Cell Reports, Volume 7

Supplemental Information

MicroRNA Targeting of CoREST Controls

Polarization of Migrating Cortical Neurons

Marie-Laure Volvert, Pierre-Paul Prévot, Pierre Close, Sophie Laguesse, Sophie Pirotte,

James Hemphill, Florence Rogister, Nathalie Kruzy, Rosalie Sacheli, Gustave Moonen,

Alexander Deiters, Matthias Merkenschlager, Alain Chariot, Brigitte Malgrange, Juliette

D. Godin, and Laurent Nguyen

  1  

Supplemental Data

Figure S1. Conditional removal of Dicer in cortical progenitors impairs corticogenesis

Microphotography of E14 mouse brains from Dicer conditional knockout (Dicerlox/lox;

FoxG1Cre/+) or corresponding wild-type (Dicerlox/+;FoxG1Cre/+) mice. Histogram on the left

shows cortical thickness in transgenic E14 embryos, genotypes as indicated (A).

Immunolabelings of cortex from Dicer knockout or wild-type embryos show: the distribution

of apical (Pax6+, red) or basal (Tbr2+, red) progenitors (B), the radial glia scaffold (BLBP in

  2  

green and nestin in red, the inset shows holes in nestin labelling corresponding to loss of glial

scaffold integrity) (C), the distribution of cortical progenitors (Sox2 in red) and neurons (BIII-

tubulin in green) or upper layer neurons (Tbr1 in green) (D), dying cells (ac-capsase-3 in red)

or cells accumulating DNA double-strand breaks (pH2AX in red) (E), nuclei are

counterstained with Hoechst 33342 (Hoechst) in blue. Scale bars represent 100 µm.

Figure S2. Conditional removal of Dicer impairs neuronal morphology and radial migration

A-D, acute depletion of Dicer thanks to NeuroD:Cre-GFP expression in Dicerlox/lox embryos

cell autonomously disturbs neuron migration. Immunolabelings of E18 NMRI brain sections

shows GFP+ electroporated cells (GFP in green) (A) with Cre (red) (B) or the radial glia

scaffold (BLBP in red) (C) or the upper layer marker Cux1 (red) (D). E-I, acute depletion of

  3  

Dicer in postmitotic neurons leads to morphological and motility defects. Histogram shows

the proportion of Dicerlox/lox electroporated neurons at E14 that harbor distinct morphologies

two days later (E). Real time imaging on one day cultured brain slice from E17 embryos

electroporated at E14 reveals that distance (G, H, I) but not velocity (F) of somal

translocation is affected after conditional removal of Dicer. Time lapse sequences in minutes

(H, I).

Figure S3. Analysis of gene expression after acute removal of Dicer in migrating projection

neurons

Expression level of REST (A), Rnd2 (B), FilaminA (C), FoxP2 (D), Stathmin (E), Neuropilin

1 (F), COUPTF1 (G), Sin3A (H), MeCP2 (I), and CoREST (J) as quantified by qRT-PCR

from RNA-extracted from FACS-purified Dicerlox/lox electroporated neurons with

  4  

NeuroD:GFP, NeuroD:Cre-GFP with or without shSCR or Sh CoREST. Western blot of

CoREST and actin in N2A cells transfected with either shSCR or shCoREST (K).

Immunolabelings showing the cortical distribution of E17 neurons electroporated (GFP,

green) with selected plasmids at E14, as annotated above individual pictures. Counterstaining

was performed with dapi (blue) (L) Relative distribution of corresponding electroporated

neurons throughout the cortical wall (N). Level of CoREST messengers in VZ/SVZ or IZ in

microdissected cortical E16 brain slices after in utero electroporation of shSCR or shCoREST

plasmids two days earlier (N). Abbreviations are subventricular zone (SVZ), intermediate

zone (IZ), and cortical plate (CP).

  6  

Figure S4. Heatmap of miRNA expression in the developing cerebral cortex at three

developmental milestones

Expression levels (in arbitrary values) of miRNAs in cerebral cortex extracts from E12, E14,

and E18 mouse embryos ranked top down according to E14. Undetected miRNAs are

excluded from the heatmap. The blue arrows point miRNAs that have been bioinformatically

predicted to target CoREST (miR-124>mir-22>mir-185).

Figure S5. Modulation of endogenous miRNA expression

Luciferase assay in HEK-293 cells with combination of vectors expressing the Luciferase

gene followed by the 3’UTR of CoREST, specific miRNAs mimics (miR-) and antagomiRs

as indicated on the histogram (A). Relative expression levels of Dicer in cortical extracts from

embryos of different genotypes, as indicated (B). Luciferase assay in HEK-293 cells with

combination of vectors expressing the Luciferase gene followed by the 3’UTR of CoREST,

specific miRNAs mimics (miR-) and NeuroD-driven miRNA sponges (SPGmiR-), as

  7  

indicated on the histogram (C) or UV-activatable caged antagomiRs (D) (ANOVA-1,

Bonferoni post test, ***p<0.0001).

Figure S6. Rescue of radial migration defects induced by expression of selected miRNA

sponges

A-B, levels of Dcx (A) and CoREST (B) mRNA in 17 NMRI mouse embryos after in utero

electroporation of SPGmiRNAs (as indicated) at E14. Immunolabelings showing the cortical

distribution of neurons three (C; RFP, red) or four (E; GFP, green) days after electroporation

  8  

of selected plasmids (as annotated above individual pictures) in E14 NMRI mouse brains ,.

Counterstaining was performed with dapi (blue). Inset show magnified field highlighting

neuronal polarity (E). Relative distribution of corresponding electroporated neurons

throughout the cortical wall (D, F). Abbreviations are subventricular zone (SVZ),

intermediate zone (IZ), and cortical plate (CP) (D, F, ANOVA-2, Bonferoni post test,

**p<0.001, ***p<0.0001).

Movie S1. Defects of multipolar to bipolar polarization in absence of Dicer expression.

Multipolar GFP-expressing projection neurons (pointed by red arrowhead) navigating in

upper SVZ to lower intermediate zone of cultured brain slices from E16.5 Dicerlox/lox mouse

embryos electroporated with either NeuroD:GFP (left) or NeuroD:Cre-GFP (right) expressing

plasmids. The magnification is 40X and the recording duration is 10 hours.

Movie S2. Defects of bipolar maintenance in absence of Dicer expression. Bipolar GFP-

expressing projection neurons (pointed by red arrowhead) navigating in the lower

intermediate zone of cultured brain slice from E16.5 Dicerlox/lox mouse embryos

electroporated with either NeuroD:GFP (left) or NeuroD:Cre-GFP (right) expressing

plasmids. The magnification is 40X and the recording duration is 10 hours.

Supplemental Experimental Procedures

Mouse lines and genotyping

Time-pregnant NMRI (Janvier labs, Saint Berthevin, France), Dicerlox/lox (M. Merkenschlager,

Londres), FoxG1Cre/+ (J.-M. Hébert, New York) and NEXCre/+ (K.A. Nave, Göttingen) mice

backrossed in MF1 genetic background were housed under standard conditions and treated

according to guidelines of the Belgian Ministry of Agriculture in agreement with the

European community Laboratory Animal Care and Use Regulations (86/609/CEE, Journal

Officiel des Communautés Européennes L358, 18 December 1986). Dicerlox/lox mice were

crossed with FoxG1Cre/+ mice to obtain Dicerloxp/+ FoxG1Cre/+ mice, and genetic invalidation of

Dicer was performed after crossing the latter with Dicerlox/lox. The resulting Dicerlox/+lox;

  9  

FoxG1+/+ (control) and Dicerlox/lox; FoxG1Cre/+ (Dicer conditional knockout) littermates were

analyzed. The same strategy was used to obtain Dicerlox/lox; NEXCre/+. PCR-based genotyping

was performed with the following primers: Dicer Fwd

(AGTAATGTGAGCAATAGTCCCAG) and Dicer Rev

(CTGGTGGCTTGAGGACAAGAC) to detect Dicer lox alleles. The following primers were

used to detect Cre recombinase: Cre Fwd (ATCCGAAAAGAAAACGTTGA) and Cre Rev

(ATCCAGGTTACG GATATAGT).

Tissue processing

Embryonic brains were dissected in 0.1 M phosphate-buffered saline (PBS) (pH 7.4) and

further fixed in a solution containing 4% paraformaldehyde (PFA) at 4°C for 1.5 hours (for

immunohistochemistry) or overnight (for RNA in situ hybridization). P2 and P17 brains were

dissected from anesthetized animals subjected to intracardial perfusion of 0.9% NaCl,

followed by 4% PFA. Brains were further post-fixed for an additional 1.5 hours in 4% PFA.

Fixed samples were cryoprotected overnight in 20% sucrose in PBS at 4°C, then embedded in

OCT Compound (VWR International, Leuven, Belgium), cryosectioned (10-20 µm), and

placed onto slides for analyses (SuperFrost Plus, VWR International).

Immunohistochemistry and RNA in situ hybridization

For immunocytochemistry, samples were washed three times with PBS-Triton (0.1%) (PBST)

and blocked at room temperature for 1 hour in PBST containing 10% donkey serum (Jackson

Immunoresearch Laboratories, West Grove, USA). All primary antibodies were incubated

overnight at 4°C. The following primary antibodies were used: anti-GFP (1:1000, rabbit,

Invitrogen, Paisley, UK; 1:500, chicken, Millipore, Billerica, USA; 1:1000 Rat, Gentaur,

Belgium; 1:500, goat, Abcam, UK), anti-βIII tubulin (1:1000, rabbit, Covance, USA), anti-

Cre recombinase (1:500, rabbit, Covance, USA), anti-activated caspase3 (1:500, rabbit,

Promega, USA) anti-Brain Lipid-Binding Protein (BLBP) (1:500, rabbit, Millipore), anti-

CDP (Cux1) (1:500, goat, Santa Cruz, USA), anti-Sox5 (1:500, rabbit, Aviva systems

biology), anti-Tbr2 (1:500, rabbit, Millipore, USA), anti-Tbr1 (1:500, rabbit, Millipore,

USA), anti-Pax6 (1:100, Covance, USA), anti-Nestin (1:200, chicken, Novus Biologicals,

UK), anti-Sox2 (1:500, goat, Santa Cruz, USA), anti-CoREST (1:500, rabbit, Millipore USA),

  10  

anti-Satb2 (1:500, Mouse, Abcam, UK), anti-Ctip2 (1:300, rat, Abcam, UK), anti-Dcx

(1:1000, goat, Santa Cruz, USA) anti-Ki67, clone B56 (1:50, mouse, BD Pharmingen,

Erembodegem, Belgium) anti-Kif1a (1:500, Mouse, BD Transduction), anti-Kif1a (1:500,

Goat Santa Cruz, USA). Cryosections were washed and incubated with corresponding

secondary antibodies coupled either with RHODredX, Cy5 or FITC (Jackson

Immunoresearch laboratories) for 1 hour at room temperature. Nuclei were counterstained

with Hoechst 33342 (1:1000, Invitrogen, Paisley, UK). Sections were analyzed by confocal

microscopy (Nikon A1 Eclipse).

RNA in situ hybridizations were performed on frozen brain sections with 3’-digoxigenin-

labeled LNATM antisense probes (Exiqon, Euroclone, Milano, Italy) to mouse miR-124,

miR185, miR-22 as described previously (De Pietri Tonelli et al., 2008).

Plasmids preparation

Plasmids DNA were prepared using a Plasmid Endofree Maxi Kit (Qiagen, Hilden,

Germany). pNeuroD-IRES-GFP was a gift from F. Polleux (SCRIPPS, CA, USA). p-

shCoREST and p-shSCR were gift from M. Kukuljan (Universidad de Chile, Santiago, Chile).

The targeting efficiency of p-shCoREST towards endogenous CoREST mRNAs was assessed

by qRT-PCR in extracts obtained from microdissected cortical VZ/SVZ and IZ obtained from

E16 embryos electroporated in utero two days earlier with p-shCoREST or p-shSCR (Figure

S3N). The Cre recombinase, CoREST, and Dcx coding sequence were subcloned into the

pNeuroD-IRES-GFP/RFP. The 3’UTR of CoREST was subcloned into a psiCHECK-2 vector

(Promega, USA). All constructs were checked by sequencing. Mutations in the 3’UTR of

CoREST were performed using QuikChange   Lightning   Site-­‐Directed   Mutagenesis   Kit

(Agilent Technologies). Website for miRNA target prediction: Target scan,

http://www.targetscan.org/ MicroRNA.org,  

http://www.microrna.org/microrna/home.do   and   Diana-­‐microT   V3.0,

http://diana.cslab.ece.ntua.gr/microT/

Dual luciferase assay

HEK-293T (human embryonic kidney) cells were seeded in 24-well plates and further

transfected in each well using Lipofectamine 2000 (Invitrogen) with 20ng psiCheck-2

containing CoREST 3’UTR and 250 ng p-CMV-miR vectors (microR-22, miR-124, miR-185)

(Origene, MD, USA) according to the manufacturer’s instructions. Cells were incubated 48

  11  

hours at 37°C. psiCheck-2 containing CoREST 3’UTR with point mutations in the seed

sequences for miR-124 (guacauuuggaauuggugAACuc), miR-22

(caucucuguggacaagcGTAuau) were included as negative controls. Negative controls were

transfected with the p-CMV-microR empty vector. Antisens validation was performed after

transfection of antagomiRs (50 pmol, 25 nM) or sponge plasmids (500 ng). For caged

antagomiRs validation, HEK-293 cells were seeded in clear-bottom 96-well plates (BD

biosciences, San Jose,CA), and transfected with 5ng psiCheck-2 containing CoREST 3’UTR,

25 ng p-CMV-miR vectors, caged antagomiRs (10 pmol, 25nM) and 50 ng of centrin-Kaede

(Wang et al., 2009). Six hours after transfection, cells were either kept in dark or irradiated for

5 minutes with a mercury lamp (Nikon C-LHGFI Intensilight) and a DAPI filter cube for

excitation (Nikon A1 Eclipse Ti microscope, 4x objective, half power of the lamp). Cells

were incubated 15 hours at 37°C after exposition. Firefly and renilla luciferase activities were

measured with a luminometer using the Dual-Luciferase Reporter Assay System kit

(Promega).

NMRI E14 embryos were electroporated in utero with plasmids psiCheck-2 containing

CoREST 3’UTR, or containing CoREST 3’UTR with point mutations in the seed sequences

for miR-124 and miR-22. Brains were collected at E17 and homogenized in 250µl of passed

lysis buffer (PLB, Promega). Data are the mean of at least 10 samples (pool of two brains in

each sample). Firefly and renilla luciferase activities were measured with a luminometer using

the Dual-Luciferase Reporter Assay System kit (Promega).

Electroporation

In utero electroporation were performed as described previously (Creppe et al., 2010; Nguyen

et al., 2006), with minor modifications. Briefly, uteri of anaesthetized timed-pregnant mothers

(14.5 days) with isoflurane in oxygen carrier (Abbot Laboratories Ltd, Kent, UK) were

exposed through a 1.5 centimeter incision in the ventral peritoneum. Embryos were carefully

lifted using ring forceps through the incision and placed on humidified gauze pads. Plasmid

DNA solution (2 to 4 µg/µl), prepared using EndoFree plasmid purification kit (Qiagen

Benelux B.V.), mixed with 0.05% Fast Green (Sigma, St. Louis, MO) was injected through

the uterine wall into the telencephalic vesicle using pulled borosilicate needles and a Femtojet

microinjector (VWR International). Five electrical pulses were applied at 35V (50 ms

duration) across the uterine wall at one second intervals using five mm platinum tweezers

electrodes (CUY650P5, Sonidel, Ireland) and an ECM-830 BTX square wave electroporator

(VWR International). The uterine horns were then replaced in the abdominal cavity and the

  12  

abdomen wall and skin were sutured using surgical needle and thread. The pregnant mouse

was injected with buprenorphine (Temgesic®, Schering-Plough, Brussels, Belgium) and

warmed on heating pad until it woke up. The whole procedure was complete within 45

minutes. Several days following surgery, pregnant mice were sacrificed by neck dislocation

and embryos were processed for tissue analyses to study radial migration.

Focal electroporation. Brains from E14 mouse embryos were  dissected and transferred into

liquid 3% low-melting agarose (38 °C, BioRad) and incubated on ice for 1 hour.  Embedded

brains were cut coronally (300 µm) with a vibratome (VT1000S, Leica). All steps were

performed at 4 °C. Slices  were then subjected to ex vivo electroporation with pNeuroD-IRES-

GFP (3 µg/µl), pNeuroD-Cre-IRES-GFP (3 µg/µl) and miRIDIAN microRNA Mimics

(Thermo Scientific, Lafayette, CO, USA) or antagomiRs of cel-miR-67 (negative control

miRNA), miR-22, miR-185 or miR-124 (5µM). After cutting, brain slices were transferred

onto 1% low-melting agarose placed onto a petridish square platinum plate electrode

(Nepagene). We injected plasmid DNA solution with 0.05% Fast Green (Sigma, St. Louis,

MO) into the intermediate zone of brain slices using a pulled glass micropipette and a

microinjector (Femtojet, Eppendorf). Electroporations were performed by placing a cover

square platinum plate electrode (Nepagene) onto the microinjected region. Square electric

pulses (100 V, 5 ms) were injected five times at one second intervals using an electroporator

(ECM 830, BTX). Micropipettes and electrodes were guided using a micromanipulator (WPI)

under a stereomicroscope (Stemi DV4, Carl Zeiss). Following electroporation, slices were

transferred onto Matrigel (BD bioscience, USA) and cultured for three days in semi-dry

conditions in a humidified incubator at 37 °C in a 5% CO2 atmosphere in wells containing

Neurobasal medium supplemented with 1% B27, 1% N2, and 1% penicillin/streptomycin.

Ex vivo electroporation.  They were performed as described previously (Nguyen et al., 2006) with minor

modifications. Briefly, NMRI mouse embryos (E14) were decapited and heads were placed in

PBS glucose, NeuroD Sponge SCR (SPG miR-SCR) (4µg/µl) + Kif1A myc (0.5µg/µl) (Tsai

et al., 2010), NeuroD sponge 124 (SPG miR-124) (2µg/µl) + NeuroD sponge 22 (SPG miR-

22) (2µg/µl) + Kif1A myc (0.5µg/µl) with 0.05% Fast Green (Sigma, St. Louis, MO) were

injected into lateral ventricles using a pulled glass micropipette and a microinjector (Femtojet,

Eppendorf). Electroporation experiments were carried out by placing heads between tweezer-

type electrodes (BTX). Five electrical pulses were applied at 35V (50 ms duration) across the

uterine wall at 1 second intervals using five mm platinum tweezers electrodes (CUY650P5,

Sonidel, Ireland) and an ECM-830 BTX square wave electroporator (VWR International).

Electroporated region were further dissected into OPTIMEM Glucose medium and then the

  13  

tissue was mechanically dissociated to obtain a single cell suspension. Neurons were cultured

(300000 cells par 24 wells) on polyD lysine (40µg/ml; Sigma) and laminin (6µg/ml; Sigma)

coated coverslips during five days.

Time-lapse imaging

For slice culture, brains from E16 electroporated embryos from Dicerlox/lox or NMRI mice

were embedded in 3% agarose and sliced (300 µm) with a vibratome (VT1000S, Leica,

Wetzlar, Germany). Brain slices were cultured up to 24 hours in semi-dry conditions

(Millicell inserts, Merck Millipore), in a humidified incubator at 37 °C in a 5% CO2

atmosphere in wells containing Neurobasal medium supplemented with 1% B27, 1% N2, and

1% penicillin/streptomycin (Gibco, Life Technologies, Ghent, Belgium).

Slice cultures were placed in a humidified and thermo-regulated chamber maintained at 37°C

on the stage of an inverted confocal microscope. Time-lapse confocal microscopy was

performed with a Nikon A1 Eclipse Ti laser scanning confocal microscope. Images were

taken with a 40X objective and 25 successive “z” optical plans spanning 50 µm every 30

minutes during 10 hours. Sequences were analyzed using Image J.

Fluorescence Activated Cell Sorting (FACS)

Pregnant dam were sacrificed three days after in utero electroporation by neck dislocation.

Embryo brains were harvested and the electroporated regions (green) were dissected under a

GFP-microscope. Dissected tissue from four to five embryos were pooled and placed at 37°C

for 20 minutes into a papaïne and DNAse 0.01% containing solution (Worthington, NJ,

USA). After adding ovomucoide inhibitor and DMEM/10% fetal bovine serum, the tissue was

triturated to obtain a single cell suspension. The solution was filtered through 40 µm filter

(BD biosciences, San Jose,CA). The cell suspension was spun at 500g for 5 minutes at 4°C in

a microcentrifuge. The supernatant was removed and replaced with cold PBS into 5 mL tubes

for FACS using a BD biosciences FACsVantage SE cell sorter (San Jose, CA). A non-GFP

positive embryo was used as control to set up backround florescence level. Collection

windows were set based on GFP cell counts. The purity of the sorts for the GFP using the

established windowing level was 98%. The FACs sorting yielded ~100.000 GFP-expressing

cells for each sample.

  14  

Quantitative RT-PCR

Quantification of RNAs. Four to five cortices were pooled for FACS and total RNA extraction

was perform using the Qiagen RNA micro kit (Qiagen, Valencia, CA). All RNA samples

were then subjected to treatment with DNaseI (Roche Diagnostics) at RT for 15 minutes.

Synthesis of cDNA was performed starting with total RNA, which was reverse-transcribed

with SuperScript II or III Reverse Transcriptase (Invitrogen) according to the manufacturer’s

instructions. This process was also performed without reverse transcriptase to confirm the

absence of contaminating genomic DNA in all samples. The resulting cDNA was used for

quantitative PCR with the Faststart Universal SYBR Green Master (Roche Diagnostics).

Thermal cycling was performed on an Applied Biosystems 7900HT Fast Real-Time PCR

detection system (Applied Biosystems, Foster City, CA, USA). Optimal annealing

temperature for the primers was determined to be 60°C (40 cycles). The quantity of each type

of mRNA transcript was measured and expressed relative to glyceraldehyde 3-phosphate

dehydrogenase (GAPDH). The following primers were designed with Primer3 software

(Rozen and Skaletsky, 2000). Rnd2, Fwd CTACACTGCCAGCTTCGAGA, Rev

GAGGCCGGACATTGTCATAG; MeCP2, Fwd GCCGATCTGCTGGAAAGTAT, Rev

CCCACCTTTTCAAAGTATGC; Sin3a, Fwd TCCTTGACATCATGAAGGAATTT, Rev

GGGTGGCCTTTAAATAGCTG; Stathmin-2, Fwd CACTGATCTGCTCCTGCTTCT, Rev

CACTGATCTGCTCCTGCTTCT; COUP-TF1, Fwd CCTCAAAGCCATCGTGCTAT, Rev

TGATTTCTCCTGCAGGCTTT; Dcx, Fwd TGCTTGTGGTCCTGAAAAATTCCGC, Rev

AGCTGCGGCAGATGGATTCCC; Dicer, Fwd GAACGAAATGCAAGGAATGGA Rev

GGGACTTCGATATCCTCTTCTTTCTC; REST, Fwd

CACACAGGAGAACGCCCGTATAAA, Rev CGCATGTGTCGCGTTAGATGAGT;

CoREST, Fwd CGGAGTGCAAGCCTGAGAGCC Rev GGTTGGGGGACCACACCAGC;

Foxp2, Fwd ATCCTGGAAAGCAAGCAAAA, Rev GCTGCTGGAAGACGAGCTG;

Filamin A, Fwd ACTGTTGGCCAAGCCTGTAA, Rev TTGAAGTCGGCTGTTTCCTT;

Neuropilin-1, Fwd CATGATCAACTTCAACCCACA, Rev

TCTCCCCATCGATTACTTCC.

Quantification of miRNAs. Reverse transcriptase reactions were performed using TaqMan

MicroRNA Reverse Transcription kit (Applied Biosystem, Foster City, CA, USA) as

described previously (Chen et al., 2005). Real-time PCRs were performed using a standard

TaqMan PCR kit protocol on a 7900HT Sequence Detection System (Applied Biosystems,

Foster City, CA, USA). The 20 µl PCR mix included 0.67 µl RT product, 1× TaqMan

  15  

Universal PCR Master Mix (Applied Biosystems, Foster City, CA, USA), 0.2 µM TaqMan

probe. The reactions were incubated in a 384-well plate at 95°C for 10 minutes, followed by

40 cycles of 95°C for 15 seconds and 60°C for 1 minute. All reactions were run in triplicate.

The threshold cycle (CT) was defined as the fractional cycle number at which the fluorescence

passes the fixed threshold. TaqMan CT values were converted into absolute copy numbers

using a standard curve from U6 snRNA.

Microarrays

miRNA microarrays. Small RNAs were extracted from cortices dissected from E12.5 to E18.5

wild-type embryos. Three animals were tested for each genotype. RNA extraction was

performed using mirVana™ miRNA Isolation Kit (Ambion, USA) according to the

manufacturer’s instructions. These samples were outsourced (Febit, Germany) for microarray

processing and analysis. Each array contained the reverse complements of all major mature

miRNAs and the mature sequences published in the recent Sanger miRBase release (version

10.1, December 2007) from mouse.

mRNA microarrays. Cortices dissected from E12.5 FoxG1Cre/+; Dicerlox/lox and

FoxG1+/+;Dicerloxlox embryos were preserved in RNAlater (Ambion, USA). Samples were

outsourced to Miltenyi Biotech (Leiden, The Nederlands) for mRNA microarray processing

and analysis (see also appendix1).

Western blot

N2A cells were cultured in six-well plate and transfected with scramble or shCoREST

expressing plasmids (Fuentes et al., 2012) using with Lipofectamine 2000 (Invitrogen, USA).

After 72 hours in culture, cells were washed twice with cold PBS and incubated in a lysis

buffer (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 1% triton, 10 mM NaF, 1 mM Na3VO4 and

proteases inhibitors; Roche, Basel, Switzerland). Cortices from E14, E18 and P0 were

dissected and transferred in lysis buffer and proteins were extracted by centrifugation

(10000g) for 10 minutes at 4°C, separated by SDS-PAGE and transferred to 0.45 µm

Nitrocellulose membranes (Millipore, Billerica, USA). Membranes were blocked for 1 hour in

a solution containing non-fat milk then incubated with antibody anti-CoREST antibodies

(1:250, rabbit, Millipore, USA) O/N at 4°C. After rinses, secondary antibodies (HRP-

conjugated antibodies (anti-rabbit 1:10000, GE Healthcare, Waukesha, USA) were applied

during one hour at RT Membranes were developed with the ECL chemiluminescent reagent

(Thermo scientific, Rockford, USA) using Hyperfilm ECL (GE Healthcare, Waukesha, USA).

  16  

Chromatin immunoprecipitation

ChIP assays were essentially performed as described previously (Close et al., 2006) by using

anti-REST and anti-CoREST antibodies (Millipore, USA), or IgG antibody as negative

control. Extracts from E17 or Dicer CKO cortices were precleared by 1 h incubation with

protein A or G/Herring sperm DNA, and immunoprecipitation was performed by incubating

overnight at 4°C with the relevant antibody and then 1 hr with protein A or G/Herring sperm

DNA. Protein-DNA complexes were washed as per standard ChlP techniques. After elution,

proteinase K treatment, and reversal of crosslinks, DNA fragments were analyzed by real time

PCR with SYBr Green detection. Input DNA was analyzed simultaneously and used for

normalization. For the histone-related ChIP, modifed-histone-specific ChIP values were

normalized according to the total H3 signal. Anti-H3 anti-H3 acetyl-K9 and anti-H3 tri-

methyl-K4 were from Abcam. The following primers were used to study the DCX gene: DCX

RE1 Forward: 5’- gatccctagctcttaggtaaatacacac - 3’, Reverse: 5’- agctcatggagctaatgaccaccc -

3’ ; DCX negative Forward: 5’- gacccaaggctagcaaagac -3’, Reverse: 5’- cctgcactttcttggtcgta -

3’; DCX -1000 Forward: 5’- ttcccaatctttaaaacacacttc -3’, Reverse: 5’- aaaagggaaagcagcaccta -

3’ ; DCX TATA Forward: 5’- ggcagaaggttttagccaag -3’, Reverse: 5’- ggaaattgcagggtaggaaa -

3’.

Supplementary movies

Movie S1: mutlipolar to bipolar morpholgy transition of electroported neurons with NeuroD-

GFP (left) or NeuroD-Cre-GFP (right).

Movies S2: stability of bipolar morphlogy of electroported neurons with NeuroD-GFP (left) or

NeuroD-Cre-GFP (right).

Supplementary table

Table S1 : Statistical analyses.

  17  

Supplemental References

Chen,  C.,  Ridzon,  D.A.,  Broomer,  A.J.,  Zhou,  Z.,  Lee,  D.H.,  Nguyen,  J.T.,  Barbisin,  M.,  Xu,  N.L.,  

Mahuvakar,  V.R.,  Andersen,  M.R.,  et  al.  (2005).  Real-­‐time  quantification  of  microRNAs  by  

stem-­‐loop  RT-­‐PCR.  Nucleic  Acids  Res  33,  e179.  

Close,   P.,   Hawkes,   N.,   Cornez,   I.,   Creppe,   C.,   Lambert,   C.A.,   Rogister,   B.,   Siebenlist,   U.,  

Merville,  M.P.,  Slaugenhaupt,  S.A.,  Bours,  V.,  et  al.  (2006).  Transcription  impairment  and  

cell  migration  defects  in  elongator-­‐depleted  cells:  implication  for  familial  dysautonomia.  

Mol  Cell  22,  521-­‐531.  

Creppe,  C.,  Malinouskaya,  L.,  Volvert,  M.L.,  Close,  P.,  Laguesse,  S.,  Gillard,  M.,  Chariot,  A.,  

and  Nguyen,  L.  (2010).  [Elongator  orchestrates  cerebral  cortical  neurogenesis].  Med  Sci  

(Paris)  26,  135-­‐137.  

De  Pietri  Tonelli,  D.,  Pulvers,  J.N.,  Haffner,  C.,  Murchison,  E.P.,  Hannon,  G.J.,  and  Huttner,  

W.B.  (2008).  miRNAs  are  essential  for  survival  and  differentiation  of  newborn  neurons  

but   not   for   expansion   of   neural   progenitors   during   early   neurogenesis   in   the   mouse  

embryonic  neocortex.  Development  135,  3911-­‐3921.  

Fuentes,  P.,  Canovas,  J.,  Berndt,  F.A.,  Noctor,  S.C.,  and  Kukuljan,  M.  (2012).  CoREST/LSD1  

control  the  development  of  pyramidal  cortical  neurons.  Cereb  Cortex  22,  1431-­‐1441.  

Nguyen,   L.,   Besson,   A.,   Heng,   J.I.,   Schuurmans,   C.,   Teboul,   L.,   Parras,   C.,   Philpott,   A.,  

Roberts,   J.M.,   and   Guillemot,   F.   (2006).   p27kip1   independently   promotes   neuronal  

differentiation  and  migration  in  the  cerebral  cortex.  Genes  Dev  20,  1511-­‐1524.  

Rozen,   S.,   and   Skaletsky,   H.   (2000).   Primer3   on   the  WWW   for   general   users   and   for  

biologist  programmers.  Methods  Mol  Biol  132,  365-­‐386.  

Tsai,   J.W.,   Lian,  W.N.,  Kemal,   S.,  Kriegstein,  A.R.,   and  Vallee,  R.B.   (2010).  Kinesin  3  and  

cytoplasmic  dynein  mediate  interkinetic  nuclear  migration  in  neural  stem  cells.  Nature  

Neuroscience  13,  1463-­‐U1443.  

Wang,  X.,  Tsai,   J.W.,   Imai,   J.H.,  Lian,  W.N.,  Vallee,  R.B.,  and  Shi,  S.H.   (2009).  Asymmetric  

centrosome  inheritance  maintains  neural  progenitors  in  the  neocortex.  Nature  461,  947-­‐

955.