supplemental information hematogenous metastasis of ovarian

21
Cancer Cell, Volume 26 Supplemental Information Hematogenous Metastasis of Ovarian Cancer: Rethinking Mode of Spread Sunila Pradeep, Seung W. Kim, Sherry Y. Wu, Masato Nishimura, Pradeep Chaluvally- Raghavan, Takahito Miyake, Chad V. Pecot, Sun-Jin Kim, Hyun Jin Choi, Farideh Z. Bischoff, Julie Ann Mayer, Li Huang, Alpa M. Nick, Carolyn S. Hall, Cristian Rodriguez- Aguayo, Behrouz Zand, Heather J. Dalton, Thiruvengadam Arumugam, Ho Jeong Lee, Hee Dong Han, Min Soon Cho, Rajesha Rupaimoole, Lingegowda S. Mangala, Vasudha Sehgal, Sang Cheul Oh, Jinsong Liu, Ju-Seog Lee, Robert L. Coleman, Prahlad Ram, Gabriel Lopez-Berestein, Isaiah J. Fidler, and Anil K. Sood

Upload: trinhcong

Post on 13-Feb-2017

221 views

Category:

Documents


1 download

TRANSCRIPT

Page 1: Supplemental Information Hematogenous Metastasis of Ovarian

Cancer Cell, Volume 26

Supplemental Information

Hematogenous Metastasis of Ovarian Cancer:

Rethinking Mode of Spread

Sunila Pradeep, Seung W. Kim, Sherry Y. Wu, Masato Nishimura, Pradeep Chaluvally-Raghavan, Takahito Miyake, Chad V. Pecot, Sun-Jin Kim, Hyun Jin Choi, Farideh Z. Bischoff, Julie Ann Mayer, Li Huang, Alpa M. Nick, Carolyn S. Hall, Cristian Rodriguez-Aguayo, Behrouz Zand, Heather J. Dalton, Thiruvengadam Arumugam, Ho Jeong Lee, Hee Dong Han, Min Soon Cho, Rajesha Rupaimoole, Lingegowda S. Mangala, Vasudha Sehgal, Sang Cheul Oh, Jinsong Liu, Ju-Seog Lee, Robert L. Coleman, Prahlad Ram, Gabriel Lopez-Berestein, Isaiah J. Fidler, and Anil K. Sood

Page 2: Supplemental Information Hematogenous Metastasis of Ovarian

SUPPLEMENTAL DATA

Figure S1, related to Figure 1. Parabiosis model with hematogenous

metastasis of ovarian cancer. (A) Host parabionts injected with SKOV3ip1 cells

into the peritoneal cavity were separated after 35 days. (B) The guest mice were

dissected after 75 days and found to have tumor in the omentum. (C) Omental tumor

formed in guest mice after intraovarian injection of SKOV3-OM3 cells in the host

mice (D) Metastatic colonies in indicated organs on day 25. Scale bars represent 50

µm. (E) Following intra-cardiac injection of SKOV3-OM3 cells, tumor was detected in

the omentum. (F) Guest murine C57BL/6 parabionts with IG10-induced ascites due

to tumor burden. (G) Guest parabiont with omental tumor.

Page 3: Supplemental Information Hematogenous Metastasis of Ovarian

Table S1, related to Figure 1

Organs Host Guest Omentum 15/15 8/15 Mesentery 15/15 7/15

Porta hepatic 12/15 6/15 Spleen 8/15 3/15

Diaphragm 5/15 2/15 Peritoneum 5/15 3/15

Liver 6/15 2/15

Number of tumor bearing mice with metastases in the indicated organs of parabiosis

mice.

Page 4: Supplemental Information Hematogenous Metastasis of Ovarian
Page 5: Supplemental Information Hematogenous Metastasis of Ovarian

Figure S2, related to Figure 2. ErbB3 axis underlies omental metastasis in

ovarian cancer. (A) Gene expression analysis between SKOV3ip1 and SKOV3-

OM3 cells. The 1.5-fold cutoff includes the top 2.45% of all altered genes and all

genes meeting this cutoff have highly significant p-values. (B) Histogram of all gene

fold-change values. (C) Heat map shows normalized gene expression levels

obtained from the microarray data of ovarian cancer cell lines, SKOV3ip1 and

SKOV3-OM3. (D) Netwalk analysis of gene expression between SKOV3ip1 and

SKOV3-OM3 cells. Relative mRNA expression of (E) EGFR, (F) ERBB2, (G) ERBB3,

and (H) ERBB4 in SKOV3ip1 and SKOV3-OM3 cells in the presence or absence of

NRG1 stimulation. Relative expression of (I) EGFR, (J) ERBB2, (K) and ERBB3 in

IG10 and IG10-OM2 cells after NRG1 stimulation. (L) Cell lysates from 4-day 3DlrBM

cultures were analyzed for phosphorylated (Y1289) and total ErbB3 via Western

blotting. (M) Serum-starved SKOV3ip1 and SKOV3-OM3 cells were treated with

Page 6: Supplemental Information Hematogenous Metastasis of Ovarian

αErbB3 (10 μg/mL) or left untreated. Expression of total and phosphorylated proteins

was determined using Western blotting with the indicated antibodies. Mean ± SEM

values are shown. **p < 0.01; ***p <0.001.

Page 7: Supplemental Information Hematogenous Metastasis of Ovarian

Table S2, related to Figure 2. (Provided as an Excel file)

Complete gene array of SKOV3ip1 and SKOV3-OM3 cells.

Page 8: Supplemental Information Hematogenous Metastasis of Ovarian

Figure S3, related to Figure 3. EMT features in SKOV3-OM3 cells. (A) E-Cadherin

and vimentin expression on SKOV3ip1 and SKOV-OM3 cells. (B) Integrated density

of vimentin expression was plotted from immunoblot. (C) SKOV3ip1 and SKOV3-

OM3 cells were left untreated (control) or exposed to NRG1 (50 ng/mL) alone or in

combination with ErbB3 antibody (10 µg/mL) or PI3K inhibitor (LY29004 µg/mL) and

then processed for indirect immunofluorescence to detect membrane-bound E-

cadherin (C) and vimentin (D) levels. Scale bar represents 50 µm. (E) Total CTCs in

host and guest mice in the SKOV3-OM3 parabiosis model. (F) CTCs were isolated

from 9 patients with ovarian cancer, and their ErbB3 expression was analyzed via

immunofluorescence. Scale bar represents 100 µm. Mean ± SEM values are shown.

***p <0.0001.

Page 9: Supplemental Information Hematogenous Metastasis of Ovarian

Table S3, related to Figure 3

Tumor model

CK-/ErbB3+

CK+/ErbB3+

SKOV3ip1

3 0 3 0 8 4

11 0 SKOV3-OM3

68 32 133 31 233 57 46 113

Number of CK-\ErbB3+ and CK+\ErbB3+ circulating tumor cells were detected in blood

samples collected from SKOV3ip1 and SKOV3-OM3 in vivo models.

Page 10: Supplemental Information Hematogenous Metastasis of Ovarian

Table S4, related to Figure 3

Summary of clinical analysis for ErbB3 expression in 217 ovarian cancer patients.

Variable Low High p values Age mean (range;

years) 59.6 (31-92)

Stage Low (I and II) 18 5

0.003 High (III-IV) 88 106

Grade Low 3 1

0.29 High 103 110

Histology Serous 75 90

0.07 Other 31 21

Page 11: Supplemental Information Hematogenous Metastasis of Ovarian
Page 12: Supplemental Information Hematogenous Metastasis of Ovarian

Figure S4, related to Figure 4. ErbB3 knockdown inhibits tumor growth. ERBB3

mRNA (A) and protein (B) expression following transfection of SKOV3-OM3 cells

with human ErbB3 siRNA sequences. siErbB3 #2 showed the greatest knock down.

ERBB3 mRNA (C) and protein (D) expression following transfection of IG10-OM2

cells with murine ErbB3 siRNA sequences. (E) C57BL/6 mice that received IG10-

OM2 cells via intra-cardiac injection were randomly allocated into two groups (control

siRNA-DOPC or ErbB3 siRNA-DOPC). Representative images of extent of

metastatic spread in control vs. ErbB3 siRNA-DOPC treated mice. Metastatic areas

are outlined with dotted white lines. (F) Bar graph represents the percent of animals

in each study arm with metastases to intraperitoneal and distant organ sites. (G)

Mice were treated with human ErbB3 siRNA-DOPC after SKOV3-OM3 cell injection

into the heart. Aggregate tumor weight is plotted after four weeks of treatment. (H)

Percentage of mice with metastases in organs. (I) Mice were treated with murine

ErbB3 siRNA-DOPC after IG10-OM2 cell injection into the heart. Tumor weight is

plotted after 7 weeks of treatment. (J) Percentage of mice with metastases in

indicated organs were plotted. Mean ± SEM values are shown. *p < 0.05.

Page 13: Supplemental Information Hematogenous Metastasis of Ovarian

Figure S5, related to Figure 5. Functional role of ErBb3/NRG1 axis on

hematogenous metastasis. OVCA432 cells were injected into the heart and mice

were treated with control or ErbB3 siRNA-DOPC. Tumor weight (A) and pattern of

metastases was plotted. (B) Percentage of metastases in distant organs in host and

guest mice was plotted. Nude mice were injected with HCT116 or SW620 cells into

the heart and mice were treated with control or ErbB3 siRNA-DOPC. (C) Tumor

weight and (D) pattern of metastases was plotted after five weeks of treatment. (E)

Tumor weight after SW620 cell injection and (F) pattern of metastases was plotted

after five weeks. Mean ± SEM values are shown. *p < 0.05; **p < 0.01.

Page 14: Supplemental Information Hematogenous Metastasis of Ovarian

Figure S6, related to Figure 6. Ectopic ErbB3 expression in ErbB3-negative

cells confers potential for hematogenous metastasis. (A) ERBB3 expression in

different ovarian cancer cell lines (HIO180 is a non-transformed cell line). (B) ERBB3

expression in pCDH-ErbB3 transfected cells was determined using qRT-PCR. (C)

Nude mice were given intra-cardiac injection of HeyA8-ErbB3 or HeyA8-Ev

transfected cells. The average number of tumor nodules and tumor weight is shown.

(D) H&E staining of omental sections. (Scale bar represents 200 μm). Mean ± SEM

values are shown. **p < 0.01.

Page 15: Supplemental Information Hematogenous Metastasis of Ovarian
Page 16: Supplemental Information Hematogenous Metastasis of Ovarian

Figure S7, related to Figure 7. ErbB3/NRG1 signaling enhances omental

metastasis. Tumors harvested after 4 weeks of therapy were subjected to

immunohistochemistry for markers of (A) proliferation (Ki67); and apoptosis

(Cl.casp3). Five random fields per slide were examined, and the average number of

Ki67+ cells and apoptotic bodies are shown in the adjacent graph. Scale bar

represents 50 µm. (B) NRG1 mRNA expression levels in indicated normal human

samples. (C) NRG1 levels were assessed by qRT-PCR in human normal omentum

and peripheral fat. (D) NRG1 levels were assessed via ELISA in human normal

omentum and peripheral fat. Error bars represent standard error. (E) NRG1 mRNA

Page 17: Supplemental Information Hematogenous Metastasis of Ovarian

levels were determined via real-time qRT-PCR in normal omentum and tumor

omentum from patients. (F) CD31 and NRG1 staining of sections from human normal

omentum and peripheral adipocytes. Scale bar represents 100 µm. (G) Non-specific

mouse and rabbit immunoglobulin antibodies were used as controls for CD31 and

NRG1 staining, respectively (the actual CD31 and NRG1 staining is shown in panel

H). (H) NRG1 and CD31 expression in human primary ovarian tumor samples

(representative images are shown here from a sample out of a total of 11 examined).

Prostate and pancreas tissue sections were used as positive and negative controls,

respectively. Scale bar represents 100 µm. (I) NRG1 expression in omental sections

after control siRNA-CH or NRG1 siRNA-CH treatment. Scale bar represents 100

µm. Mean ± SEM values are shown. Error bars indicate SEM. ***p <0.001.

Page 18: Supplemental Information Hematogenous Metastasis of Ovarian

SUPPLEMENTAL EXPERIMENTAL PROCEDURES

qRT-PCR analysis

Total RNA from both cell lines and tumor tissues was extracted using a Qiagen

RNeasy Kit (Qiagen). Using 1 μg of RNA, we synthesized cDNA using a Verso cDNA

kit (Thermo Scientific) followed by manufacturer's instructions. cDNA was subjected

to amplification by qRT-PCR using specific primer sequences (100 ng/μL). Each

sample was normalized on the basis of its 18S content as previously described (Yi et

al., 1997).

Protein analysis

Western blot analysis was performed as previously described (Landen et al., 2005).

Protein concentrations were determined using a BCA protein assay reagent kit

(Pierce). Densitometry was calculated using Image-J software.

Generation of HeyA8-ErbB3 cells

The cDNA of ErbB3 was extracted from a pDONR223 plasmid containing the ERBB3

Part1 (2371bp) sequence (Addgene).

ErbB3-NheI-1F: CTAGCTAGCGCCACCATGAGGGCGAACGACGCTCTGC;

ErbB3-NdeI-1R: GCAAATATTGAGTGACAAGCTG:

ErbB3 (Part2) (1912bp) ErbB3-NdeI-2F: GACAGAGCTAAGGAAGCTTAAAG;

ErbB3-SwaI-2R: CCCCCCATTTAAATTTACGTTCTCTGGGCATTAGC] primers.

To appropriately insert ErbB3 into the pCDH-CMV-MCS-EF1 lentiviral vector, we first

cloned the ErbB3 sequence into the PCR2.1 expression vector. The insert was then

cut and transferred into the pCDH-CMV-MCS-EF1-puro expression vector. The

inserted ErbB3 sequence was confirmed by sequencing. The lentivirus was then

produced by transfecting human embryonic kidney cells (293FT; Invitrogen) with the

sequence-verified pCDH vector containing the ErbB3 or an empty vector, the

Page 19: Supplemental Information Hematogenous Metastasis of Ovarian

packaging plasmid (MD2G), and the envelope plasmid (PAX2), which are required

for viral production. Three days later, the viral supernatant was collected and filtered

to remove cellular debris. HeyA8 cells were plated at 70% confluence in 6-well plates

and transduced with the virus. After 16 hr, the virus-containing medium was removed

and replaced with normal growth medium. Transduced cells were selected by

resistance to puromycin.

ELISA

NRG1 protein levels in the human tissues were quantified via ELISA using the

Quantikine immunoassay kit (R&D Systems) according to the manufacturer's

protocol. Briefly, punched pieces of the tissues were homogenized using a mortar

and pestle cooled by liquid nitrogen. The tissue homogenates were then incubated

overnight in 0.5 mL of 50 mM Tris-HCl buffer (pH = 7.5) containing 2 mM ATP, 5 mM

MgCl2, 1 mM dithiothreitol, 1 mM EDTA, and 100 mM NaCl. The homogenates were

centrifuged at 10,000×g for 30 min at 4 °C. Protein concentration in homogenate

extracts was determined using a BCA protein assay reagent kit. NRG1 protein levels

were expressed as pg per mg total protein. Samples were assayed in duplicate, and

data represent the mean fold induction over triplicate experiments.

Immunostaining

Staining was performed on formalin-fixed, paraffin-embedded 8-μm thick tumor

sections or OCT-embedded frozen tissue sections. After deparaffinization,

rehydration, and antigen retrieval or fixation, 3% H2O2 was used to block

endogenous peroxidase activity for 10 minutes. Protein blocking of non-specific

epitopes was done using either 5% normal horse serum, 1% normal goat serum, or

2.8% fish gelatin in either PBS or TBS-T for 20 minutes. Slides were incubated with

primary antibody for ErbB3 (Thermo Scientific, 1:100), NRG1 (Santa Cruz, 1:100), E-

cadherin (BD Transduction Laboratories, 1:50), vimentin (Cell Signaling, 1:50), CK

Page 20: Supplemental Information Hematogenous Metastasis of Ovarian

wide (Dako,1:100), CD-31 (Pharmingen, 1:800 for mouse tissue; Dako, 1:200 for

human tissue), Ki67 (Abcam, 1:200), or cleaved caspase 3 (BioCare Medical, 1:100)

overnight at 4 ºC. For immunohistochemistry, after primary antibody was washed

with PBS, the appropriate amount of horseradish peroxidase-conjugated secondary

antibody was added and visualized with 3,3’-diaminobenzidine chromogen and

counterstained with Gill’s hematoxylin #3. For immunofluorescence, secondary

antibody staining was performed with either Alexa 594 (Molecular Probes) or DyLight

(Jackson ImmunoResearch). Nuclear staining was performed with Hoechst 33342

(1:10,000; Molecular Probe H3570). Light field images were obtained using a Nikon

Microphot FXA microscope and Leica DFC320 digital camera, and

immunofluorescent images were obtained using a Zeiss Axioplan 2 microscope and

Hamamatsu ORCA-ER digital camera. To quantify microvessel density, we

examined 5-10 random fields at 100x magnification for each tumor (5 tumors per

group) and counted the microvessels within those fields as previously described

(Zhang et al., 2012). A vessel was defined as an open lumen with at least one

adjacent CD31-positive cell. Multiple positive cells beside a single lumen were

counted as one vessel. Quantification was performed by two investigators in a

blinded fashion. Proliferation indices were determined using Cell Profiler 2.0 from

three representative fields at 200x magnification for each tumor (5 tumors per group).

All Ki67 positive cells per high-powered field were enumerated (Kang et al., 2013; Lu

et al., 2010).

Tissue microarray

Patient tissue microarray blocks were constructed by taking core samples from

morphologically representative areas of paraffin-embedded tissues and assembling

them on a recipient paraffin block with a precision instrument (Beecher Instruments)

as described previously (Merritt et al., 2008).

Page 21: Supplemental Information Hematogenous Metastasis of Ovarian

Tumor-Cell Growth in soft agar

Agar assays were performed as described previously (Li et al., 1989). In brief, 1 mL

of RPMI containing 10% FBS and 0.6% agar or RPMI serum-free and 0.6% agar was

plated into individual wells of six-well plates (BD Biosciences, San Jose, CA). HeyA8-

ErbB3 cells were harvested via brief exposure to a solution containing 0.25%

trypsin/0.02% EDTA (v/v) and then suspended in RPMI containing 10% FBS or

serum-free. Over this bottom layer, we laid a second layer of medium containing

agarose and suspension of single tumor cells. The concentration of the top-layer

agarose was 0.4%. This cell-containing mixture was then pipetted gently over the

bottom layer of agar in the wells. Cells were seeded at a density of 5 × 103 cells/well

in 1 mL of RPMI containing 10% FBS or serum-free. After the top layer (with

suspended tumor cells) gelled, we added 1 mL of medium with or without NRG1.

One milliliter of media was periodically added to the wells to keep the agar surface

hydrated. Colonies were stained and the diameters of tumor colonies were calculated

when they became visible.

SUPPLEMENTAL REFERENCES

Kang, Y., Hu, W., Ivan, C., Dalton, H. J., Miyake, T., Pecot, C. V., Zand, B., Liu, T., Huang, J., Jennings, N. B., et al. (2013). Role of focal adhesion kinase in regulating YB-1-mediated paclitaxel resistance in ovarian cancer. J Natl Cancer Inst 105, 1485-1495.

Li, L., Price, J. E., Fan, D., Zhang, R. D., Bucana, C. D., and Fidler, I. J. (1989). Correlation of growth capacity of human tumor cells in hard agarose with their in vivo proliferative capacity at specific metastatic sites. J Natl Cancer Inst 81, 1406-1412.

Yi, E. S., Harclerode, D., Gondo, M., Stephenson, M., Brown, R. W., Younes, M., and Cagle, P. T. (1997). High c-erbB-3 protein expression is associated with shorter survival in advanced non-small cell lung carcinomas. Mod Pathol 10, 142-148.

Zhang, J., Guo, X., Chang, D. Y., Rosen, D. G., Mercado-Uribe, I., and Liu, J. (2012). CD133 expression associated with poor prognosis in ovarian cancer. Mod Pathol 25, 456-464.