Cell Metabolism, Volume 20 Supplemental Information Hepatic Oxidative Stress Promotes Insulin-STAT-5 Signaling and Obesity by Inactivating Protein Tyrosine Phosphatase N2 Esteban N. Gurzov, Melanie Tran, Manuel A. Fernandez-Rojo, Troy L. Merry, Xinmei Zhang, Yang Xu, Atsushi Fukushima, Michael J. Waters, Matthew J. Watt, Sofianos Andrikopoulos, Benjamin G. Neel, and Tony Tiganis

SUPPLEMENTAL INFORMATION

(Refer to figure legend on next page)

Supplementary Figure 1, related to Figures 1 and 2. Hepatic PTP oxidation. (a) Eight week-old

male C57BL/6 mice were HFF for 24 weeks and livers isolated and homogenised in the presence of

NEM. The clarified extracts were resolved by SDS-PAGE and immunoblotted with the PTPox

antibody to monitor for irreversible PTP oxidation (-SO3H), or otherwise processed for the

detection of total (reversible and irreversible PTP oxidation; as described in Material and Methods)

and then subjected to SDS-PAGE and immunoblotting with the PTPox antibody. (b) Eight week-

old male C57BL/6 mice were HFF for 24 weeks, fasted and then injected with PBS or insulin (0.65

mU insulin/g body weight, 10 min) and livers extracted and processed for an assessment of total

PTP oxidation by immunoblotting with the PTPox antibody. (c) Twenty week-old male C57BL/6

mice were fasted overnight and subjected to hyperinsulinemic euglycemic clamps (60 mU/ml

insulin infused at 20-40 µl/min and fasted blood glucose levels maintained by the co-infusion of 5%

w/v glucose). Blood glucose levels in individual clamped mice are shown. Livers were extracted

and processed for an assessment of total PTP oxidation by immunoblotting with the PTPox

antibody. (d-e) AML12 hepatocytes were either left untreated or treated with 0.5 mM palmitate-

BSA overnight and (d) H2O2 production measured in live cells using Amplex Red and normalised

to total protein, or (e) processed for an analysis of total PTP oxidation and immunoblotted with

PTPox. (f-g) Ten week-old male Gpx1+/+ and Gpx1–/– mice were HFF for 24 weeks and (f) whole

blood GSH, GSSG and GSH/GSSG ratios determined and (g) livers extracted and processed for an

assessment of total PTP oxidation by immunoblot analysis with the PTPox antibody. Results shown

in (d, f) are means ± SEM for the indicated number of mice and are representative of at least two

independent experiments. Significance was determined using 2-tailed student’s t-test; **p<0.01,

***p<0.001.

Supplementary Figure 2, related to Figure 2. Hepatic STAT-1, STAT-3 and STAT-5 signaling.

(a-b) Eight week-old male C57BL/6 mice were chow fed or high fat-fed (HFF) for 24 or 40 weeks

as indicated and livers extracted from fasted (4 h) mice and processed for immunoblotting. (c) Eight

week-old male C57BL/6 chow fed mice were fasted for 6 h and injected with PBS or insulin (0.65-

1.3 mU/g,10 min) and livers extracted and processed for immunoblot analysis with the indicated

antibodies.

Supplementary Figure 3, related to Figure 3. Generation of LTKO mice. Tissue homogenates

from Ptpn2lox/lox (lox/lox) and Alb-Cre;Ptpn2lox/lox (LTKO) mice were processed for immunoblotting

to monitor for TCPTP deletion. Representative results are shown.

(Refer to figure legend on next page)

Supplementary Figure 4, related to Figure 3. HFF LTKO and LTKO HET mice exhibit

decreased energy expenditure, insulin resistance and glucose intolerance. (a) Seven week-old

female lox/lox control and LTKO mice were HFF for 12 weeks and day and night oxygen

consumption, respiratory exchange ratios (RER= VO2/VCO2), energy expenditure and ambulatory

activity were assessed using a Comprehensive Lab Animal Monitoring System (CLAMS) fitted

with open circuit indirect calorimetry and activity monitors. (b) Eight week-old male versus female

lox/lox control and LTKO mice were fed a standard chow diet and weekly body weight monitored.

(c) Body composition (as assessed by DEXA) in 20 week-old female mice fed a chow diet. (d, e, g)

Seven week-old male versus female lox/lox and LTKO mice, or Ptpn2lox/+ (lox/+) and Alb-

Cre;Ptpn2lox/+ (LTKO HET) were HFF for 12 weeks and 20 weeks respectively. HFF mice were

subjected to insulin tolerance tests (0.5 mU/g) or glucose tolerance tests (2 mg/g); areas under

curves were determined and arbitrary units (AU) are shown. (f) Seven week-old male lox/lox and

LTKO mice were HFF for 12 weeks and fed and fasted blood glucose and plasma insulin levels

determined. (h-i) Seven week-old male versus female lox/lox and LTKO mice were HFF for 12

weeks, fasted for 6 h and then injected with PBS or insulin (0.65-1.0 mU/g, 10 min).

Gastrocnemius muscle or livers were extracted and processed for immunoblotting; representative

and quantified results are shown. Results shown are means ± SEM; significance was determined

using 2-tailed student’s t-test; *p<0.05, **p<0.01.

(Refer to figure legend on next page)

Supplementary Figure 5, related to Figures 4 and 5. HFF LTKO mice exhibit increased hepatic

STAT-1, STAT-3 and STAT-5 signaling, PPARγ , Fas, Scd1 and PDK4 expression and steatosis.

Seven week-old female lox/lox and LTKO mice were HFF for 12 weeks. (a) Livers were extracted

and fixed in formalin or frozen in OCT and processed for histological assessment (stained with

hematoxylin and eosin staining and Oil Red O respectively). (b) Fed plasma triacylglycerol and free

fatty acid (FFA) levels were determined. (c-d) Livers were extracted from fasted (4 h) mice and

processed for immunoblot analysis. (e) Mice were fasted for 4 h and injected with PBS or insulin

(0.75 mU/g, 10 min) and livers extracted and processed for immunoblot analysis. (f-g) Seven week-

old male lox/lox and LTKO mice were HFF for 12 weeks, fasted and injected with PBS or insulin

(1 mU/g, 10 min) and livers extracted and processed for (f) immunoblotting or (g) JAK-2

immunoprecipitation and immunoblotting. (h-i) Seven week-old female lox/lox and LTKO mice

were HFF for 12 weeks, fasted for 4 h and livers extracted and processed for (h) immunoblot

analysis or (i) quantitative (ΔΔCt) real time PCR to monitor for the mRNA expression of Pdk4.

Results shown are means ± SEM; significance was determined using 2-tailed student’s t-test;

*p<0.05, **p<0.01.

(Refer to figure legend on next page)

Supplementary Figure 6, related to Figure 5. Tyrosine phosphorylation-dependent signaling is

not altered in general in HFF LTKO mice. (a-b) Seven week-old male versus female lox/lox and

LTKO mice were HFF for 12 weeks, fasted for 4 h and livers extracted and processed for

immunoblot analysis. (c) Primary hepatocytes were isolated from chow fed C57BL/6 mice and

transfected with GFP control or Ptpn2-specific siRNAs (TCPTP#1, TCPTP#2) and 48 h later serum

starved for 6 h and stimulated with 50 U/ml IFN-γ or 200 ng/ml GH for the indicated times and

processed for immunoblot analysis. Quantified results are means ± SEM; significance was

determined using 2-tailed student’s t-test; *p<0.05, **p<0.01.

(Refer to figure legend on next page)

Supplementary Figure 7, related to Figure 6. STAT-5 heterozygosity corrects the obesity

phenotype in HFF LTKO mice. Seven week-old female lox/lox, Ptpn2lox/lox;Stat5lox/+ (lox/lox;Stat5

lox/+), LTKO mice, and Alb-Cre;Ptpn2lox/lox;Stat5lox/+ (LTKO;Stat5lox/+) mice were HFF for 12

weeks. (a) Liver homogenates were processed for immunoblotting and STAT-5 levels quantified

and normalised to tubulin. Quantified results are means ± SEM and significance was determined

using 2-tailed student’s t-test; ***p<0.001. (b) Body and tissue weights were determined and body

composition assessed by DEXA. Results shown are means ± SEM; significance was determined

using a one-way ANOVA; * LTKO versus lox/lox, $ LTKO versus lox/lox;Stat5 lox/+, # LTKO

versus LTKO;Stat5lox/+; *,$,#p<0.05, **,$$,##p<0.01, ***,$$$,###p<0.001. (c-d) Seven-week-old male

Stat5lox/+and Alb-Cre; Stat5lox/+ mice were HFF for 12 weeks and body and tissue weights

monitored/determined and body composition assessed by DEXA. Quantified results shown are

means ± SEM; significance was determined using 2-tailed student’s t-test; *p<0.05, **p<0.01,

***p<0.001. (e) Livers were extracted and processed for histology (hematoxylin and eosin).

Representative micrographs are shown.

SUPPLEMENTAL EXPERIMENTAL PROCEDURES

Antibodies and reagents

Rabbit α-phospho-AKT-S473 (p-AKT), α-phospho-STAT-5-Y694 (p-STAT-5), α-

phospho-STAT-3-Y705 (p-STAT-3), α-phospho-STAT-1-Y701 (p-STAT-1), α-phospho-ERK1/2-

T202/Y204 (p-ERK1/2), α-phospho-SFK-Y418 (p-SFK), α-STAT-5, α-STAT-1, α-PPAR-γ, α-

JAK-2, α-SCD1, α-FasN, α-SHP1 and mouse α-STAT-3, and α-AKT (pan) were from Cell

Signaling Technology (Beverly, MA). Rabbit α-SHP2, α-SREBP1, α-ERK2, α-JAK-1 (sc-7228),

α-JAK-2 (sc-294), goat α-PDK4 and mouse IRβ and β-actin (sc-1616) antibodies were purchased

from Santa Cruz Biotechnology (Santa Cruz, CA). Rabbit α-phospho-IRβ-Y1162/Y1163 (p-IRβ)

and α-phospho-JAK-1-Y1022/Y1023 (p-JAK-1) were from Invitrogen (Carlsbad, CA), mouse α-

PTP1B from BD Bioscience (San Jose, CA), α-DEP-1 (143-41) from R&D Systems (Minneapolis,

MN), rabbit α-Gpx1 and rabbit α-CD45 from Abcam (San Francisco, CA), mouse α-phospho-

tyrosine (p-Tyr) and rabbit α-phospho-JAK-2-Y1007/Y008 (p-JAK-2) from Millipore (Billerica,

MA), α-tubulin from Sigma-Aldrich (St Louis, MO) and α-actin (pan) from Neomarkers (Fremont,

CA). α-Ptpn2 (6F3) was from Medimabs (Quebec, Canada) and mouse oxidised PTP active site

(PTPox) antibody from R&D systems (Minneapolis, MN). CMP6 (JAK Inhibitor I) was from

Calbiochem (San Diego, CA), sodium palmitate, bovine and human insulin and recombinant human

GH from Sigma-Aldrich (St Louis, MO), recombinant human IL-6 and mouse IFN-γ from

PeproTech (Rocky Hill, NJ) and JI-38 from Phoenix Pharmaceuticals (Burlingame, CA). The

m/rIG1 ELISA kit was from Mediagnost (Reutlinger, Germany) and the m/r Insulin and m/r GH

ELISA kits were from Millipore (Billerica, MA). MitoTempol from Enzo Life Sciences

(Farmingdale, NY) and the mitochondrial-localised peptide SS31 (Bendavia, active ingredient is

MTP-131) was provided by Stealth Peptides Incorporated (Newton Center, MA)

Mice

We maintained mice on a 12 h light-dark cycle in a temperature-controlled high barrier

facility (Monash ARL) with free access to food and water. Aged- and sex-matched mice were used

for all experiments. Ptpn2lox/lox (C57BL/6) described previously (Loh et al., 2012; Wiede et al.,

2011) were mated with Alb-Cre (C57BL/6) mice (JAX, Bar Harbor, Maine) for the postnatal

deletion of Ptpn2 specifically in hepatocytes (Postic and Magnuson, 2000). Stat5lox/lox (C57BL/6)

mice described previously (Cui et al., 2007) and provided by Lothar Henighausen (The National

Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD) were mated with Alb-

Cre;Ptpn2lox/lox mice to generate Ptpn2lox/+;Stat5lox/+ and Alb-Cre;Ptpn2lox/+;Stat5lox/+ mice which

were thereon bred with Ptpn2lox/lox to generate experimental mice. Gpx1–/– (C57BL6) mice have

been described previously (Loh et al., 2009). Mice were fed a standard chow (20% protein, 6% fat

and 3.2% crude fibre; Barastoc, Australia) or a high fat diet (23% fat; 45% of total energy from fat;

SF04-027; Specialty Feeds) as indicated. All experiments were approved by the Monash University

School of Biomedical Sciences Animal Ethics Committee and performed in accordance with the

NHMRC Australian Code of Practice for the Care and Use of Animals.

Metabolic measures

Insulin and pyruvate or glucose tolerance tests were performed on 4 h and 6 h fasted mice,

respectively, by injecting human insulin (0.5 mU/g body weight), pyruvate (2 mg/g body weight),

or D-glucose (2 mg/g body weight) intraperitoneally and measuring glucose in tail blood with an

Accu-chek performa glucose meter (Roche Diagnostics, Germany) as described previously

(Fukushima et al., 2010; Loh et al., 2009). For an assessment of hepatic insulin signaling, mice

were fasted for 4 h, injected intraperitoneally with the indicated concentrations of insulin and after

10 min the livers excised rapidly and frozen in liquid N2 for subsequent biochemical analyses. For

the determination of fed and fasted blood glucose and corresponding plasma insulin levels, blood

was collected by retro-orbital bleeding after a 6 h fast. Plasma insulin levels were determined using

a rat insulin RIA kit (Linco Research, St. Charles, MO) according to the manufacturer’s

instructions, or with an in-house ELISA. For metabolic measures mice were acclimated for 24 h and

monitored for 48 h in an environmentally controlled Comprehensive Lab Animal Monitoring

System (CLAMS; Columbus Instruments, Columbus. OH) fitted with indirect open circuit

calorimetry and food consumption and activity monitors to measure activity, food intake and energy

expenditure. Energy expenditure and the respiratory exchange ratio (RER = VCO2/VO2) were

calculated from the gas exchange data. Body composition was measured by DEXA (Lunar

PIXImus2; GE Healthcare) and analysed using PIXImus2 software; the head region was excluded

from analyses.

Hyperinsulinaemic euglycaemic clamps (without tracer) were performed as described

previously (Loh et al., 2009). Briefly 20 week-old mice were fasted overnight (16 h) and

anesthetized on the morning of the experiment with an intraperitoneal injection of sodium

pentobarbitone (100 mg/kg). Two catheters were inserted, one in the right jugular vein for insulin

and glucose infusion and the other in the left carotid artery for sampling. A tracheostomy was also

performed to prevent upper respiratory tract obstruction and body temperature maintained using a

heat lamp. Insulin (60 mU/ml) was infused at a rate of 20-40 µL/min for 4 h. Euglycemia was

maintained by the co-infusion of a 5% (w/v) glucose solution. Immediately following the collection

of the last blood sample at 4 h, animals were sacrificed and livers removed rapidly, frozen in liquid

nitrogen and stored at -70oC for subsequent analyses.

Cell culture and RNA interference

Hepatocytes from were isolated by a two-step collagenase A (0.05% w/v; Roche

Diagnostics, Germany) perfusion method as described previously (Fukushima et al., 2010).

Hepatocytes were cultured in M199 medium (Invitrogen, Carlsbad, CA) containing 10% (v/v) heat-

inactivated FBS, 100 units/ml penicillin, 100 µg/ml streptomycin and 20 ng/ml EGF (R&D

Systems, Minneapolis, MN). After 24 h cells were serum starved in M199 medium for 2-4 h and

then stimulated with bovine insulin, GH, IFN-γ or IL-6 as indicated. Alternatively, cells were

treated with 0.5 mM sodium palmitate in the presence of 1% w/v fatty acid free BSA overnight (16

h) and then serum starved (4 h) and stimulated as indicated. AML12 hepatocytes were cultured as

recommended (ATCC) and treated with 0.5 mM sodium palmitate in the presence of 1% w/v fatty

acid free BSA overnight for subsequent analysis of H2O production or PTP oxidation.

Ptpn2 or Jak-2 were knocked down transiently in primary murine hepatocytes using Ptpn2

(TCPTP#1: AAGCCCATAUGAUCACAGUCG; TCPTP#2: AAGAUUGACAGACACCUAAAU;

Dharmacon Thermo Scientific, Waltham, MA) or Jak2-specific siRNAs (sc-39100; Santa Cruz

Biotechnology, Santa Cruz, CA); enhanced green fluorescent protein (GFP;

CAAGCUGACCCUGAAGUUCdTdT; Dharmacon Thermo Scientific, Waltham, MA) siRNA was

used as a control. Primary hepatocytes were transfected 24 h after isolation with 40 nM siRNA

using Lipofectamine® RNAiMAX (Invitrogen, Carlsbad, CA) as described previously (Galic et al.,

2005). After overnight incubation the medium was replaced and cells allowed to recover for 24 h

before further treatment.

ROS determinations

For monitoring H2O2, hepatocytes were cultured in 96 well white ViewPlates (Perkin Elmer,

Waltham, MA) and H2O2 levels determined in live hepatocytes using the Amplex® Red hydrogen

peroxide assay kit (Invitrogen, Carlsbad, CA). Amplex Red fluorescence was measured on a BMG

Fluorostar fluorescent plate reader (Hamilton, Reno, NV) at excitation 545 nm and emission 590

nm and normalised to the corresponding protein content. Total (GSH) and oxidised (GSSG)

glutathione levels in the clarified supernatants or in whole blood were measured using a

BIOXYTECH GSH/GSSG-412 assay kit (Oxis International, Inc., Foster City, CA), and GSH to

GSSG ratios determined as per the manufacturer’s instructions.

Biochemical Analysis

Mouse tissues were excised rapidly and snap-frozen in liquid N2. Frozen tissues were

homogenised using a mechanical homogeniser in 10-20 volumes of ice cold RIPA lysis buffer (50

mM HEPES [pH 7.4], 1% (vol/vol) Triton X-100, 1% (vol/vol) sodium deoxycholate, 0.1%

(vol/vol) SDS, 150 mM NaCl, 10% (vol/vol) glycerol, 1.5 mM MgCl2, 1 mM EGTA, 50 mM

sodium fluoride, leupeptin (5 µg/ml), pepstatin A (1 µg/ml), 5 µg/ml aprotinin, 1 mM benzamadine,

1 mM phenylmethysulfonyl fluoride, 1 mM sodium vanadate) and clarified by centrifugation at 50,

000 g for 20 min at 4°C as described previously (Loh et al., 2009). Cells were lysed in RIPA buffer

and clarified by centrifugation (16,000 g, 5 min, 4°C). Supernatants were resolved by SDS-PAGE

and immunoblotted as described previously (Tiganis et al., 1998).

PTP oxidation

Total (reversible and irreversible) PTP oxidation was assessed essentially as described

previously (Karisch et al., 2011) with some modifications. Briefly, frozen liver tissue or freshly

isolated hepatocytes were homogenised under anaerobic conditions in de-gassed, ice-cold PTPox

lysis buffer [50 mM Hepes, pH 6.5, 150 mM NaCl, 10 % (vol/vol) Glycerol, 1 % (w/v) NP40, 20

mM NaF, 1 µg/ml pepstatin A, 5 µg/ml leupeptin, and 5 µg/ml aprotinin, 1 mM benzamadine, 1

mM phenylmethysulfonyl fluoride] containing 10 mM N-ethylmaleimide to prevent post-lysis

oxidation and to alkylate all reduced and active PTPs, and incubated for 1 h at 4°C. Cell lysates and

liver homogenates were clarified by centrifugation at 16,000 g and 50,000 g respectively for 20 min

and the buffer exchanged (NAPTM-5 columns, GE Healthcare) to 20 mM HEPES containing 10 mM

DTT to reduce oxidised PTPs. Reduced PTPs were then hyperoxidised to their sulfonic (-SO3H)

state by exchanging the buffer to 20 mM HEPES containing 100 µM pervanadate and resolved by

SDS-PAGE and immunoblotted with PTPox antibody. Alternatively pervanadate-treated samples

were made to 9 M urea and 4.5 mM DTT, incubated at 60°C for 30 min and then treated with 10

mM iodoacetamide before being diluted to a final concentration of 2 M urea for digestion with

TPCK-trypsin (Thermo Scientific) and processing for PTPox immunoprecipitation and analysis by

mass spectrometry as described previously (Karisch et al., 2011).

Lipid analyses and hepatic lipogenesis

TAGs , diglycerides and ceramide were extracted and quantified as described previously

(Loh et al., 2009). Blood TAGs and were quantified using a commercial enzymatic colorimetric

assay (GPO-PAP reagent, Roche Diagnostics, Germany) and FFAs assessed as described previously

(Loh et al., 2009). Hepatic lipogenesis was assessed by measuring the incorporation of 14C-glucose

(Glucose, D-[14C(U)]-, 100 µCi/ml, Perkin Elmer) into TAG. Briefly, liver slices (~20 mg) were

incubated for 2 h in DMEM (5 mM glucose, 1 µCi/ml 14C-glucose). Tissues were washed with

warm PBS and the intracellular lipids were extracted in 1.8 mL chloroform:methanol (2:1 v:v); 600

ul 4 mM MgCl2 was added, the mixture mixed vigorously and centrifuged at 1,000 x g for 10 min.

The organic phase containing lipids was subjected to thin layer chromatography to separate the

TAGs, and incorporated radioactivity counted in a beta-counter.

Immunohistochemistry

Livers were frozen in OCT or fixed with formalin and embedded in paraffin. Liver sections

were stained with Oil red-O (OCT fixed) or hematoxylin and eosin (formalin fixed) counterstained

before being analyzed using a BX51 Olympus slide system and OlyVIA imaging software

(Olympus, Tokyo, Japan).

Real time PCR.

RNA from frozen liver or hepatocytes was extracted using Trizol reagent (Invitrogen,

Carlsbad, CA). mRNA was reverse transcribed using a High Capacity cDNA Reverse Transcription

Kit (Applied Biosystems, Foster City, CA) and quantitative real time PCR performed TaqMan

Universal PCR Master Mix and TaqMan Gene Expression Assays (Applied Biosystems, Foster

City, CA) for G6pc, Pck1, Pdk4, Igf-1 and CD36; Gapdh (TaqMan™ Endogenous Controls Mouse

GAPDH) was used as an internal control. Reactions were performed in triplicate and relative

quantification achieved using the ΔΔCt method.

Statistical Analysis

Results shown are means ± standard error of mean (SEM) for the indicated number of mice

or experimental repeats. Statistical significance was determined by a two-tailed paired Student’s t-

test or ANOVA with Bonferroni correction. P values < 0.05 were considered statistically

significant.

REFERENCES:

Cui, Y., Hosui, A., Sun, R., Shen, K., Gavrilova, O., Chen, W., Cam, M.C., Gao, B., Robinson,

G.W., and Hennighausen, L. (2007). Loss of signal transducer and activator of transcription 5 leads

to hepatosteatosis and impaired liver regeneration. Hepatology 46, 504-513.

Fukushima, A., Loh, K., Galic, S., Fam, B., Shields, B., Wiede, F., Tremblay, M.L., Watt, M.J.,

Andrikopoulos, S., and Tiganis, T. (2010). T-cell protein tyrosine phosphatase attenuates STAT3

and insulin signaling in the liver to regulate gluconeogenesis. Diabetes 59, 1906-1914.

Galic, S., Hauser, C., Kahn, B.B., Haj, F.G., Neel, B.G., Tonks, N.K., and Tiganis, T. (2005).

Coordinated regulation of insulin signaling by the protein tyrosine phosphatases PTP1B and

TCPTP. Mol Cell Biol 25, 819-829.

Karisch, R., Fernandez, M., Taylor, P., Virtanen, C., St-Germain, J.R., Jin, L.L., Harris, I.S., Mori,

J., Mak, T.W., Senis, Y.A., et al. (2011). Global proteomic assessment of the classical protein-

tyrosine phosphatome and "Redoxome". Cell 146, 826-840.

Loh, K., Deng, H., Fukushima, A., Cai, X., Boivin, B., Galic, S., Bruce, C., Shields, B.J., Skiba, B.,

Ooms, L.M., et al. (2009). Reactive oxygen species enhance insulin sensitivity. Cell Metab 10, 260-

272.

Loh, K., Merry, T.L., Galic, S., Wu, B.J., Watt, M.J., Zhang, S., Zhang, Z.Y., Neel, B.G., and

Tiganis, T. (2012). T cell protein tyrosine phosphatase (TCPTP) deficiency in muscle does not alter

insulin signalling and glucose homeostasis in mice. Diabetologia 55, 468-478.

Postic, C., and Magnuson, M.A. (2000). DNA excision in liver by an albumin-Cre transgene occurs

progressively with age. Genesis 26, 149-150.

Tiganis, T., Bennett, A.M., Ravichandran, K.S., and Tonks, N.K. (1998). Epidermal growth factor

receptor and the adaptor protein p52Shc are specific substrates of T-cell protein tyrosine phosphatase.

Mol Cell Biol 18, 1622-1634.

Wiede, F., Shields, B.J., Chew, S.H., Kyparissoudis, K., van Vliet, C., Galic, S., Tremblay, M.L.,

Russell, S.M., Godfrey, D.I., and Tiganis, T. (2011). T cell protein tyrosine phosphatase attenuates

T cell signaling to maintain tolerance in mice. J Clin Invest 121, 4758-4774.