studies on necroptosis signalling: pleiotropic function of...

1 Abstract

Studies on necroptosis signalling: pleiotropic function of MLKL and target identification

of Sorafenib

Heleen VANHOOLANDT

Master’s dissertation submitted to obtain the degree of

Master of Science in Biochemistry and Biotechnology

Major biomedical biotechnology (BIB)

Academic year 2014-2015

Promoter Ghent University: Prof. Dr. Peter Vandenabeele Scientific Supervisor: Dr. Nozomi Takahashi

Molecular Signaling and Cell Death unit VIB Inflammation Research Center, University of Ghent – Department Biomedical Molecular Biology Erasmus Promoter: Prof. Dr. Jaehwan Song Scientific Supervisor: Man Hyung Jeong, Jin Ho Seo Laboratory of Tumorigenesis and Cell Senescence, University of Yonsei - Department of biochemistry

Acknowledgements

1

Acknowledgements

My extreme gratitude goes out to the people who made it possible for me to perform this master

dissertation. Especially I would like to thank Prof. Doc. Peter Vandenabeele for granting me a wonderful

chance and for always supporting me, even in the hard times, and Prof. Doc. Jaehwan Song, for allowing

me to work in his lab, even if it only was for a short period. Also thanks to Nozomi, Vera, Sofie en Inge for

starting up a project on very short notice and educating me in lab practice, and to Manhyung, Jinho,

Chunchil and Daehyun for guiding my lab work even if the language barrier sometimes got in the way.

Acknowledgments

2

Table of contents

3

Table of contents

Acknowledgements ......................................................................................................................................... 1

Table of contents ............................................................................................................................................. 3

List of Abbreviations ........................................................................................................................................ 5

Summary .......................................................................................................................................................... 8

Samenvatting ................................................................................................................................................. 10

Introduction ................................................................................................................................................... 12

1. Necroptosis, a form of regulated necrosis driven by cellular stress............................................. 12

1.1 MLKL, an elusive member of the necroptotic pathway ........................................................... 15

2. A possible link between alternatively regulated and/or activated MLKL and cancer .................. 16

2.1 Candidates for MLKL regulation in melanoma and colorectal cancer cells .............................. 17

2.2 The Ras/Raf/MEK/ERK or MAPK/ERK pathway and its importance in cancer ......................... 17

2.3 C-myc, a TF both important in inducing and maintaining cancer cells .................................... 19

2.4 Β-catenin and the TCF/LEF family of transcription factors ....................................................... 19

2.5 ETS-domain transcription factor family .................................................................................... 19

2.6 Microphthalmia-associated transcription factor ...................................................................... 20

3. Epithelial to mesenchymal transition (EMT), its role in cancer and a possible link with MLKL

regulation in cancer cells ........................................................................................................................... 20

4. Sorafenib, a possible inhibitor of the necroptosis pathway ......................................................... 21

4.1 Cellular thermal shift assay ...................................................................................................... 23

Aim ................................................................................................................................................................ 25

Results ........................................................................................................................................................... 27

1. Study of MLKL regulation in stable human cancer cell lines through .......................................... 27

2. Creation of mutated Ras isoforms, B-Raf and c-Myc transformed cell lines ................................ 29

2.1 Cloning of HrasV12, BrafV600E and c-Myc constructs into the pENTR3c vector ..................... 29

2.2 Cloning of HrasV12, BrafV600E and c-Myc constructs into the pSin destination vector ......... 31

3. Analysis of protein lysates derived from EMT melanoma panels ................................................ 32

4. In vitro effect of c-Myc, β-catenin, ETS1 and MITF knock-down on MLKL levels ......................... 33

5. Identification of a Sorafenib tosylate target within the necroptotic pathway through cellular

thermal shift assay ..................................................................................................................................... 35

5.1 CETSA with intact cells .............................................................................................................. 35

5.2 CETSA with cell lysate ............................................................................................................... 37

Discussion ...................................................................................................................................................... 41

Discussie ........................................................................................................................................................ 45

Methods and materials .................................................................................................................................. 46

Table of contents

4

References ..................................................................................................................................................... 49

Addendum ..................................................................................................................................................... 54

western blot protocol ................................................................................................................................ 54

2x Laemli buffer (100 mL) .......................................................................................................................... 56

Heat shock tranformatie E. coli .................................................................................................................. 56

cloning 56

CESTA 61

List of Abbreviations

5


A

APC: adenomatous polyposis coli

ATC: Advanced Thyroid Carcinoma

C

CETSA: cellular thermal shift assay

cIAP: cellular IAP

CK1: casein kinase 1

CRC: colorectal cancer

CTSA: cellular thermal shift assay

CYLD: cylindromatosis

D

DAI: DNA-dependent activator of IFN-regulatory

factors

DAMP: damage-associated molecular pattern

DISC: death-inducing signaling complex

DMSO: dimethylsulfoxide

DRP1: dynamin-related protein 1

E

ERK: extracellular signal-regulated kinase

EGF: Epidermal growth factor

EGFR: Epidermal Growth Factor Receptor

EMT: Epithelial to mesenchymal transition

F

FADD: FAS-associated death domain

FDA: Food and Drug Administration

FGFR1:Fibroblast growth factor receptor 1

FLIPL: FLICE-like inhibitory protein long isoform

G

GTPase: guanosine triphosphatase

GSK3β: glycogen synthase kinase 3 beta

H

HCC: hepatocellular carcinoma

HFF: human foreskin fibroblastoma, primary cell

line

HCT-116: human colorectal adenocarcinoma cell

line

HT-29: human colorectal adenocarcinoma cell line

I

IFNγR: interferon gamma receptor

IMR90: lung fibroblast, primary cell line

K

KLD: kinase-like domain

L

LEF: lymphoid-enhancing factor

M

MAPK: mitogen-activated protein kinase

MAP2K: MAPK kinase

MAP3K: MAPk kinase kinase

MeWo: human melanoma cell line

MITF: Microphthalmia-associated transcription

factor

MLKL: mixed lineage kinase domain-like

MTA: molecular targeted agent

List of Abbriviations

6

N

NF-κB: nuclear factor κ B

NIK: NF-κB-inducing kinase

NLRP3:

NLS: nucleus localization signal

P

PDGFR: platelet-derived growth factor receptor

PGAM5: phosphoglycerate mutase 5

PIPs: phosphatidylinositol phosphates

R

RCC: renal cell carcinoma

RHIM: RIP homotypic interaction motif

RIPK1: Receptor Interacting protein Pro-necrotic

serine/threonine-kinase 1

RIPK3: Receptor Interacting protein Pro-necrotic

serine/threonine-kinase 3

RTK:

S

SDS-PAGE: sodium dodecyl sulfate polyacrylamide

gel electrophoreses.

siRNA: small interfering ribonucleic acid

Smac: second mitochondria-derived

Skmel 28: human melanoma cell line

T

TCF:

TCR: T-cell receptors

TF: transcription factor

TLR: Toll like receptor

TNF: tumor necrosis factor

TNFR1: TNF receptor 1

TRAF: TNF receptor-associated factor

TRADD: TNFR-associated death domain

TRAIL: TNF-related apoptosis-inducing ligand, also

known as APO-2L

TRAILR: TRAIL receptor

TSA: thermal shift assay

TWEAK: TNF-related weak inducer of apoptosis

TWEAKR: TWEAK receptor

V

VEGFR: vascular endothelial growth factor receptor

W

Wnt: wingless

Z

ZEB: Zinc finger E-box-binding homeobox

zVAD-FMK: carbobenzoxy-valyl-alanylaspartyl-[O-

methyl]- fluoromethylketone

1-9

4HBD: four-helical bundle domain


7

Summary

8

Summary

Necroptosis can be described as a genetically controlled form of necrosis. As it also leads to plasma membrane permeabilization and cellular leakage it is morphologically indistinguishable from accidental necrosis, which is triggered by physicochemical stress. Necroptosis can cause negative effects such as tissue damage and inflammation contributing to pathophysiology of several disorders including ischemia-reperfusion injury but also protects the organism by removal of virus-infected cells. An important event in the

necroptosis pathway is the formation of the necroptosis-inducing complexes which contains RIPK1, RIPK3 and MLKL.

While much is known about the role of RIPK1, RIPK3 and MLKL in necroptosis, we participated in a research project exploring pleiotropic functions of MLKL. Recent preliminary data obtained by the Yonsei Tumorigenesis and Cell Senescence unit of Prof. J. Song have shown a possible link between mlkl gene regulation and mutant H-Ras signaling in a MEK/ERK dependent way. The same research unit also generated data that point to the possibility of MLKL induction by c-Myc mediated transcription. As both the MAPK/ERK pathway and c-Myc have a known influence in many cancer cells, this might indicate a novel role for MLKL within these cells beyond necroptosis or regulates it. In respect with the pleiotropic function of MLKL

we want to determine the link between altered Ras or B-Raf signaling and MLKL gene expression and activation. Secondly we want to determine the possible difference in MLKL expression between primary melanocytes and a panel of metastatic melanoma cell lines with defined epithelial-mesenchymal transition (EMT) status. Lastly we want to determine if c-Myc, β-catenin, ETS1 or MITF are crucial transcription factor of MLKL, and thus regulates its expression. The results of this master dissertation will contribute to better understanding whether MLKL is linked to oncogenic transformation or metastasis, and maybe indirectly also to necroptosis sensitivity.

Sorafenib tosylate has recently emerged during independent screens in the Song and the Vandenabeele lab and appeared as a strong candidate for necroptosis inhibition. As sorafenib

tosylate is already known as a multikinase inhibitor we presume it inhibits key kinase components of the necroptosis pathway. Therefore, in the second part of this master dissertation we perform a cellular thermal shift assay, a recently developed technique to assess the target of Sorafenib in the necroptotic pathway.

Summary

9

Samenvatting

10

Samenvatting

Necroptosis kan beschreven worden als een genetisch gecontroleerde vorm van necrosis. Aangezien het evenwel leidt tot plasma membraan doorlaatbaarheid en het lekken van de cel, valt het morfologisch niet te onderscheiden van incidentele necrosis, welke getriggerd wordt door fysicochemische stress. Necroptosis kan negatieve effecten veroorzaken zoals weefselschade en inflammatie die bijdraagt tot de pathofysiologie van verschillende ziektes waaronder ischemia-reperfusie verwonding, maar beschermt het organisme ook door

verwijdering van virus-geïnfecteerde cellen. Een belangrijke gebeurtenis in de necroptosis signalisatie weg is de vorming van necroptosis-inducerende complexen bestaande uit RIPK, RIPK3 en MLKL.

Er is reeds veel geweten over de rol van RIPK1, RIPK3 en MLKL in necroptosis, maar over mogelijke pleiotropische functies van MLKL. Recente preliminaire data verkregen door de Yonsei Tumorigenesis en Cel Senescence unit onder leiding van Prof. J. Song hebben aangetoond dat er een mogelijke link bestaat tussen mlkl gen expressie en mutante H-Ras

signalisatie in een MEK/ERK afhankelijke manier. In dezelfde research unit werd ook data verkregen die wijzen op een mogelijke inductie van MLKL door c-Myc bemiddelde transcriptie. Zowel de MAPK/ERK pathway en c-Myc hebben reeds een bekende invloed in vele kanker

cellijnen, wat kan wijzen op een mogelijke nieuwe rol van MLKL in deze cellijnen los van necroptosis of juist deze cellen gevoeliger maakt voor necroptosis. De pleiotropische functies van MLKL respecterend, willen we een link bepalen tussen gewijzigde Ras en B-Raf signalisatie en MLKL gen expressie en activiteit. Ten tweede willen we bepalen of er een mogelijke verandering optreedt in MLKL expressie tussen primaire melanocuten en een panel van mestatische melanoma cellijnen met een gedefinieerde epitheliale-mesenchymale transitie (EMT) status. Ten laatste willen we bepalen of c-Myc, β-catenine, ETS1 of MITF cruciale transcriptie factoren kunnen zijn van MLKL. De resultaten van deze master thesis zullen bijdragen tot een beter inzicht in de mogelijke link tussen MLKL en oncogene transformatie of metastasis, en indirect de mogelijkheid dat MLKL deze cellen kwetsbaarder maak voor

necroptosis.

Sorafenib tosylate is recentelijk naar voor getreden tijdens onafhankelijke screenings uitgevoerd in de Song en de Vandenabeele units, en geeft de indruk een sterke kandidaat te zijn voor necroptosis inhibitie. Sorafenib tosylate is reeds gekend als een multikinase inhibitor,

wat erop wijst dat belangrijke kinase componenten van de necroptosis signalisatie weg zou kunnen uitschakelen. In het tweede deel van deze master thesis voeren we een cellulaire thermale verschuiving assay uit, een recentelijk ontwikkelde techniek, om te bepalen welk lid van de necroptosis signalisatie weg het doelwit vormt voor Sorafenib.

Samenvatting

11

Introduction

12

Introduction

1. Necroptosis, a form of regulated necrosis driven by cellular stress

Cell death is a fundamental cellular process in multicellular organisms. The balance between cell death, proliferation and differentiation is indispensable in development and maintenance of the adult tissue homeostasis. Its perturbation plays a role in many processes of pathogenesis and infection. Initially the concept of genetically ‘regulated cell death’ was described by Lockshin and Williams in 1964 through their study of insect metamorphosis

(Lockshin & Williams, 1964). By 1973 this concept was further distinguished into three separate cell death types: type I, associated with heterophagy; type II, associated with autophagy; and type III, which was independent of any digestion (Schweichel & Merker, 1973). These three different types are nowadays known as apoptosis, cell death associated with autophagy and necrosis. Historically apoptosis has been considered to be the sole form of regulated or programmed cell death, while necrosis was perceived as an accidental process causing premature cell death. As such it was mainly necrosis that was linked to tissue damage, disease pathogenesis and inflammation while apoptosis was perceived to protect the organism (Suzanne & Steller, 2013; Taylor et al., 2008). In the late 1980s the suggestion for the existence of a molecular pathway mediating programmed necrosis was raised. Since the discovery of the

importance of receptor interacting protein pro-necrotic serine/threonine-kinase 1 (RIPK1) and RIPK3 activity within TNF-induced necrosis, growing genetic, biochemical and functional evidence has proven the existence of ‘programmed necrosis’ (or caspase-independent regulated cell death) driven by multiple pathways (Cho et al., 2009b; He et al., 2009; Zhang et al., 2009). One system of regulated necrotic cell death was aptly named necroptosis (Degterev et al., 2005). It can be described as a genetically controlled process, morphologically indistinguishable from accidental necrosis but induced by particular receptors leading to activation of an unique signalling pathway that can be specifically inhibited by RIPK1-targetting necrostatins (Degterev

et al., 2008). Comparable to accidental necrosis, necroptosis leads to swelling of the cell (oncosis) and organelles, enzymatic digestion and rapid loss of plasma membrane integrity followed by

the consequential release of cellular contents (Vanden Berghe et al., 2014; Vandenabeele et al., 2010;

Vanlangenakker et al., 2012; Wu et al., 2012). If this happens as a result of death receptor activation, release of endogenous danger signals may potentially lead to tissue damage, misguided immune response activation, cancer growth promotion and inflammation. The latter contributing to the pathogenesis of inflammatory diseases such as, for example, ischemia-reperfusion injury and sepsis (Cauwels et al., 2003; Degterev et al., 2005; Kono & Rock, 2008; Pasparakis &

Vandenabeele, 2015). Alternatively necroptosis contributes to protection of the organism in case of viral infections through destruction and disposal of the infected cell and activation of the immune system by damage-associated molecular patterns (DAMPs). By generating murine knockout models for the proteins involved in the necroptosis pathway, it was observed that

these proteins play an important part during certain developmental 'checkpoints' in mice and play a part in the homeostasis of a tissue or organism. (Silke et al., 2015).

The necroptotic pathway can be initiated by the ligation of a whole assortment of death receptors, interferons, toll-like receptors or intracellular RNA and DNA sensors (Figure 1). Most

Introduction

13

extensively studied is the signal transduction caused by the ligation of tumor necrosis factor (TNF) family members to TNF receptor 1 (TNFR1).

In most cases TNRF1 ligation leads to the induction of the cell survival pathway by the assembly of the membrane-associated survival complex, also known as complex I. Complex I formation drives activation of the nuclear factor κ B (NF-κB) pathway and induction of pro-survival/pro-inflammatory signals. Inhibition of the NF-κB pathway leads to loss of this signalization and cause a shift towards a caspase-8 dependent apoptotic pathway (Vanden

Berghe et al., 2014). It has been proven that under specific conditions the induction of apoptosis becomes dependent on RIPK1 kinase activity (Biton & Ashkenazi, 2011; Dondelinger et al., 2013; Wang

et al., 2008). In these cases RIPK1, together with RIPK3, FAS-associated death domain (FADD) and the FLICE-like inhibitory protein long isoform (FLIPL) – caspase-8 heterodimer, form the RIPK1-dependent complex IIb or the ripoptosome (Vanden Berghe et al., 2014) (Figure 2).

Figure 1 │ Triggers of necroptosis, the formation of the necrosome and the downstream effects. There is already a great deal known about the different ways in which the necrotic pathway can be triggered. A whole assortment of death receptors (TNFR1, TRAILR, TWEAKR, CD29R), interferon receptors (IFNγR), toll-like receptors (TLR), T-cell receptors (TCR) or intracellular RNA and DNA sensors are capable of inducing necroptosis when ligated. Also events happening within the cell like genotoxic stress, the presence of viral components (DAI) and the effect of anticancer drugs, can initiate the pathway. The binding of TNF to TNFR is most excessively studied. In order for the necrosome to be able to form, apoptosis needs to be inhibited through the inactivation of caspase-8. Crucial components within the necrosome are the kinases RIPK1, RIPK3 and the pseudokinase MLKL. The last one is presumed to relocate to membranes where it performs his function and initiates necroptosis. Eventually necroptosis will lead to tissue damage or inflammation. Necroptosis signalling can be blocked by necrostatin 1 (NEC1) mediated inhibition of RIPK1 activity. (Vanden Berghe et al., 2014)

Introduction

14

Besides TNFR1 ligation capable of initiating the survival and apoptotic pathways, another molecular shift, it can also activate the necroptotic pathway. This is realized by compromising the caspase-8 activation, leading to apoptosis inhibition, and alternative regulation of the RIPK1 enzymatic activity. Following this process, RIPK1 and RIPK3 are able to associate, resulting in both kinases being able to phosphorylate themselves and each other (Cho et al.,

Figure 2 │ TNFR1 signaling pathways. A) Upon ligation with TNF, TNFR1 recruits TRADD, which on its turn

attracts RIPK1, cIAP1/2, TRAF2 and TRAF5. RIPK1 become subjected to Lys63-linked polyubiquitylation

mediated by cIAP1 and cIAP2, which allows docking of TAK1 in complex with TAB2 or TAB3, as well as of the

IKK complex. The assembly of the IKK complex activates the NF-κB pathway, which is enhanced by the

recruitment of LUBAC through the linear ubiquitin chains on RIPK1. B) Subsequently, CYLD removes Lys63-

linked polyubiquitins from RIPK1, rendering complex I unstable and allowing RIPK1 to dissociate from the

plasma membrane and to interact with TRADD, FADD, pro-caspase 8 and the long isoform of FLIP (FLIPL). The

lather and pro-caspase 8 form a heterodimeric caspase that cleaves and inactivates RIPK1 and RIPK3, as well

as CYLD, to prevent necroptosis. The TRADD-dependent complex IIa allows caspase 8 homodimerization and

subsequent activation, which on its turn stimulates the executioner caspases caspase 3 and caspase 7,

eventually leading to apoptosis. C) When caspase 8 is inhibited the RHIM domains of RIPK1 and RIPK3 associate

in microfilament-like complexes called necrosomes. The auto- and transphosphorylation of RIPK1 and RIPK3

and the recruitment of MLKL enables necroptosis initiation. D) When cells are depleted of cIAPs — for example,

by SMAC mimetics — RIPK1 will not be ubiquitylated, enabling the formation of complex I which leads to the

upregulation of NIK and the activation of the non-canonical NF-κB pathway. E) Moreover, in the absence of

cIAPs, a large TRADD-independent cytosolic complex is formed between RIPK1, RIPK3, FADD and the FLIPL–

caspase-8 heterodimer, which is referred to as RIPK1-dependent complex IIb. Like earlier mentioned in section

B, RIPK1 and RIPK3 are inactivated through cleavage mediated by caspase 8–FLIPL heterodimers, followed by

apoptosis induction. However when the activation or recruitment of caspase-8 is faulty, necroptosis will be

induced instead. (Vanden Berghe et al., 2014)

Introduction

15

2009a; He et al., 2009; Zhang et al., 2009). Phosphorylated RIPK3 recruits and binds the mixed lineage kinase domain-like (MLKL), a key downstream component, by homotypic RIP homotypic interaction motif-domain (RHIM) interactions (Li et al., 2012; Sun et al., 2012). The assembling of the RIPK1-RIPK3 complex, together with the activation of MLKL by RIPK3-mediated phosphorylation, lead to the formation of microfilament-like multiprotein complexes called necrosomes or necroptosis-inducing complexes (Li et al., 2012; Sun et al., 2012; Vandenabeele et al.,

2010; Xie et al., 2013b) (Figure 1, Figure 2). These complexes are suggested to regulate the signalization that leads to the cellular changes associated with necroptosis. Initially phosphoglycerate mutase 5 (PGAM5) was perceived as a target of activated MLKL. Activated PGAM5 empowers a signalization pathway leading to mitochondrial fragmentation mediated

by dynamin-related protein 1 (DRP1), which on its turn leads to necroptosis initiation (Wang et

al., 2012b). The importance of PGAM5 and DRP1 have however been questioned in multiple studies (Murphy et al., 2013; Remijsen et al., 2014; Tait et al., 2013). Additionally the existence of necroptosis that is independent from mitochondrial disruption has been reported (Tait et al.,

2013). These findings suggest that MLKL most probably executes necroptosis independent of mitochondrial dysfunction and must have another target. Even though the precise decisions how a cell initiates the necroptotic pathway stay obscure, there is a strong correlation with the RIPK3 and MLKL expression levels (He et al., 2009; Sun et al., 2012).

Independent of the centre role the RIPK1-RIPK3-MLKL axis plays in regulated cell death; all

members are also involved in enhanced activation of the late pathway NLRP3 (nucleotide-binding domain and leucine-rich repeat containing) directed inflammasome formation (Kang et

al., 2015; Lawlor et al., 2015; Vince et al., 2012). This as a result of both compromised caspase-8 activity during the pathway shift from apoptosis towards necroptosis, leading to RIPK3 recruitment, and the RIPK1-RIPK3-MLKL axis activity (Kang et al., 2015; Kang et al., 2013).

1.1 MLKL, an elusive member of the necroptotic pathway

As the MLKL kinase-like domain lacks two of the three conserved catalytic residues that were determined to be crucial for phosphoryl transfer activity. Therefore, it is not capable to

phosphorylate other molecules and is regarded as a protein kinase homolog, also called a pseudokinase (Manning et al., 2002). This domain, better known as the kinase-like domain (KLD), has however still an important structural function as it is needed for the recruitment of MLKL to RIPK3 and forms the binding spot for RIPK3 (Sun et al., 2012; Xie et al., 2013b). Recent data revolving the crystal structure of MLKL revealed that apart from the KLD it consists of a N-terminal four-helical bundle domain (4HBD) (Murphy et al., 2013). After RIPK3-mediated phosphorylation induces conformational changes in the protein, the this amino-terminal coiled-coil domain becomes exposed which enables MLKL to form homotrimers through (Cai

et al., 2014; Dondelinger et al., 2014; Hildebrand et al., 2014).

How MLKL transduces the death signal remains mostly unknown, but recently two models

have been proposed. Both involve the recruitment of MLKL to membranes and disruption of the ion homeostasis. In the first model given by Cai et al., trimerized MLKL is believed to be recruited to the plasma membrane where it associates with Ca+ ion channels leading to increased Ca++ influx, an early event in the process of necroptotis which probably causes osmotic swelling of the cell (Cai et al., 2014). Related to this Chen et al. had previously published data where MLKL was involved in Na+ influx (Chen et al., 2014). In the second model given by

Introduction

16

Wang et al., MLKL binds to the plasma and intracellular membranes where it forms membrane disrupting pores (Wang et al., 2014). Research performed by Dondelinger et al. supports this second model. In this study it was shown that MLKL associates with the plasma membrane where is forms interactions with phosphatidylinositol phosphates (PIPs) followed by formation of PIP-containing liposomes responsible for cellular leakage, both steps mediated by the aforementioned 4HBD (Dondelinger et al., 2014).

A recently performed study may provide another point of view on the matter. The gathered data suggest that upon activation MLKL, together with the other members of the necroptosome, translocates to the nucleus guided by a C-terminal NLS motif which becomes exposed after phosphorylation (Yoon et al., 2015). This is presumed to happen before the

interactions with the plasma membrane take place. It is however still unclear if the MLKL molecules that translocate to the nucleus are the same molecules that migrate to the plasma membrane, or these are distinct MLKL molecules affected by unrelated events. Also the actions MLKL, RIPK1 and RIPK3 may cause or undergo following the recruitment to the nucleus are unknown. Which effect this action has on necroptosis induction, conductive or negative, still remains elusive (Yoon et al., 2015).

2. A possible link between alternatively regulated and/or activated MLKL and cancer

The initiation of the necroptotic pathway, the necrosome formation and the role necroptosis plays in pathologies already formed the subject of intensive research (reviewed in Pasparakis and Vandenabeele, 2015) (Pasparakis & Vandenabeele, 2015). The focus of many of these studies has predominantly been on signalling, the dual RIPK1 activity and the function and importance of RIPK3 in regulated cell death (Moriwaki & Chan, 2013). MLKL, however, is still a relatively untouched subject. While its interaction with RIPK3 and the general structure are known, the function MLKL occupies in the necroptotic pathway, its downstream interacting partners and its regulation by transcription factors under various conditions are still mostly undefined (Murphy et al., 2013; Sun et al., 2012). Expression of MLKL has been identified as a good prognostic factor for the treatment of ovarian cancer and pancreatic adenocarcinoma, probably

associated with sensitivity to necroptosis during chemotherapy (Colbert et al., 2013; He et al., 2013). However, a probable role for MLKL beyond necroptosis in cancer cell initiation or maintenances and a possible MLKL activity independent of RIPK3 have not been considered in detail yet.

Many cancer therapies target the processes of cell growth and cell survival as a consequence of oncogenic mutation. If MLKL, besides its function in the execution of necroptosis, might be situated down-stream of an oncogenic mutation and is a target gene of transcription factors with aberrant regulation, MLKL might have the potential to become a novel therapeutic target. In the late 1970’s Carswell et all. discovered that TNF could induce cell death in tumors (Carswell et al. 1975). Since then the pathways downstream of TNFR1 leading to eventual cell

death have been extensively studied. The expression of MLKL in cancer cells has been studied in ovarian and early-stage resected pancreatic adenocarcinoma to assess its potential as a prognosis biomarker (He et al. 2013; Colbert et al. 2013). These studies demonstrated that cancers in an early stage display low levels of both RIPK3 and MLKL, suggesting a possible tumor suppressor function. The study performed by Colbert et al. also reported a correlation between low MLKL protein levels and poor survival rates in patients with early-stage resected

Introduction

17

pancreatic adenocarcinoma. The links between cancer and various forms of cell death have likewise been recognized in the past. Apoptosis, known to eliminate harmful cells in a way that protects the direct environment of this cell, is protective against cancer development however many tumors develop resistance against apoptosis as a consequence of a Darwinian selection mechanism resulting in the evasion this programmed cell death (Hanahan and Weinberg

2011). Necrotic cell death could function as a backup cell death mechanism for cancer cells that have acquired this resistance to apoptosis (Kreuzaler and Watson 2012), although it can be expected that the core necroptotic pathway could also be target of counterselection resulting in silencing of RIPK3 or MLKL (Colbert et al., 2013; He et al., 2013), as discussed above. On the other hand histologic necrosis occurs in many solid tumors and is acknowledged to be a prognostic

biomarker for bad outcome (Caruso et al., 2012), suggesting that the necrotic core could function as a tumor supportive mechanism. Whether necroptosis plays a role in the necrotic core is not clear. As a result of these facts, targeting or modulating the necroptotic pathway in cancer treatments may indeed seem promising. But then again, the process of necroptosis may also facilitate the release of endogenous danger signals, which may contribute to tumor promoting effects as a result of inflammation (Pasparakis and Vandenabeele 2015).

2.1 Candidates for MLKL regulation in melanoma and colorectal cancer cells

Preliminary data, generated by the Tumorigenesis and Cell Senescence unit of Prof. J. Song, in human foreskin fibroblastoma (HFF) cells and lung fibroblast (IMR90), have shown a possible

link between mlkl gene expression and mutant H-RasV12 signalling in a MEK/ERK dependent way. These data also identified c-Myc as a possible transcription factor (TF) involved in mlkl transcription. As both the MAPK/ERK pathway and c-Myc have a known influence in many cancer types, this might indicate a role for MLKL in carcinogenesis. Because these data were gathered in normal cell lines they need to be verified in stable cancer cell lines to give a more conclusive image. Based on mlkl gene expression data presented in the published microarray dataset containing records from siRNA-treated A375 melanoma cells (GSE31534, Gene Expression Omnibus (GEO) datasets, NCBI), three alternative TF were selected, this being β-catenin, ETS1 and MITF (Wang et al., 2012a).

2.2 The Ras/Raf/MEK/ERK or MAPK/ERK pathway and its importance in cancer

The mitogen-activated protein kinase (MAPK) cascades form a major player in the process of intracellular signalling. Activation of these signalling cascades leads to responses controlling essential cell physiological functions such as proliferation, differentiation or cell death. There are four distinct MAPK cascades with a similar build up of three serine/threonine (Ser/Thr) kinases that phosphorylate each other in a consecutive way: a MAPK kinase kinase (MAP3K), a MAPK kinase (MAP2K) and eventually a MAPK (Figure3). The extracellular signal-regulated kinase (ERK) cascade is one of these cascades. Signalling can be triggered by multiple stimuli, both extracellular and intracellular, of which the ligation of the epidermal growth factor

receptor (EGFR), a cell surface or receptor tyrosine kinase (RTK), is the most common. Binding of EGF to its receptor leads to the activation of a guanosine triphosphatase (GTPase), a

GTP/GDP-binding signal transducing molecule which conducts a signal from the cell surface to the nucleus by fluctuating between inactive GDP-bound and active GTP-bound states (Cox &

Der, 2002; Malumbres & Barbacid, 2003). In active state they are able to phosphorylate the MAP3K, thus activating the cascade (Brand et al., 2011). Within the ERK cascade this GTPase is Ras. It

Introduction

18

creates a sequential activation of multiple sets of cytoplasmic protein kinases such as Raf (MAP3K), MEK (MAP2K) and ERK (MAPK). The targets that lie downstream of ERK are very divergent including other kinases or nuclear and cytosolic proteins.

This pathway is found to be aberrantly activated in cancer cells at an overwhelming frequency.

More specifically mutations in the upstream activation, such as activation mediated by the Ras isoforms, are known to be some of the most frequent genetic aberrations found in cancer cells, especially in solid tumors (Chambard et al., 2007; Roberts & Der, 2007). There are three canonical members of the Ras oncogene family; H-Ras, N-Ras and K-Ras. The ras genes are known to have frequently occurring point mutations in human cancers. Although they have a similar structure, different cancer types have a preference for one specific mutated isoform. This is one of the observations that can point out a difference in function between these members (Castellano & Santos, 2011). B-Raf is a Raf isoform and has the highest potency to activate ERK. Its constitutive active form, caused by activating oncogenic mutations such as the B-Raf V600E mutation, is a frequently reoccurring feature during both benign and

malignant melanomagenesis and in papillary thyroid carcinomas (Levy et al., 2006). While Ras isoforms are still able to activate an alternative pathway, B-Raf is only capable of initiating the ERK pathway (Chambard et al., 2007).

Figure 3 │ EGFR signalling within the MAPK/ERK pathway. The extracellular signal-regulated kinase (ERK)

cascade is one of the four MAPK cascades. All of the MAPK pathways have a similar build up of three Ser/Thr

kinases that phosphorylate each other in a consecutive way: a MAPK kinase kinase (MAP3K), a MAPK kinase

(MAP2K) and eventually a MAPK. In the case of the ERK pathway these are Raf, Mek and ERK. When the

Epidermal Growth Factor Receptor (EGFR) gets ligated activates the intrinsic tyrosine kinase activity of the

EGFR. This leads to the phosphorylation of specific tyrosines on the cytoplasmic tails of the receptor pair.

These phosphor groups will be eventually transferred to Ras, a GTPase, that on his turn will transfer the

phosphor groups to Raf. The targets that lie downstream of ERK are very varied including other kinases or

nuclear and cytosolic proteins. This pathway is found to be aberrantly activated in cancer cells at an

overwhelming frequency. (Brand et al., 2011, panel B of Figure 1: classical EGFR signalling)

Introduction

19

2.3 C-myc, a TF both important in inducing and maintaining cancer cells

Myc is a transcription factor directly activated by ERK (Chambard et al., 2007). As it’s a master regulator in cell growth and metabolism, upregulation of c-Myc supports both the metabolic need and the proliferation of cancer cells. In this manner it will cause of the rate-limiting constraints cancer cells may encounter. Due to this it not only forms an important inducer, or primary oncogene, but also a supporter of the transformed phenotype in cancer cells (Miller et

al., 2012).

2.4 Β-catenin and the TCF/LEF family of transcription factors

Beta-catenin (β-catenin) is an important transcription coactivator involved in the canonical Wingless (Wnt)-signaling pathway which determines cell faith. This pathway is well-known for being intimately involved in embryonic development and adult homeostasis of multiple organs. Mutational deregulation of Wnt-signaling, leading to constitutive activation of the β-catenin cascade, causes malignant transformation and tumorigenesis. These mutations play an important part in most colon cancer cell lines. When the extracellular Wnt ligand is absent, the tumor suppressor gene adenomatous polyposis coli (APC) together with Axin, glycogen synthase kinase 3 beta (GSK3β) and casein kinase 1 (CK1) will form a β-catenin degradation complex, directing β-catenin phosphorylation, marking it for proteasome-mediated

destruction and leading to depletion of the β-catenin pool present in the cell. When the Wnt ligand binds to it receptors, Frizzled and LRP5/6, forming a complex that reduces the GSK3β kinase activity and thus instigating β-catenin stabilization. As a result of this β-catenin molecules start accumulating and translocate to the nucleus. Once in the nucleus it is be recruited by members of the DNA-binding lymphoid-enhancing factor-1 (LEF-1)/TCF transcription factor family as a coactivator to modulate the expression of genes involved in the regulation of cell proliferation, cell fate and cell renewal. One of these target genes is the c-myc regulator gene. Regarding the research performed in this master dissertation, β-catenin was both selected because of the low mlkl expression levels seen in the aforementioned microarray dataset (GSE31534) after β-catenin siRNA-treatment as for its relevance in colorectal cancer cells (CRC) where aberrant regulation of the Wnt/β-catenin signalling

pathway forms one of the major causes of tumorigenesis.

2.5 ETS-domain transcription factor family

ETS-1 was the first discovered member of the ETS-domain transcription factor family. This protein family shares a winged helix-turn-helix (wHTH) structure which can interact with 5′-GGAA/T-3′DNA core motif where it can select specific nucleotides over an 11-base-pair sequence (Karim et al., 1990). Members of this family act as nuclear targets of signal-transduction pathways. Moreover, ETS-domain proteins usually function in collaboration with other

transcription factors making its interaction with a specific binding sequence highly dependent on this interaction with other transcriptional partners. Additionally also interactions with DNA sequences adjacent of the sequence of interest regulate the TF binding strength and activity. The specific signalling mechanisms and protein binding partners however differ substantially between individual family members, creating a large variety in possible functions for this TF family both as repressors and activators of transcription (Reichert et al., 2000; Sharrocks et al., 1997).

Introduction

20

Another interesting feature of this TF is that several family members are predominantly expressed in certain tissue types, occasionally even in an ubiquitously way. Among the genes targeted by these TF’s one can find a whole list of interesting genes connected to cancer promotion and maintenance: oncogenes, tumor suppressor genes, apoptosis-related genes, differentiation-related genes, angiogenesis-related genes, invasion and metastasis-related genes and genes linked to malignant transformation and tumor progression when aberrantly expressed (Dittmer & Nordheim, 1998). Just like c-Myc the ETS TF’s are effectors of the MAPK/ERK signaling pathway (Wasylyk et al., 1998).

2.6 Microphthalmia-associated transcription factor

Microphthalmia-associated transcription factor (MITF) is a member of a basic helix-loop-helix and leucine-zipper (bHLH-LZ) containing TF family and is known to have at least five isoforms (MITF-A, MITF-B, MITF-C, MITF-H, and MITF-M). It binds to E-box motifs in DNA and forms homodimers or heterodimers in order to be active. MITF plays an important role in the development and/or survival of several cell lineages, including melanocytes, retinal pigment epithelium (RPE), mast cells, and osteoclasts. Melanomas are known to be highly heterogeneous tumors where individual cells have highly variable phenotypes and gene expression patterns. MITF expression is found to be highest in a slow-growing stem-cell-like melanoma-initiating cell population. MITF and B-Raf, a mutation found in melanoma cells at

high frequency, appear to work in synergy to transform primary human melanocytes but still maintain a high level of differentiation. Research has also pointed out MITF is differently regulated in some cancer cells as a result of a constitutively active MEK/ERK signaling pathway Likewise there is a link between the EMT transcription factor ZEB2 activity and MITF levels in the process of controlling melanocyte differentiation (Denecker et al., 2014). It was reported that the MITF-M isoform may play a role in the Wnt signalling pathway both as a target and a nuclear mediator of the pathway (Karim et al., 1990).

3. Epithelial to mesenchymal transition (EMT), its role in cancer and a possible link with MLKL regulation in cancer cells

During EMT a differentiated cell undergoes fundamental changes induced and directed by several regulatory gene circuits so it becomes transiently transcriptionally reprogrammed to have a dedifferentiated, migratory and invasive character (De Craene & Berx, 2013). It is an event linked to morphogenesis of the embryo and wound healing in adult organisms but also to cancer progression, as EMT can be linked to metastasis, a potential deadly occurrence (Nieto,

2011; Savagner et al., 1997; Thiery, 2002). Since the discovering of EMT many transcription factors capable of inducing this process have been identified. Interestingly many of these factors are also involved in suppression of senescence and apoptosis, attenuation of cell-cycle progression and resistance to radiotherapy and chemotherapy (Ansieau et al., 2008; Mejlvang et al.,

2007; Nieto, 2011). Best known EMT-TFs are probably the nuclear factors of the SNAIL, ZEB and TWIST families. However, it has been pointed out that EMT is not only regulated by transcriptional control but also by other fundamental regulatory networks like non-coding

Introduction

21

RNA’s (Figure 4), differential splicing, translational and post-translational regulation (De Craene &

Berx, 2013).

Malignant melanoma, a very aggressive skin cancer, is known to have a high phenotypical plasticity controlled by MITF (Bell & Levy, 2011; Cheli et al., 2010). Although melanoma are generated from neural crest-derived melanocytes, which are not epithelial cells, the latter do express some EMT-TFs and E-cadherin (Alexaki et al., 2010; Gupta et al., 2005; Miller & Mihm, 2006). As

both the processes regulated by EMT-TFs and loss of E-cadherin are essential for EMT, the progression of malignant melanoma can still be seen as an EMT driven process. Melanoma are known to be genetically complex as multiple genetic alterations take part in the disease progression. One of the most frequently observed alterations are lesions of the b-raf gene and the n-ras gene (Davies et al., 2002; Haluska & Ibrahim, 2006). They are present in various stages of melanoma progression, rendering the dysregulation of the MAPK/ERK pathway to be a key driver in the process of malignant melanoma transformation. Based on the earlier mentioned preliminary data, this could also imply that the mlkl gene is differentially expressed in metastatic and non-metastatic melanoma.

4. Sorafenib, a possible inhibitor of the necroptosis pathway

Sorafenib tosylate (Nexavar) is an US Food and Drug Administration (FDA) approved oral multikinase inhibitor currently administated to patients who are under treatment for advanced renal cell carcinoma (RCC), radioactive iodine resistant advanced thyroid carcinoma

Figure 4 │ Epithelial mesenchymal transition and the fundamental regulatory networks involved in this process.

During EMT a differentiated cells undergoes fundamental changes induced and directed by several

regulatory circuits so it becomes transiently transcriptionally reprogrammed to have a dedifferentiated,

migratory and invasive character. The cell will express a majorly different panel of genes then before, and

will, as a result of this, express other features. EMT is regulated by transcriptional control, non-coding RNA’s,

differential splicing, translational and post-translational regulation. ( De Craene et al., 2013)

Introduction

22

(ATC) or unresectable hepatocellular carcinoma (HCC), for which is the only FDA-approved systemic molecular targeted agent (MTA) in advanced stage HCC. It also received the European Commission marketing authorization for use in treatment of both RCC and HCC. Sorafenib is a small molecule that inhibits autophosphorylation in receptor tyrosine kinases (RTK) involved in tumorigenesis and tumor progression, such as the fibroblast growth factor receptor 1 (FGFR1), c-kit and FLT-3, and RTK’s involved in in tumor angiogenesis, such as the platelet-derived growth factor receptor β (PDGFRβ) and vascular endothelial growth factor receptors (VEGFR-1, VEGFR-2, VEGFR-3) (Figure 5). The later implying that Sorafenib not only has an inhibitory effect on cancer cells but also on the endothelial cells and pericytes of the tumor vasculature. It is also known to inhibit the downstream Raf serine/threonine kinase

isoforms (Raf-1, wild-type B-Raf, and oncogenic B-Raf V600E) activity of the ubiquitous MAPK/ERK pathway (Figure 5). As a result of this the MAPK signaling is perturbed creating an anti-angiogenic, antiproliferative effect in the cancer cell, which will eventually lead to tumor stasis and inhibited tumor growth, and/or pro-apoptotic signaling leading to cancer cell death. Clinical trials have revealed that Sorafenib could be applicable as a treatment in a large repertoire of tumor types. (Wilhelm et al., 2006; Wilhelm et al., 2008)

Two independent screenings performed by Martens et al., identified Sorafenib tosylate as a

potent inhibitor of TNF-induced necroptosis, which could indicate a novel role for this compound besides its role in cancer treatment. More specificly Sorafenib could be appointed a role in treatment for various pathologies to which necroptosis contributes. These are inflammatory diseases such as atherosclerosis, pancreatitis, inflammatory bowel disease and chronic inflammatory diseases, but also acute tissue damage such as myocardinal infarction,

Figure 5 │ The inhibitory activity of Sorafenib tosylate (Nexavar). Sorafenib inhibits Raf activity, hereby

successfully inhibiting the MAPK/ERK signalisation and by this blocking the survival and proliferation signals

but lifting the inhibition on the apoptotic pathway. Sorafenib does not only have an effect within the cancer

cell but also on the endothelial cells or pericytes that surround cancer cells and are a part of the tumor. By

inhibiting signal transduction of ligated PDGFR an VEGFR, it inhibits angiogenesis, differentiation of the

surrounding cells, proliferation, migration and tubule formation.This leading towards tumor stasis. (Wilhelm,

Carter et al., 2008)

Introduction

23

stroke and ischemia-reperfusion injury. Necroptotic regulated cell death plays also an important role in sepsis, neurodegeneration, and some cancers (Zhou & Yuan, 2014).

The inhibitory effect of Sorafenib on necroptosis was validated in both murine and human cell lines, where it suppressed the necrosome establishment without affecting NF-κB activity pro-inflammatory signaling. Given its function as a multikinase inhibitor, Sorafenib most likely targets a kinase specific too the necroptotic pathway. This means most likely RIPk1 and/or RIPK3 are its targets. During this master dissertation we applied a relatively new assay, the cellular thermal shift assay (CETSA), to validate the interaction between Sorafenib and its potential binding partner.

4.1 Cellular thermal shift assay

Cellular thermal shift assay (CETSA) is a cell-based assay that relies on the principle that ligand-bound proteins or drug-bound proteins have a higher thermodynamic stability as a result of added binding energetics. Because of this additional stability the targeted cellular proteins become more resistant to temperature-induced changes in its protein structure. The cell lysate is exposed to a temperature gradient. At a certain increased temperature proteins that are not ligand bound will denature and precipitate as the internal amino acid interactions (Van der Waals, electrostatic, hydrophobic) within the protein get broken because of the applied thermal energy leading towards unfolding of hidden hydrophobic patches. Proteins that are

however ligand-bound, and by this become more resilient to effects of added energy, stay soluble and can easily be separated and later analysed. As the amount of thermal energy added to the protein-ligand complex rises, it will eventually also unfold. The temperature at which the protein unfolds thus ‘shifts’ after binding of the ligand. The size of this ‘shift’ also implicates the efficiency with which the ligand binds. Advantages of this technique are the lack of need for a functional readout (in comparison to phenotypic assays), its use for high throughput screenings and the possibility to link it to a whole variety of analytical techniques

such as mass spectrometry. TSAs have highly contributed in the research for both drug discovery and structural genomics research in protein-ligand interactions (Groftehauge et al.,

2015; Hau et al., 2011; Layton & Hellinga, 2010; Senisterra et al., 2012). CETSA ads the advantage that target engagement of drug candidates can be performed in a cellular context, and thus at the

target level. This means one can monitor and quantify how a drug candidate reaches and binds its protein target within more complex environments like cell lysates, intact cells and tissues, which allows the target to maintain post-translational modifications and interactions with proteins and other biomolecules. As a result of this more biologically relevant data is obtained (Jafari et al., 2014).

Introduction

24

Aim

25

Aim

In the first part of this master dissertation on necroptosis signaling we focus on the

transcriptional regulation of the mlkl gene. Our first goal is to determine the possible link

between altered Ras signaling in cancer cells and the possible effect it has on the MLKL

expression levels and/or it’s protein activity. We want to do this for all three of the Ras

isoforms (H-Ras, K-Ras, N-Ras) and see if there is a difference in effect on MLKL for every Ras

isoform individually. Secondly we want to determine the link between altered B-Raf signaling

and MLKL expression and activation. As a third aim we want to conclude the possible

differential MLKL expression in primary melanocytes and both metastatic and non-metastatic

melanoma’s using melanoma panels with different EMT panels. This could possibly provide an

idea if the altered expression of microphthalmia-associated transcription factor (MITF)

regulated by the MAPK/ERK pathway is involved in MLKL gene expression in melanoma (Levy

et al., 2006; Primot et al., 2010), . As a last aim we want to determine if c-Myc, β-catenin, ETS1 or

MITF are involved in MLKL gene expression in colon cancer cell lines.

In the second part we want to determine if RIPK1 and/or RIPK3 are targets of the drug

Sorafinib by using a new and promising technique, the cellular thermal shift assay (CETSA) .

Aim

26

Results

27

Results

1. Study of MLKL regulation in stable human cancer cell lines through

As a first strategy we analyzed the regulation of MLKL stable human carcinoma cell lines that are known to have natural mutations causing altered MAPK/ERK signaling. These include all cell lines with altered H-Ras, K-Ras, N-Ras and B-Raf regulation. After screening for cell lines that carry the mutations, three cell lines were selected: a cell line carrying a K-Ras mutation (human colon adenocarcinoma HT-29 cells), a cell line carrying a B-Raf mutation (invasive

melanoma cell line SK-Mel 28) and a control cell line without a known mutation in either B-Raf or one of the Ras isoforms (melanoma cell line MeWo). The first cell line HT-29 was more specifically selected as it has already been used in previous studies concerning MLKL expression (Zhao, Jitkaew et al., 2012).

HT-29 B, MeWo and SK-Mel 28 cell were cultured and treated with EGF in order to stimulate the MAPK/ERK signalization. For all three the cell cultures the same amount of EGF was added at different time points prior to the time point of harvesting. EGF treatment was performed at regular intervals over a course of 24 hours to be able to observe the timeframe in which the MAPK/ERK signalling took place and when the possible changes in MLKL level occurred

after stimulation and signalization. Using western blotting we analysed the translational level of our protein of interest, MLKL, and the protein levels of phosphorylated (activated) ERK to determine if the MAPK/ERK pathway was indeed stimulated. (Figure 6A, B and C).

Based on the observed fluctuations in p-ERK protein levels in all three the cell lines over the timeframe of treatment we can conclude that there is indeed stimulation of the MAPK/ERK signalization pathway. In all three the cell lines we observe that the phosphorylation of ERK is at its strongest point within one hour of EGF-stimulation, indicating this to be a very fast paced process. Remarkably however is the large difference in protein level patterns between all three of the cell lines, this both for MLKL protein levels as p-ERK protein levels. We chose

MeWo as a control cell line, believing as the members of its MAPK/ERK pathway are not mutated that the MLKL levels should have to stay more or less constant given our hypothesis would be legit. This is however not the case as we can notice a difference in the MLKL levels (Figure 6A). P-ERK signalling seems to be at its highest point around 1 hour after EGF stimulation after which is slowly decreases. The highest level of stable MLKL protein was measured around 3 hours after EGF stimulation.

In our B-Raf mutated cell line SK-Mel 28 we notice a complete different pattern in both MLKL and p-ERK protein levels compared to the control melanoma cell line (Figure 6B). Most remarkably is the presence of a secondary, ‘heavier’, band for both cell lines. The second band

in the P-ERK protein detection appears after 1 hour of stimulation and is accompanied by a rise in the first band its intensity. The second band starts to fade away after one hour while the primary band stays at the same intensity for 22 hours. On the other side the intensity of both band detected for MLKL drops 5 hours after stimulation.

Contrary to what we expected to see in our third cell line, HT-29 B, we see no changes in MLKL levels although we can observe a clear, although short, stimulation of the MAPK/ERK pathway

Results

28

(Figure 6C). The MLKL protein levels in this cell line are also surprisingly high compared with the other cell lines.

Figure 6 │ We observe three different situations in MLKL regulation after EGF treatment in our cell lines of

choice. MeWo, SkMel 28 and HT-29 cell lines were treated with EGF. We separately stimulated groups

of cells from all three cell lines 24h, 8h, 6h, 5h, 4h, 3h, 2h and 1h before the cells were harvested. As a

control group we included an untreated group of cells (0h). After harvesting the cells were lysed, protein

levels were determined, samples were diluted to consist comparable total protein levels and western

bot analysis was performed using anti-MLKL and anti-p-ERK antibodies. A) Situation as observed in the

control cell line MeWo. B) Situation as observed in the B-Raf mutated cell line SK-Mel 28. C) Situation

observed in the K-Ras mutated cell line HT-29. All cell lines were treated simultaneously at regular

interval periods for over a course of 24 h. All wells were stimulated with the same EGF concentration

(100ng EGF/ml of medium). Tubulin protein level detection by anti-β-tubulin antibodies was used as

sample protein content control during all Western Blot detections. EGF(h) stands for amount of hours

between EGF stimulation and the moment the cells were harvested for analysis.

Results

29

2. Creation of mutated Ras isoforms, B-Raf and c-Myc transformed cell lines

In a second strategy we wanted to analyze MLKL- levels in cell lines where an inducible mutated Ras, mutated Raf or c-Myc gene was introduced. We selected three mutated human genes of interest: HrasV12, BrafV600E and c-Myc. We used pSin vectors where we cloned these mutated human genes into under the control of a doxycycline-inducible promoter. After every gene we will place a fragment that codes for a HA-tag.

2.1 Cloning of HrasV12, BrafV600E and c-Myc constructs into the pENTR3c vector

The mutated genes were ordered from Adgene within pBabe-puro lentiviral vector (HrasV12, BrafV600E) or pCDH-EF1-T2A-copGFP retroviral vectors (c-Myc). These vectors were transfected in Dh5α E. coli bacteria through heat shock transfection after which they were plated out on agar plates containing antibiotics, so only the bacteria containing the amplified lentiviral or retroviral vector could be able to grow successfully. After this screening step we collected growing colonies from which we isolated the DNA. With these DNA samples we

performed a Miniprep and Maxiprep assay followed by PCR amplification of the open reading frames of HrasV12, BrafV600E and c-Myc. We designed primer sets for all three the genes which contained small fragments of the chosen entry vector pENT3c. As our destination

vector, pSin, already incorporated a sequence coding for a HA-tag we don’t need to add this sequence in our primer sets. We do, however, need to make sure the stop codon present in the genes of interest is not included in our construct. Our genes of interest were successfully amplified (Figure 7). We extracted the correct genes from the agarose gel.

The pENT3C vector was linearized using EcoRI and XhoI restriction enzymes. We separated the

large and the small vector fragment through agarosegel electrophoresis. The large fragment was extracted gel for further use. The PCR products were cloned in frame into the large pENT3C fragment using the CloneEZ® PCR cloning kit (Genscript). After transforming competent Dh5α E. coli strains with this newly formed constructs, a colony PCR screen was

Figure 7 │ Amplification of the ORF. cMyc, HrasV12

and BrafV600E were amplified using a PCR reaction

with specific primers. Both primers encoded small

sequences of the pENTR3c vector for alignment. In

the reverse primer the stop-codon was left out.

Results

30

performed to identify colonies that contain the plasmid with insert (Figure 8). Positive colonies were identified for each construct.

We selected two colonies off every construct. The plasmids were isolated and controlled again

with a EcoRI and XhoI restriction digest (Figure 9). Plasmids with the correct restriction pattern were once more isolated and sequenced to ensure the plasmid contains the full ORF in the correct orientation. In this case we discarded BrafV600E colony #7 because of a faulty restriction pattern.

Figure 9 │ Control restriction digest on pDNA. A EcoRI

and XhoI restriction digest was performed on cMyc,

BrafV600E and HrasV12 transformed colonies that

showed positive results in the colony PCR.

Figure 8: Colony PCR of cMyc, BrafV600E and HrasV12 transformed colonies. All constructs were

transformed in competent Dh5α E. coli strains and grown on LB + Kan plates. Several transformants were

used to perform a PCR reaction with specific primers. Selected colonies are indicated in bold.

Results

31

2.2 Cloning of HrasV12, BrafV600E and c-Myc constructs into the pSin destination vector

By using Gateway® cloning we transfer the genes of interest from the pENT3C entry vector into a pSin destination vector. The destination vector containing the construct was transfected in dH5α DB3.1 E. coli strains as the vector contains ccdB, which is toxic for normal Dh5α strains. The final construct will be used to transform competent human cell lines.1

1 Plasmid construction and cloning was performed under the technical guidance of Inge Bruggeman.

Results

32

3. Analysis of protein lysates derived from EMT melanoma panels

Protein lysates derived from an EMT melanoma panel were provided by the laboratory of Prof. G. Berx, University of Ghent. This panel contains primary melanocytes directly derived from patients and stable melanoma cell lines that were analysed and defined for status of EMT phenotypically (metastatic potential) and based on gene expression profile (genes involved in EMT such as ZEB1 and ZEB2) (Denecker et al., 2014). After we performed Western Blot analysis on this EMT melanoma panel and detected MLKL protein levels, a correlation between higher MLKL protein levels and more highly proliferating melanoma cell lines with low metastatic potential, and thus a not-invasive character, became clear (Figure 10). The highest detected

MLKL levels were found in the A375m and 501Mel cell lines, two cell lines who have been used in previous research as melanoma cell lines with low metastasis potential and a non-invasive character (Carreira et al., 2006; Li et al., 2009). Also the primary, non-melanoma, cell lysates showed a higher level of MLKL protein present although there was were variations between the different ethnicities. MLKL protein levels were however extremely low in the cell lysates of the melanoma cell lines diagnosed with proliferative and invasive phenotypes (FM45, BLM and RPMI7951).

Figure 10 │ MLKL is highly expressed in higher differentiated, non-invasive melanoma cell lines. WB analysis was

performed on a melanoma panel consisting cell lysates derived from 4 invasive melanoma cell lines (FM45,

FM3p, BLM, RPMI7951), 5 differentiated, non-invasive cell lines (HM_AN, SkMel parental, A375 m, MeWo,

501Mel) and 3 primary non-melanoma obtained from people with varying ethnic backgrounds. MLKL levels

were detected using anti-MLKL antibodies. As actin protein level detection proved to not be a trustworthy

control, detection of tubulin levels was used as sample protein content control during all Western Blot

detections. EMT melanoma panel cell lysates were provided by the laboratory of Prof. G. Berx, University of

Ghent.

Results

33

4. In vitro effect of c-Myc, β-catenin, ETS1 and MITF knock-down on MLKL levels

The transcriptional regulation of MLKL, both in normal cells and in stable cancer cell lines is still shrouded in mystery. We wanted to validate if the preliminary data concerning TF c-Myc en MLKL regulation in primary cell lines are applicable in stable cancer cell lines. We also want to determine if any of the TF we selected through database screening have a significant effect on MLKL protein levels in cancer cell lines (Wang et al., 2012a). To evaluate this, we performed an experiment where we repress c-Myc, β-catenin, ETS1 and MITF expression in HCT-116 cells, a colorectal cancer cell line, using siRNAs. We made use of siRNA pools containing 4 different targeting sequneces to reduce OFF-Target affects. As a general control we also transfect HCT-

116 cells with nonspecific siRNA (siNon) (Figure 11). We performed this experiment twice at different points in time and with cells grown at different densities. After 48h of incubation we harvested the cells and performed western blot analysis on the cell lysates. In both trials we see a clear knock-down of both β-catenin and c-Myc, indicating that the siRNA transfection was successful. We could not check the transfection efficiency of ETS1 and MITF as we didn’t have antibodies directed against these two TFs. Both in trial A and trial B we observe no change in MLKL protein levels, indicating that the TFs studied in this experiment had no effect on MLKL expression, pending an effective knockdown of the TFs.

In trial A we also immunoblotted for the expression of p53 protein levels in our cell lysates. Cellular tumor antigen P53 is known to play an crucial role in cell growth regulation and

apoptosis induction in situations of cellular stress, such as DNA damage and oncogenic events. It is a molecule often targeted in cancer cells as its mutated form is unable to bind to DNA allowing cell survival. In this way it allows promotion of cells with tumorigenic mutations (Haffner & Oren, 1995; Ko & Prives, 1996). Furthermore, a possible link between p53 and mlkl gene expression has already been observed during ischemia-reperfusion (Zhang et al., 2014). We suspect MLKL may have a function in delaying cancer cell growth, which could happen in a p53-dependant way. By looking at the p53 levels we wanted to see if there could be any fluctuations. However, we see no difference in p53 protein levels.

We also performed the reverse experiment. A MLKL knock-down experiment in HCT-116 cells using siMLKL to observe changes in β-catenin and c-Myc protein levels. After immunoblotting

with antibodies against MLKL, β-catenin and c-Myc, we see a successful knock-down of MLKL and some variation in β-catenin and c-Myc protein levels compared with the siNon control lane (Figure 12).

Results

34

Figure 11 │ In vitro effect of c-Myc, β-catenin, ETS1 and MITF knock-down on MLKL levels. HCT-116 cells were

either transfected with 20 nM of control siRNA (siCtrl), β-catenin siRNA, ETS1 siRNA, MITF siRNA or c-Myc

siRNA. Cells were harvested 48h post transfection, lysed and immunoblotted with antibodies against MLKL,

β-catenin, p53, c-Myc and actin. Because antibodies directed against ETS1 and MITF were not in our

possession we could not perform western blotting analysis for these TF. A: lower cell culture concentration

(15µl/well of 1ml cell suspension seeded per well). B: Higher cell culture concentration (40µl/well of 1ml cell

suspension seeded per well) .

Figure 12 │ In vitro effect of MLKL knock-down on c-Myc and β-catenin levels. HCT-116 cells were either

transfected with 20 nM of control siRNA (siNon) or MLKL siRNA. Cells were harvested 48h post transfection,

lysed and immunoblotted with antibodies against MLKL, β-catenin, c-Myc and actin.

Results

35

5. Identification of a Sorafenib tosylate target within the necroptotic pathway through cellular thermal shift assay

During independent screenings in the lab of Prof. Jaehwan Song and Prof. Peter Vandenabeele of FDA-approved compounds and kinase-inhibitors, to find a possible necroptosis pathway inhibitor, Sorafenib tosylate emerged as an interesting candidate. The effectiveness as an inhibitor was validated both on mouse and human cells, and proved to be specific for the necroptotic pathway without causing grave side effects as no other pathways were activated. Sorafenib is already known as a potent multikinase inhibitor that targets various kinases in

cancer related pathways. Because of this its target in the necroptotic pathway is most likely to be a kinase, bringing RIPk1 and/or RIPK3 forth as the most potent candidates. Thermal shift assays have already proven their worth in the research for protein-ligand binding (Groftehauge

et al., 2015; Hau et al., 2011; Layton & Hellinga, 2010; Senisterra et al., 2012). Through the use of the cellular thermal shift assay (CETSA), we can examine the interaction of Sorafenib with either RIPK1 or RIPK3 in a way that comes close to the physiological situation making the obtained data very realistic.

5.1 CETSA with intact cells

In our initial research design we wanted to validate binding between Sorafenib and its target protein on the intact cell level by incubating mouse fibrosarcoma L929 cells for a short period of 1 hour with Sorafenib and a positive and negative control compound. This means Sorafenib will have to cross the plasma membrane barrier before being able to bind to its target, which we presume to be located in the cytoplasm, creating a situation which reflects physiological conditions in vitro. To the negative control plate we chose to add dimethylsulfoxide (DMSO),

to the positive control plate we added Necrostatin 1 (Nec-1) a compound known to interact with RIPK1 and thus should stabilize RIPK1 levels in this assay. After the 1 hour chemical pre-treatment the cells were harvested and prepared for the thermal shift assay (TSA), we chose to work with seven different temperatures, varying from 40 °C to 62,5 °C. As immediately after the TSA step we will perform snap-freezing to lysate the cells, protease inhibitors are added in advance. After snap-freezing the cell debris, RNA, DNA and precipitated proteins are

Figure 13 │ Schematic reproduction of

the experiments performed. We both

perform the CETSA assay with intact

cells and lysates obtained from in

vitro cell cultures treated with the

compound of interest or with a

control compound. These samples

will be subjected to different

temperatures to obtain information

about their thermostability with or

without the compound of interest

added. Modified image. Martinez et

al. Science, 2013.

Results

36

separated from the soluble cell fraction containing the heat protected proteins by centrifugation. Western blot analysis was performed on the collected supernatants (Figure 14). Results of the immunoblotting with anti-RIPK1, anti-RIPK3, anti p-cRaf and anti-actine antibodies were however inconclusive with respect to the functioning of the TSA with RIPK1 and its inhibitor. Nec-1 treated cells showed insufficient heat protection for RIPK1 loss. Likewise Sorafenib showed no clear protection for p-cRaf loss, cRaf is however known to be a target for Sorafenib. Altogether this results in no significant data for our positive control samples. On the other hand our DMSO-treated negative control cells showed a comparable protection against protein loss to the positive control samples. Furthermore there was some sample loss due to PCR tubes opening during the snap-freezing step.

We decided the experiment needed to be redone and that there was need for troubleshooting in our set-up. We repeated the experiment but this time also treated the cells with either 0 hours, 1 hour or 3 hours of TNF/z-VAD-fmk stimulation initiating TNF-induced signalization while z-VAD-fmk, a caspase inhibitor, mediated inhibition of the TNF-induced apoptosis pathway. As this stimulation induces necroptotic chock we expected to notice upregulated levels of activated RIPK1 and RIPK3. The data we collected from the western blotting analysis were however again very inconclusive (data not given).

Results

37

5.2 CETSA with cell lysate

Because CETSA with intact cell did not give a conclusive result, we altered our strategy and decided to repeat the assay but this time on whole cell lysate extracts. This however reflects the in vitro situation in a less correct way. After harvesting L929 cells are immediately subjected to snap-freezing followed by a 30 minute chemical treatment with DMSO, Sorafenib or Nec-1. After this the cell lysates are exposed to heating. We performed a TSA with temperatures ranging between 40 to 60 °C (6 different temperatures). We observed clearly better results through this strategy (Figure 14). In this figure we only show the data for the experiment at 44 °C, 48 °C and 52 °C as these gave the most distinct results (Figure 15). Our positive Nec-1 treated control samples showed clear signs of heath protection towards RIPK1

loss at higher temperatures. We also observed a stabilization of RIPK3 protein levels in the Sorafenib treated samples indicating protection against heat destabilization.

Figure 14 │Identification of Sorafenib target based on CETSA with intact cells. L929 cells were either treated

with 20 nM Sorafenib (Sora), Necrostatin-1 (Nec-1), a positive control compound, or DMSO, a negative

control compound. Cells were harvested 1h post treatment and aliquoted. Individual samples were subjected

to either 40 °C, 41,1 °C, 44,6 °C, 49,2 °C, 55 °C, 59,8 °C or 62,5 °C for three minutes, followed by repeated

snap-freezing, thawing and centrifugation to separate the soluble fraction. Western blotting was performed

with antibodies against RIPK1, RIPK3 and actin. Sample loss due to faulty material during the snap-freezing

step is indicated as loss.

Results

38

To verify this we performed this experiment using a more narrow range of temperatures going

from 44 until 54 °C and using higher compound levels. Again we noticed a clear stabilizing

influence of Nec-1 on RIPK1 levels and of Sorafenib on RIPK3 levels during the TSA (Figure 16).

Figure 15 │Identification of Sorafenib target based on CETSA. L929 cells were harvested followed by repeated

snap-freezing, thawing and extraction of the soluble fraction. Samples were either treated with 50 nM

Sorafenib (Sora), Necrostatin-1 (Nec-1)(positive control) or DMSO (negative control). After 30min of

incubation the samples were divided in aliquots. Individual aliquots were subjected to either 40 °C, 44 °C, 48

°C, 52 °C, 56 °C or 60 °C for three minutes. Western blotting was performed with antibodies against RIPK1,

RIPK3 and β-actin.

Results

39

Figure 15 │Identification of Sorafenib target based on CETSA. L929 cells were harvested followed by repeated

snap-freezing, thawing and extraction of the soluble fraction. Samples were either treated with 100 nM

Sorafenib (Sora), Necrostatin-1 (Nec-1)(positive control) or DMSO (negative control). After 30min of

incubation the samples were divided in aliquots. Individual aliquots were subjected to either 40 °C, 44 °C, 48

°C, 52 °C, 56 °C or 60 °C for three minutes. Western blotting was performed with antibodies against RIPK1,

RIPK3 and β-actin.

Results

40

Discussion

41

Discussion

Necroptosis can be described as a genetically controlled form of necrosis, a type of cell death associated with plasma membrane permeabilization and release of intracellular proteins that function as Damage Associated Molecular Patterns (DAMPs). These DAMPs include mitochondrial DNA, N-formyl peptides from mitochondrial translation, High Mobility Group Protein 1 (HMGB1) chromatin binding nuclear proteins, Heat Shock Proteins (HSPs) (Kaczmarek et al., 2013). This release of DAMPs is detected by Pattern Recognizing Receptors (PRR) on cells of the innate immune system, leading to modulation of the inflammatory

signaling pathways. This can cause negative effects such as tissue damage and severe inflammation contributing to pathophysiology of several disorders including ischemia-reperfusion injury, but also protects the organism by removal of virus-infected cells (Degterev

et al., 2005; Kono & Rock, 2008). Thanks to the extensive research using genetic, cell biology and biochemistry approaches, performed in the past decades, great progress has been made regarding our knowledge about necroptosis. As a result of these efforts it was discovered that the formation of the necroptosis-inducing complex, called the necrosome, consisting of RIPK1, RIPK3 and MLKL, is a crucial event in the necroptosis pathway (Cho et al., 2009a; He et al., 2009;

Holler et al., 2000; Sun et al., 2012; Vandenabeele et al., 2010; Zhang et al., 2009). However still many things remain elusive about the necroptotic pathway, particularly when it comes to MLKL, the most

downstream mediator of necroptosis identified so far. While its interaction with and activation by RIPK3 and the general protein structure are known, the exact function MLKL occupies in the necroptotic pathway, its downstream interacting partners, and its regulation by transcription factors under various conditions are still mostly undefined (Murphy et al., 2013;

Sun et al., 2012).

As mentioned above the initiation of the necroptotic pathway, the RIPK1/RIPK3/MLKL necrosome formation, events downstream of the necrosome formation and the role necroptosis plays in pathologies already formed the subject of intensive research (Cai et al.,

2014; Degterev et al., 2005; Li et al., 2012). Likewise, the pleiotropic role of the RIPK1-RIPK3-MLKL

axis in inflammatory reaction induction has been a research topic of great interest in the past few years (Kang et al., 2015; Lawlor et al., 2015; Vince et al., 2012). However little is known about the possible pleiotropic functions of MLKL independent from necroptosis. One of these functions could be the involvement of MLKL in cancer cell initiation or maintenances. MLKL has already been linked to cancer as it has been identified as a good prognostic factor for the treatment of ovarian cancer and pancreatic adenocarcinoma (Colbert et al., 2013; He et al., 2013). This is probably associated with sensitivity to necroptosis during chemotherapy (Fulda, 2014), and so, is RIPK1 and RIPK3 related. However, a possible MLKL activity independent of RIPK3 phosphorylation have not been considered in detail yet.

During this master dissertation we wanted to determine if MLKL is situated down-stream of

an oncogenic mutation and is a target gene of transcription factors with aberrant regulation in human colorectal cancer cell lines and human melanoma cancer cell lines. Based on preliminary data, we investigated if mutations in the MAPK/ERK pathway, rendering it constitutively activated, had an influence on MLKL protein levels. More specifically we looked at the effect of mutated H-Ras (HrasV12), K-Ras (KrasG13D) and B-Raf (BrafV600E). The same preliminary data suggested c-Myc, a transcription factor situated downstream of the

Discussion

42

MAPK/ERK pathway, might have influence on mlkl gene expression. We generated two strategies. In our first strategy we selected stable human carcinoma cell lines with a known natural mutation for either H-Ras, K-Ras or B-Raf. We selected three cell lines: a cell line carrying a K-Ras mutation (human colon adenocarcinoma HT-29 cells), a cell line carrying a B-Raf mutation (SK-Mel 28) and a control melanoma cell line without a known mutation in either B-Raf or one of the Ras isoforms (MeWo). The MAPK/ERK pathway was activated by EGF treatment. After western blot analysis we could observe there was activation of the MAPK/ERK pathway based in p-ERK levels. The results we obtained from the Western blot analysis regarding MLKL however, did not generate any conclusive data yet. We performed this experiment only once, so we cannot conclude about the reproducibility of the findings.

Repeating of the experiment an further analysis could bring more conclusive results. Protein levels for active phosphorylated MLKL should be observed to conclude if there was an increase of potentially active MLKL levels. Also RIPK3 protein levels should be considered to see if oncogenic MAPK/ERK signalisation influences the necroptotic pathway or influences merely activated MLKL. It could be that we don’t notice big differences on protein level, but that doesn’t mean there could no changes on mRNA level. To date the results we obtained during our experiment only give information of the effect MAPK/ERK has on the translational level as the readout was a western blot, we should also look at the transcriptional level by qPCR to see if the mlkl gene is truly upregulated.

In our second strategy we wanted to create transformed human cell lines with an inducible

vector carrying the mutated oncogenes. We successfully cloned HrasV12, BrafV600E and c-Myc constructs into the doxycycline inducible pSin destination vectors containing a HA-tag sequence behind the entry site, but were not able to transform cell lines because of lack of time. As a result of this we did not obtain any data on regulation of MLKL mRNA or protein levels after oncogene induction.

We also wanted to determine possible transcription factors that could regulate mlkl expression. Both based on preliminary data and mlkl gene expression profiles found in a siRNA-treated A375 melanoma cells database (Wang et al., 2012a), we selected four possible TF for mlkl regulation: c-Myc, β-catenin, ETS1 and MITF. We performed a siRNA mediated knock-

down of these TF in human colorectal HCT-116 cells. We observed a successful knock-down for both c-Myc and β-catenin. Because we did not have antibodies against ETS1 and MITF, we could not be certain there was a successful knock-down of these TFs. However no change in MLKL protein levels was detected, indicating that the TFs studied in this experiment had probably no effect on MLKL expression, pending an effective knockdown of the TFs. Just as in the previous experiment we should also look at the transcriptional level to make a clear conclusion about the effects of the TFs. Repeating this experiment in a different stable human cancer cell line, be it either colorectal or not, could possibly give additional results. As the data we based our selection of the TF on was generated in a melanoma cell line, performing this experiment in human melanoma cells seems a legitimate alternative.

As B-Raf and N-Ras mutations play an important role in the EMT transformation process in malignant melanomas, it seemed interesting to look at the MLKL levels in both melanoma cell lines with high metastatic potential and low metastatic potential. We observed an interesting correlation between high MLKL protein levels in cell lines with low metastatic potential and low MLKL protein levels in cell lines with an EMT phenotype. The highest detected MLKL levels were found in primary human melanocytes, the A375m and 501Mel cell lines. These two cell

Discussion

43

lines have been used in previous research as melanoma cell lines with low metastasis potential and a non-invasive character (Carreira et al., 2006; Li et al., 2009). The melanoma panel used in this experiment was previously used in EMT research in melanoma cell lines regarding the protein levels of ZEB1, ZEB2 and MITF (Denecker et al., 2014). When we compared the western blot data of our experiment with data published (Denecker et al., 2014)., we observed that MLKL protein levels correlated with high protein levels of ZEB2 and MITF in 501Mel but also with high protein levels of ZEB2 and ZEB1 but low MITF levels in A375m. High expression levels of zeb2 and low expression levels of zeb1 have been detected in highly proliferating cell lines with low metastatic potential while high expression levels of zeb1 combined with downregulation of zeb2 are correlated with EMT-TF reprogramming (Caramel et al., 2013). ZEB2 regulates the

expression of mitf and, as a result of this, the development and differentiation of melanocytes (Denecker et al., 2014). It is interesting to notice that MLKL protein levels are elevated both in a situation of higher differentiation (501Mel) and a situation where both ZEB2 and ZEB1 are expressed and MITF levels are low (A375m). There is however no conclusive indication that there indeed is a correlation between these EMT-TFs and mlkl gene expression. It is also important to note that melanoma are genetically very complex and can differ substantially from each other when it comes to genetic alterations. Still these findings could however point out a function of MLKL unrelated to its role in necroptosis or could indicate an interconnection between more differentiated phenotypes in melanoma cells and higher sensitivity for necroptosis, given that RIPK3 is present. If this is the case then activation of the necroptotic

pathway could be used as a treatment for these melanoma. However, by suggesting this, we should take in consideration that the process of necroptosis may also facilitate the release of endogenous danger signals, which may contribute to tumor promoting effects as a result of inflammation (Pasparakis & Vandenabeele, 2015). Regarding the latter hypothesis it seems to be advisable to also measure RIPK3 levels in this melanoma panel.

As mentioned earlier, if necroptosis is triggered as a result of death receptor activation the release of DAMP may potentially lead to tissue damage, misguided immune response activation, cancer growth promotion and inflammation (Kaczmarek et al., 2013). The latter contributing to the pathogenesis of inflammatory diseases such as, for example, ischemia-reperfusion injury and sepsis (Cauwels et al., 2003; Degterev et al., 2005; Kono & Rock, 2008; Pasparakis &

Vandenabeele, 2015). In these cases a drug-induced inhibition of the necroptotic pathway would be desirable. During independent screenings in the lab of Prof. Jaehwan Song and Prof. Peter Vandenabeele of a kinase inhibitor library and an FDA-approved drug library, to find a possible necroptosis pathway inhibitor, Sorafenib tosylate emerged as an interesting candidate. The effectiveness as an inhibitor was validated both on mouse and human cells, and proved to be specific for the necroptotic pathway without causing grave side effects as no other pathways were activated. Sorafenib is already known as a potent multikinase inhibitor that targets various kinases in cancer related pathways such as Raf1 and VEGFR/PDGFRb/FGFR1. Because of this its target in the necroptotic pathway is most likely to be a kinase, bringing RIPK1 and/or RIPK3 forth as the most potent candidates. We initially performed a cellular thermal shift assay

on L929 cells that were either treated with DMSO, Nec-1 or Sorafenib. The data we generated was however inconclusive, even after multiple trials of the experiment. This could indicate that in this set-up CETSA on intact cells is not applicable. As a result of these complications we decided to perform CETSA on whole cell lysate extracts. We do however need to take into account that this reflects the in vitro situation in a less correct way since the context of protein interactions may have been changed during lysis. However, using this strategy we were more

Discussion

44

successful in retrieving clear data. We observed that Sorafenib has a stabilizing effect on RIPK3 protein levels during the CESTA, indicating that Sorafenib binds to RIPK3. For RIPK1 this was however not the case. To further examine this possible interaction we need to perform functional assays like a 32P phosphorylation assay to determine if Sorafenib blocks phosphorylation of RIPK3. On structural level we could determine if there is indeed interaction between the two by performing mass spectroscopy analysis. We should also perform the CETSA assay again following induction of the necroptotic pathway to determine how effective Sorafenib blocks the necroptotic signalling. Also by adjusting the concentration of Sorafenib we treat the cells with, we can fine-tune our knowledge about the effectiveness of Sorafenib.

Sorafenib is known to bind ATP-binding pockets in its targets whit high affinity when they are

they are in their inactive conformation (Nagar et al., 2002). As a result of this its RTK targets PDGFR and VEGFR are unable to phosphorylate their tyrosine target residues. When binding to its receptor tyrosine kinase targets like c-Kit and Raf it stabilizes the autoinhibitory inactive form by binding residues from the Asp-Phe-Gly (DGF) motif, a strongly conserved tripeptide motif present in most human kinases (Haluska & Ibrahim, 2006; Simard et al., 2009). As a result the DGF motif is turned outwards thus blocking any movement of the nearby activation loop (A-loop) (Wan et al., 2004). In this position ATP is unable to bind because it is sterically hindered by the DGF motif and the catalytic kinase domain is unable to undergo a conformational change and become active. Structural research of RIPK3 has shown that it also contains a DGF motif in its activation loop (Xie et al., 2013b). The kinase domains of RIPK1 and RIPK3 share 33%

sequence identity and 53% sequence similarity, both also have the essential amino acids needed for ATP binding and hydrolysis in canonical kinases, such as the catalytic triad residues Lys51/Glu61/Asp161 located in the P-loop, conserved (Xie et al., 2013a; Xie et al., 2013b). However instead of a DGF motif, RIPK1 has a Asp-Ser-Phe (DLG) motif that has a different conformation (Xie et al., 2013a). This difference in conformation might explain why Sorafenib stabilises RIPK3 but not RIPK1 in the assay we performed. This does however not mean that RIPK1 is not a target of Sorafenib, variations in used cell lines and different experimental set-ups might lead to different results. It is very well possible that Sorafenib can bind both to RIPK1 or RIPK3 depending on the conditions. Further research can bring more clearance about this.

To conclude, to date we found no clear indication that there is a link between altered MEK/ERK signalisation in stable human colorectal and melanoma cancer cells. We were also not able to point down a transcription factor involved in mlkl gene regulation. We did however observe an interesting correlation between high MLKL protein levels in cell lines with low metastatic potential and low MLKL protein levels in melanoma cell lines with an EMT phenotype. This may either indicate a correlation between EMT-TFs an MLKL expression or a higher sensitivity for necroptosis in malignant melanoma with low metastatic character. Finally, we tried to determine whether RIPK1 or RIPK3 forms a target for Sorafenib tosylate, a cancer drug that through recent screens was discovered to specifically inhibit necroptosis. We generated data through cellular thermal shift assay that strongly suggest RIPK3 forms a target for Sorafenib

tosylate.

Discussie

45

Discussie

Necroptosis kan beschreven worden als een genetisch gecontroleerde vorm van necrosis, een type celdood geassocieerd met plasma membraan permeabiliteit en het vrijkomen van eiwitten die functioneren als Damage Associated Molecular Patterns (DAMPs). Deze DAMPs zijn mitochondrial DNA, N-formyl peptides afkomstig van mitochondriale translatie, High Mobility Group Protein 1 (HMGB1) chromatin binding nuclear proteins, Heat Shock Proteins (HSPs) (Kaczmarek et al., 2013). Wanneer deze DAMPs vrijkomen worden ze gedetecteerd door by Pattern Recognizing Receptors (PRR) aanwezig op het celoppervlak innate immuun

cellen, wat leidt tot modulatie van de inflammatoire signalisatie pathway. Dit kan leiden tot negatieve effecten zoals weefsel schade en zware inflammatie die bijdraagt tot de pathology van verschillende aandoeningen zoals ischemia-reperfusion injury, maar het beschermt het organisme ook door virus-geïnfecteerd cellen te verwijderen (Degterev et al., 2005; Kono & Rock, 2008). Dankzij uitgebreid onderzoek gebruik makende van genetisch, cel biologisch en biochemisch onderzoek, uitgevoerd in de voorbije jaren, is er grote vooruitgang geboekt in verband met onze kennis over necroptosis. Hieruit kwam de ontdekking hoe het necroptosis-inducerend complex, bestaande uit RIPK1, RIPK3 en MLKL zich vormt voort. Dit is een cruciale stap in de necroptosis signalisatie weg (Cho et al., 2009a; He et al., 2009; Holler et al., 2000; Sun et al., 2012; Vandenabeele et al., 2010; Zhang et al., 2009) . Veel zaken zijn echter nog

steeds onduidelijke over deze pathway, vooral in verband met MLKL, de laatst gelegen mediator in de signalisatie weg. De interactie met en activatie van MLKL door RIPK3 en de eiwit structuur van MLKL zijn reeds gekend maar over de exacte functie van MLKL in deze pathway, zijn downstream interactie partners en de regulatie door transcriptie factoren onder verschillende condities zijn nog steeds onduidelijk (Murphy et al., 2013; Sun et al., 2012).

Zoals eerder vermeld zijn de necroptotische pathway, de RIPK1/RIPK3/MLKL necrosoom formatie, de gebeurtenissen downstream gelegen van het necrosoom en de rol die necroptosis speelt in pathologie reeds onderwerpen van uitgebreid onderzoek (Cai et al., 2014; Degterev et al., 2005; Li et al., 2012). Ook de pleiotropische rol voor de RIPK1-RIPK3-

MLKL as in inflammatoire reactie inductie is grondig onder de loep genomen de voorbije jaren (Kang et al., 2015; Lawlor et al., 2015; Vince et al., 2012). Daar tegenover staat echter dat er weinig gekend is over mogelijke pleiotropische functies van MLKL, onafhankelijk van necroptosis. Eén van deze functies zou de ondersteuning van tumor vorming en het onderhouden van deze tumor kunnen zijn. MLKL werd eerder al beschreven in kankeronderzoek als een goede prognostische factor in de behandeling van eierstokkanker en pankreas adenocarinoma’s (Colbert et al., 2013; He et al., 2013). Dit is waarschijnlijk geassocieerd met gevoeligheid voor necroptosis tijdens chemotherapie (Fulda, 2014), en is dusdanig RIPK1 en RIPK3 afhangkelijk. Een mogelijke rol voor MLKL onafhankelijk van zijn fosforylatie door RIPK3, is tot nu toe nog niet in detail bekeken.

In deze master thesis willen we bepalen of MLKL gesitueerd kon worden down stream van een oncogene mutatie en dus een doelwit is voor transcriptie factoren met een aberrante regulatie in humaan colorectale kanker cellijnen en melanoma cellijnen. Ons baserend op preliminaire data, onderzochten we of muaties in de MAPK/ERK pathway, waardoor deze constitutief actief is, een invloed hebben op MLKL eiwit levels. Meer specifiek keken we naar het effect van mutant H-Ras (HrasV12), K-Ras (KrasG13D) en B-Raf (BrafV600E). Dezelfde

Discussion

46

preliminaire data suggereerde dat c-Myc, een transcriptie factor stroomafwaarts gelegen van de MAPK/ERK pathway, een invloed zou kunnen hebben op MLKL expressie. We stelde twee strategien op om dit te onderzoeken. In onze eerste strategie selecteerden we drie cellijnen met een gekende mutatie in H-Ras, K-Ras of B-Raf.: een cellijn met een mutatie in K-Ras (human colon adenocarcinoma HT-29 cells), een cellijn met een B-Raf muatie (SK-Mel 28) en een controle melanoma cellijn (MeWo). De MAPK/ERK pathway werd gestimuleerd door een EGF behandeling. Na het uitvoeren van een Western blot analyse gericht tegen p-ERK en MLKL, zagen we dat er inderdaad MAPK-ERK stimulatie optreedt maar de MLKL data gaven geen duidelijke resultaten. Het experiment werd echter maar éénmaal uitgevoerd waardoor we hier geen conclusie uit kunnen opmaken. Het opnieuw uitvoeren van dit experiment en

verder analyse zou meer duidelijkheid kunnen scheppen. We zouden kunnen kijken naar de p-MLKL levels om te bepalen of er meer potentieel actief MLKL aanwezig was na stimulatie. Ook zou er kunnen gekeken worden naar de aanwezigheid van verhoogde RIPK3 waarden, wat zou kunnen wijzen op een verhoogde necroptosis signalisatie. Onze data geven enkel informatie over hoe MLKL beinvloed zou kunnen worden op translationeel vlak aangezien onze read out een western blot was, we zouden ook moeten kijken naar mogelijke opregulatie op transcrptioneel vlak via een qPCR.

In onze tweede strategie wilden we getransformeerde humane cellijnen met een induceerbare vector die een gemuteerd oncogen bezit genereren. We cloneerder met succes HrasV12, BrafV600E en c-Myc constructen in doxycycline induceerbare pSin vectoren die een

HA-tag sequentie bezitten gelokaliseerd na de entry site. We konden echter geen getransformeerde cellijnen aanmaken door gebrek aan tijd. Hierdoor waren we niet in staat om data te verkrijgen over MLKL eiwit en mRna waarden.

We wilden ook mogelijke transcriptiefactoren voor mlkl expressie bepalen. We baseerden ons zowel op preliminaire data als op mlkl gen expressie profielen uit een sRNA behandelde A375 melanoma cell database (Wang et al., 2012a)., we selecteerden vier mogelijke TF voor mlkl regulatie: c-Myc, β-catenin, ETS1 and MITF. We voerden een sRNA gemedieerde knock-down van deze TF uit in humana colorectal HCT-116 cellen. We zagen een succesvolle knock-down voor c-Myc en β-catenin, maar vanwege hetfeit dat we niet over de gepaste antilichamen

beschikten konden we de knock-down niet valideren voor ETS1 en MITF. We zagen geen verandering in MLKL waarden. Het herhalen van dit experiment in een andere cellijk wou misschien meer succes kennen. Aangezien de data waar we ons op baseerden werd gegenereerd in een melanoma cellijn, lijkt het uitvoeren van dit experiment in melanoma cellijn een legitiem alternatief.

B-Raf en N-Ras mutaties spelen een belangrijke rol in het EMT proces in kwaadaardige melanoma. Het leek ons interessant om naar de MLKL levels te kijken in melanoma met een hoog metastase potentieel en een laag metastase potentieel. We namen een interessante correlatie waar tussen verhoogde MLKL levels en cellijnen met een laag metastase potentieel en lage MLKL waarden in cellijnen met een EMT fenotype. Het melanoma panel dat gebruikt

werd in dit experiment werd eerder al gebruikt in EMT onderzoek in verband met ZEB1, ZEB2 en MITF. Gebaseerd op de gepubliceerde western blot data (Denecker et al., 2014). Zagen we een correlatie tussen hoge MLKL waarden en enerzijds hoge ZEB2 en MITF waarden en anderzijds met hoge ZEB en ZEB2 waarden. Dit experiment geeft echter niet voldoende indicatie dat er daadwerkelijk een verband tussen mlkl expressie en EMT-TF-s bestaat. Het is ook belangrijk om te onthouden dat melanoma cellijnen genetisch bijzonder complex zijn dat

Discussion

47

er onderling grote verschillen kunnen bestaan in qua genetische aanpassingen. Onze dat zouden kunnen wijzen op een verhoogde gevoeligheid van meer gedifferentieerde melanoma voor necroptosis, gegeven dat RIPK3 aanwezig is.

Zoals eerder vermeld, als necroptosis getriggerd wordt als het resultaat van celdood receptor activatie, kan het vrijkomen van DAMPs leiden tot weefselschade, verkeerdelijk gerichte immuunrespons activatie, kankercel groeibevordering en inflammatie (Kaczmarek et al., 2013). De laatst vernoemde draagt bij tot de pathogenesis van inflammatoire ziektes zoals , ischemia-reperfusion injury and sepsis (Cauwels et al., 2003; Degterev et al., 2005; Kono & Rock, 2008; Pasparakis & Vandenabeele, 2015). In zulke gevallen zou een drug-geinduceerde inhibitie van necroptosis wenselijk zijn. Tijdens onafhankelijke screenings

.

As mentioned earlier, if necroptosis is triggered as a result of death receptor activation the release of

DAMP may potentially lead to tissue damage, misguided immune response activation, cancer growth

promotion and inflammation (Kaczmarek et al., 2013). The latter contributing to the pathogenesis of

inflammatory diseases such as, for example, ischemia-reperfusion injury and sepsis (Cauwels et al., 2003;

Degterev et al., 2005; Kono & Rock, 2008; Pasparakis & Vandenabeele, 2015). In these cases a drug-

induced inhibition of the necroptotic pathway would be desirable. During independent screenings in the

lab of Prof. Jaehwan Song and Prof. Peter Vandenabeele of a kinase inhibitor library and an FDA-approved

drug library, to find a possible necroptosis pathway inhibitor, Sorafenib tosylate emerged as an interesting

candidate. The effectiveness as an inhibitor was validated both on mouse and human cells, and proved to

be specific for the necroptotic pathway without causing grave side effects as no other pathways were

activated. Sorafenib is already known as a potent multikinase inhibitor that targets various kinases in

cancer related pathways such as Raf1 and VEGFR/PDGFRb/FGFR1. Because of this its target in the

necroptotic pathway is most likely to be a kinase, bringing RIPK1 and/or RIPK3 forth as the most potent

candidates. We initially performed a cellular thermal shift assay on L929 cells that were either treated

with DMSO, Nec-1 or Sorafenib. The data we generated was however inconclusive, even after multiple

trials of the experiment. This could indicate that in this set-up CETSA on intact cells is not applicable. As a

result of these complications we decided to perform CETSA on whole cell lysate extracts. We do however

need to take into account that this reflects the in vitro situation in a less correct way since the context of

protein interactions may have been changed during lysis. However, using this strategy we were more

successful in retrieving clear data. We observed that Sorafenib has a stabilizing effect on RIPK3 protein

levels during the CESTA, indicating that Sorafenib binds to RIPK3. For RIPK1 this was however not the

case. To further examine this possible interaction we need to perform functional assays like a 32P

phosphorylation assay to determine if Sorafenib blocks phosphorylation of RIPK3. On structural level we

could determine if there is indeed interaction between the two by performing mass spectroscopy

analysis. We should also perform the CETSA assay again following induction of the necroptotic pathway to

determine how effective Sorafenib blocks the necroptotic signalling. Also by adjusting the concentration

of Sorafenib we treat the cells with, we can fine-tune our knowledge about the effectiveness of Sorafenib.

Sorafenib is known to bind ATP-binding pockets in its targets whit high affinity when they are they are in

their inactive conformation (Nagar et al., 2002). As a result of this its RTK targets PDGFR and VEGFR are

unable to phosphorylate their tyrosine target residues. When binding to its receptor tyrosine kinase

targets like c-Kit and Raf it stabilizes the autoinhibitory inactive form by binding residues from the Asp-

Phe-Gly (DGF) motif, a strongly conserved tripeptide motif present in most human kinases (Haluska &

Ibrahim, 2006; Simard et al., 2009). As a result the DGF motif is turned outwards thus blocking any

movement of the nearby activation loop (A-loop) (Wan et al., 2004). In this position ATP is unable to bind

because it is sterically hindered by the DGF motif and the catalytic kinase domain is unable to undergo a

conformational change and become active. Structural research of RIPK3 has shown that it also contains a

Discussion

48

DGF motif in its activation loop (Xie et al., 2013b). The kinase domains of RIPK1 and RIPK3 share 33%

sequence identity and 53% sequence similarity, both also have the essential amino acids needed for ATP

binding and hydrolysis in canonical kinases, such as the catalytic triad residues Lys51/Glu61/Asp161

located in the P-loop, conserved (Xie et al., 2013a; Xie et al., 2013b). However instead of a DGF motif,

RIPK1 has a Asp-Ser-Phe (DLG) motif that has a different conformation (Xie et al., 2013a). This difference

in conformation might explain why Sorafenib stabilises RIPK3 but not RIPK1 in the assay we performed.

This does however not mean that RIPK1 is not a target of Sorafenib, variations in used cell lines and

different experimental set-ups might lead to different results. It is very well possible that Sorafenib can

bind both to RIPK1 or RIPK3 depending on the conditions. Further research can bring more clearance

about this.

Method and materials

46

Methods and materials

Western blot analysis

Data gathered in Belgium: Cells were lysed in Laemli-lysis buffer (50 mM Tris-HCl pH 6.8, 10 %

glycerol, 2 % SDS). After boiling and centrifuging the samples, 10 or 20 μg of protein was

resolved by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and

transferred to a Polyvinylidene Fluoride (PVDF) membrane through semi-wet transfer.

Membranes were incubated with primary antibodies and appropriate HRP-labeled secondary

antibodies. Detection was performed with the PerkinElmer enhanced chemiluminescence

(ECL) Western Blotting Substrate and dark film development. The following antibodies were

used: anti- β-actin (1/20000) (MP); anti-hMLKL (1/3000) (GeneTex); anti-p-Erk (1/2000) (cell

signaling technology); horseradisch peroxidase –conjugated secondary antibodies against

mouse/rabbit immunoglobulin (1/3000) (eBioscience); horseradisch peroxidase –conjugated

secondary antibodies against goat immunoglobulin (1/15000) (Santa Cruz Biotechnology);

rabbit anti-praf (1/2000) (cell signaling); rabbit anti-hRIP3 (1/2000) (PA1-41533, Pierce); rabbit

anti-mRIP3 (1/2000) (imgenex), .

Data gathered in South-Korea: Cells were lysed in Laemli-lysis buffer (50 mM Tris-HCl pH 6.8,

10 % glycerol, 2 % SDS). After boiling and centrifuging the samples, 10 or 8 μl of cell lysate

was resolved by SDS-PAGE and transferred to a PVDF membrane through wet transfer.

Membranes were incubated with primary antibodies and appropriate HRP-labelled secondary

antibodies (Goat anti-rabbit IgG-HRP, enzo; Goat anti-mouse IgG-HRP, Invitrogen). Detection

was performed with the Bio-rad ECL Western Blotting Substrate and LAS development. The

following antibodies were used: rabbit β-actin (1/2000) (A5316, sigma); rabbit β-catenin

(1/2000) (BD Transduction Laboratories); mouse anti-cMyc (1/2000) (cell signaling

technology); mouse anti-RIP1 (1/1000) (610409, BD Transduction Laboratories); rabbit anti-

p53 (1/1000) (Santa Cruz Biotechnology); rabbit anti-praf (1/2000) (cell signaling technology);

rabbit anti-hRIP3 (1/2000) (PA1-41533, Pierce); rabbit anti-mRIP3 (1/2000) (imgenex), .

EGF kinetics assay

MeWo, Sk-Mel 28 and HT-29B cells were grown in 12-well plates. Separate wells of each cell

line were treated with 100ng EGF per ml of medium 24 h, 8 h, 6 h, 5 h, 4 h, 3 h, 2 h and 1 h

before the cells were harvested with lyse buffer + protease cocktail. Protein concentration

were determines through Bradford assay. We used recombinant human EGF (AF-100-15,

Peprotech) stock solution 200µg/mL, solvent 5% Trehalose.

Cell lines

Belgium: HT-29 B cells were grown in EMEM+ 10 % Fetal Calf serum + 100 x L-glutamine + 100x

non-essential amino acids. MeWo cell lines were grown in DMEM+ 10 % fetal calf serum (FCS)

+ 100 x L-glutamine (L-glu) + 100 x non-essential amino acids (neaa) + 250x sodium-pyruvate.


47

SK-Mel 28 cells were grown in RPMI+ 10 % FCS + 100 x L-glu + 100 x neaa + 250x Sodium-

Pyruvate. All cells were split fitting to their growth rate.

Korea: HT-29 and HCT-116 cells were grown in RPMI + 10 % FCS + 1 % antibiotics. L929 cells

were grown in DMEM 10 % FCS + 1 % antibiotics. All cells were split fitting to their growth

rate.

Melanoma panel

Quantified EMT melanoma panel cell lysates were kindly provided by the laboratory of Prof.

G. Berx, University of Ghent.

Cloning

The pBabe-puro retroviral vector (HrasV12, BrafV600E) or pCDH-EF1-T2A-copGFP retroviral

vectors (c-Myc). The HrasV12 were transformed in dH5α E. coli cells via heat shock

transformation and grown at 28 °C on LB + puromycine. DNA material was extracted and pDNA

purification using QIAprep Spin miniprep and maxiprep Kit (Qiagen). Hrasv12, BrafV600E and

c-Myc constructs were obtained by performing a PCR reaction on and template plasmids with

Phusion DNA Polymerase using following primers:

pENTR3C_hcMyc-FW (ATCCGGTACCGAATTCACATGCCCCTCAACGTTAGCTTC),

hcMyc_pENTR3C-REV (GTCTAGATATCTCGAGTGCGCACAAGAGTTCCGTAGCTG),

pENTR3C_hHras-FW (ATCCGGTACCGAATTCACATGCCCCTCAACGTTAGCTTC),

hHras_pENTR3C-REV (ATCCGGTACCGAATTCACCATGCCCCTCAACGTTAGCTTC)

pENTR3C_hBraf-FW (ATCCGGTACCGAATTCACCATGGCGGCGCTGAGCGGTG),

hBraf_pENTR3C-REV (GTCTAGATATCTCGAGTGGTGGACAGGAAACGCACCAT).

The pENTR3C vectors were linearized using EcoRI and XhoI restriction enzymes (Thermo

Fisher), followed by cloning the PCR fragments in the linearized vector using the CloneEZ©

PCR Cloning Kit (Gencript). The plasmids were subsequently transformed in dH5α. coli cells via

heat shock transformation and grown at 28 °C on LB + puromycine. To identify colonies

containing correctly cloned plasmids, we performed a colony PCR using the primers described

above. Validated colonies were controlled by performing a EcoRI and XhoI control restriction

digest. Colonies that produced a correct restriction pattern were sequenced.

Cellular thermal shift assay (CESTA)

Cell-lysate: L929 cells were grown in 100mm plates and treated with earlier mentioned by

amounts of Sorafenib, Necrostatin-1 or DMSO. After 1h of incubation the samples were

harvested by adding trypsin, washed with phosphate-buffered saline (PBS), centrifuged, re-

suspended in PBS + 1% PMSF, A, L, P protease inhibitors, and divided in aliquots. Individual

aliquots were subjected to above mentioned temperatures for three minutes followed by

resting for 3 minutes at room temperature and lysed by snap-freezing in liquid nitrogen


48

followed by thawing at 25 °C. The last step is repeated three times. Cells were centrifuged

again and prepared for SDS-page.

Cell-lysate: L929 cells were harvested from 100mm plates by adding trypsin, followed by

washing with PBS, centrifugation and re-suspension in PBS + 1 % PMSF, A, L, P protease

inhibitors. Harvested cells were divided in Eppendorf tubes and lysed by snap-freezing in liquid

nitrogen followed by thawing at 25 °C for 3 times. The soluble fraction was extracted by

centrifugation. Samples were either treated with earlier mentioned amounts of Sorafenib,

Necrostatin-1 or DMSO. After 30 minutes of incubation the samples were divided in aliquots.

Individual aliquots were subjected to above mentioned temperatures for three minutes

followed by resting for 3 minutes at room temperature and preservation at 4°C. Cells were

centrifuged again and prepared for SDS-page.

siRNA transfections

HCT-116 cells were transfected in a 24-well plate with non-specific (Dharmacon), hc-Myc

(Dharmacon), hβ-catenin (Dharmacon), hETS1 (Dharmacon), hMITF (Dharmacon) and hMLKL

(Dharmacon) siRNA pools, using Lipofectamin RNAiMAX transfection reagent (invitrogen).

References

49

References

Alexaki VI, Javelaud D, Van Kempen LC, Mohammad KS, Dennler S, Luciani F, Hoek KS, Juarez P, Goydos JS, Fournier PJ, Sibon C, Bertolotto C, Verrecchia F, Saule S, Delmas V, Ballotti R, Larue L, Saiag P, Guise TA, Mauviel A (2010) GLI2-mediated melanoma invasion and metastasis. Journal of the National Cancer Institute 102: 1148-59

Ansieau S, Bastid J, Doreau A, Morel AP, Bouchet BP, Thomas C, Fauvet F, Puisieux I, Doglioni C, Piccinin S, Maestro R, Voeltzel T, Selmi A, Valsesia-Wittmann S, Caron de Fromentel C, Puisieux A (2008) Induction of EMT by twist proteins as a collateral effect of tumor-promoting inactivation of premature senescence. Cancer Cell 14: 79-89

Bell RE, Levy C (2011) The three M's: melanoma, microphthalmia-associated transcription factor and microRNA. Pigment cell & melanoma research 24: 1088-106

Biton S, Ashkenazi A (2011) NEMO and RIP1 Control Cell Fate in Response to Extensive DNA Damage via TNF-α Feedforward Signaling. Cell 145: 92-103

Brand TM, Iida M, Li C, Wheeler DL (2011) The nuclear epidermal growth factor receptor signaling network and its role in cancer. Discov Med 12: 419-32

Cai Z, Jitkaew S, Zhao J, Chiang HC, Choksi S, Liu J, Ward Y, Wu LG, Liu ZG (2014) Plasma membrane translocation of trimerized MLKL protein is required for TNF-induced necroptosis. Nature cell biology 16: 55-65

Caramel J, Papadogeorgakis E, Hill L, Browne Gareth J, Richard G, Wierinckx A, Saldanha G, Osborne J, Hutchinson P, Tse G, Lachuer J, Puisieux A, Pringle JH, Ansieau S, Tulchinsky E (2013) A Switch in the Expression of Embryonic EMT-Inducers Drives the Development of Malignant Melanoma. Cancer Cell 24: 466-480

Carreira S, Goodall J, Denat L, Rodriguez M, Nuciforo P, Hoek KS, Testori A, Larue L, Goding CR (2006) Mitf regulation of Dia1 controls melanoma proliferation and invasiveness. Genes & development 20: 3426-39

Caruso R, Parisi A, Bonanno A, Paparo D, Quattrocchi E, Branca G, Scardigno M, Fedele F (2012) Histologic coagulative tumour necrosis as a prognostic indicator of aggressiveness in renal, lung, thyroid and colorectal carcinomas: A brief review. Oncol Lett 3: 16-8

Castellano E, Santos E (2011) Functional Specificity of Ras Isoforms: So Similar but So Different. Genes & Cancer 2: 216-231

Cauwels A, Janssen B, Waeytens A, Cuvelier C, Brouckaert P (2003) Caspase inhibition causes hyperacute tumor necrosis factor-induced shock via oxidative stress and phospholipase A2. Nature immunology 4: 387-93

Chambard JC, Lefloch R, Pouyssegur J, Lenormand P (2007) ERK implication in cell cycle regulation. Biochimica et biophysica acta 1773: 1299-310

Cheli Y, Ohanna M, Ballotti R, Bertolotto C (2010) Fifteen-year quest for microphthalmia-associated transcription factor target genes. Pigment cell & melanoma research 23: 27-40

Chen X, Li W, Ren J, Huang D, He W-t, Song Y, Yang C, Li W, Zheng X, Chen P, Han J (2014) Translocation of mixed lineage kinase domain-like protein to plasma membrane leads to necrotic cell death. Cell research 24: 105-121

Cho YS, Challa S, Moquin D, Genga R, Ray TD, Guildford M, Chan FK (2009a) Phosphorylation-driven assembly of the RIP1-RIP3 complex regulates programmed necrosis and virus-induced inflammation. Cell 137: 1112-23

References

50

Cho YS, Challa S, Moquin D, Genga R, Ray TD, Guildford M, Chan FKM (2009b) Phosphorylation-Driven Assembly of RIP1-RIP3 Complex Regulates Programmed Necrosis and Virus-Induced Inflammation. Cell 137: 1112-23

Colbert LE, Fisher SB, Hardy CW, Hall WA, Saka B, Shelton JW, Petrova AV, Warren MD, Pantazides BG, Gandhi K, Kowalski J, Kooby DA, El-Rayes BF, Staley CA, 3rd, Adsay NV, Curran WJ, Jr., Landry JC, Maithel SK, Yu DS (2013) Pronecrotic mixed lineage kinase domain-like protein expression is a prognostic biomarker in patients with early-stage resected pancreatic adenocarcinoma. Cancer 119: 3148-55

Cox AD, Der CJ (2002) Ras family signaling: therapeutic targeting. Cancer biology & therapy 1: 599-606

Davies H, Bignell GR, Cox C, Stephens P, Edkins S, Clegg S, Teague J, Woffendin H, Garnett MJ, Bottomley W, Davis N, Dicks E, Ewing R, Floyd Y, Gray K, Hall S, Hawes R, Hughes J, Kosmidou V, Menzies A et al. (2002) Mutations of the BRAF gene in human cancer. Nature 417: 949-954

De Craene B, Berx G (2013) Regulatory networks defining EMT during cancer initiation and progression. Nat Rev Cancer 13: 97-110

Degterev A, Hitomi J, Germscheid M, Ch'en IL, Korkina O, Teng X, Abbott D, Cuny GD, Yuan C, Wagner G, Hedrick SM, Gerber SA, Lugovskoy A, Yuan J (2008) Identification of RIP1 kinase as a specific cellular target of necrostatins. Nature chemical biology 4: 313-321

Degterev A, Huang Z, Boyce M, Li Y, Jagtap P, Mizushima N, Cuny GD, Mitchison TJ, Moskowitz MA, Yuan J (2005) Chemical inhibitor of nonapoptotic cell death with therapeutic potential for ischemic brain injury. Nature chemical biology 1: 112-9

Denecker G, Vandamme N, Akay Ö, Koludrovic D, Taminau J, Lemeire K, Gheldof A, De Craene B, Van Gele M, Brochez L, Udupi GM, Rafferty M, Balint B, Gallagher WM, Ghanem G, Huylebroeck D, Haigh J, van den Oord J, Larue L, Davidson I et al. (2014) Identification of a ZEB2-MITF-ZEB1 transcriptional network that controls melanogenesis and melanoma progression. Cell death and differentiation 21: 1250-61

Dittmer J, Nordheim A (1998) Ets transcription factors and human disease. Biochimica et biophysica acta 1377: F1-11

Dondelinger Y, Aguileta MA, Goossens V, Dubuisson C, Grootjans S, Dejardin E, Vandenabeele P, Bertrand MJM (2013) RIPK3 contributes to TNFR1-mediated RIPK1 kinase-dependent apoptosis in conditions of cIAP1/2 depletion or TAK1 kinase inhibition. Cell death and differentiation 20: 1381-1392

Dondelinger Y, Declercq W, Montessuit S, Roelandt R, Goncalves A, Bruggeman I, Hulpiau P, Weber K, Sehon CA, Marquis RW, Bertin J, Gough PJ, Savvides S, Martinou JC, Bertrand MJ, Vandenabeele P (2014) MLKL compromises plasma membrane integrity by binding to phosphatidylinositol phosphates. Cell reports 7: 971-81

Fulda S (2014) Therapeutic exploitation of necroptosis for cancer therapy. Seminars in Cell & Developmental Biology 35: 51-56

Groftehauge MK, Hajizadeh NR, Swann MJ, Pohl E (2015) Protein-ligand interactions investigated by thermal shift assays (TSA) and dual polarization interferometry (DPI). Acta Crystallographica Section D 71: 36-44

Gupta PB, Kuperwasser C, Brunet JP, Ramaswamy S, Kuo WL, Gray JW, Naber SP, Weinberg RA (2005) The melanocyte differentiation program predisposes to metastasis after neoplastic transformation. Nature genetics 37: 1047-54

Haffner R, Oren M (1995) Biochemical properties and biological effects of p53. Current opinion in genetics & development 5: 84-90

Haluska FG, Ibrahim N (2006) Therapeutic targets in melanoma: map kinase pathway. Current oncology reports 8: 400-5

References

51

Hau JC, Fontana P, Zimmermann C, De Pover A, Erdmann D, Chene P (2011) Leveraging the contribution of thermodynamics in drug discovery with the help of fluorescence-based thermal shift assays. Journal of biomolecular screening 16: 552-6

He L, Peng K, Liu Y, Xiong J, Zhu FF (2013) Low expression of mixed lineage kinase domain-like protein is associated with poor prognosis in ovarian cancer patients. OncoTargets and therapy 6: 1539-43

He S, Wang L, Miao L, Wang T, Du F, Zhao L, Wang X (2009) Receptor interacting protein kinase-3 determines cellular necrotic response to TNF-alpha. Cell 137: 1100-11

Hildebrand JM, Tanzer MC, Lucet IS, Young SN, Spall SK, Sharma P, Pierotti C, Garnier J-M, Dobson RCJ, Webb AI, Tripaydonis A, Babon JJ, Mulcair MD, Scanlon MJ, Alexander WS, Wilks AF, Czabotar PE, Lessene G, Murphy JM, Silke J (2014) Activation of the pseudokinase MLKL unleashes the four-helix bundle domain to induce membrane localization and necroptotic cell death. Proceedings of the National Academy of Sciences 111: 15072-15077

Holler N, Zaru R, Micheau O, Thome M, Attinger A, Valitutti S, Bodmer JL, Schneider P, Seed B, Tschopp J (2000) Fas triggers an alternative, caspase-8-independent cell death pathway using the kinase RIP as effector molecule. Nature immunology 1: 489-95

Jafari R, Almqvist H, Axelsson H, Ignatushchenko M, Lundbäck T, Nordlund P, Molina DM (2014) The cellular thermal shift assay for evaluating drug target interactions in cells. Nat Protocols 9: 2100-2122

Kaczmarek A, Vandenabeele P, Krysko DV (2013) Necroptosis: the release of damage-associated molecular patterns and its physiological relevance. Immunity 38: 209-23

Kang S, Fernandes-Alnemri T, Rogers C, Mayes L, Wang Y, Dillon C, Roback L, Kaiser W, Oberst A, Sagara J, Fitzgerald KA, Green DR, Zhang J, Mocarski ES, Alnemri ES (2015) Caspase-8 scaffolding function and MLKL regulate NLRP3 inflammasome activation downstream of TLR3. Nat Commun 6

Kang T-B, Yang S-H, Toth B, Kovalenko A, Wallach D (2013) Caspase-8 Blocks Kinase RIPK3-Mediated Activation of the NLRP3 Inflammasome. Immunity 38: 27-40

Karim FD, Urness LD, Thummel CS, Klemsz MJ, McKercher SR, Celada A, Van Beveren C, Maki RA, Gunther CV, Nye JA, et al. (1990) The ETS-domain: a new DNA-binding motif that recognizes a purine-rich core DNA sequence. Genes & development 4: 1451-3

Ko LJ, Prives C (1996) p53: puzzle and paradigm. Genes & development 10: 1054-72

Kono H, Rock KL (2008) How dying cells alert the immune system to danger. Nature reviews Immunology 8: 279-89

Lawlor KE, Khan N, Mildenhall A, Gerlic M, Croker BA, D’Cruz AA, Hall C, Kaur Spall S, Anderton H, Masters SL, Rashidi M, Wicks IP, Alexander WS, Mitsuuchi Y, Benetatos CA, Condon SM, Wong WW-L, Silke J, Vaux DL, Vince JE (2015) RIPK3 promotes cell death and NLRP3 inflammasome activation in the absence of MLKL. Nat Commun 6

Layton CJ, Hellinga HW (2010) Thermodynamic analysis of ligand-induced changes in protein thermal unfolding applied to high-throughput determination of ligand affinities with extrinsic fluorescent dyes. Biochemistry 49: 10831-41

Levy C, Khaled M, Fisher DE (2006) MITF: master regulator of melanocyte development and melanoma oncogene. Trends in molecular medicine 12: 406-14

Li J, McQuade T, Siemer AB, Napetschnig J, Moriwaki K, Hsiao YS, Damko E, Moquin D, Walz T, McDermott A, Chan FK, Wu H (2012) The RIP1/RIP3 necrosome forms a functional amyloid signaling complex required for programmed necrosis. Cell 150: 339-50

References

52

Li LZ, Zhou R, Xu HN, Moon L, Zhong T, Kim EJ, Qiao H, Reddy R, Leeper D, Chance B, Glickson JD (2009) Quantitative magnetic resonance and optical imaging biomarkers of melanoma metastatic potential. Proceedings of the National Academy of Sciences 106: 6608-6613

Lockshin RA, Williams CM (1964) Programmed cell death—II. Endocrine potentiation of the breakdown of the intersegmental muscles of silkmoths. Journal of Insect Physiology 10: 643-649

Malumbres M, Barbacid M (2003) RAS oncogenes: the first 30 years. Nat Rev Cancer 3: 459-65

Manning G, Whyte DB, Martinez R, Hunter T, Sudarsanam S (2002) The protein kinase complement of the human genome. Science (New York, NY) 298: 1912-34

Mejlvang J, Kriajevska M, Vandewalle C, Chernova T, Sayan AE, Berx G, Mellon JK, Tulchinsky E (2007) Direct Repression of Cyclin D1 by SIP1 Attenuates Cell Cycle Progression in Cells Undergoing an Epithelial Mesenchymal Transition. Mol Biol Cell 18: 4615-24

Miller AJ, Mihm MC, Jr. (2006) Melanoma. The New England journal of medicine 355: 51-65

Miller DM, Thomas SD, Islam A, Muench D, Sedoris K (2012) c-Myc and cancer metabolism. Clinical cancer research : an official journal of the American Association for Cancer Research 18: 5546-53

Moriwaki K, Chan FK (2013) RIP3: a molecular switch for necrosis and inflammation. Genes & development 27: 1640-9

Murphy JM, Czabotar PE, Hildebrand JM, Lucet IS, Zhang JG, Alvarez-Diaz S, Lewis R, Lalaoui N, Metcalf D, Webb AI, Young SN, Varghese LN, Tannahill GM, Hatchell EC, Majewski IJ, Okamoto T, Dobson RC, Hilton DJ, Babon JJ, Nicola NA et al. (2013) The pseudokinase MLKL mediates necroptosis via a molecular switch mechanism. Immunity 39: 443-53

Nagar B, Bornmann WG, Pellicena P, Schindler T, Veach DR, Miller WT, Clarkson B, Kuriyan J (2002) Crystal structures of the kinase domain of c-Abl in complex with the small molecule inhibitors PD173955 and imatinib (STI-571). Cancer research 62: 4236-43

Nieto MA (2011) The ins and outs of the epithelial to mesenchymal transition in health and disease. Annu Rev Cell Dev Biol 27: 347-76

Pasparakis M, Vandenabeele P (2015) Necroptosis and its role in inflammation. Nature 517: 311-20

Primot A, Mogha A, Corre S, Roberts K, Debbache J, Adamski H, Dreno B, Khammari A, Lesimple T, Mereau A, Goding CR, Galibert MD (2010) ERK-regulated differential expression of the Mitf 6a/b splicing isoforms in melanoma. Pigment cell & melanoma research 23: 93-102

Reichert TE, Nagashima S, Kashii Y, Stanson J, Gao G, Dou QP, Whiteside TL (2000) Interleukin-2 expression in human carcinoma cell lines and its role in cell cycle progression. Oncogene 19: 514-25

Remijsen Q, Goossens V, Grootjans S, Van den Haute C, Vanlangenakker N, Dondelinger Y, Roelandt R, Bruggeman I, Goncalves A, Bertrand MJ, Baekelandt V, Takahashi N, Berghe TV, Vandenabeele P (2014) Depletion of RIPK3 or MLKL blocks TNF-driven necroptosis and switches towards a delayed RIPK1 kinase-dependent apoptosis. Cell death & disease 5

Roberts PJ, Der CJ (2007) Targeting the Raf-MEK-ERK mitogen-activated protein kinase cascade for the treatment of cancer. Oncogene 26: 3291-310

Savagner P, Yamada KM, Thiery JP (1997) The zinc-finger protein slug causes desmosome dissociation, an initial and necessary step for growth factor-induced epithelial-mesenchymal transition. J Cell Biol 137: 1403-19

Schweichel JU, Merker HJ (1973) The morphology of various types of cell death in prenatal tissues. Teratology 7: 253-66

Senisterra G, Chau I, Vedadi M (2012) Thermal denaturation assays in chemical biology. Assay and drug development technologies 10: 128-36

References

53

Sharrocks AD, Brown AL, Ling Y, Yates PR (1997) The ETS-domain transcription factor family. The International Journal of Biochemistry & Cell Biology 29: 1371-1387

Silke J, Rickard JA, Gerlic M (2015) The diverse role of RIP kinases in necroptosis and inflammation. Nature immunology 16: 689-697

Simard JR, Getlik M, Grutter C, Pawar V, Wulfert S, Rabiller M, Rauh D (2009) Development of a fluorescent-tagged kinase assay system for the detection and characterization of allosteric kinase inhibitors. Journal of the American Chemical Society 131: 13286-96

Sun L, Wang H, Wang Z, He S, Chen S, Liao D, Wang L, Yan J, Liu W, Lei X, Wang X (2012) Mixed lineage kinase domain-like protein mediates necrosis signaling downstream of RIP3 kinase. Cell 148: 213-27

Suzanne M, Steller H (2013) Shaping organisms with apoptosis. Cell death and differentiation 20: 669-75

Tait Stephen WG, Oberst A, Quarato G, Milasta S, Haller M, Wang R, Karvela M, Ichim G, Yatim N, Albert Matthew L, Kidd G, Wakefield R, Frase S, Krautwald S, Linkermann A, Green Douglas R (2013) Widespread Mitochondrial Depletion via Mitophagy Does Not Compromise Necroptosis. Cell reports 5: 878-885

Taylor RC, Cullen SP, Martin SJ (2008) Apoptosis: controlled demolition at the cellular level. Nature reviews Molecular cell biology 9: 231-41

Thiery JP (2002) Epithelial-mesenchymal transitions in tumour progression. Nat Rev Cancer 2: 442-454

Vanden Berghe T, Linkermann A, Jouan-Lanhouet S, Walczak H, Vandenabeele P (2014) Regulated necrosis: the expanding network of non-apoptotic cell death pathways. Nature reviews Molecular cell biology 15: 135-47

Vandenabeele P, Galluzzi L, Vanden Berghe T, Kroemer G (2010) Molecular mechanisms of necroptosis: an ordered cellular explosion. Nature reviews Molecular cell biology 11: 700-14

Vanlangenakker N, Vanden Berghe T, Vandenabeele P (2012) Many stimuli pull the necrotic trigger, an overview. Cell death and differentiation 19: 75-86

Vince JE, Wong WW, Gentle I, Lawlor KE, Allam R, O'Reilly L, Mason K, Gross O, Ma S, Guarda G, Anderton H, Castillo R, Hacker G, Silke J, Tschopp J (2012) Inhibitor of apoptosis proteins limit RIP3 kinase-dependent interleukin-1 activation. Immunity 36: 215-27

Wan PT, Garnett MJ, Roe SM, Lee S, Niculescu-Duvaz D, Good VM, Jones CM, Marshall CJ, Springer CJ, Barford D, Marais R (2004) Mechanism of activation of the RAF-ERK signaling pathway by oncogenic mutations of B-RAF. Cell 116: 855-67

Wang H, Sun L, Su L, Rizo J, Liu L, Wang LF, Wang FS, Wang X (2014) Mixed lineage kinase domain-like protein MLKL causes necrotic membrane disruption upon phosphorylation by RIP3. Molecular cell 54: 133-46

Wang L, Du F, Wang X (2008) TNF-α Induces Two Distinct Caspase-8 Activation Pathways. Cell 133: 693-703

Wang L, Hurley DG, Watkins W, Araki H, Tamada Y, Muthukaruppan A, Ranjard L, Derkac E, Imoto S, Miyano S, Crampin EJ, Print CG (2012a) Cell Cycle Gene Networks Are Associated with Melanoma Prognosis. PLoS ONE 7: e34247

Wang Z, Jiang H, Chen S, Du F, Wang X (2012b) The Mitochondrial Phosphatase PGAM5 Functions at the Convergence Point of Multiple Necrotic Death Pathways. Cell 148: 228-243

Wasylyk B, Hagman J, Gutierrez-Hartmann A (1998) Ets transcription factors: nuclear effectors of the Ras–MAP-kinase signaling pathway. Trends in Biochemical Sciences 23: 213-216

References

54

Wilhelm S, Carter C, Lynch M, Lowinger T, Dumas J, Smith RA, Schwartz B, Simantov R, Kelley S (2006) Discovery and development of sorafenib: a multikinase inhibitor for treating cancer. Nat Rev Drug Discov 5: 835-844

Wilhelm SM, Adnane L, Newell P, Villanueva A, Llovet JM, Lynch M (2008) Preclinical overview of sorafenib, a multikinase inhibitor that targets both Raf and VEGF and PDGF receptor tyrosine kinase signaling. Molecular Cancer Therapeutics 7: 3129-3140

Wu W, Liu P, Li J (2012) Necroptosis: an emerging form of programmed cell death. Critical reviews in oncology/hematology 82: 249-58

Xie T, Peng W, Liu Y, Yan C, Maki J, Degterev A, Yuan J, Shi Y (2013a) Structural Basis of RIP1 Inhibition by Necrostatins. Structure 21: 493-499

Xie T, Peng W, Yan C, Wu J, Gong X, Shi Y (2013b) Structural insights into RIP3-mediated necroptotic signaling. Cell reports 5: 70-8

Yoon S, Bogdanov K, Kovalenko A, Wallach D (2015) Necroptosis is preceded by nuclear translocation of the signaling proteins that induce it. Cell death and differentiation

Zhang D, Liu Y, Wei Q, Huo Y, Liu K, Liu F, Dong Z (2014) Tubular p53 regulates multiple genes to mediate AKI. Journal of the American Society of Nephrology : JASN 25: 2278-89

Zhang DW, Shao J, Lin J, Zhang N, Lu BJ, Lin SC, Dong MQ, Han J (2009) RIP3, an energy metabolism regulator that switches TNF-induced cell death from apoptosis to necrosis. Science (New York, NY) 325: 332-6

Zhou W, Yuan J (2014) Necroptosis in health and diseases. Seminars in Cell & Developmental Biology 35: 14-23

Addendum

54

Addendum

western blot protocol

Buffers

- Lower Gel Buffer (running buffer) 1,5 M Tris HCl pH 8,8 0,4% SDS (=0,4 g/100 ml) MW Tris HCl = 121,14 g/mol

- Upper Gel Buffer (stacking buffer) 0,5 M Tris HCl pH 6,8 0,4% SDS (=0,4 g/100 ml) MW Tris HCl = 121,14 g/mol ! First make 1 M Tris HCl pH 6,8 stock, use this for making the buffer !

- Transfer Buffer 10x (1 L) 151 g glycine 30 g TRIS HCl Voor 1x (1 L):

200ml methanol 100ml transfer buffer 10x 700ml H2O

- TBST 10x (1 L) ( = Tris-Buffered Saline and Tween-20) 24,12 g TRIS HCl 8,8 g NaCl ! pH 7,4 ! Then: + 10 ml Tween 20

- Sample Buffer 2x (make in small bottle) ! in vriezer als 5x !

60 mM Tris HCl pH 6,8 2% SDS 15% glycerol 0,05% Bromphenol blue (5% β ME -> add in 1x Sample Buffer)

- TG buffer (10x) 721g glycine

151g Tris base 50g SDS pH 8.3 ! (use 1x: 25mM Tris, pH 8.3, 192mM glycine, 20% methanol)

Addendum

55

Treatment of cells (standard protocol)

- Seed cells in 6-wells at 300.000 cells/well (day before experiment) - Treat cells next day with compounds/stimuli - Remove medium, wash 2x with ice-cold PBS and add 200 µL 2x laemli buffer - Boil 10 min at 93°C

SDS-PAGE Detectie van mRIPK3 op 10 % gels FOR 2 GELS: lower gel

8% 10% 13% 15%

lower gel buffer 10 ml 5 ml 4,6 ml 4,6 ml acrylamide 8 ml 5 ml 6,5 ml 7,5 ml H2O 21,7 ml 9,9 ml 7,5 ml 6,5 ml APS 240 µl 200 µl 115 µl 115 µl TEMED 24 µl 24 µl 15 µl 15 µl

After making the running gel, add a layer isopropanol FOR 4 GELS: upper gel

4%

5 ml upper gel buffer 2 ml acrylamide 12,9 ml H2O 100 µl APS 20 µl TEMED

- 20 µl staal laden - 5 µl ladder laden - 135V for 1,5h-2h, till blue front is off

- Semi-wet blotting: !!Soak everything in transfer buffer!!

3 WT paper (van onder) Gel

Nitrocellulose membrane 3 WT papier (naar boven)

- Blot for 1,5h at 75 mA/blot (1 mA/cm2) (watch out: do not go above 15V) - Block membrane for 1h in a 3% milk solution (3 g in 100 ml TBST) at RT (or overnight at 4°C)

Incubation with antibodies and detection

- Use antibodies anti-GFP #657 (cell signaling technology, 1:5000) Anti-LC3 #966 (nanotools, 1:1000)

- Incubate with primary antibody (dilution in 3% milk solution) 1h at RT or overnight at 4°C - Wash at least 3x with 1x TBST (every wash step at least 10 min!) - Incubate with secondary antibody (1:3000 dilution in 3% milk solution) for 1h at RT. Not

longer than 1h!!!

References

56

- Wash at least 3x with 1x TBST (every wash step at least 10 min!) - Incubate membrane 1 minute in a solution containing ECL substrate for HRP enzyme

(2ml/blot). Develop film in the dark room.

2x Laemli buffer (100 mL)

• 20 mL of SDS 20%

• 12 mL of 1M Tris-HCl pH 6.8

• 20 mL of glycerol 50%

• A little bit bromophenol blue

• 1.54 g DTT

• Add pure H2O till 100 mL

Heat shock tranformatie E. coli

- consult Plasmid Manager on the ICR website in which bacteria the plasmid can be grown

- collect bacteria (normally 100 µl) from deepfreezer

- let the vile thaw on ice

- Add 50 – 100 ng DNA/Plasmid to the vile

- incubate 10 minutes on ice

- 5 minutes heatshock at 37°C (hot water bath, heatblocks)

- incubate 10 minutes on ice

cloning

General

Template DNA:

- hcMyc: pCDH-EF1-T2A-copGFP retroviral vector (Addgene)

- hHras: pBabe-puro lentivral vector (Addgene)

- hBraf: pBabe-puro lentivarl vector (Addgene)

Primers:

- pENTR3C_hcMyc-FW: ATCCGGTACCGAATTCACATGCCCCTCAACGTTAGCTTC

- hcMyc_pENTR3C-REV: GTCTAGATATCTCGAGTGCGCACAAGAGTTCCGTAGCTG

- pENTR3C_hHras-FW: ATCCGGTACCGAATTCACATGCCCCTCAACGTTAGCTTC

- hHras_pENTR3C-REV: GTCGACCTCGAGGGATCCTCACTCAACCCAGAAGAAACC

- pENTR3C_hBraf-FW: ATCCGGTACCGAATTCACCATGGCGGCGCTGAGCGGTG

- hBraf_pENTR3C-REV: GTCTAGATATCTCGAGTGGTGGACAGGAAACGCACCAT

Addendum

57

1. Preparation of PCR fragment

PCR reaction

PCR reaction (Phusion™ High-Fidelity DNA Polymerase (Finnzymes - New England Bio labs)

1. Following components were mixed for 50 µl PCR reaction/sample

10 ng/µl Template DNA 1 µl

5X Phusion HF Buffer 10 µl

10mM dNTP mix (promega) 1.5 µl

10 µM Fw primer 2.5 µl

10 µM Rv primer 2.5 µl

2 U/µl Phusion DNA Polymerase 0.5 µl

Ultra pure water 32 µl

PCR programme

98°C – 5 min

98°C - 45 sec

55°C – 30 sec 29 x

72°C – 120 sec

72°C – 7 min

21°C – 1 min

- 6x loading buffer was added to the PCR product

- 5 µl PCR product was loaded on 1.2 % agarose gel

- Agarose gel was stained with Ethidium Bromide

Result

- Bands were cut from Agarose gel and purified by using MinElute reaction cleanup kit

- 40 µl PCR fragment was purified using the PureLink®PCR purification kit (Invitrogen)

- DNA was eluted in 25 µl water

- DNA concentrations were determined through nanodrop analysis:

hC-myc: 71,5 ng/µl

hHras: 42,3 ng/µl

hBraf: 23,1 ng/µl

References

58

2. Linearisation of the vector pENTR3C

Following components were mixed for 100 µl reaction

x ng Template DNA 10 µl

10 U/µl EcoRI enzyme (Promega) 4 µl

10 U/µl XhoI enzyme (Promega) 4 µl

10 x Buffer H 10 µl

Ultrapure water 75 µl

- sample was incubated at 37°C for 1,5 hours (Thermomixer)

- after incubation: 1 µl CIP (Roshe) was added

- sample was incubated at 37°C for 1 hour (Thermomixer)

- 6x loading buffer was added to the linearized vector



- 2285 bp vector was cut from the agarose gel and purified by using MinElute reaction cleanup

kit

- vector concentration was determined with nanodrop: 23,1 ng/µl

3. Ligation

Procedure using CloneEZ® PCR Cloning Kit (Genscript), Purified PCR product : 50 ng, Linearized

vector : 100 ng

Following components were mixed for 20 µl/reaction

For pENTR3C – hcMyc

Purified PCR product (71,5 ng/µl) 50 ng needed 0.7 µl

Linearized pENTR3C vector (23,1 ng/µl) 100 ng needed 4.33 µl

10X CloneEZ® Buffer 2 µl

CloneEZ® enzyme ( 5U / µl) 2 µl

Deionized water 13.6 µl

For pENTR3C – hHras






Addendum

59

For pENTR3C – hBraf






- Reactions were incubated at 22°C( RT ) for 30 min ( Thermomixer)

- To terminate the reaction, transfer tubes to ice and incubate on ice for for 5 min

4. Bacterial transformation (Heat shock protocol)

• 100 µl competent E.coli cells ( dH5α) were thawed on ice for 10 minutes.

• 10 µl of the ligation mixture was added to the competent E.coli cells

• Cells were incubated on ice for 10 minutes

• Cells were incubated at 37 °C for 5 minutes ( Thermomixer)

• Tubes were rapidly transferred to ice to allow the cells to chill for 10 minutes

• 900 µl of LB-medium without antibiotics was added to each tube

• Samples were incubated at 28°C for 2 hours in a Thermomixer, shaking 500 rpm

• 50 µl and 200 µl of bacterial culture was plated out on LB + Puromycin plates

• Plates were incubated upside down at RT over a weekend

5. PCRscreening – colony PCR

PCR reaction (Taq)

Following components were mixed for 20 µl PCR reaction/colony

10X PCR Buffer minus Mg2+ 2 µl

50 mM MgCL2 0.6 µl

10mM dNTP mix (promega) 0.4 µl

10 µM Fw primer 1 µl

10 µM Rv primer 1 µl

5 U/µl Taq DNA Polymerase 0.2 µl

Ultra pure water 14.8 µl

Template DNA 1 colony

PCR programme

94°C – 5 min

94°C - 45 sec

55°C – 30 sec 29 x

References

60

72°C – 120 sec

72°C – 7 min

21°C – 1 min

- 6x loading buffer was added to the PCR product



- Positive colonies were selected (green) for pDNA purification using QIAprep Spin miniprep

Kit (Qiagen)

6. Control restriction digest on pDNA

Following components were mixed for 20 µl reaction

± 1000 ng pDNA x µl

10 U/µl EcoRI enzyme (Promega) 0,5 µl

10 U/µl XhoI enzyme (Promega) 0,5 µl

10 x Buffer H 2 µl

10 µg/ µl Acetylated BSA 0,2 µl

Ultrapure water up to 20 µl

- Samples were incubated at 37°C for 2 hours ( Thermomixer)

- 6x loading buffer was added to the reaction

- 20 µl reactionmix was loaded on 2 % agarose gel

7. Sequencing

pDNA of good colonies was send for sequencing analysis to the Genetic service facility

Addendum

61

CESTA

Quick protocol 1

1. Plate L929 cells in 75-T flask (3 in total)

2. DMSO, Sorafenib, Nec-1 20 µM treatment for 1hr, after this harvest cells

3. Centrifuge cells at 800 rpm for 3 min, wash with PBS, repeat centrifuge step, prepare

liquid nitrogen (LN2) gas.

4. Add 1 ml of PBS + protease inhibitors, suspend

5. Distribute 100 µl of each cell suspension into eight different 200 µl PCR tubes at Room

Temperature (RT)

6. Prepare PCR machine (Temperature settings - 40 ~ 64°C, divided by 8)

7. Heath each sample at the designed temperature for 3 min, put them 3 min in RT,

immediately snap-freeze

8. Thaw (with brief vortexing) the cells at 25°C, refreeze, rethaw, in ice

9. Centriguge at 20.000g for 20 min at 4 °C

10. Take 80 µl of the supernatant, add 40 µl 4x sample buffer

Quick protocol 2

1. Plate L929 cells in 60 mm flask (9 in total)

DMSO 1 hr Sorafenib 20 µM 1 hr Nec-1 20 µM 1 hr

Unt 1 4 7 mTZ 2 5 8 mTZ 3 6 9

2. DMSO (1-3), Sorafenib (4-6), Nec-1 (7-9) 20 µM treatment for 1hr

3. mTZ treatment for indicated time (2,3,5,6,8,9) after this harvest cells

4. Centrifuge cells at 800 rpm for 3 min, wash with PBS, repeat centrifuge step, prepare

liquid nitrogen (LN2) gas.

5. Add 400 µll of PBS + protease inhibitors, suspend

6. Distribute 100 µl of each cell suspension into eight different 200 µl PCR tubes at Room

Temperature (RT)

7. Prepare PCR machine (Temperature settings – 48 °C – 9 sampled, 55 °C – 9 sampled)

8. Heath each sample at the designed temperature for 3 min, put them 3 min in RT,

immediately snap-freeze

9. Thaw (with brief vortexing) the cells at 25°C, refreeze, rethaw, in ice



References

62

Quick protocol 3

1. Plate L929 cells in 60 mm flask (9 in total)

Temp DMSO 30 min Sorafenib 100 µM 30 min

Nec-1 100 µM 30 min

44 1 7 13 46 2 8 14 48 3 9 15 50 4 10 16 52 5 11 17 54 6 12 18

2. Harvest cells, centrifuge cells at 800 rpm for 3 min, wash with PBS, repeat centrifuge

step, prepare liquid nitrogen (LN2) gas.

3. Add 400 µll of PBS + protease inhibitors, suspend, aliquot 500 µl of solution

4. Snap-freeze and thaw (with brief vortexing) the cells at 25°C, refreeze, rethaw, in ice


6. 3 E-tubes, 400 µl per tube

7. DMSO (4 µl), Sorafenib (4 µl), Nec-1 (1,33 µl/ 2,67 µl DMSO) 100 µM treatment for 30

min at RT

8. Distribute 50 µl of each E-tube PCR tubes at Room Temperature (RT)

9. Prepare PCR machine (see table)

10. Heath each sample at the designed temperature for 3 min, put them 3 min in RT, on

ice 4 °C



studies on necroptosis signalling: pleiotropic function of...

Documents