Supplementary Information for OsmiR528 regulates rice pollen intine formation by targeting an uclacyanin to influence flavonoid metabolism Authors: Yu-Chan Zhang, Rui-Rui He, Jian-Ping Lian, Yan-Fei Zhou, Fan Zhang, Quan-Feng Li, Yang Yu, Yan-Zhao Feng, Yu-Wei Yang, Meng-Qi Lei, Huang He, Zhi Zhang and Yue-Qin Chen* *Corresponding author: School of Life Science, Sun Yat-Sen University, Guangzhou 510275, P. R. China Phone: 86-20-84112739 Fax: 86-20-84112399 Email: lsscyq@mail.sysu.edu.cn This PDF file includes:

Supplementary text Figures S1 to S7 SI References

1 www.pnas.org/cgi/doi/10.1073/pnas.1810968117

Supplementary Information Text Materials and Methods Plant growth conditions and generation of transgenic rice plants The growth conditions and generation of transgenic plants were conducted according to Zhang et al (1). Briefly, the Zhonghua 11 (Oryza sativa japonica) and Dongjin (DJ) rice cultivars were used in these experiments. Rice plants were grown in the field in Guangzhou, China (23°08′ N, 113°18′ E), where the growing season extends from late April to late September. The average low temperature range is 22.9–25.5°C, and the average high temperature range is 29.7–32.9°C. The day length ranged from 12 to 13.5 h. The plants were maintained with routine management practices. OsmiR528, OsUCL23, and OsD3 were overexpressed under the control of the CaMV35S promoter using A binary vector, pHQSN, which was constructed by inserting the CaMV35S promoter into the multiple cloning sites of pCAMBIA1390 between the HindIII and XbaI sites. The OsUCL23 knockout mutants were generated using CRISPR-Cas9-based genome editing technology. The following primers were used: OsUCL23 Target site: 5′-GTTGGACGTTTTCGCTTCCAAGA-3′ and 5′- AAACTCTTGGAAGCGAAAACGTC -3′; POT Target site: 5′- TCTTCATCACGCCGCTCATgttttagagctagaaat -3′ and 5′- ATGAGCGGCGTGATGAAGACggcagccaagccagca -3′. The transgenic rice plants were generated according to the Agrobacterium tumefaciens-mediated transformation methods. Briefly, embryonic calli were induced from rice seeds on N6 basal medium supplemented with 2mg/L 2,4-D. After co-cultivation of the calli with Agrobacterium strain EHA105 that harboring the binary vector, the calli were transferred to selection medium supplemented with hygromycin. Hygromycin resistant calli were subsequently used for shoot regeneration and root induction. The transgenic plantlets were then transferred to the field of the experimental station for normal growth and seed harvesting. Semi-thin sections and transmission electron microscopy Anther development process has been divided into 12 stages: stamen primordial stage (stage 1), archesporial cells differentialtion stage (stage 2), primary parietal cells differentialtion stage (stage 3), secondary parietal cells and primary sporogenous cell differentialtion stage (stage 4), secondary sporogenous cells differentialtion stage (stage 5), pollen mother cells differentialtion stage (stage 6), pre-meiosis stage (stage 7), meiosis stage (stage 8), early microspore stage (stage 9), late microspore stage (stage 10), binucleate pollen stage (stage 11) and mature pollen stage (stage 12) (2). Anthers with different length have been collected and observed by 4',6-diamidino-2-phenylindole(DAPI) staining and section to monitoring their developmental stages. Anthers of 0.9-1.6 mm length are at stage 9, of 1.6-1.8 mm length are at stage 10, of 1.9-2.3 mm length are at stage 11, of 2.3-2.9 mm length are at stage 12.The anther samples at different stages were fixed in 2.5% paraformaldehyde - 3.0% glutaraldehyde in 0.1 mol/L PBS (pH 7.2) for 4 h at 4°C and then washed 3 times in the same buffer, which was followed by post-fixation in 1% osmium tetroxide for 2 h at room temperature and 3 rinses using the same buffer. Specimens were dehydrated in a graded ethanol series and embedded in Epon812 (SPI Supplies Division of Structure Probe Inc., West Chester, PA, USA). Polymerization took place for 24 h at 40°C, followed by 24 h at 60°C. Specimens were cut to a thickness of 1 μm on a Leica RM2155 and were stained with 0.5% toluidine blue. Sections were observed and photographed with a Leica DMLB microscope. Ultrathin sections (50 to 70 nm) were double-stained with 2% (w/v) uranyl acetate and 2.6% (w/v) lead citrate aqueous solution and examined with a JEM 1400 transmission electron microscope (JEOL Ltd, Japan) at 120 kV. Examination of gene expression by qRT-PCR analysis Total RNA from rice seedlings at 14 d after germination or panicles before heading was reverse transcribed using the PrimeScript RT reagent kit (Takara, Japan). Real-time PCR was performed using SYBR Premix Ex Taq (Takara, Japan) to detect the PCR products. Actin2 was used as the reference gene. Real-time PCR was performed according to the manufacturer’s instructions (Takara, Japan), and the resulting melting curves were visually inspected to ensure the specificity

2

of the product detection. Gene expression was quantified using the comparative Ct method. The experiments were performed in triplicate, and the results are represented as the mean ± s.d. For Actin2, the primers were Actin2-F (5′-GTGCTTTCCCTCTATGCT-3’) and Actin2-R (5′-CTCGGCAGAGGT GGTGAA-3′); for OsUCL23, the primers were OsUCL23-F (5′- ATGGAGTGGGCTCGAGGTCCAG-3′) and OsUCL23-R (5′- GAGATGTTGTTGGCGTTGGA -3′); for OsD3, the primers were OsD3-F (5′- CTTGATGGTGTTGCGGTGTG-3′) and OsD3-R (5′- AATGCAAGCCTCCTGATCCC -3′); for Pri-miR528, the primers were Pri-miR528-F (5′- CCCATAATATAAACTCTGCA-3’) and Pri-miR528-R (5′- GGGATAGGTAGGTGTTATGT -3′) (3, 4); for Pre-miR528, the primers were Pre-miR528-F (5′- GCAGAGGAGCAGGAGATTCA-3’) and Pre-miR528-R (5′- GAAGAGGCAAGCACAGGAGA -3′); for OsmiR528, the primers were OsmiR528-F (5′- GCGCGTGGAAGGGGCATGCA-3’) and OsmiR528-R (5′- GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTCCTC -3′); for POT, the primers were POT -F (5′- GGTGACGATCTTCATCCTGCTGGCCGC-3’) and POT -R (5′- GAACGCGTAGTAGTAGTCGAGGCGCG -3′); for LAC5, the primers were LAC5-F (5′- CCGGGTGGTGCCGCTCGCGTTC-3’) and LAC5-R (5′- TGACGGTGTTGCGCTCGACGGGGTC -3′). Northern blot analysis. Total RNA was isolated with TRIzol (Invitrogen) from each sample according to the manufacturer's instructions. Northern blotting was performed as described with some modifications (5). Briefly, 80 μg of total RNA from the transgenic and wild-type plants were resolved on a denaturing 10% polyacrylamide gel and then electrophoretically transferred to Hybond-N+ membranes (Amersham, GE Life Sciences) using a semidry blotting apparatus (BioRad). The membranes were then irradiated with UV light for 4 min and baked at 80°C for 50 min. DNA oligonucleotides complementary to different miRNA sequences were synthesized (Sangon, Shanghai). The 5′ ends of the DNA probes were labeled with [γ-32P]ATP (Yahui Co.) using T4 polynucleotide kinase (TaKaRa). The membranes were prehybridized for at least 30 min in hybridization buffer (5× SSC, 20 mM NaH2PO4 pH 7.2, 7% SDS, 2× Denhardt’s Solution) and then were hybridized overnight at 42°C. After washing three times with 2× SSPE/0.1% SDS at room temperature, the membranes were exposed to a phosphor screen and visualized using a Typhoon 8600 variable mode imager (Amersham Biosciences). The probes used for OsmiR528 northern blot analysis was 5′- CTCCTCTGCATGCCCCTTCCA-3′ and for tRNA was 5’-GTCAGTACCGTGGGAGGGTA-3’. Histochemical GUS staining A binary vector, pCAMBIA1303 was used to generate the GUS-OsmiR528 transgenic line. The ~2000-bp region upstream of the OsmiR528 locus was used as the promoter region to control the expression of GUS gene. The GUS activity in the transgenic plants was localized by histochemical staining with 5-bromo-4-chloro-3-indolyl-β-D-glucuronic acid (X-Gluc). Transgenic plants were cut and incubated overnight at 37°C in staining buffer (1 mM X-Gluc, 100 mM sodium phosphate [pH 7.0], 10 mM EDTA, 0.5 mM K4Fe(CN)6, 0.5 mM K3Fe(CN)6, and 0.1% [v/v] Triton X-100) and then destained in 70% ethanol before photographing. Cytochemical Analysis The intine was stained with 0.1% calcofluor white for 15 min. The stained pollen was monitored under UV light with a confocal microscope. We have then calculated the ratio of fluorescent area to total pollen area of each pollen grain by image J. The pollen grains with the ratio less than 3020% and have irregular fluorescent area shape were considered as intine defective pollen grains. After staining with 0.001% auramine O in 17% sucrose, the pollen was observed on the fluorescein isothiocyanate channel of the microscope to observe the exine (6). To estimate pollen viability, mature pollen grains were stained in Alexander solution (7). Metabolic profiling A liquid chromatography-electrospray ionization-tandem mass spectrometry system as described previously was used for the relative quantification of widely targeted metabolites in rice anther samples (8). Mature anther of WT, OXmiR528, mir528, ucl23 and OXUCL23 plants were

3

collected respectively and used for the metabolic profiling. 200mg dry weight samples were used for one assay, and we performed three replications for each sample. Transient expression assay and BiFC Two-week-old rice shoots were used to isolate protoplasts. A bundle of rice plants (approximately 30 seedlings) were cut together into approximately 0.5-mm strips with propulsive force using sharp razors. The strips were incubated in an enzyme solution (1.5% cellulose RS, 0.75% macerozyme R-10, 0.6Mmannitol, 10 mM MES, pH 5.7, 10 mM CaCl2 and 0.1% BSA) for 4nd 0.1% BSA) formM CaClCl MES, pH 5.7, 10 mM CaCl10 mM CaClolution (1.5% cellulose RS, 0.75%tely of W5 solution (154 mM NaCl, 125 mM CaCl2, 5mM KCl and 2mM MES, pH 5.7) was added, followed by shaking (6025 mM CaCl10 mM CaCl10 mM CaClolution (1.5% cellulose RS, 0 through 40-owed by shaking (6025 mM CaCl10 mM CaCl10 mM CaClolution (1.5% cellulose RS, solution. The pellets were collected by centrifugation at 800 rpm for 3 min in a swinging bucket. After washing once with W5 solution, the pellets were then resuspended in MMG solution (0.4Mmannitol, 15 mM MgCl2 and 4 mM MES, pH 5.7) at a concentration of 2 2n6 cells mL-1. BIFC PEG-mediated transfections were performed as previously described (9). Protoplasts were observed using a confocal laser-scanning microscope (Zeiss 7 DUO NLO) at 488 and 561 nm excitation. All manipulations described above were performed at room temperature.

4

Fig. S1. Phenotype analysis of transgenic plants. (A) Gross morphology of DJ (WT), mir528, ZH11 (WT), OXmiR528, ucl23, and OXUCL23 plants at the flowering stage. Scale bar, 40 cm. (B) Plant height of different transgenic plants. Values shown are the means ± s.d. (n > 20 plants). Significant differences were identified using Student’s t-test. (C) Spikelets of DJ (wild-type; WT), mir528, ZH11 (WT), OXmiR528, ucl23, and OXUCL23 plants. Scale bars, 1 mm. (D) anthers of WT and mutants during different development stages. Scale bars, 20 µm. PMC, pollen mother cell; MS, meiosis stage; EMS, early microspore stage; LMS, late microspore stage; BPS, binucleate pollen stage; MPS, mature pollen stage.

5

Fig. S2. OsmiR528 and OsUCL23 regulate pollen maturation and pollination. (A) Transverse semithin sections of WT, overexpressor, and mutant anthers at the early microspore stage (EMS), binucleate pollen stage (BPS), and mature pollen stage (MPS), from top to bottom. The aborted pollen grains are indicated by asterisks. Scale bars, 50 µm. (B) Ratio of unviable pollen grains in different transgenic plants. Values shown are the means ± s.d. (n > 10 plants, 200 pollen grains). Significant differences were identified using Student’s t-test. (C) Alexander’s staining of heterozygous mir528 pollen grains. Scale bars, 50 µm. Heterozygous mir528 plants have less aborted pollen grains than that of homozygous mir528 plants, showing an intermediate phenotype. (D) Aniline blue staining of pollen tubes germinated on the stigma of the WT and mutants showed a defect in the pollination of the mir528 and OXUCL23 plants. Scale bars, 500 µm. (E) In vitro pollen germination of different transgenic plants. Scale bars, 50 µm.

6

Fig. S3. TEM analysis of the pollens of the WT and mutants pollen grains at early microspore stage (EMS), vacuolated pollen stage (VPS) and early binucleate pollen stage (EBPS). The lower panels were the amplification of the black squares in the upper panels. The intine is surrounded by blue lines. Scale bars, 2.5 µm.

7

Fig. S4. Relative expression levels of genes in different mutants and the morphology of OXD3 plants. (A) The expression level of LAC5 and D3 in OXmiR528, mir528 and WT panicles. (B) The expression level of OsUCL23 in OXmiR528, mir528, OXUCL23, ucl23 and WT panicles. (C) The expression level of D3 in OXD3 and WT seedlings. (D) Morphology of WT and OXD3 transgenic plants. Scale bar, 40 cm. (E) Panicles of WT and OXD3 plants. Scale bar, 4 cm. Values shown are the means ± s.d.

8

Fig. S5. Cross between OXmiR528 and OXUCL23 plants or between DJ and mir528 plants. (A) Aniline blue staining of pollen tubes germinated on the stigma when crossing OXmiR528 with OXUCL23 or crossing DJ with mir528 plants. Scale bars, 500 µm. (B) Ovary of hybrids 3 days after cross. Scale bars, 2mm for bright field photos; 200 µm for eosin staining photos. (C) The success rate of hybridization when crossing OXmiR528 with OXUCL23 or crossing DJ with mir528 plants. Values shown are the means ± s.d. (n > 8 plants). Significant differences were identified using Student’s t-test. (D) Seed setting rate of the hybrids and their male and female parent .Values shown are the means ± s.d. (n > 10 plants)

9

Fig. S6. Subcellular localization of OsUCL23 and POT protein. Green fluorescence represents fusion proteins; red fluorescence represents the organelle specific markers. Scale bars, 2 µm.

10

Fig. S7. OsUCL23 and OsmiR528 regulate the flavonoid metabolism pathway during pollen gametogenesis. (A) Relative expression of OsmiR528 and OsUCL23 during anther development. (B-C) Relative expression of OsUCL23 (B) and OsmiR528 (C) during lemma and palea development. VPS: vacuolated pollen stage; BPS, early binucleate pollen stage; MPS, mature pollen stage. Values shown are the means ± s.d. (D) Flavonoid metabolism pathway and the affected flavonoids by OsmiR528 and OsUCL23. Red represents flavonoids that are upregulated in OXUCL23 and mir528 pollens but downreglated in OXmiR528 and ucl23 pollens; blue represents flavonoids that are downregulated in OXUCL23 and mir528 pollen but upregulated in OXmiR528 and ucl23 pollens; red or blue arrowheads and numbers represent the number of flavonoid derivatives that are up- or downregulated in OXUCL23 and mir528 pollen respectively. (E) Genotype of pot plant. (F) Relative expression levels of POT in WT and OXPOT panicles. Values shown are the means ± s.d.

11

References 1. Y. C. Zhang et al., Overexpression of microRNA OsmiR397 improves rice yield

by increasing grain size and promoting panicle branching. Nat. Biotechnol. 31, 848-852 (2013).

2. D. Zhang, X. Luo, L. Zhu, Cytological analysis and genetic control of rice anther development. J Genet Genomics 38, 379-390 (2011).

3. R. Yang et al., Fine-Tuning of MiR528 Accumulation Modulates Flowering Time in Rice. Mol. Plant (2019).

4. J. Wu et al., ROS accumulation and antiviral defence control by microRNA528 in rice. Nat Plants 3, 16203 (2017).

5. J. F. Wang, H. Zhou, Y. Q. Chen, Q. J. Luo, L. H. Qu, Identification of 20 microRNAs from Oryza sativa. Nucleic Acids Res 32, 1688-1695 (2004).

6. S. Moon et al., Rice glycosyltransferase1 encodes a glycosyltransferase essential for pollen wall formation. Plant Physiol 161, 663-675 (2013).

7. M. P. Alexander, Differential staining of aborted and nonaborted pollen. Stain Technol 44, 117-122 (1969).

8. W. Chen et al., Comparative and parallel genome-wide association studies for metabolic and agronomic traits in cereals. Nat Commun 7, 12767 (2016).

9. Y. Zhang et al., A highly efficient rice green tissue protoplast system for transient gene expression and studying light/chloroplast-related processes. Plant Methods 7, 30 (2011).

12