Chemistry & Biology, Volume 22

Supplemental Information

Combined Mitigation of the Gastrointestinal and

Hematopoietic Acute Radiation Syndromes

by an LPA2 Receptor-Specific Nonlipid Agonist

Renukadevi Patil, Erzsébet Szabó, James I. Fells, Andrea Balogh, Keng G. Lim, Yuko Fujiwara,Derek D. Norman, Sue-Chin Lee, Louisa Balazs, Fridtjof Thomas, Shivaputra Patil,Karin Emmons-Thompson, Alyssa Boler, Jur Strobos, Shannon W. McCool, C. Ryan Yates,Jennifer Stabenow, Gerrald I. Byrne, Duane D. Miller, and Gábor J. Tigyi

1

Supplementary Material to “Protection Against the Gastrointestinal and Hematopoietic

Acute Radiation Syndromes by a Novel LPA2 Receptor-specific

Non-lipid Agonist”

By Renukadevi Patil, Erzsebet Szabo, et al.

Supplemental Figure 1. DBIBB attenuates Adriamycin-induced DNA fragmentation in LPA2 MEFs (related to Fig.2 in the main paper).

DBIBB or LPA was applied to the cells 1 h before exposure to 1.7 µM Adriamycin. DNA

fragmentation (mean ± SD, n=3) was measured 5 h later. In LPA2 MEFs but not vector-

transduced DKO MEFs, these compounds similarly to LPA significantly reduced DNA

fragmentation relative to vehicle-treated cells. ***p < 0.001 using Student’s t-test relative to

vehicle.

2

Supplemental Figure 2. Effective shielding of the tibial bone marrow in the PBI model

(related to the Partial body irradiation model in the main text).

This representative H&E-stained section of a decalcified tibia and femur from an irradiated

mouse shows well-preserved bone marrow in the tibia, whereas a complete ablation of

hematopoiesis is seen in the femur.

Tibia Femur

Position of the shield

3

Supplemental Figure 3. The time course of crypt count and TUNEL-positive apoptotic

cells in jejunum sections of C57BL/6 mice irradiated with 15.69 Gy γ-irradiation (related to

the PBI-BM5 irradiation model in the main text).

Mice were culled on postirradiation days 1, 5, 10, and 20; and the jejunum was dissected and

processed for either H&E staining or TUNEL staining. Three sections taken at different

positions of the jejunum were evaluated for every animal, and the number of crypts containing

more than 10 surviving nuclei (mean count ± SD, n ≥ 6) were counted on H&E-stained sections

by three evaluators blinded to the treatment. TUNEL-stained slides were processed using an

Aperio ImageScope slide digitizer (version 11.1.2), and positive nuclei were counted with the

Nuclear Quantification algorithm (version 9). The symbol X represents the positive nuclei from

individual sham-irradiated control animals, and symbol Δ represents counts from irradiated mice.

Note that the nadir of crypt count/circumference was reached on postirradiation day 5, which

also coincided with the peak of TUNEL-positive nuclei. For this reason, the effects of DBIBB on

crypt count, Ki67 proliferative cell count, and TUNEL-positive nuclei were tested on

postirradiation day 5.

4

Supplemental Figure 4. Effect of DBIBB treatment on Lim-c-Kit-Sca-1 hematopoietic stem cells in the tibial bone marrow of C57BL/6 mice exposed to PBI-BM5 irradiation (related to Fig.5 in the main text).

For flow cytometric analysis of hematopoietic stem cells, bone marrow cells were harvested

from tibiae of irradiated mice treated with DBIBB (10 µg/kg daily) or vehicle four days after

irradiation. After depleting bone marrow nuclear cells of red blood cells through lyses in ACK

buffer, the cell suspension was washed in PBS and stained for dead cell exclusion with Fixable

Viability Dye eFluor 450R (Ebioscience, San Diego, CA). Subsequently cells were stained with

FITC-conjugated antibody cocktail against multilineage (Lin), APC-conjugated CD117 (c-Kit,

Biolegend Inc., San Diego CA) and PE -conjugated Ly-6A/E (Sca-1, Biolegend Inc.). Samples

were measured with LSR II instrument (Becton Dickinson Inc.). Lin-c-Kit+Sca-1+ cell population

(mean count ± SEM, n=3) was acquired within the living cell population and analyzed with the

FACSDiva software (Becton Dickinson Inc.).

5

Supplemental Figure 5. Quantitative PCR profile of LPA receptor subtypes in CD34+

human hematopoietic progenitor cells (related to Fig.5 in the main text).

Human umbilical cord blood-derived CD34+ cell RNA was isolated with the RNeasy Micro kit

(Qiagen) according to the manufacturer’s instructions. Five hundred nanograms of total RNA

were used for the subsequent synthesis of cDNA using the ThermoScript RT-PCR system for

first strand synthesis (Invitrogen) as recommended by the manufacturer. Quantitative PCR

reactions were performed using 0.8 µl of the cDNA mix with 300 nmol of each primer in a final

volume of 25 µl of 2 x RT2 Real-Time SYBR Green/ROX master mix (Qiagen). The primers

used in the reactions are listed in Supplemental Table 1. Amplification was performed for 40

cycles at 94 °C /15 s and 60 °C/60 s. Relative gene expression of each mRNA to GAPDH was

determined by using the dCt (mean ±SEM) method.

6

Supplemental Table 1. Primer sequences used for real-time quantitative PCR (related to

Fig.5 in the main text)

Experimental Procedures

Docking DBIBB into the LPA2 pharmacophore. Docking was performed on a computer with

an Intel Core 2 Duo 2.0 GHz processor using the Ubuntu 12.04 operating system with software

from Molecular Operating Environment (MOE), version 2011.10 (http://www.chemcomp.com

and Autodock Vina (Trott and Olson, 2010)). Pharmacophore analysis of the protein-ligand

complexes was performed using the protein ligand interaction fit function in MOE. Amino acids

in the transmembrane (TM) domains were assigned index positions (Ballesteros and Weinstein,

1995).

LPA receptor-mediated Ca2+ mobilization assay. Stable cell lines expressing the individual

LPA1, LPA2, LPA3, LPA4, and LPA5 established receptor subtypes or appropriate empty vector-

transfected controls have been previously generated and described (Patil, et al., 2014; Williams,

et al., 2009). LPA1/2/3 activation was tested in DKO MEF reconstituted with a single receptor

Gene Forward sequence (5’- 3’) Reverse sequence (5’- 3’)

GAPDH CTGCACCACCAACTGCTTAG   GGGCCATCCACAGTCTTCT  

LPA1 TGGCTGCCATCTCTACTTCC   GAAGGCAATGGACTCGTTGT  

LPA2 CAGCCTGGTCAAGACTGTTGT TGCAGGACTCACAGCCTAAA

LPA3 TTGTCTCCGCATACAAGTGG   GGGTCCAGCATACCACAAAC  

LPA4 TGTGCCTTGCAACTCTGAAC   TCTGATGTGGGCATTGATGT  

LPA5 TGTTAGCCAACAGCTCCTCA   CAGCACCAAGCTGTAGACCA  

7

subtype or, alternatively, in RH7777 cells stably transfected with the human receptor orthologs.

LPA4, LPA5, and S1P1 were tested respectively in CHO, B103, and HTC4 cells stably

expressing these receptors and compared to vector-transfected control cells. Assays for ligand-

activated mobilization of intracellular Ca2+ were performed using a Flex Station 2 robotic

fluorescent plate reader (Molecular Devices; Sunnyvale, CA) as previously described (Kiss, et

al., 2012). The appropriate concentrations of DBIBB was either added alone (for agonist

testing) or mixed with the respective ~EC50 concentration of LPA 18:1 for the LPA receptor

being tested (antagonist screen) were applied to the test cell lines. All samples were run in

quadruplicate. The half maximally effective concentration (EC50), and inhibitory constant (Ki)

values were calculated using the Prism 5 software (GraphPad Software, Inc., La Jolla, CA,

USA).

Cell culture and treatments. Mouse embryonic fibroblast (MEF) cells were isolated from

embryonic day 13.5 LPA1/2 double knockout (LPA2 DKO) mice embryos as described previously

(Lin, et al., 2007). These MEF cells lack LPA1/2/3 GPCR subtypes and show no Ca2+-

mobilization responses to LPA unless transfected with one of the LPA GPCR. The human LPA2

receptor was transduced into these MEF cells by LPA2-containing lentiviruses, selected with 1.5

µg/ml puromycin, and designated LPA2 MEFs. Empty vector-transduced MEF cells, designated

DKO MEFs, were used as a control in all experiments. Cells were maintained in complete

growth medium consisting of Dulbecco’s modified Eagle’s medium (DMEM) supplemented with

10% (v/v) fetal bovine serum (FBS), 2 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml

streptomycin. During serum starvation, the growth medium was replaced with DMEM

containing 0.1% (w/v) BSA. The rat intestinal epithelial cell line 6 (IEC-6) was purchased from

the American Type Culture Collection (ATCC; Rockville, MD) at passage 14 and was

8

maintained as described earlier (Deng, et al., 2002). The serum-starved medium contained 10

µg/ml insulin and DMEM without FBS.

CD34+ cord blood cells were recovered after thawing in StemSpam serum-free media for 3 h.

After recovery, cells were washed in serum-free Iscove's MDM (IMDM) and aliquoted in 400 µl

in serum-free IMDM (40,000 cells/ml). Cells were irradiated with 4 Gy. After irradiation, cells

were treated with 1 µM, 3 µM, or 10 µM DBIBB for either 2 or 4 h. Cells were plated 4,000

cells/plate/ml in triplicate in Methocult medium (STEMCELL Technologies Inc., Vancouver,

Canada). DBIBB was dissolved in dimethyl sulfoxide (DMSO), and the vehicle was DMSO.

Colonies were counted after 14 days of culture.

Lysophosphatidic acid (LPA) 18:1 was purchased from Avanti Polar lipids (Alabaster, AL).

Stock solutions of LPA (1 mM) were prepared in phosphate-buffered saline (PBS) with an

equimolar complex of charcoal-stripped, fatty acid-free bovine serum albumin (BSA; Sigma-

Aldrich; St Louis, MO). Stock solutions (10 mM) of the test compounds were prepared in DMSO.

Clonogenic Survival Assay. The effect of DBIBB on clonogenic survival after irradiation was

determined by the method of Saha et al. (Saha, et al., 2012) with modifications. Briefly, single

cell suspension of IEC-6 cells was plated at 200 cells/well on 6-well culture plates. Next day, the

complete growth medium was replaced with serum-free medium supplemented with 10 µg/ml of

insulin for 24 h hours pre-irradiation. Cells were irradiated with increasing doses of 137Cs γ-

irradiation (0, 2, 4, 6 Gy at 4.31 Gy/min). After irradiation the medium was removed and

replaced with fresh complete growth medium supplemented with 10 µM DBIBB or vehicle (3 µM

BSA + 0.1 % DMSO in PBS). Cells were treated with fresh DBIBB or vehicle daily on the first

three postirradiation days and allowed to grow in complete growth medium for five more days.

On postirradiation day eight the cells were fixed, stained with crystal violet, and the number of

colonies was counted. Surviving fractions for each treatment were determined by normalizing

9

the mean plating efficiency for each dose to the plating efficiency of the unirradiated control

plates using the following formula: Surviving fraction = (colonies counted/cell seeded x plating

efficiency)/100. Assays were performed in triplicates.

References

Deng, W., Balazs, L., Wang, D.A., Van Middlesworth, L., Tigyi, G., and Johnson, L.R. (2002). Lysophosphatidic acid protects and rescues intestinal epithelial cells from radiation- and chemotherapy-induced apoptosis. Gastroenterology 123, 206-216. Kamal, A., Ramu, R., Tekumalla, V., Khanna, G.B., Barkume, M.S., Juvekar, A.S., and Zingde, S.M. (2008). Remarkable DNA binding affinity and potential anticancer activity of pyrrolo[2,1-c][1,4]benzodiazepine-naphthalimide conjugates linked through piperazine side-armed alkane spacers. Bioorganic & medicinal chemistry 16, 7218-7224. Lin, F.T., Lai, Y.J., Makarova, N., Tigyi, G., and Lin, W.C. (2007). The lysophosphatidic acid 2 receptor mediates down-regulation of Siva-1 to promote cell survival. J Biol Chem 282, 37759-37769. Saha, S., Bhanja, P., Liu, L., Alfieri, A.A., Yu, D., Kandimalla, E.R., Agrawal, S., and Guha, C. (2012). TLR9 agonist protects mice from radiation-induced gastrointestinal syndrome. PLoS One 7, e29357. Tumiatti, V., Milelli, A., Minarini, A., Micco, M., Gasperi Campani, A., Roncuzzi, L., Baiocchi, D., Marinello, J., Capranico, G., Zini, M., et al. (2009). Design, synthesis, and biological evaluation of substituted naphthalene imides and diimides as anticancer agent. J Med Chem 52, 7873-7877.