supplementary information...supplementary information supplementary methods all chemical reagents...

Mechanical memory and dosing influence stem cell fate

Chun Yang1,#, Mark W. Tibbitt2,#,†, Lena Basta2, and Kristi S. Anseth2,3, 4*

1Department of Chemistry and Biochemistry, 2Department of Chemical and Biological Engineering,

3Howard Hughes Medical Institute, 4BioFrontiers Institute

University of Colorado Boulder 3415 Colorado Avenue

Boulder, CO 80303 #These authors contributed equally to this work

*Corresponding author: [email protected]

†Present Address: Koch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, 500 Main Street, Cambridge, MA, 02139

SUPPLEMENTARY INFORMATIONDOI: 10.1038/NMAT3889

NATURE MATERIALS | www.nature.com/naturematerials 1

© 2014 Macmillan Publishers Limited. All rights reserved.

http://www.nature.com/doifinder/10.1038/nmat3XXX

Supplementary Information

Supplementary Methods

All chemical reagents were purchased from Sigma-Aldrich, except as noted. All cell

culture media and supplements were purchased from Invitrogen, except as noted.

Synthesis of hydrogel components.

Polyethylene glycol di-photodegradable acrylate (PEGdiPDA) was synthesized and

characterized as previously described.1,2 Briefly, an acrylated, o-nitrobenzyl ether was

synthesized, 4-[4-(1-Acrylethyl)-2-methoxy-5-nitrophenoxy]butanoic acid,1,2 and coupled

to poly(ethylene glycol) bis-amine (Mn ~ 3400 Da; Laysan Bio Inc.) with HATU

activation. The resultant product, PEGdiPDA, was purified by precipitation in diethyl

ether and purified by dialysis (SpectraPor 7, MWCO 2000 Da; Spectrum Labs). Product

purity was confirmed by 1H NMR with > 90% functionalization.

The adhesive peptide OOGRGDSG (diethylene glycol-diethylene glycol-glycine-

arginine-glycine-aspartic acid-serine-glycine) was synthesized (Protein Technologies

Tribute peptide synthesizer) through Fmoc solid-phase methodology and HATU

activation.3 Acrylic acid was coupled on resin to the N-terminal amine with HATU to

synthesize Acryl-OOGRGDSG. The crude peptide was purified by semi-preparative

reversed-phase high performance liquid chromatography (RP-HPLC; Waters 2767, 2489,

2545). Peptide purity was confirmed by analytical RP-HPLC and matrix-assisted laser

desorption-ionization time-of-flight mass spectrometry (Applied Biosystems DE Voyage)

2 NATURE MATERIALS | www.nature.com/naturematerials

SUPPLEMENTARY INFORMATION DOI: 10.1038/NMAT3889



using Alpha-CHC Acid matrix (Agilent Technologies): calculated ([M+H]+ 892);

observed ([M+H]+ 891.5) (Fig. S3).

Preparation of acrylated cover glass.

To provide a support for the photodegradable hydrogels during culture, cover glass

(18 and 22 mm diameter, No. 2; Fisher Scientific) were treated with an acrylate silane-

coupling agent so that the gel would covalently attach to the glass during polymerization.

The cover glass were cleaned by piranha, and subsequently incubated in a vapor chamber

at 80°C with (3-acryloxypropyl)-trimethoxysilane overnight to allow complete acrylation.

Fabrication of photodegradable hydrogels for cell seeding.

The preparation of PEGdiPDA, photodegradable hydrogels was adapted from

previously described protocols.4,5 Briefly, PEGdiPDA was co-polymerized with

poly(ethylene glycol) monoacrylate (PEGA; Mn ~ 400 Da; Monomer-Polymer and Dajac

Laboratories, Inc.) and Acryl-OOGRGDSG in PBS via redox-initiated free radical

polymerization. Gel solutions were prepared with 2.5 wt% PEGdiPDA, 10 wt% PEGA, 5

mM Acryl-OOGRGDSG, and 0.2 M ammonium persulfate (APS). To catalyze the

polymerization, a final concentration of 0.1 M tetramethylethylenediamine (TEMED)

was added to the gel solution. Gels were formed on acrylated cover glass with diameter

of 18 or 22 mm and a thickness of 100 m. Gels were rinsed in PBS prior to cell seeding.

Rheometry of photodegradable hydrogels.




http://www.nature.com/doifinder/10.1038/nmat3889

PEGdiPDA hydrogels were polymerized, as described above, in situ on a shear

rheometer (ARES; TA) with a custom irradiation set-up. Thin PEGdiPDA hydrogels

(thickness = 50 m) were polymerized between an 8 mm diameter, optically transparent,

quartz plate and a temperature-controlled Peltier plate (25°C). Hydrogel formation was

tracked with a dynamic time sweep ( = 10%; = 10 rad/s; determined to be in the LVE

regime for this material) until the storage modulus (G´) reached a plateau. The formed

gels were exposed to irradiation ( = 365nm; I0 = 10 mW/cm2; Omnicure 1000, Lumen

Dynamics) and degradation was monitored using the same dynamic time sweep

parameters (Fig. S4). The initial PEGdiPDA hydrogels (stiff hydrogels) formed with an

average Young’s modulus of 9.6 ± 0.2 kPa. Young’s modulus was determined as E =

2•(1+ )•G, with G = G´ and = 0.5 (assumed for PEG hydrogels). After 360s of

irradiation, the average Young’s modulus was 2.3 ± 0.2 kPa (soft hydrogels).

Additionally, 120s of irradiation formed PEGdiPDA hydrogels with an average Young’s

modulus of 6.1 ± 0.2 kPa (6 kPa hydrogels) and 210s of irradiation formed hydrogels

with an average Young’s modulus of 4.0 ± 0.2 kPa (4 kPa hydrogels).

Softening of PEGdiPDA hydrogels.

To fabricate the soft hydrogels (2 kPa) as well as the 4 kPa and 6 kPa hydrogels from

the stiff hydrogels (10 kPa), hydrogels were formed as described above on 18 or 22 mm

cover glass. For softening prior to cell seeding, hydrogels were submerged in 2 ml PBS

within 6-well culture dishes and irradiated ( = 365nm; I0 = 10 mW/cm2; Omnicure

1000, Lumen Dynamics) for appropriate amounts of time: 360s for 2 kPa, 210s for 4 kPa,

and 120s for 6 kPa. For softening in the presence of cells, the growth media was





exchanged with growth media without phenol red and the gels were irradiated ( =

365nm; I0 = 10 mW/cm2; Omnicure 1000, EXFO) for appropriate amounts of time: 360s

for 2 kPa, 210s for 4 kPa, and 120s for 6 kPa. The growth media without phenol red was

then replaced with standard growth media.

hMSC isolation and culture.

Human mesenchymal stem cells (hMSCs) were isolated from human bone marrow

(Lonza) based on their preferential adhesion to tissue culture polystyrene (TCPS) plates.6

Freshly isolated hMSCs were frozen down in 95% fetal bovine serum (FBS) and 5%

DMSO and marked as P1 hMSCs. P1 hMSCs were used and cultured in growth media,

except as noted. In all experiments, media was changed every 2 to 3 days and hMSCs

were treated with mitomycin (10 g/ml) for 2h, to inhibit proliferation, 24 h after

seeding. Samples that were used in RT-PCR for RUNX2 expression analysis were not

treated with mitomycin. Growth media consisted of low-glucose Dulbecco’s modified

Eagle’s medium (DMEM) supplemented with 10% FBS, 50U/ml penicillin, 50 g/ml

streptomycin, and 1 g/ml fungizone. For hMSC differentiation studies, a bipotential

adipogenic/osteogenic inductive medium (‘mixed media’) was made by combining

adipogenic and osteogenic inductive media 1:1. Adipogenic media consisted of high-

glucose DMEM supplemented with 15% FBS, 50U/ml penicillin, 50 g/ml streptomycin,

1 g/ml fungizone, 10 g/ml insulin, 1 M dexamethasone, and 0.5 mM 3-isobutyl-1-

methylxanthine (IBMX). Osteogenic media consisted of high-glucose DMEM

supplemented with 10% FBS, 50U/ml penicillin, 50 g/ml streptomycin, 1 g/ml





fungizone, 100 nM dexamethasone, 50 M ascorbic acid, and 20 mM -

glycerophosphate.

Gene expression analysis.

Quantitative real-time polymerase chain reaction (qRT-PCR) was used to quantify the

mRNA expression levels of ALP, RUNX2, PPAR relative to GAPDH. RNA

was extracted from the culture samples using TRI Reagent following manufacturer’s

instructions. The quantity and purity of extracted RNA was measured via

spectrophotometry (ND-1000; NanoDrop). cDNA was synthesized from total RNA using

the iScript Synthesis kit (Bio-Rad). Relative mRNA expression levels were measured via

qRT-PCR using SYBR Green reagents (Bio-Rad) on an iCycler (Bio-Rad) and

normalized to the housekeeping gene GAPDH in experimental samples. Primer

sequences are listed below:

PRIMER SEQUENCE (5’-3’)

ALP-FWD GTGGAGTATGAGAGTGACGAGAA

ALP-REV AGATGAAGTGGGAGTGCTTGTAT

RUNX2-FWD GGTATGTCCGCCACCACTC

RUNX2-REV TGACGAAGTGCCATAGTAGAGATA

PPARγ-FWD CGGTTTCAGAAGTGCCTTG

PPARγ-REV GGTTCAGCTGGTCGATATCAC

GAPDH-FWD GCAAGAGCACAAGAGGAAGAG

GAPDH-REV AAGGGGTCTACATGGCAACT





YAP-FWD TGTAGTGGCACCTATCACTC

YAP-REV CCATCTCATCCACACTGTTC

Immunocytochemistry.

Immunocytochemistry samples were harvested at each time point during the time

course study on TCPS and degradable gels. For KI-67 staining, samples were harvested

24h post mitomycin treatment on 2kPa, 10kPa and TCPS. hMSCs cultured on TCPS or

photodegradable hydrogels were fixed with 2% PFA for 30 minutes at room temperature.

The fixation solution was removed and the samples were rinsed with PBS for 5 minutes

at room temperature. Samples were permeabilized with 0.1% TritonX-100 in PBS for 1h

at room temperature. The permeabilization solution was removed and the samples were

rinsed with PBS for 5 minutes at room temperature. Samples were blocked with 5 wt%

bovine serum albumin (BSA) in PBS for 1h at room temperature. Samples were

incubated with primary antibodies in 5 wt% BSA in PBS overnight at 4°C: anti-YAP and

anti-TAZ (rabbit polyclonal, 1:250; Santa Cruz Biotechnology), anti-RUNX2 (mouse

monoclonal, 1:250; abcam), anti- KI-67 (rabbit polyclonal, 1:250; AnaSpec), anti-OCN

(mouse monoclonal, 1:100; R&D Systems) and/or anti-PPAR (rabbit polyclonal, 1:250;

abcam). The primary antibody solution was removed and the samples were rinsed 3 times

with PBST (0.5 wt% Tween-20 in PBS) for 10 minutes each at room temperature.

Subsequently, samples were incubated with secondary antibodies and DAPI for 1h at

room temperature: goat anti-rabbit AlexaFluor488 (1:1000; Invitrogen), goat anti-mouse

AlexaFluor555 (1:1000; Invitrogen), phalloidin (1:1000, Invitrogen) and DAPI (1 g/ml;

Sigma). Samples were imaged using laser scanning confocal microscopy (LSM 710





NLO; Carl Zeiss AG). DAPI was used to quantify cell number. The percentages of

hMSCs with nuclear YAP or RUNX2 were obtained by manually counting cells with

nuclear co-localized YAP or RUNX2 and then dividing by the total number of cells and

multiplying by 100.

Alkaline phosphatase (ALP) and Oil Red O (ORO) staining.

Samples were fixed in citrate buffered 60% acetone for 30 seconds prior to ALP

staining by naphthol AS-MX phosphate and FAST BLUE RR SALT based kit (85L1,

Sigma-Aldrich) following manufacture’s instructions. Additional samples were fixed and

stained for Oil Red O (ORO) by incubation in 0.3% Oil-Red-O solution for 20 min at

room temperature. Percentages of ALP and ORO positive cells were calculated by

dividing the number of blue or red stained cells by total cell number based on DAPI

staining.

Mechanical dosing on TCPS.

For the initial mechanical dosing on TCPS, hMSCs were seeded at 1000 cells/cm2 on

TCPS (6-well or 60 cm2 plates) in growth media. Samples (n ≥ 3) were harvested 1, 3, 5,

and 7 days after seeding for qRT-PCR to analyze for RUNX2 gene expression. In an

additional experiment, hMSCs were seeded at 1000 cells/cm2 on TCPS in growth media

prior to treatment with 0.05% trypsin-EDTA (Gibco) and transfer to soft hydrogels at

1000 cells/ cm2 in growth media 1, 3, 5, 7 and 10 days after initial seeding. After 3 days

on the soft hydrogels, samples were harvested (n ≥ 3) for immunocytochemistry. To test

the effect of mechanical dosing on TCPS on hMSC differentiation, hMSCs were seeded





at 2000 cells/cm2 on TCPS in growth media. The cells were treated with trypsin and

transferred to soft hydrogels at 3000 cells/ cm2 1, 5, and 10 days after initial seeding. The

media was replaced with mixed media 48h after hMSCs were transferred to the soft

hydrogels. A control sample was included in which hMSCs were seeded directly on soft

hydrogels; 48h after seeding, control samples were exposed to mitomycin (5 g/ml) for

1h, followed by mixed media. Samples were harvested (n ≥ 3) after 7 days in mixed

media for qRT-PCR, immunocytochemistry, alkaline phosphatase, and Oil Red staining.

Mechanical dosing on photodegrable hydrogels.

hMSCs were seeded on stiff hydrogels at 1000 cells/cm2 in growth media. Samples (n

≥ 3) were harvested 1, 3, 5, and 7 days after seeding for qRT-PCR to analyze for RUNX2

gene expression. Another batch of hydrogels were softened in situ 1, 7, and 10 days after

seeding with UV light ( = 365nm; I0 = 10 mW/cm2) for 360s in growth media without

phenol red. hMSCs were cultured on the soft hydrogels in growth media and harvested 1,

3, and 5 days after in situ softening for immunostaining. For samples that were softened

10 days after seeding, samples were harvested 1, 5, and 10 days after in situ softening

(Fig. S6).

To study the role of cytoskeletal tension on mechanical dosing, hMSCs were treated

with F-actin inhibitor latrunculin A (Lat.A, 0.5μM) for 8h prior to in situ degradation

after 10-day culture on stiff hydrogel. Lat.A was washed out thoroughly after degradation

and samples were harvested 5 days after degradation.

Mechanical dosing on soft hydrogel.





hMSCs were seeded on soft (2kPa) hydrogels at 3000 cells/cm2 in growth media.

Samples (n ≥ 3) were harvested 1, 3, 5, and 7 days after seeding for qRT-PCR to analyze

for RUNX2 gene expression. In a parallel experiment, samples were treated with the

inhibitor of CRM1-dependent nuclear export Leptomycin B (LMB, 40ng/ml) for 2h after

cell attachment, and harvested 1, 3, 5, and 7 days after LMB treatment for qRT-PCR to

analyze for RUNX2 gene expression. Samples were also harvested 24h after LMB

treatment for immunocytochemistry.

In an additional experiment, hMSCs were seeded at 1000 cells/cm2 on soft hydrogels

in growth media prior to treatment with 0.05% trypsin-EDTA (Gibco) and transfer to stiff

(10kPa) hydrogels at 1000 cells/ cm2 in growth media 1, 4, 7 and 10 days after initial

seeding. After 3 days on the stiff hydrogels, samples were harvested (n ≥ 3) for

immunocytochemistry.

To test the effect of mechanical dosing on soft hydrogel on hMSC differentiation,

hMSCs were seeded at 3000 cells/cm2 on soft hydrogels in growth media. Media was

replaced to mixed media 0, 1, 5, and 10 days after initial seeding. Samples were

harvested (n ≥ 3) after 7 days in mixed media for qRT-PCR.

siRNA transfection.

hMSCs were transfected with siRNA against YAP (ON-TARGET plus Human YAP1

siRNA, Fisher Scientific) and TAZ (s13805, Life Techonologies) using the Human MSC

Nucleofection Kit (Lonza) under the U-23 program. In a parallel control experiment,

hMSCs were transfected with a non-targeted control siRNA. Each transfection included

100μl buffer, 1x106 cells and 0.1 nmole of siRNA. After transfection, hMSCs were plated





on TCPS at 1000 cells/cm2, samples were harvested 1, 3, 5 and 7 days after plating for

qRT-PCR to analyze for RUNX2 expression.

Characterization of peptide surface concentration.

To model the extent of release of the adhesive peptide, Acryl-OOGRGDSG, during

irradiation, the concentration of released methacrylated rhodamine was quantified as a

function of irradiation. Photodegradable hydrogels were fabricated as described above

with 4.9 mM Acryl-OORGDSG and 0.1 mM methacrylated rhodamine instead of 5.0

mM Acryl-OOGRGDSG. The gels were exposed to irradiation ( = 365nm; I0 = 10

mW/cm2; Omnicure 1000, Lumen Dynamics) as described above for 360s, 600s, and

900s. The PBS that the gels were submerged in during irradiation was collected after 5

minutes and the fluorescence of the solutions were analyzed by a plate reader (Synergy

H1, BioTek) with an excitation wavelength of 548nm and an emission wavelength of

580nm. A standard curve of methacrylated-rhodamine concentrations was created from 1

M to 1 mM and the solution concentrations were determined based on the standard

curve. The solution concentration was then used to determine the percent release based

on total loading of methacrylated-rhodamine in the gel. For 360s, the longest degradation

used in the study, only ~ 5% of the methacrylated-rhodamine was released (Fig. S5),

demonstrating that the surfaces present similar concentrations of adhesive ligand between

the stiff and soft hydrogels.





Supplementary Figures

Figure S1. Immunocytochemistry of control samples on TCPS and soft hydrogels. A, YAP and RUNX2 are located in the nuclei (activated) of hMSCs cultured strictly on TCPS at day 3. DAPI, blue; YAP, green; RUNX2, red. Scale bar, 20 m. B, YAP and RUNX2 are located in the cytoplasm (de-activated) of hMSCs cultured strictly on soft hydrogels at days 3, 5, 7, 10, and 13. DAPI, blue; YAP, green; RUNX2, red. Scale bar, 20 m.





Figure S2. Activation of YAP on control stiff and soft hydrogels. YAP is activated (located in the nuclei) in hMSCs cultured strictly on stiff hydrogels (blue squares) at days 3, 5, 7, 10, and 13. Whereas, YAP is de-activated (excluded from the nuclei) in hMSCs cultured strictly on soft hydrogels (yellow circles) at days 3, 5, 7, 10, and 13.





Figure S3. Mass spectroscopy of RGD adhesive peptide. MALDI-TOF MS spectrum for the adhesive peptide Acryl-OOGRGDSG. MW calculated ([M+H]+ 892); observed ([M+H]+ 891.5).





Figure S4. Rheometry of PEGdiPDA hydrogel formation and degradation. Representative rheometric plot of PEGdiPDA hydrogel formation (G´ at plateau = 9.6 ± 0.2 kPa) and irradiation-induced ( = 365nm; I0 = 10 mW/cm2; purple box) degradation for 360s (G´ after degradation = 2.3 ± 0.2 kPa).





Figure S5. Methacrylated-rhodamine release with irradiation. Quantification of the percent release of methacrylated-rhodamine from PEGdiPDA after 360, 600, and 900s of irradiation. **, p < 0.01; ***, p < 0.001.





Figure S6. Immunocytochemistry of irreversible effects of mechanical dosing on photodegradable hydrogels. YAP and RUNX2 are constitutively activated (located in the nuclei) of hMSCs that were mechanically dosed on stiff (10kPa) photodegradable hydrogels for 10 days prior to in situ softening. DAPI, blue; YAP, green; RUNX2, red. Scale bar, 20 m.





Figure S7. Immunocytochemistry of YAP and TAZ on stiff and soft substrates. YAP and TAZ co-localize on soft substrates (cytoplasm) and stiff substrates (nucleus). DAPI, blue; TAZ, green; YAP, red. Scale bar, 20 m.





Figure S8. RUNX2 expression as a function of mechanical dose on TCPS in P2 hMSCs. qRT-PCR of relative RUNX2 expression level of P2 hMSCs reveals a monotonic increase in RUNX2 expression with increasing culture time on TCPS, as observed in P1 hMSCs.





Figure S9. Long-term expression of YAP and RUNX2 on soft hydrogels. hMSCs were cultured on TCPS for 10 days and then passaged to soft hydrogels and cultured for up to 10 days on soft gels. YAP and RUNX2 remained activated up to 5 days on soft gels. RUNX2 expression decreased after 10 days on soft hydrogels (*, p < 0.05).





Figure S10. KI-67 in hMSCs with and without mytomycin treatment. A, KI-67 was detected within the nucleus on all the substrates without mitomycin, indicating that cells were in active phases of the cell cycles (G1, S, G2, and mitosis). B, KI-67 was absent in cells after mitomycin treatment, indicating they were in G0.7 Scale bar, 20 m.





Figure S11. RUNX2 expression over time with siRNA knockdown of YAP/TAZ on TCPS. A, hMSCs YAP expression level was significantly suppressed to about 25% by siRNA knockdown on TCPS (***, p<0.001). B, RUNX2 expression increased monotonically with increased mechanical dosing with a non-targeted siRNA transfection on TCPS. C, RUNX2 expression remained at basal levels with mechanical dosing after siRNA knockdown of YAP and TAZ on TCPS. D, RUNX2 expression remained steady over time on soft substrate.





Figure S12. Forced YAP nuclear localization by leptomycin B (LMB) on soft hydrogels. A, Nuclear YAP percentage significantly increased after LMB treatment on soft substrates(**, p<0.01). B, RUNX2 expression profile of hMSCs treated with LMB on soft substrates. A large increase in RUNX2 expression was observed after 3 days of culture on soft hydrogels with LMB treatment. However, cells began to behave aberrantly and die after 3 days in culture with LMB. C, Immunocytochemistry images of YAP in hMSCs with and without LMB treatment. Scale bar, 20 m.





Figure S13. RUNX2 expression profile of hMSCs. A, RUNX2 expression levels as a function of mechanical dosing with 3% FBS. B, RUNX2 expression levels as a function of mechanical dosing on stiff hydrogels with 10% FBS. C, RUNX2 expression levels of hMSCs on soft hydrogels with 10% FBS.





Figure S14. Mechanical dosing on soft hydrogels. A, YAP and RUNX2 nuclear localization in hMSCs after 3 days on stiff hydrogels with previous mechanical dosing on soft hydrogels from 1 to 10 days. B, Immunocytochemistry images of YAP (green), RUNX2 (red) and DAPI (blue) in hMSCs after 10 days of culture on soft hydrogels. C, Immunocytochemistry of hMSCs after 3 days on stiff hydrogel with previous 10 days culture on soft hydrogel. Scale bar, 20 m. D, PPAR- gene expression in hMSCs with mechanical dosing on soft hydrogels prior to culture in mixed media for 7 days as quantified by qRT-PCR. E, ALP gene expression in hMSCs with mechanical dosing on soft hydrogels prior to culture in mixed media for 7 days as quantified by qRT-PCR.





Figure S15. Mechanical dosing experiments with another hMSCs donor source. A, RUNX2 expression levels of hMSCs increased monotonically with increased mechanical dosing on TCPS analyzed by qRT-PCR. B, YAP (left) and RUNX2 (right) nuclear localization in hMSCs after 3 days on soft hydrogels with previous mechanical dosing on TCPS for 1 and 7 days. C, YAP (left) and RUNX2 (right) nuclear localization in hMSCs 5 days after in situ softening with previous mechanical dosing on stiff hydrogels for 1 and 10 days. D, YAP and RUNX2 localization in hMSCs on soft hydrogels with 1 day of mechanical dosing on TCPS and 7 days of mechanical dosing on TCPS. DAPI, blue; YAP, green, RUNX2, red. Scale bars, 20 m.





Figure S16. Inhibition of F-actin formation of hMSCs prior to in situ degradation by Latrunculin A. A, Immunocytochemistry images of hMSCs on stiff hydrogel, DAPI (blue), YAP (green), F-actin (red). Stressed F-actin fibers of hMSCs were formed on stiff substrate. B, Image of hMSCs that were exposed to latrunculin A to inhibit cytoskeletal tension prior to in situ softening after 10 days culture on stiff hydrogel. Cells treated with latrunculin A lost cytoskeletal organization and presented cortical actin structures. However, after 10 days of culture on stiff hydrogels, YAP persisted in the nucleus at the same levels as stiff gels without latrunculin A treatment. C, Comparison of nuclear YAP percentage between hMSCs on strictly stiff hydrogel and hMSCs on soft hydrogel 5 days post in situ degradation after 10 days culture on stiff with and without latrunculin A treatment. No significant differences were observed in nuclear YAP percentage between these conditions.





Supporting References:

1. Kloxin, A. M., Kasko, A. M., Salinas, C. N. & Anseth, K. S. Photodegradable hydrogels for dynamic tuning of physical and chemical properties. Science 324, 59-63 (2009).

2. Kloxin, A. M., Tibbitt, M. W. & Anseth, K. S. Synthesis of photodegradable hydrogels as dynamically tunable cell culture platforms. Nature Protocols 5, 1867-1887 (2010).

3. Wang, H., Haeger, S. M., Kloxin, A. M., Leinwand, L. A. & Anseth, K. S. Redirecting valvular myofibroblasts into dormant fibroblasts through light-mediated reduction in substrate modulus. Plos One 7 (2012).

4. Kloxin, A. M., Tibbitt, M. W., Kasko, A. M., Fairbairn, J. F. & Anseth, K. S. Tunable hydrogels for external manipulation of cellular microenvironments through controlled photodegradation. Adv. Mater. 22, 61-66 (2010).

5. Tibbitt, M. W., Kloxin, A. M., Dyamenahalli, K. U. & Anseth, K. S. Controlled two-photon photodegradation of peg hydrogels to study and manipulate subcellular interactions on soft materials. Soft Matter 6, 5100-5108 (2010).

6. Mariner, P. D., Johannesen, E. & Anseth, K. S. Manipulation of mirna activity accelerates osteogenic differentiation of hmscs in engineered 3d scaffolds. J. Tissue Eng. Regen. Med. 6, 314-324 (2012).

7. Scholzen, T. & Gerdes, J. The ki-67 protein: From the known and the unknown. J. Cell. Physiol. 182, 311-322 (2000).





supplementary information...supplementary information supplementary methods all chemical reagents...

Documents