Neuron, Volume 84

Supplemental Information

Antisense Proline-Arginine RAN Dipeptides Linked

to C9ORF72-ALS/FTD Form Toxic Nuclear Aggregates

that Initiate In Vitro and In Vivo Neuronal Death

Xinmei Wen, Wenzhi Tan, Thomas Westergard, Karthik Krishnamurthy, Shashirekha S.

Markandaiah, Yingxiao Shi, Shaoyu Lin, Neil A. Shneider, John Monaghan, Udai B.

Pandey, Piera Pasinelli, Justin K. Ichida, and Davide Trotti

1

SUPPLEMENTARY ITEMS

1. Supplementary Figure Legends:

Figure S1 (related to Figure 1) shows the randomized codon sequences

encoding the different DRPs. Modules of DRP-encoding specific 25-long

repeats are shown. The modules are repeated in the construct to achieve the

desired DRP length.

Figure S2 (related to Figure 1) shows validation of DRP constructs, expression

analysis and localization of di-peptide repeat proteins.

Figure S3 (related to Figure 2) shows time-lapse imaging approach employed for

survival analysis of neurons in culture.

Figure S4 (related to Figure 1) shows survival analysis of different neuronal

types transfected with DRP constructs, including untagged constructs. ALS-

linked mutation selective toxicity is also shown here.

Figure S5 (related to Figure 2) shows the schematics of plasmid containing

intronic G4C2 repeats expansion, characterization of the constructs and their

expression.

Figure S6 (related to Figure 4) shows additional images of nuclear localization of

PR50 and GR50 and association with nucleolar proteins.

Figure S7 (related to Figure 7) shows representative snapshots, which

demonstrates persistence of PR aggregates after neuron degeneration.

Figure S8 (related to Figure 8) shows western blots and immunocytochemistry

performed to characterize the new commercial anti-PR antibody and subjective

2

assessment of PR staining of an investigator blinded with respect to human

tissue samples.

2. Supplementary Experimental Procedures

3. Supplementary References

3

Figure S1. Randomized codon sequences encoding the different DRPs. Randomized

codons sequences encoding the indicated DRPs. Sequences represent individual modules

4

that are repeated in the construct to achieve the desired encoded DRP length. The cloning

strategy is described in Supplementary Experimental Procedures.

5

Figure S2. Validation of DRP constructs and cellular localization of C9RAN DRPs.

(A) Validation of DRP constructs by immunoblotting using transiently transfected NSC34

6

cells. DRP constructs (50 repeats long) in pcDNA3.1 vectors were transfected in NSC34

cells (1 g DNA/well). Cells homogenates were prepared 48 hours post-transfection and

analyzed on Tricine 10-20% gradient gels. (B) Analysis of DRPs expression levels was done

by probing western blot of NSC34 cell homogenates with anti-GFP antibody. Among

different DRPs, the arginine–rich dipeptides PR and GR showed consistently lower

expression levels. (C) Immunofluorescence performed on NSC34 cells transfected with

different DRPs. Confocal microscopy on cells stained with anti-GFP antibody at 48 hours

post-transfection. Calibration bar is 20 m. (D) Confocal microscopy imaging of cortical

neurons co-transfected at DIV10 with the indicated DRP and synapsin-driven Td-tomato

construct to aid visualization of neurons. Cortical neurons were imaged 48 hours post-

transfection. Expression levels of Td-tomato reporter protein were noticed to be

consistently lower in PR-expressing neurons. Exposure settings were uniform throughout

confocal analysis. Arrows point at aggregates within the soma and neurites (GA50) and

nucleus (GR50 and PR50). Calibration bar is 20 m. (E) DRP constructs (50 repeats long) in

pcDNA3.1 vectors were transfected in primary rat motor neurons at DIV5 (0.5 g

DNA/well). Neurons were imaged by confocal microscopy 24 hours post-transfection.

Calibration bar is 20 m. Arrows point at aggregates within neurites (GA50) and nucleus

(GR50 and PR50). Calibration bar is 20 m.

7

Figure S3. Time-lapse imaging of individual neurons in culture. (A) Schematic of live-

cell longitudinal tracking experiments. Primary cortical neurons are transfected at DIV 10

8

and transfected neurons (Td-tomato+) in the same optical field are imaged at a 24h interval

for up to 9 days post-transfection. To monitor individual neurons, a synapsin promoter

driven Td-Tomato construct was co-transfected as a sensitive reporter of survival. (B)

Representative images of cortical neurons co-transfected with Td-tomato reporter construct

driven by synapsin promoter and GFP-control construct. Calibration bar is 100 m. (C)

Cortical neurons were imaged at transfection day 0 in bright field, which corresponds to

DIV10. Image shows full maturation of the cortical neurons in vitro. The same neurons in

the optical field were then imaged for 8 consecutive days post-transfection at 24-hour

intervals using Td-tomato as fluorescent reporter. Arrows point at 4 neurons that were

successfully transfected in this field. Time-lapse images show the increased expression of the

Td-tomato reporter construct in those neurons that allows visualization of the in vitro

neurites’ network. Calibration bar is 100 m.

9

Figure S4. Survival analysis of different DRPs transfected in motor and hippocampal

neurons. (A) Representative live-cell images of motor neurons co-transfected with Td-

10

Tomato (0.1 g/well; red fluorescence signal shown in top panels) and PR50 cDNA plasmids

(0.4 g/well; green fluorescence in bottom panels). Motor neuron with aggregates died,

while motor neuron with diffused PR50 expression (orange arrow and inlet) did not undergo

neurodegeneration. Calibration bar is 20 μm. (B) Kaplan-Meier survival analysis suggested

that both PR50 and GR50 were toxic to primary motor neurons compared to control

(***P<0.001). Although a trend was observed for GA50 expressing motor neurons difference

with control did not reach significance. At least 40 neurons were followed/group; n=3

independent experiments. (C) Kaplan-Meier survival analysis of hippocampal neurons

transfected with different DRP constructs showed that PR50 was toxic to hippocampal

neurons. At least 80 neurons were followed/group; n=3 independent experiments. (D)

However, hippocampal neurons were less vulnerable to PR50 compared to cortical neurons.

*P<0.05, ***P<0.001. (E) Expression levels of GFP were quantified 72 hours post-

transfection by confocal microscopy measuring immunofluorescence intensity in each

neurons. At least 20 cortical and hippocampal neurons were imaged and quantified (Image J).

Camera acquisition parameters were set the same between the two groups (unpaired t-test;

P=0.0824). Data shown are as mean+s.e.m. (F) Expression of untagged PR50 causes cortical

neuron death, which is not significantly different from that caused by GFP- PR50 as shown

by Kaplan-Meier survival analysis. At least 40 neurons/group; n = 4-6 experiments;

***P<0.001. (G) Immunoflurescence analysis using α-PR antibody shows that untagged

PR50 forms nuclear aggregates. Td-Tomato signal indicates a neuron transfected with

untagged PR50. (H) Western blot using lysates of NSC34 transfected with untagged PR50

shows that untagged PR50 is recognized by α-PR antibody and runs at predicted molecular

weight. (I, J) Survival analysis of primary cortical and motor neurons transfected with

human wild type SOD1 or the ALS-linked SOD1-G93A mutant. Expression of ALS-linked

11

mutant SOD1-G93A did not affect survival of cortical neurons (I), while it was neurotoxic

to motor neurons (J). At least 80 cortical and 40 motor neurons are followed/group; at least

3 independent experiments. ***P<0.001.

12

Figure S5. Generation of GFP plasmids containing intronic G4C2 repeats expansion.

(A) Schematic of GFP construct harboring intronic GGGGCC repeat expansions. The

13

insert has been subcloned into the GFP splicing reporter plasmid, pGint (plasmid 24217;

Addgene; pEGFP-N1 vector backbone) (B) Restriction analysis showing the correct

calculated size for the R0, R21 and R42 inserts. Lanes indicate individual bacterial colonies

from which the DNA has been extracted. Confirmation of the presence or absence of

GGGGCC repeat sequences in R0, R21 and R42 constructs was obtained by sequencing.

Analysis of the R21 and R42 sequence was only partially successful due to their high GC

content. (C) Representative images of co-transfection strategy. Cortical neurons were co-

transfected with 0.2 g of Td-tomato cDNA and 0.8 g of R42 cDNA constructs/well at

DIV10 and live imaged over time. Each neuron expressing Td-tomato fluorescent protein

also expressed GFP from the R42 construct. Calibration bar is 100 m. (D)

Immunoblotting analysis of NSC34 cells transfected with R0-42 constructs showed that the

presence of G4C2 repeats in the intronic sequence of the construct did not affect GFP

expression in NSC34 cells, suggesting correct splicing. (E) Fluorescent in situ hybridization

(FISH) analysis shows RNA nuclear inclusions detected in NSC34 cells transfected with

R21-42 constructs. R0 construct serving as control did not produce nuclear inclusions.

DAPI was used to stain the nucleus. Cells were fixed and in situ hybridized with Cy3-linked

(CCCCGG)4 probe. Red staining represents positive hybridization of the probe. Calibration

bar is 5 m.

14

Figure S6. Nuclear localization of PR50 and GR50 and association with nucleolin. (A)

Immunofluorescence staining of PR50 transfected motor neuron with SMI32 and nucleolin

15

showed that PR nuclear aggregates co-localized with nucleolin. DAPI: blue; Nucleolin: red;

GFP-CTRL or GFP-PR50: green; SMI32: magenta. (B) 3D reconstructions of cortical

neurons transfected with PR50 and stained for nucleolin. Nuclear aggregates formed by PR

appeared enclosed by nucleolin. DAPI: blue; Nucleolin: red; GFP-PR50: green. (C, D) PR

nucleolar staining was confirmed by its co-localization with fibrillarin. Orthogonal view

showing co-localization of PR nuclear aggregates and fibrillarin. DAPI: blue; GFP-PR50:

green; Fibrillarin: magenta. Calibration bars are 10 m. (E) 3D reconstruction of cortical

neurons transfected with GR50 and stained for nucleolin. DAPI: blue; Nucleolin: red; GFP-

GR50: green. Calibration bars are 10 m.

16

Figure S7. PR aggregates persist in the dish after the neuron has degenerated and

lost membrane integrity. Motor neurons were co-transfected at DIV 5 with Td-Tomato

17

and GFP-PR50 and monitored over time. At 24 hours post-transfection, distinct nuclear

aggregates were detected. At 28 hours post-transfection, nuclear aggregates became more

prominent and the soma swelled. At 36 hours post-transfection, the motor neuron lost its

membrane integrity and died, while prominent PR aggregates remained. Calibration bar is

100 m.

18

Figure S8. Nuclear localization of PR aggregates in spinal cord tissues from C9 ALS

and C9 ALS/FTD patients. (A, B) Characterization of the α-PR antibody from

19

ProteinTech. HEK-293 cells were transfected with DRP constructs and the control

construct, and cell lysates were subjected to immunoblotting. The α-PR antibody from

ProteinTech recognized poly-PR at predicted molecular weight with decent specificity. Actin

was used as a loading control. Immunofluorescence analysis suggests that the α-PR antibody

from ProteinTech specifically recognizes poly-PR. DAPI: blue; GFP-PR50: green; α-PR: red.

Calibration bar is 10 μm. (C) Intensity of nuclear and extranuclear PR staining in human

tissues was quantified subjectively by 3 blinded investigators. 10 representative 15-slice z-

series images from each patient (a total of 80 images) were randomized for each investigator.

The investigators ranked the PR fluorescent levels as absent, light, moderate, or heavy. The

rankings were added up and taken as a percent of images quantified. - = 0%; +/- = 1 – 25%;

+ = 26 – 50%; ++ = 51 – 75%; +++ = 76 – 100%. (D) Orthogonal view of nuclear PR

inclusion in C9-ALS/FTD patient spinal cord section. DAPI: blue; PR: red. Calibration bar

is 10 μm.

20

SUPPLEMENTARY EXPERIMENTAL PROCEDURES

Plasmids. Intronic G4C2 repeats constructs were generated by synthesizing (GGGGCC)21

sequence (Integrated DNA technology) containing upstream XmaI and downstream

NgoMIV sites and cloned between BamHI and SalI sites of pGint plasmid (Bonano et al.,

2007). To expand the length of GGGGCC repeats, a NheI/NgOMIV fragment was inserted

into the same vector with NheI/XmaI cut. C9RAN dipeptide repeat flag-EGFP vectors

were created by annealing the TTAAG

GCCACCATGGATTACAAGGATGACGACGATAAGAAGCTTTGGCGGCGGTACC

GAGCTCGGATCCACTACTCCAGTGTGGTGG sequence and

AATTCCACCACACTGGAGTAGTGGATCCGAGCTCGGTACCGCCGCCAAAGCTT

CTTATCGTCGTCATCCTTGTAATCCATGGTGGCC into AflII/EcoRI cut pEGFP

vector (Tan et al., 2013). Sense poly-GA, GP, GR peptides were made from oligos

containing BamHI-HindIII-XmaI-25 repeats of randomized exon codons-NgOMIV-KpnI

SalI inserted into pGint cut with BamHI/SalI. The repeats were expanded multiple times to

create up to 400 repeats using the same strategy we used for the intronic G4C2 repeat

expansions. The different exonic RAN dipeptide constructs were generated by subcloning

into HindIII/KpnI sites of the flag-EGFP vector. Antisense poly-PA, PR peptides were

made from oligos containing BamHI-HindIII-NgOMIV-25 repeats of randomized exon

codons-XmaI-KpnI-SalI inserted into pGint cut with BamHI/SalI. Repeats were expanded

by subcloning of XmaI/SalI fragments into NgOMIV/SalI vector. Constructs encoding

poly-PA or poly-PR at different lengths were generated using the strategy described for the

sense constructs. Constructs encoding untagged PR50 were generated by subcloning PR

sequence (length=50 repeats) from PR50 – pGint construct into pcDNA 3.1 between XhoI

and EcoRI. Short hairpin RNAs targeting C9ORF72 (Open Biosystem, #RHS4531-

21

NM_018325) and non-silencing control shRNAs (Open Biosystem, #RHS4346) were

purchased from Open Biosystem.

Longitudinal live-cell imaging analysis. Longitudinal live-cell imaging was performed on

neuronal cultures (human and rat). Survival and risk of death analyses were performed on

images acquired by an automated imaging system consisting of an inverted Nikon Eclipse Ti

microscope equipped with PerfectFocus, a Tokai Hit stage top incubator with gas and

temperature controller and a CoolSNAP ES2 High-performance CCD camera. Stage and

shutter movements, focusing and image acquisition are fully automated and controlled by PC

running NIS-elements Ar microscope imaging software (Nikon). With automated

microscopy, tens of individual neurons were imaged from each group at regular 24-h

intervals. Td-tomato fluorescence served as a sensitive survival marker for cortical,

hippocampal and motor neurons as well, as loss of fluorescence, retraction of neurites or

disruption of the plasma membrane indicates cell death. It also has the advantage of

assessing all forms of cell death, apoptotic and non-apoptotic, in the same assay, thereby

rendering them more sensitive to gauge neurotoxicity (Strebel et al., 2001). Both GFP and

Td-tomato signals were monitored over time. DRPs aggregation and neuronal survival data

were extracted from files generated with automated imaging by visual inspection.

iPSC-derived neurons. XCell’s Human Neuro Kit containing cryo-preserved, pre-

differentiated mixed population neurons derived from a footprint-free, karyotype normal

iPSC line was purchased from XCell Science (cat.# XN-001-S-NH). Mature neurons were

obtained within 8 days following manufacturer’s protocol. At 8 days post-seeding, the cell

22

population contained >98% neurons and <1% GFAP-positive cells. Cells were transfected

with the DRP constructs following the protocol reported for rat neurons.

Human-induced motor neurons from C9ORF72 patients and controls. Induced motor

neurons were derived from iPSCs generated from two C9ORF72-ALS patients (Coriell ID

ND06769 and ND10689) and controls (ND03231 and ND12133) using the forced

expression of ASCL1, BRN2, MYT1L, NGN2, LHX3, ISL1, and NEUROD1 and culturing

in N3 medium containing DMEM/F12, 1% N2 (Life Technologies), 2% B27 (Life

Technologies), penicillin/streptomycin (Genesee Scientific), 10 ng/ml bFGF (Peprotech), 10

ng/ml GDNF, 10 ng/ml BDNF, and 10 ng/ml CNTF (all R&D Systems) for 15 days as

previously described (Son et al., 2011). iPSCs were derived using episomal plasmids as

described (Okita et al., 2011) and used for induced motor neuron generation at passage 7 or

greater. Induced motor neurons were labeled by co-transduction of a lentivirus expressing

channelrhodopsin-YFP under the control of the Hb9 enhancer. Cells were fixed 15 days

post-transduction using 4% PFA/PBS and permeabilized using 0.05%Tween-20/PBS. After

blocking with 10%FBS/0.01%Tween-20/PBS, cells were incubated with primary antibody

overnight in 4 OC and then incubated with Alexa Fluro conjugated secondary antibody.

Image was taken using Zeiss LSM780 confocal microscopy and modified with ImageJ. For

survival analysis, the starting number of iMNs in each well was determined by counting at

the peak of iMN formation at day 15 post-transduction. Induced MNs were counted again at

days 20, 25, 30, and 35 and the number of iMNs surviving was determined by dividing the

number of iMNs remaining in each well at each time point by the starting number of iMNs

in that well at day 15. Each patient or control sample was assayed in biological triplicate and

Kaplan-Meier survival analysis was performed.

23

Analysis of human samples. Lymphoblasts from one C9ORF72-ALS patient (Coriell ID

ND06769) and one neurologically normal population control (Coriell ID ND11463) were

obtained from Coriell. Postmortem samples were donated to the New York Brain Bank by

patients and their families cared for in the Eleanor and Lou Gehrig ALS Center at Columbia

University (Three control individuals with no neurological disease, three C9ORF72 ALS

cases and two ALS non-C9ORF72 cases). The clinical diagnosis of ALS was confirmed by

neuropathological studies. The presence or absence of the C9ORF72 hexanucleotide

expansion was determined by repeat primed PCR analysis of blood DNA. For

immunofluorescence analysis, 5 μm frozen sections were obtained from flash frozen spinal

cord tissues. Prior to fixation and permeabilization, slides were equilibrated in room

temperature PBS for 5 minutes. Tissues were then fixed and permeabilized with ice-cold

acetone at -20°C for 15 minutes. Slides were washed three times with PBS and then the

tissues blocked with 10% goat serum, 0.5% BSA, and 0.5% Triton x-100 for 1hr. Tissues

were then incubated for 1hr with indicated primary antibodies in 2% goat serum, 0.5% BSA,

and 0.5% Triton x-100. Slides were washed three times with PBS and then the tissues

incubated for 1h with goat raised secondary antibody in 2% goat serum, 0.5% BSA, and

0.5% Triton x-100. A secondary not specific to the primary antibodies was added to

highlight tissue artifacts and distinguish specific binding. Slides were washed three times with

PBS and coverslips mounted with Prolong Gold Antifade Reagent with DAPI and imaged

analyzed by Olympus, Fluoview FV1000. Primary antibodies used include α-PR (gift from

Dr. Petrucelli, 1: 1,000), α-PR (ProteinTech#23979-1-AP, 1:1,000), α-nucelophosmin

(Millipore#MABE937, 1:100).

24

Western Blots. For detection of DRPs, protein extracts were run on 10-20% Trincine gels

and transferred to PVDF membranes with 0.2 m pore size. For detection of other proteins,

proteins extracts were run on Any KD Glycine gels and transferred to nitrocellulose

membranes. Following primary antibodies were used at indicated dilutions: α-GA, α-GP, α-

GR, α-PA and α-PR antibodies (gifts from Dr. Petrucelli, 1:1,500), α-GFP (Clontech

#632381, 1:3,000), α-PARP (Cell Signaling #9542, 1:1,000), α-GAPDH (Fitzgerald #10R-

G109a, 1:10,000), α-C9ORF72 (Sigma #HPA023873, 1:150), α-Actin (Sigma#A2103,

1:1,000), α-PR (ProteinTech#23979-1-AP, 1:3,000).

Dot Blots. Transfected NSC34 and cortical neurons were collected at 24h to 72h post-

transfection and lysed in 0.1% SDS-RIPA buffer. Equal amount of cell lysates were loaded

onto nitrocellulose membranes, and membranes were allowed to dry at room temperature.

Then, the membranes were immunoblotted with indicated antibodies using the same

protocol as western blotting.

Fluorescent In Situ Hybridization. RNA fluorescent in situ hybridization (FISH) was

done according to the protocol reported in Donnelly et al. (2013) with modifications. Briefly,

cells transfected with R0-42 transcripts were fixed in 4% PFA in PBS and permeabilized

with 0.3% Triton for 15 min. at room temperature and hybridized for 35 min. at 70 C with

0.5 nM (CCCCGG)4 probe.

Fly transgenesis and experiments. Transgenic flies that carry GAL4-activatable genes

encoding RAN proteins were made by phiC31 mediated integration of C9RAN-protein-

PUASTattb at a defined attP site on the 3rd chromosome (86F8). The attP site is carried by

25

fly stock number 24749 at the Bloomington Drosophila Stock Centre (Bischof et al., 2007).

The strains were stabilized using the 3rd chromosome balancers TM6B and TM3 for motor

neuron and eye studies respectively. Eye expression was induced by crossing C9RAN

protein flies with the GMR GAL4 strain (Lanson et al., 2011) at 25C. Motor neuron

expression was induced by crossing C9RAN protein flies with the OK371 GAL4 strain at

25C (Mahr and Aberle, 2006). Muscle expression was induced by crossing C9RAN protein

flies with the MHC GAL4 strain at 25 C. Eye phenotype were scored based on 4 criteria:

reduction in size of the eye, loss of pigmentation in the eye, disruption of the ommatidial

array; altered hair growth between the ommatidia. Each criteria was scored 1 to 4 depending

on the severity. Signicant difference between the genotypes was assessed using one way

ANOVA and Scheffe's post-hoc test. For the viability assay C9RAN protein flies containing

the TM6b balancer were crossed with OK371 GAL4 driver flies. Viability of F1 C9RAN

protein expressors was normalized to viability of F1 TM6b. For western blot analysis

thoraxes were collected C9RAN protein flies, snap frozen, crushed to dust on dry ice,

suspended in RIPA buffer, sonicated to further promote cellular lysis, suspended in laemli

buffer and subjected to acrylamide gel electrophoresis. Proteins were transferred to a

nitrocellulose membrane by western blot and detected using the following antibodies FLAG

M2 (Sigma Aldrich #F1804, 1:500), GFP B2 (Santa Cruz Biotechnology #sc-9996, 1:500),

Tubulin (Sigma Aldrich #T5168, 1:10,000). For immunofluorescence analysis third instar

larvae of flies that express GFP tagged C9RAN proteins in motor neurons were pinned to a

silicon bed in a petri dish full of PBS and flayed so that the larval brain was visible. These

larvae were fixed for 1 hour in 3 % formaldehyde in PBS and then probed with the

following antibodies: anti-Lamin (Developmental Studies Hybridoma Bank #ADL84.12,

26

1:200), anti-mouse Alexafluor546 (Invitrogen A11030, 1:500). Imaging was done on an

Olympus confocal microscope.

Quantitative PCR. Total RNA was extracted from Drosophila melanogaster (wandering

third instar larvae OK371-GAL4 motor neuron expressors, day-one-white-pre-pupae GMR-

GAL4 eye expressors) using trizol reagent (Life technologies). Total RNA was used as

template for reverse transcription using oligo dT to produce cDNA (Revertaid first strand

cDNA synthesis kit, Thermo scientific). Quantitative PCR was done on a 7500 Real-Time

PCR system (Life technologies). The RAN50 mRNA levels were normalized against alpha

Tubulin 84b mRNA levels. RAN50 mRNA was detected using a primer/probe set that

targets the 3'UTR of PUASTattb-inserted transgenes (F: TGG TGT GAC ATA ATT GGA

CAA AC; R: ACT AGA TGG CAT TTC TTC TGA GC; Probe: /56-FAM/CT GAT GAA

T/Zen/G GGA GCA GTG GTG GAA/3IABkFQ/). Alpha Tubulin 84b mRNA was

detected using the following primer/probe set (F: CCT CGA AAT CGT AGC TCT ACA C;

R: ACC AGC CTG ACC AAC ATG; Probe: /56-FAM/TC ACA CGC G/Zen/A CAA

GGA AAA TTC ACA GA/3IABkFQ/).

SUPPLEMENTARY REFERENCES

Bischof, J., Maeda, R.K., Hediger, M., Karch, F., and Basler, K. (2007). An optimized

transgenesis system for Drosophila using germ-line-specific phiC31 integrases. Proc Natl

Acad Sci U S A 104, 3312-3317.

Bonano, V.I., Oltean, S., and Garcia-Blanco, M.A. (2007). A protocol for imaging alternative

splicing regulation in vivo using fluorescence reporters in transgenic mice. Nat Protoc 2,

2166-2181.

27

Mahr, A., and Aberle, H. (2006). The expression pattern of the Drosophila vesicular

glutamate transporter: a marker protein for motoneurons and glutamatergic centers in the

brain. Gene expression patterns : GEP 6, 299-309.

Okita, K., Matsumura, Y., Sato, Y., Okada, A., Morizane, A., Okamoto, S., Hong, H.,

Nakagawa, M., Tanabe, K., Tezuka, K., et al. (2011). A more efficient method to generate

integration-free human iPS cells. Nature methods 8, 409-412.

Son, E.Y., Ichida, J.K., Wainger, B.J., Toma, J.S., Rafuse, V.F., Woolf, C.J., and Eggan, K.

(2011). Conversion of mouse and human fibroblasts into functional spinal motor neurons.

Cell Stem Cell 9, 205-218.

Strebel, A., Harr, T., Bachmann, F., Wernli, M., and Erb, P. (2001). Green fluorescent

protein as a novel tool to measure apoptosis and necrosis. Cytometry 43, 126-133.

Tan, W., Naniche, N., Bogush, A., Pedrini, S., Trotti, D., and Pasinelli, P. (2013). Small

peptides against the mutant SOD1/Bcl-2 toxic mitochondrial complex restore mitochondrial

function and cell viability in mutant SOD1-mediated ALS. J Neurosci 33, 11588-11598.