTGCCCTGACTATcctgca-3’) and OJY9-2 (5’-

ggATAGTCAGGGCACTGAGTATATAGTCAGGGCACTGAGTATATAGTCAGGGCACTGAGTATATA

GTCAGGGCACTGAGTATgacgt-3’) were annealed and cloned into the corresponding sites (AatII/SbfI) of

pJY6.



cATACTCAGTGCCCTGACTATATACTCAGTGCCCTGACTATATACTCAGTGCCCTGACTATATACT

CAGTGCCCTGACTATATACTCAGTGCCCTGACTATcctgca-3’) and OJY10-2 (5’-

ggATAGTCAGGGCACTGAGTATATAGTCAGGGCACTGAGTATATAGTCAGGGCACTGAGTATATA

GTCAGGGCACTGAGTATATAGTCAGGGCACTGAGTATgacgt-3’) were annealed and cloned into the

corresponding sites (AatII/SbfI) of pJY6.

This work

pJY12 Constitutive PSV40-driven PcaA expression vector (PSV40-PcaA-pA; PcaA, PcaV-VP16). PcaV-VP16 was

chemically synthesized, restricted with EcoRI/XbaI and cloned into the corresponding sites (EcoRI/XbaI) of

pSEAP2-control.

This work

pJY13 Protocatechuic acid-responsive SEAP expression vector (PPcaR6-SEAP-pA; PPcaR6, PhCMV-OPcaV). OPcaV-SEAP

was excised from pJY1 with HindIII/HpaI and cloned into the corresponding sites (HindIII/HpaI) of pCK191.

This work

pJY14 Protocatechuic acid-responsive SEAP expression vector [PPcaR7-SEAP-pA; PPcaR7, PhCMV-(OPcaV)2].

(OPcaV)2-SEAP was excised from pJY2 with HindIII/HpaI and cloned into the corresponding sites

(HindIII/HpaI) of pCK191.

This work




This work




This work




This work

pJY18 Constitutive PSV40-driven PcaR expression vector (PSV40-PcaR-pA; PcaR, KRAB-PcaV). PcaV was

PCR-amplified from pJY12 using oligonucleotides OJY18-1 (5’-

CACGCgacgtcGCAGCGGTCGATCTGGCCACCCACCC-3’) and OJY18-2 (5’-

TGCtctagaTCAGCCCGGTGCCACCGCCGGCTC-3’), restricted with AatII/XbaI and cloned into the

corresponding sites (AatII/XbaI) of pJY11.

This work

pJY19 Constitutive PCAG-driven PcaR expression vector (PCAG-PcaR-pA; PcaR, KRAB-PcaV). PCAG was

PCR-amplified from pHP187 using oligonucleotides OJY19-1 (5’-

CGacgcgtTCATGTCCAACATTACCGCCATG-3’) and OJY19-2 (5’-

CCCaagcttGAATTCTTTGCCAAAATGATGAG-3’), restricted with MluI/HindIII and cloned into the

corresponding sites (MluI/HindIII) of pJY18.

This work

pJY29 Constitutive PhEF1α-driven PcaR expression vector (PhEF1α-PcaR-pA; PcaR, KRAB-PcaV). PhEF1α was

PCR-amplified from pSimpleII using oligonucleotides OJY29-1 (5’-

GGggtaccGGGAAAGTGATGTCGTGTACTGGCTC-3’) and OJY29-2 (5’-

CGgaattcTCACGACACCTGAAATGGAAG-3’), restricted with KpnI/EcoRI and cloned into the

corresponding sites (KpnI/EcoRI) of pJY18.

This work

pJY36 Protocatechuic acid-responsive dCas9-VP64 expression vector [PPcaR5-dCas9-VP64-pA; PPcaR5, PSV40-(OPcaV)5].

dCas9-VP64 was PCR-amplified from pWS52 using oligonucleotides OJY36-1

(5’-CGgaattcGCCACCATGTACCCATACGATGTTCCAG-3’) and OJY36-2

(5’-TGCtctagaTTAATCGATATATAACATATCGAGATC-3’), restricted with EcoRI/XbaI and cloned into the

corresponding sites (EcoRI/XbaI) of pJY5.

This work

pJY39 SB100X derivative containing a constitutive PcaR expression unit and a constitutive PuroR expression unit

(ITR-PhEF1α-PcaR-pA: PmPGK-PuroR-pA-ITR). A linearized vector (Fragment 1) was PCR-amplified from

pHY118 using oligonucleotides OJY39-1 (5’-GCTAGCTTCGATCCAGACATGATAAG-3’) and OJY39-2

(5’-CTAGATAGCGGACCCCTTACCGAAAC-3’), PhEF1α-PcaR (Fragment 2) was PCR-amplified from pJY29

using oligonucleotides OJY39-3 (5’-

GGTAAGGGGTCCGCTATCTAGGGTACCGAGCTCTTACGCGTGCTAG-3’) and OJY39-4 (5’-

CATGTCTGGATCGAAGCTAGCGCCGGCCGCCCCGACTCTAGATCAGC-3’), and both fragments were

assembled by homologous recombination using the GeneArt® Seamless Cloning and Assembly Kit.

This work

pJY40 SB100X derivative containing a protocatechuic acid-responsive bicistronic SEAP and mINS expression unit and This work

a constitutive ZeoR expression unit (ITR-PPcaR6-SEAP-P2A-mINS-pA: PmPGK-ZeoR-pA-ITR). A linearized

vector (Fragment 1) was PCR-amplified from pHY121 using oligonucleotides OJY40-1 (5’-

GCTTCGATCCAGACATGATAAGATAC-3’) and OJY40-2 (5’-

CTAGATAGCGGACCCCTTACCGAAAC-3’), PPcaR6-SEAP-P2A-mINS (Fragment 2) was PCR-amplified

from pJY36 using oligonucleotides OJY40-3 (5’- GTTTCGGTAAGGGGTCCGCTATCTAGGGTACCGAGCTCTTACGCGTGCTAG-3’) and OJY40-4 (5’-

GTATCTTATCATGTCTGGATCGAAGCTTAGTTGCAGTAGTTCTCCAGTTGG -3’), and both fragments

were assembled by homologous recombination using the GeneArt® Seamless Cloning and Assembly Kit.

pJY41 SB100X derivative containing a protocatechuic acid-responsive bicistronic shGLP-1 and SEAP expression unit

and a constitutive ZeoR expression unit (ITR-PPcaR6-shGLP-1-P2A-SEAP-pA: PmPGK-ZeoR-pA-ITR). A

linearized vector (Fragment 1) was PCR-amplified from pHY121 using oligonucleotides OJY40-1 (5’-

GCTTCGATCCAGACATGATAAGATAC-3’) and OJY40-2 (5’-

CTAGATAGCGGACCCCTTACCGAAAC-3’), PPcaR6-shGLP-1-P2A-SEAP (Fragment 2) was PCR-amplified

from pJY26 using oligonucleotides OJY40-3 (5’-

GTTTCGGTAAGGGGTCCGCTATCTAGGGTACCGAGCTCTTACGCGTGCTAG-3’) and OJY40-4 (5’-

GTATCTTATCATGTCTGGATCGAAGCTTACGGGTGCGCGGCGTCGGTGGTG-3’), and both fragments

were assembled by homologous recombination using the GeneArt® Seamless Cloning and Assembly Kit.

This work

pJY53 Protocatechuic acid-responsive gRNAASCL1 expression vector [PPcaR13-gRNAASCL1; PPcaR13, (OPcaV)5-PU6-OPcaV].

PU6 (Fragment 1) was PCR-amplified from pHP1 using oligonucleotides OJY53-1 (5’-

GTGCCCTGACTATCCTGCAGGGAGGGCCTATTTCCCATGATTCCTTC-3’) and OJY53-2 (5’-

GGTGGAATTCGATAGTCAGGGCACTGAGTATAAGCTTGATATATAAAGCCAAGAAATCG-3’),

gRNAASCL1 (Fragment 2) was PCR-amplified from pJY49 using oligonucleotides OJY53-3 (5’-

ATACTCAGTGCCCTGACTATCGAATTCCACCGCAGCCGCTCGCTGCAGCAGGTTTTAG-3’) and

OJY53-4 (5’-GCCGGCCGCCCCGACTCTAGAGTGAAATACCGCACAGATGCGTAAGGAG-3’), both

fragments were cloned into the corresponding sites (SbfI/XbaI) of pJY38 by homologous recombination using

the GeneArt®

Seamless Cloning and Assembly Kit.

This work

pJY54 Protocatechuic acid-responsive gRNAASCL1 expression vector [PPcaR14-gRNAASCL1; PPcaR14,

(OPcaV)5-PU6-(OPcaV)2]. Oligonucleotides OJY2-1 (5’-

agcttATACTCAGTGCCCTGACTATATACTCAGTGCCCTGACTATg-3’) and OJY2-2 (5’-

This work

aattcATAGTCAGGGCACTGAGTATATAGTCAGGGCACTGAGTATa-3’) were annealed and cloned into

the corresponding sites (HindIII/EcoRI) of pJY53.

pJY55 Protocatechuic acid-responsive gRNAPDX1(MS2) expression vector [PPcaR14-gRNAPDX1(MS2); PPcaR14,

(OPcaV)5-PU6-(OPcaV)2]. gRNAPDX1(MS2) was PCR-amplified from pJY48 using oligonucleotides OJY55-1 (5’-

CAGTGCCCTGACTATGAATTCCACCGGCCTGGCTGGCCGCACTAAG-3’) and OJY55-2 (5’-

AGGGCATCGGTCGACGGATCCGTGAAATACCGCACAGATGCGTAAGGAG-3’), and cloned into the

corresponding sites (EcoRI/BamHI) of pJY54 by homologous recombination using the GeneArt®

Seamless


This work

pJY56 Protocatechuic acid-responsive gRNAASCL1(MS2) expression vector [PPcaR13-gRNAASCL1(MS2); PPcaR13,

(OPcaV)5-PU6-OPcaV]. gRNAASCL1(MS2) was PCR-amplified from pJY47 using oligonucleotides OJY56-1 (5’-

CAGTGCCCTGACTATGAATTCCACCGCAGCCGCTCGCTGCAGCAG-3’) and OJY55-2 (5’-



Seamless


This work


(OPcaV)5-PU6-(OPcaV)2]. gRNAASCL1(MS2) was PCR-amplified from pJY47 using oligonucleotides OJY56-1 (5’-




Seamless


This work

pJY58 Protocatechuic acid-responsive gRNACCR5 expression vector [PPcaR14-gRNACCR5; PPcaR14, (OPcaV)5-PU6-(OPcaV)2].

gRNACCR5 was PCR-amplified from pJY50 using oligonucleotides OJY58-1 (5’-

CCGgaattcCACCGTGACATCAATTATTATACATG-3’) and OJY58-2 (5’-

TGCtctagaGCTTGTCTGCAGAATTGGCGCACGCG-3’), restricted with EcoRI/XbaI and cloned into the


This work

pJY59 Protocatechuic acid-responsive gRNAEMX1 expression vector [PPcaR14-gRNAEMX1; PPcaR14,

(OPcaV)5-PU6-(OPcaV)2]. gRNAEMX1 was PCR-amplified from pJY51 using oligonucleotides OJY59-1 (5’-

CCGgaattcCACCGAGTCCGAGCAGAAGAAGAAG-3’) and OJY58-2 (5’-


This work


pJY60 Constitutive PhCMV-driven PuroR expresssion vector (PhCMV-PuroR-pA). PuroR was PCR-amplified from

pHY118 using oligonucleotides OJY60-1

(5’-CTAgctagcGCCACCATGACCGAGTACAAGCCCACGGTG-3’) and OJY60-2

(5’-CCCaagcttTTAGGCACCGGGCTTGCGGGTCATG-3’), restricted with NheI/HindIII and cloned into the

corresponding sites (NheI/HindIII) of pcDNA3.1(+).

This work

pJY61 Protocatechuic acid-responsive gRNAASCL1 expression vector [PPcaR15-gRNAASCL1; PPcaR15,

(OPcaV)5-PU6-(OPcaV)5]. Oligonucleotides OJY5-1

(5’-agcttATACTCAGTGCCCTGACTATATACTCAGTGCCCTGACTATATACTCAGTGCCCTGACTATA

TACTCAGTGCCCTGACTATATACTCAGTGCCCTGACTATg-3’) and OJY5-2 (5’-


AGTCAGGGCACTGAGTATATAGTCAGGGCACTGAGTATa-3’) were annealed and cloned into the

corresponding sites (HindIII/EcoRI) of pJY53.

This work


(OPcaV)5-PU6-(OPcaV)5]. gRNAASCL1(MS2) was PCR-amplified from pJY47 using oligonucleotides OJY56-1 (5’-




Seamless


This work

pJY84 Constitutive PhCMV-driven dCas9-KRAB expression vector (PhCMV-dCas9-KRAB-pA). KRAB was


CGCggatccGATGCTAAGTCACTAACTGCCTGGTCC-3’) and OJY84-2 (5’-

TGCtctagaTTACCAGAGATCATTCCTTGCCATTC-3’), restricted with BamHI/XbaI and cloned into the

corresponding sites (BamHI/XbaI) of pWS52.

This work

pJY109 gRNAASCL1-responsive SEAP expression vector (PgRNA1-SEAP-pA; PgRNA1, PSV40-GBSASCL1; GBSASCL1,

gRNAASCL1 binding sequence). Oligonucleotides OJY109-1 (5’-

agcttCACCGCAGCCGCTCGCTGCAGCAGCGGg-3’) and OJY109-2 (5’-

aattcCCGCTGCTGCAGCGAGCGGCTGCGGTGa-3’) were annealed, and cloned into the corresponding sites

(HindIII/EcoRI) of pSEAP2-control.

This work

pJY110 gRNAASCL1-responsive SEAP expression vector (PgRNA2-SEAP-pA; PgRNA2, GBSASCL1-PhCMVmin; GBSASCL1,

gRNAASCL1 binding sequence). Oligonucleotides OJY110-1 (5’-

cCACCGCAGCCGCTCGCTGCAGCAGCGGcctgca-3’) and OJY110-2 (5’-

ggCCGCTGCTGCAGCGAGCGGCTGCGGTGgacgt-3’) were annealed, and cloned into the corresponding

sites (AatII/SbfI) of pJY10.

This work

pJY131 Protocatechuic acid-responsive dCas9-KRAB expression vector [PPcaR12-dCas9-KRAB-pA; PPcaR12,

(OPcaV)5-PhCMV-(OPcaV)5]. PPcaR12 was excised from pJY38 with NheI/EcoRI and cloned into the corresponding

sites (SpeI/EcoRI) of pJY84.

This work

pJY137 Protocatechuic acid-responsive MS2-p65-HSF1 and EGFP expression vector

[PPcaR2-MS2-p65-HSF1-P2A-EGFP-pA; PPcaR2, PSV40-(OPcaV)2]. MS2-p65-HSF1 (Fragment 1) was


CAGTGCCCTGACTATGAATTCGCCACCATGGCTTCAAACTTTACTCAG-3’) and OJY137-2 (5’-

GGAGACAGTGGGGTCCTTGGCTTTGG-3’), P2A-EGFP was PCR-amplified from pJY20 using OJY137-3

(5’-CCAAAGCCAAGGACCCCACTGTCTCCGGAAGCGGAGCTACTAACTTCAGCCTGC-3’) and

OJY137-4 (5’-GCCGGCCGCCCCGACTCTAGATTACTTGTACAGCTCGTCCATGCCGAGAG-3’), both

fragments were ligated into the corresponding sites (EcoRI/XbaI) of pJY2 by homologous recombination using

the GeneArt®


This work

pJY158 Vanillic acid-responsive SEAP expression vector (PVanON4-SEAP-pA; PVanON4, PhCMV-VanO4). Oligonucleotides

OJY160-1 (5’- ctagcATTGGATCCAATGCATTGGATCCAATGGATTGGATCCAATCG

ATTGGATCCAATa-3’) and OJY160-2

(5’-agcttATTGGATCCAATCGATTGGATCCAATCCATTGGATCCAATGCATTGGATCCAATg-3’) were

annealed and cloned into the corresponding sites (NheI/HindIII) of pcDNA3.1(+).

This work

pJY159 Protocatechuic and vanillic acid-responsive SEAP expression vector (PPV2-SEAP-pA; PPV2, OPcaV-PhCMVmin-

VanO4). VanO4-SEAP was PCR-amplified from pJY158 using oligonucleotides OJY159-1

(5’-CCGgaattcATTGGATCCAATGCATTGGATCCAATGGATTGGATCCAATCGATTGGATCCAATGT

ATTCGCCCACCATG-3’) and OJY159-2 (5’-CCCaagcttTTATCATGTCTGCTCGAAGCGGCCG-3’),

restricted with EcoRI/HindIII and cloned into the corresponding sites (EcoRI/HindIII) of pJY6.

This work

pJY162 Protocatechuic and vanillic acid-responsive SEAP expression vector [PPV1-SEAP-pA; PPV1,

VanO2-PhCMVmin-(OPcaV)2]. (OPcaV)2-SEAP was PCR-amplified from pJY2 using oligonucleotides OJY162-1

This work

(5’-CCGgaattcATACTCAGTGCCCTGACTATATACTCAGTGCCCTGACTATGATATCGCCCACCATGC

-3’) and OJY159-2 (5’-CCCaagcttTTATCATGTCTGCTCGAAGCGGCCG-3’), restricted with EcoRI/HindIII

and cloned into the corresponding sites (EcoRI/HindIII) of pDL20.

pJY179 Constitutive PSV40-driven VanA5 expression vector (PSV40-VanA5-pA; VanA5, VanR-VPR; VPR,

VP64-p65-Rta). VanR (Fragment 1) was PCR-amplified from pCK189 using oligonucleotides OJY179-1 (5’-

AAAGCTTCGAATCGCGAATTCGCCACCATGGACATGCCGCGC-3’) and OJY179-2 (5’-

CCAGCGCGTCGGCGCGCCCGGATCCGTCGGCGCGAATGCTCCACGCCGCGC-3’), VPR (Fragment 2)

was PCR-amplified from pJY175 using oligonucleotides OJY179-3 (5’-

GCGCGGCGTGGAGCATTCGCGCCGACGGATCCGGGCGCGCCGACGCGCTGG-3’) and OJY179-4

(5’-GCCGGCCGCCCCGACTCTAGATTAAAACAGAGATGTGTCGAAGATG-3’), both fragments were

ligated into the corresponding sites (EcoRI/XbaI) of pSEAP2-control by homologous recombination using the

GeneArt®


This work

pJY200 Vanillic acid-responsive Coh2-VP16 expression vector (P1VanO2-Coh2-VP16-pA; P1VanO2, VanO2-PhCMVmin).

Coh2-VP16 was chemically synthesized, restricted with EcoRI/XhoI and cloned into the corresponding sites

(EcoRI/XhoI) of pDL20.

This work

pJY201 Protocatechuic acid-responsive TetR-Docs expression vector [PPcaA5-TetR-DocS-pA; PPcaA5, (OPcaV)5-PhCMVmin].

TetR-DocS was chemically synthesized, restricted with EcoRI/XbaI and cloned into the corresponding sites

(EcoRI/XbaI) of pJY10.

This work

pJY202 Tetracycline-responsive d2EYFP expression vector (PhCMV*-1-d2EYFP-pA; PhCMV*-1, tetO7-PhCMVmin). d2EYFP

was PCR-amplified from pd2EYFP using oligonucleotides OJY202-1 (5’-

GCCTCCGCGGCCCCGAATTCGCCACCATGGTGAGCAAGGGCGAGGAG-3’) and OJY202-2 (5’-

CCAGAGCTGTTTTAAAAGCTTCTACACATTGATCCTAGCAGAAGCAC-3’) and cloned into the

corresponding sites (EcoRI/HindIII) of pMF111 by homologous recombination using the GeneArt®

Seamless


This work

pJY221 Constitutive PhCMV-driven fsEGFP expression vector (PhCMV-fsEGFP-pA; fsEGFP, frameshift EGFP).

Oligonucleotides OJY221-1 (5’-agcttGCCACCATGCCTGACATCAATTATTATACATCGGc-3’) and

OJY221-2 (5’-tcgagCCGATGTATAATAATTGATGTCAGGCATGGTGGCa-3’) were annealed and cloned

into the corresponding sites (HindIII/XhoI) of pJY220.

This work

pJY303 Protocatechuic and vanillic acid-responsive SEAP expression vector (PPV3-SEAP-pA; PPV3, This work

PhCMV-VanO4-OPcaV). OPcaV-SEAP was PCR-amplified from pJY1 using oligonucleotides OJY303-1

(5’-CGgaattc ATACTCAGTGCCCTGACTATGATATC-3’) and OJY303-2

(5’-GCtctagaGTAACCCGGGTGCGCGGC-3’), restricted with EcoRI/XbaI and cloned into the corresponding

sites (EcoRI/XbaI) of pJY158.

pJY306 Protocatechuic and vanillic acid-responsive d2EYFP expression vector (PPV3-d2EYFP-pA; PPV3,

PhCMV-VanO4-OPcaV). d2EYFP was PCR-amplified from pd2EYFP using oligonucleotides OJY306-1 (5’-

CGgaattcATACTCAGTGCCCTGACTATGATATCGCCACCATGGTGAGCAAGGGCGAGG-3’) and

OJY303-2 (5’- GCtctagaTTACACATTGATCCTAGCAGAAGCAC-3’), restricted with EcoRI/XbaI and

cloned into the corresponding sites (EcoRI/XbaI) of pJY303.

This work

pJY322 Constitutive PCMV-driven PcaK expression vector (PCMV-PcaK-pA). PcaK was PCR-amplified from PPcaK using

oligonucleotides pJY322-1 (5’-

CTAGCGTTTAAACTTAAGCTTGCCACCATGAACCAAGCTCAGACCAATGTGGGCAAATC-3’) and

pJY322-2 (5’-TGCTGGATATCTGCAGAATTCTTAGGTGGCGTCAGCATGGGACACCAGTC-3’) and

ligated into the corresponding sites (HindIII/EcoRI) of pcDNA3.1 (+) by homologous recombination using the

GeneArt® Seamless Cloning and Assembly Kit.

This work

pJY325 SB100X derivative containing a protocatechuic acid-responsive SEAP expression unit, a constitutive PcaK

expression unit and a constitutive ZeoR expression unit (ITR-PPcaR7-SEAP-P2A-mINS-pA: PhCMV-PcaK:

PmPGK-ZeoR-pA-ITR). PhCMV-PcaK was PCR-amplified from pJY322 using oligonucleotides pJY325-1 (5’-

TACAAATGTGGTAAAATCGATCGGGCCAGATATACGCGTTGACATTG-3’) and pJY325-2

(5’-ATCGTTCAGATCCTTATCGATTTAGGTGGCGTCAGCATGGGACACC-3’) and ligated into the

corresponding sites (ClaI) of pJY228 by homologous recombination using the GeneArt® Seamless Cloning and

Assembly Kit.

This work

pJY326 SB100X derivative containing a protocatechuic acid-responsive SEAP expression unit, a constitutive PcaK

expression unit and a constitutive ZeoR expression unit (ITR-PPcaR7-shGLP-1-P2A-SEAP-pA: PhCMV-PcaK:

PmPGK-ZeoR-pA-ITR). PhCMV-PcaK was PCR-amplified from pJY322 using oligonucleotides pJY325-1 (5’-

TACAAATGTGGTAAAATCGATCGGGCCAGATATACGCGTTGACATTG-3’) and pJY325-2

This work

(5’-ATCGTTCAGATCCTTATCGATTTAGGTGGCGTCAGCATGGGACACC-3’) and ligated into the

corresponding sites (ClaI) of pJY264 by homologous recombination using the GeneArt® Seamless Cloning and

Assembly Kit.

pWL66 Protocatechuic acid-responsive gRNATP53 expression vector [PPcaR13-gRNATP53; PPcaR13, (OPcaV)5-PU6-OPcaV].

gRNATP53 was PCR-amplified from pWL64 using oligonucleotides OWL66-1 (5’-

CCGgaattcCACCGCCAGTCTTGAGCACATGGG-3’) and OJY58-2 (5’-



This work

pWL67 Protocatechuic acid-responsive gRNACXCR4 expression vector [PPcaR13-gRNACXCR4; PPcaR13, (OPcaV)5-PU6-OPcaV].

gRNACXCR4 was PCR-amplified from pWL65 using oligonucleotides OWL67-1 (5’-

CCGgaattcCACCGACTTACACTGATCCCCTCCA-3’) and OJY58-2 (5’-



This work

pDL6

Galactose-responsive SEAP expression vector [PUAS-SEAP-pA; PUAS, (UAS)5-PhCMVmin]. (UAS)5 was

chemically synthesized, restricted with AatII/ SbfI and cloned into the corresponding sites (AatII/ SbfI) of pJY6.

This work

pDL20 Vanillic acid-responsive SEAP expression vector (P1VanO2-SEAP-pA; P1VanO2, VanO2-PhCMVmin).

Oligonucleotides ODL20-1 (5’-cGTCAATTCGCGAATTGGATCCAATAGCGCTATTGGATCCAAT

GATATCGGAcctgca-3’) and ODL20-2

(5’-ggTCCGATATCATTGGATCCAATAGCGCTATTGGATCCAATTCGCGAATTGACgacgt-3’) were

annealed, and cloned into the corresponding sites (AatII/SbfI) of pJY6.

This work

pDL24 Protocatechuic acid-responsive GV and N-peptide-mCherry expression vector containing an active HHR

binding site in its 3’UTR [PPcaR5-GV-P2A-N-peptide-mCherry-HHR-pA; PPcaR5, PSV40-(OPcaV)5; GV,

Gal4-VP16]. GV-P2A (Fragment 1) was PCR-amplified from pJY79 using oligonucleotides ODL24-1 (5’-

CAGTGCCCTGACTATGAATTCGCCACCATGTGCGGCCGCAAGCTGCTGAG-3’) and ODL24-2 (5’-

CGACGGCGTGTCTGTGCATCCATTCCGCTAGGTCCGGGATTCTCCTCCACATCTCCAGC-3’),

N-peptide-mCherry (Fragment 2) was PCR-amplified from pDL17 using oligonucleotides ODL24-3 (5’-

GAATCCCGGACCTAGCGGAATGGATGCACAGACACGCCGTCGGGAACGCCGTGC-3’) and

ODL24-4 (5’-CTTGTCCAAACTCATCAATGTATCCTAGACTCGAGCGGCCGCCACTGTGCTG-3’),

This work

HHR-pA (Fragment 3) was PCR-amplified from pDL2 using oligonucleotides ODL24-5 (5’-

CTAGGATACATTGATGAGTTTGGACAAGTTTAAACCC-3’) and ODL24-6 (5’-

GAATGCAATTGTTGTTGTTAACCATGCATCTCAATTAGTCAGCAACCATAG-3’), all fragments were

ligated into the corresponding sites (EcoRI/HpaI) of pJY5 by homologous recombination using the GeneArt®


pDL30 Vanillic acid-responsive GV and N-peptide-mCherry expression vector containing an active HHR in its 3’UTR

(PVanON8- GV-P2A-N-peptide-mCherry-HHR-pA; PVanON8, PhCMV-VanO8; GV, Gal4-VP16).

GV-P2A-N-peptide-mCherry-HHR was PCR-amplified from pDL24 using oligonucleotides ODL30-1 (5’-

TCGATTGGATCCAATGAATTCGCCACCATGTGCGGCCGCAAGCTG-3’) and ODL30-2 (5’-

GAATGCAATTGTTGTTGTTAACCATGCATCTCAATTAGTCAGCAACCATAG-3’) and cloned into the

corresponding sites (EcoRI/HpaI) of pCK191 by homologous recombination using the GeneArt®

Seamless


This work

pDL34 Protocatechuic and vanillic acid-responsive d2EYFP expression vector [PPV2-d2EYFP-pA; PPV2,

OPcaV-PhCMVmin-(OVanR)4]. A linearized vector (Fragment1) was PCR-amplified from pJY159 using

oligonucleotides ODL34-1 (5’-

GCTTCTGCTAGGATCAATGTGTAGAAGCTTTTAAAACAGCTCTGGGG-3’) and ODL34-2 (5’-

CCTCGCCCTTGCTCACCATGGTGGCGGTGGGCGAATACATTGGATCCAATCGATTGG-3’), d2EYFP

(Fragment2) was PCR-amplified from pd2EYFP using oligonucleotides ODL34-3 (5’-

GGATCCAATGTATTCGCCCACCGCCACCATGGTGAGCAAGGGCGAGGAGCTG-3’) and ODL34-4

(5’-CAGAGCTGTTTTAAAAGCTTCTACACATTGATCCTAGCAGAAGCAC-3’), both fragments were

ligated by homologous recombination using the GeneArt®


This work

pDL35 Protocatechuic and vanillic acid-responsive d2EYFP expression vector [PPV1-d2EYFP-pA; PPV1,

VanO2-PhCMVmin-(OpcaV)2]. A linearized vector (Fragment 1) was PCR-amplified from pJY162 using

oligonucleotides ODL35-1 (5’-GCTAGGATCAATGTGTAGAAGCTTTTAAAACAGCTCTGG-3’) and

ODL35-2 (5’-CTCGCCCTTGCTCACCATGGTGGCGGTGGGCGATATCATAGTCAGGGC-3’), d2EYFP

(Fragment2) was PCR-amplified from pd2EYFP using oligonucleotides ODL35-3 (5’-

CCTGACTATGATATCGCCCACCGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTC-3’) and

ODL35-4 (5’-GAGCTGTTTTAAAAGCTTCTACACATTGATCCTAGCAGAAGCACAGGCT-3’), both

fragments were ligated by homologous recombination using the GeneArt®

Seamless Cloning and Assembly Kit

This work

pDL46 Galactose-responsive d2EYFP expression vector [PUAS- d2EYFP-pA; PUAS, (UAS)5-PhCMVmin]. d2EYFP was

PCR-amplified from pd2EYFP using oligonucleotides ODL46-1(5’-

CGgaattcGCCACCATGGTGAGCAAGGGCGAGG-3’) and ODL46-2 (5’-CCGctcgagCTACACATTGAT

CCTAGCAGAAGC-3’), restricted with EcoRI/XhoI and cloned into the corresponding sites (EcoRI/XhoI) of

pDL6.

This work

Oligonucleotides:

Restriction endonuclease-specific sites are underlined in lowercase letters, annealing base pairs are indicated in capital letters, the homologous

recombination sequences are underlined in capital letters.

Abbreviations:

Cas9, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated protein 9; Coh2, type 2 cohesin; dCas9, dead Cas9;

d2EYFP, destabilized variant of the enhanced yellow fluorescent protein; DocS, the dockerin from cellulose S; EGFP, enhanced green fluorescent

protein; Gal4, galactose-responsive transcription factor; gRNA, guide RNA; gRNAASCL1, gRNA targeting achaete-scute family bHLH

transcription factor 1; gRNACCR5, gRNA targeting C-C motif chemokine receptor type 5; gRNAEMX1, gRNA targeting empty spiracles homeobox

1; gRNAPDX1, gRNA targeting pancreatic and duodenal homeobox 1; HHR, hammerhead ribozyme; HSF1, heat shock factor 1; IRES, internal

ribosome entry site; KRAB, human Kruppel-associated box protein; MCS, multiple cloning site; mCherry, red-fluorescent protein; mINS,

mouse insulin; MS2, monomeric variant of the phage MS2 coat protein; N-peptide, short nutR-binding peptide; nutR, nutR-boxB RNA motif of

bacteriophage lambda; OPcaV, PcaV-specific operator; pA, polyadenylation signal; P2A, picornavirus-derived self-cleaving peptide engineered for

bicistronic gene expression in mammalian cells; PCR, polymerase chain reaction; PcaV, Streptomyces coelicolor repressor of the protocatechuic

acid catabolism; PCBh, chicken β-actin promoter; PCAG, synthetic mammalian promoter containing the cytomegalovirus early enhancer element

and chicken β-actin promoter; PhCMV, human cytomegalovirus immediate early promoter; PhCMVmin, minimal version of PhCMV; PhCMV*-1,

tetracycline-responsive promoter (tetO7-PhCMVmin); PcaR, protocatechuic acid-dependent transrepressor (KRAB-PcaV); PcaA, protocatechuic

acid-dependent transactivator (PcaV-VP16); PcaK, protocatechuic acid transporter protein; PPcaA1-5, protocatechuic acid-repressible promoters

harboring different OPcaV-operator repeats in front of PhCMVmin [(OPcaV)1-5-PhCMVmin); PPcaR1-5, protocatechuic acid-inducible promoters harboring

different OPcaV-operator repeats behind PSV40 (PSV40-(OPcaV)1-5]; PPcaR6-10, protocatechuic acid-inducible promoters harboring different

OPcaV-operator repeats behind PhCMV [PhCMV-(OPcaV)1-5]; PPcaR12, protocatechuic acid-inducible promoter containing PhCMV flanked by five

OPcaV-operator repeats in each side [(OPcaV)5-PhCMV-(OPcaV)5]; PPcaR13-15, protocatechuic acid-inducible promoters containing PU6 flanked by

different OPcaV-operator repeats in each side [(OPcaV)5-PU6-(OPcaV)1,2,5]; P1VanO2, vanillic acid-repressible promoter (VanO2-PhCMVmin); PVanON4,

vanillic acid-inducible promoter (PhCMV-VanO4); PVanON8, vanillic acid-inducible promoter (PhCMV-VanO8); p65, 65kDa transactivator subunit of

NF-kB; PuroR, puromycin resistance gene; PSV40, simian virus 40 promoter; PhEF1α, human extension factor α gene promoter; PmPGK, mouse

phosphoglycerate kinase gene promoter; PUAS, Gal4-specific promoter; Rta, human herpesvirus transcription activator; SEAP, human placental

secreted alkaline phosphatase; shGLP-1, short human glucagon-like peptide 1; VP16, Herpes simplex-derived transactivation domain; VP64,

tetrameric core of Herpes simplex virus-derived transactivation domain; VanA4, vanillic acid-dependent transrepressor (VanR-KRAB); VanA5,

vanillic acid-dependent transactivator (VanR-VPR); VanR, vanillic acid-dependent repressor of the Caulobacter crescentus VanAB gene cluster.

Table S4. The primers used for qPCR analysis.

Target

Gene

Forward primer Reverse primer

TP53 AGCCAAGTCTGTGACTTGCA AACCTCCGTCATGTGCTGT

CXCR4 GAAGCTGTTGGCTGAAAAGG CTCACTGACGTTGGCAAAGA

ASCL1 CGCGGCCAACAAGAAGATG CGACGAGTAGGATGAGACCG

PDX1 AAGTCTACCAAAGCTCACGCG CGTAGGCGCCGCCTGC

GAPDH CGAGATCCCTCCAAAATCAA ATCCACAGTCTTCTGGGTGG

Table S5. The primers used for PCR amplification.

Target Gene Primer name Sequence

CCR5 1st PCR-Forward CTCCATGGTGCTATAGAGCA

2st PCR-Forward GAGCCAAGCTCTCCATCTAGT

Reverse GCCCTGTCAAGAGTTGACAC

EMX1 Forward GGAGCAGCTGGTCAGAGGGG

Reverse GGGAAGGGGGACACTGGGGA

Table S6. The expression vectors and mixtures for logic gates in mice.

Plasmid (µg) A NIMPLY B B NIMPLY A AND OR NOR

pJY12 0 6 0 0 4

pJY29 6 0 6 5.7 0

pJY159 0 6 0 0 0

pJY162 6 0 0 0 0

pJY179 6 0 0 0 4

pJY200 0 0 0 0 4

pJY201 0 0 0 0 4

pJY303 0 0 6 0 0

pDL6 0 0 0 1 0

pDL24 0 0 0 2.8 0

pDL30 0 0 0 4.25 0

pCK189 0 6 6 4.25 0

pMF111 0 0 0 0 2

total amount 18 18 18 18 18

Table S7. The expression vectors and mixtures for logic gates in mammalian cells.

Plasmid (ng) A NIMPLY B B NIMPLY A AND OR NOR

pJY12 0 100 0 0 100

pJY29 100 0 100 50 0

pJY179 100 0 0 0 100

pJY200 0 0 0 0 100

pJY201 0 0 0 0 100

pJY202 0 0 0 0 50

pJY306 0 0 100 0 0

pDL24 0 0 0 50 0

pDL30 0 0 0 50 0

pDL34 0 100 0 0 0

pDL35 100 0 0 0 0

pDL46 0 0 0 10 0

pCK189 0 100 100 50 0

pcDNA3.1(+) 150 150 150 240 0

total amount 450 450 450 450 450

supplementary materials for · 10/23/2019 · fig. s10. flow cytometric histograms showing...

Documents