supplementary information methods - nature research · wiwam is designed for 216 plants each, grown...

Supplementary Information

METHODS

Lines

For overview of the lines, see also Table S1.

Seeds of MBF1c OE were kindly obtained from Ron Mittler (University of Nevada, USA);

myb60 and myb90 from Chiara Tonelli (University of Milano, Italy); ANAC055 OE from Vicky

Buchanan-Wollaston (University of Warwick, UK); SRK2C OE, GOLS2 OE, NCED3 OE from

Kazuo Shinozaki (RIKEN Institute, Japan); CPK4 OE from Da-Peng Zhang (China Agricultural

University, Beijing, China); NHX1 OE from Eduardo Blumwald (University of Toronto,

Canada); tAPX OE from Irene Murgia (University of Milano, Italy); RCl3 OE from Julio Salinas

(University of Madrid, Spain), HSP101 from Susan Lindquist (University of Chicago, USA);

strs1 and strs2 from Simon Barack (Ben Gurion University, Israel)n and AVP1 OE from

Roberto A. Gaxiola (University of Connecticut, USA). All lines were up–scaled alongside the

wild-type plants and expression levels of genes of interest were checked with reverse

transcription (RT--PCR or quantitative (q)-RT-PCR.

The T-DNA SALK insertion lines for elo2 (N667190), chr12 (N605458), cipk23

(N532341), mapkkk (N501982), aao (N608854), and cyp707a3 (N601566) were obtained from

NASC. Homozygous and azygous plants were selected by PCR with specific border primers and

Lbb1 T-DNA primers. Lack of expression was confirmed with RT-PCR.

Open reading frame of NF-YB and CBL1 were obtained by PCR from the Arabidopsis leaf

cDNA library. PCR fragments were cloned with BP reaction into the entry vector and

Nature Biotechnology: doi:10.1038/nbt.1801

subsequently by LR reaction into the 35S-pXK7 destination vector. Arabidopsis was transformed

by flower dip15. Single-insertion homozygous plants and azygous wild-type plants were selected

by means of kanamycin resistance. Two lines with the highest over-expression level, as

determined by Q-RTPCR, were used for phenotypic analysis. The primers used were:

AttB1-NF-YB: GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGGCGGATACGCCTTCGA

AttB2-NF-YB: GGGGACCACTTTGTACAAGAAAGCTGGGTATTACCAGCTCGGCATTTCTT

AttB1-CBL1: GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGGGCTGCTTCCACTCAA

AttB2-CBL1: GGGGACCACTTTGTACAAGAAAGCTGGGTATCATGTGGCAATCTCATCGA.

In-soil plant growth - survival assay

Each plant was grown in a separate pot (55 mm diameter) filled with Jiffy-7 pellets (Jiffy

Products, Stange, Norway). Mutant and respective controls were randomized in the same tray (5

x 7 pots), grown under normal conditions (16 h light regime at 21°C) for 14 days before the

weight of all pots was equalized. Water was withheld for approximately 2 weeks and plants were

re-watered when most of the plants clearly showed symptoms of wilting. Importantly, plants

were regularly randomized within the trays during the whole duration of the experiment. Plants

that survived were counted and survival was scored. Plants (12 to 18) of each genotype were

used to assess survival in three independent experiments.

In-soil plant growth - WIWAM

Plants were grown under a long-day regime (16 h light) at 21°C and 110-120 µmol m-2 s-1 light

intensity. The Weighing Imaging and Watering Machine (WIWAM) is an automated

phenotyping platform in which water deficit can be imposed by controlling and stabilizing the

soil water status during the development of soil-grown plants. WIWAM was designed together


with SMO (Eeklo, Belgium: http://www.smo.be) that also supplied the control electronics. The

portal was provided by Automotion (Lovendegem; Belgium: http://www.automotion.be/) and

contained linear drives from Bergher Lahr (now Schneider Electric Motion, Freiburg, Germany;

http://www.schneider-electric.com). The gripper was purchased from Shunk (Brackenheim-

Hausen, Germany; http://www.schunk.com) with a scale from Kern & Sohn (Ballingen,

Germany; http://www.kern-sohn.com). WIWAM is controlled by a standard personal computer

(PC) with a CAN bus card from Peak Systems (Darmstadt, Germany; http://www.peak-

system.com/). The controlling PC runs a Centeos Linux Operating System that was programmed

with an in-house developed software written in C and Ruby. This software is available upon

request. WIWAM is designed for 216 plants each, grown in cylindrical polypropylene pots (200

ml, diameter 53 mm, height 88 mm; VWR International, Leuven, Belgium) that had been

perforated to allow fast desiccation. Each pot contains a transponder, linking individual plants to

the local database where the information on the watering regime is stored. In a single run, a plant

is lifted by an automated robotic arm, moved to the camera position where the transponder is

identified, and a photograph is taken; the transponder is recognized, shifted to the scale where

dry mass is recorded and used to calculate the amount of water required, moved to the watering

position where water is added, transported back to the scale where the wet mass is recorded, and

finally returned to the home position on the platform. The photographs of the plants and the dry

and wet masses are automatically stored in the local database. Projected rosette area, perimeter,

and compactness (projected rosette area/area of convex hull) are measured automatically by

image analysis. Imaging algorithms were written in a Ruby script making use of the Open Source

Computer Vision Library (OpenCV) of Intel. Data were stored in a local Mysql database. In the

presented experiments, seeds were germinated in 85 g±2 g of Saniflor compost (Van Israel N.V.,


Geraardsbergen, Belgium; http://www.vanisrael.be) of 71% absolute water content (2.57 water/g

dry soil). At 6 or 7 days after stratification (DAS), plants were randomized (Figure S6) and

moved to the platform. Controlled watering (set at 68% absolute water content; 2.125 g water/g

dry soil) would last until plants reached stage 1.04, after which the stress treatment would start.

While control plants were watered daily (to keep the water content at 68%), drought-treated

plants were not watered until the water content dropped to 40% (0.66 g water/g of dry soil),

which took approximately 7 to 8 days, before the watering would be reinitiated for the next 2-3

days to keep the water content at 40%.

Statistical analysis

Data presented in the current manuscript are from six independent experiments. As all six

experiments were designed to have a similar treatment structure, we used the residual maximum

likelihood (REML) as implemented in Genstat16 for a combined analysis, also called meta-

analysis, of the repeated measurements data. The following linear mixed model was fitted to the

data (random terms underlined): yijklmn = µ + bm + gi + cj + tk + gcij + gtik + ctjk + gctijk + xn+ eijklmn,

where yijklmn is the phenotypic value of the l-th plant from the genotype i measured under

condition j at time point k in block m of experiment n, µ is the overall mean term, and eijklmn is

the residual effect; random effects in the model were assumed to be independent and normally

distributed with means zero and variance 2rσ , where r = x (experiment) and e (error). Times of

measurements were equally spaced and various ways of modeling the correlation structure

(uniform, autoregressive order 1 (AR1) or 2 (AR2), and antedependence order 1 and 2) were

compared in the REML framework as implemented in Genstat16. Selection of the best model fit

was based on a likelihood ratio test (LRT) statistic and the Aikake Information coefficient (AIC).


When residuals from the analysis indicated increasing variance over time, this was modeled

directly by specifying that heterogeneity is to be introduced into the model. Significance of the

fixed main and interaction effects was assessed by a F-test. Fitting linear contrasts among the

levels of factors in the REML analysis of repeated measurements was done with the

VTCOMPARISON procedure in Genstat17. Here, the cut-off for significance was set to α = 0.01

to compensate for the large number of contrasts made.

References

15. Clough, S.J. & Bent, A.F. Floral dip: a simplified method for Agrobacterium-mediated

transformation of Arabidopsis thaliana. Plant J. 16, 735-743 (1998).

16. Genstat Release 13 Reference Manual, Part 3 Procedure library PL21 (VSN International,

Oxford).

17. GenStat Release 14 Reference Manual, Part 3 Procedure Library PL22 (in press) (VSN

International, Oxford).


Figure S1. Survival assay.

(A) Survival rate of MYB90 and tAPX over-expressing lines compared to wild-type controls.

Data are means±SE from three independent experiments. Asterisk indicates significance (t-test

P-value<0.05). (B) Example of the survival assay 24 h after plants were re-watered.


Figure S2. WIWAM.

(A) Imaging, weighting and watering positions. (B) Mass of the pot that is recorded. (C)

Watering.


Figure S3. Experimental set-up used for drought experiments.

Seeds were stratified in cold for 2-3 days prior to sowing (4°C). Plants were germinated in the

long-day (16 h light) growth chamber (GC) and moved to WIWAM at 6-7 days after

stratification (DAS). Controlled watering was imposed to all plants until stage 1.04 (4th leaf is

approximately 1 mm in size), after which watering continued for control plants, but was stopped

for stressed plants until the set stress level had been reached that was kept constant afterward.


Figure S4. Example of the output data obtained from WIWAM during 10 days of control (red)

and stress (green) treatment.

Presented are the amount of water added to control and stress plants calculated from the mass

recorded before and after watering and changes in water content over the course of the

experiment (calculated based on the mass prior watering). Images were subjected to an

automated analysis that provided information on rosette area and perimeter (green line) and hull

area (red line). Changes in rosette area can be used to calculate the relative growth rate (RLGR =

ln (area dayt) – ln (area dayt-1) and the difference (∆) of RLGR of control and stressed plants.


Figure S5. Growth reduction caused by drought compared for all genotypes tested.

Means±SE of rosette area (on a ln scale) measured in STG lines (12 independent plants per

treatment and from one experiment) and wild-type (WT) plants (120 independent plants per

treatment and from six independent experiments) during 10 days of control (red) and drought

(green) treatment.


Figure S6. Schematic diagram depicting plant randomization on the WIWAM platform.

All WIWAM experiments were designed as a complete randomized block design with the

genotype*environment combinations occurring exactly twice in each of the six blocks, as

depicted on the schematic diagram. Up to nine different genotypes (G1 to G9) were analyzed in

control (C) and drought (Stress) conditions that accounted per 12 plants per

genotype*environment combination. The platform was divided in six blocks, each block

containing two plants per genotype and treatments. Block effects were accounted for in the

statistical analysis.


supplementary information methods - nature research · wiwam is designed for 216 plants each, grown...

Documents