structure determination of the apo-form … · 2010-12-10 · structure determination of the...

$: STRUCTURE DETERMINATION OF THE APO-FORM … · 2010-12-10 · STRUCTURE DETERMINATION OF THE APO-FORM OF ... IMPDH has been ... X-ray diffraction data collection and processing$
STRUCTURE DETERMINATION OF THE APO-FORM OF HUMAN INOSINE 5'-MONOPHOSPHATE

DEHYDROGENASE TYPE I I

Steve Bryson

A thesis submitted in confomity with the requirements

for the degree of Doctor of Philosophy

Graduate Department of Biochemistry

University of Toronto

O Copyright by Steve Bryson 2001

National Library I*( of Canada Bibliothèque nationale du Canada

Acquisitions and Acquisitions et Bibliographie Services services bibliographiques

395 Wellington Street 395, nie Wellington Ottawa ON K1A ON4 OttawaON K1AON4 Canada Canada

The author has granted a non- L'auteur a accordé une licence non exclusive licence allowing the exclusive permettant à la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, distrihte or seLi reproduire, prêter, distribuer ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de microfiche/film, de

reproduction sur papier ou sur format électronique.

The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d' auteur qui protège cette thèse. thesis nor substantial extracts fiom it Ni la thèse ni des extraits substantiels m2y be printed or otheMnse de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation.

STRUCTURE DETERMINATION OF THE APO-FORM OF HUMAN INOSINE 5'-MONOPHOSPHATE

DEHYDROGENASE TYPE II

Steve Bryson Ph.D. 2001 Department of Biochemistry

University of Toronto

Abstract

Human inosine 5'-monophosphate dehydrogenase (IMPDH) controls a key

metabolic step in the regulation of cell differentiation and growth. The catalytic

reaction involves the NAD-dependent oxidation of inosine 5'-monophosphate

(IMP) to xanthosine 5'-monophosphate (XMP), which is the rate-limiting step in

the de novo biosynthesis of guanine nucleotides. There are two identifiable

isoforms of IMPDH, type I and type II. Type I is a tissue-specific, constituatively

expressed protein while the type II isoform is significantly up-regulated in

neoplastic and differentiating cells. As a consequence. IMPDH has been

validated as a target in antitumor and irnmunosuppressive drug design.

A method was developed to obtain rnilligram quantities of the human type II

IMPDH isoform by amplification of the coding region cDNA by PCR, recombining

the cDNA into a bacterial nigh-level expression plasmid. and large-scale protein

purification to obtain between 25 and 30 mg of protein per liter of bacterial culture.

Large. single crystals of the apo-form of the enzyme were reproducibly grown.

They were suitable for X-ray diffraction analysis and diffraction data were

collected to 3.2 A resolution. The crystal structure was solved by molecular

replacement using the hamster IMPDH II structure as a search model followed by

model building and refinement. The residuals for the final model were RWst =

23.0% and Rt,,, = 28.9%.

Analysis of the model demonstrated that the main fold of the enzyme was

an d p barrel. It was also revealed that parts of the protein surrounding the active

site were disordered. When comparing the human apo-form of IMPDH II to the

human IMPDH II structure that was complexed with ligands, these regions

becorne ordered upon ligand association. Sequence alignments indicated that

these regions are conserved throughout evolution and that this type of ordering

was most probably fundamental to the proper function of the enzyme. These

structural data were consistent with published functional data that showed that

IMPDH undergoes significant conformational changes on substrate association

and that the apo-fom of IMPDH has multiple structural conformations.

Acknowledgments

I would like to acknowledge the people who directly and indirectly

contributed to this work. The first person I would like to recognize is Yvette

Losier. She is my lover, my best friend, and the mother of my daughter. EmJ.

She never expected anything less of me, while never being too concerned about

the outcome. She supported me during my undergraduate years aiid stayed

home to raise Our daughter throughout the entirety of this work. In fact, she

worked far harder than I on a project far more important. I would like to thank my

supervisor, Dr. Emil F. Pai of the Department of Biochemistry, University of

Toronto. He allowed me to follow my own learning path and attain the goals that I

had established for myself from the beginning; and, cutting me a few new paths in

the process. I would also like to acknowledge my graduate committee, Dr. B.

Sarkar (Hospital For Sick Children) and Dr. Dave Rose (Ontario Cancer Institute)

for always providing me with positive encouragement and advice.

I would like to give a great deal of thanks to my good friend Annie

Cunningham. who sat at my back for 7 years and always making it fun to corne

work. She was the driving force behind the high level of moral that was constant

in the Pai lab. I would like to recognize the assistance of Vinnie Stoll and Rosi

Hynes, who taught me the practice of protein crystallography; Piotr Sliz and Abdu

Djebli, who showed me the quickest way to do things on the cornputers; Emma

MacFarlane, for teaching me the practice of molecular biology (and telling me

what I could do and not what I should do); and, Uli Eikmanns who taught me the

practice of protein expression and purification (and showed me how to get the job

done, even if you don't have the equiprnent to do it).

I would like to acknowledge sorne of the people in the Department of

Biochemistry. First I would like to thank the Biochemistry office staff. specifically

Suzanne Delvise, Carol Justice, Anna Vanek. and Carrie Harber. for always

having a smile and a kind word for me (and sorne cookies and water for my

daughter). I would also like to thank Pat Bronskill for making teaching easy and

telling me 1 was her favorite TA; Dr. Mariam Packham. for recognizing my

potential as a scientist and giving me a great letter of reference which helped me

get rny first laboratory job in the Pai lab; and Theo Hoffman, for showing me that

the desire and motivation for science cornes frorn a youthful curiosity to learn new

things - even if your in your seventies.

Finally, I would like to recognize the roll that my family played in this work.

I would like to acknowledge the efforts of my mom, Sheila Rooney (nee Hogan),

who, following the death of my father. raised my two brothers and myself on her

own. She provided us with a safe and stable home, which gave us the roots to

stand on Our own. I would also like to thank my step-father Larry Rooney, for

providing me with an example of how tu be hard-working and self-sufficient; and

finally my brother Paul Rooney, who always bestowed upon me a unique

prospective on life, which kept rny "intellectual feet" firmly planted on the ground.

Dedication

l dedicate my Ph.D. thesis to my daughter Emily Jane Losier-Bryson (EmJ).

Her life - and this project - were born coincidentally.

3 . Resul ts ....................................................................................... 3.1. Molecular Biology ...............................................................

3.1 . 1. Cloning of human IMPDH II cDNA ............................. 3.1.2. Sub-cloning human IMPDH II cDNA ..........................

....................... 3.1.3. Expression of human IMPDH II cDNA 3.2. Biochemistry ....................................................................

................................ 3.2.1 . Purification of human IMPDH II ................................................... 3.2.2. Enzyme kinetics

...................................................... 3.3. Protein Crystallography 3.3.1. Preliminary crystallization screens ............................

....................... 3.3.2. Crystallization of human apo-IMPDH II 3.3.3. X-ray diffraction data collection and processing ...........

........................................... 3.3.4. Molecular replacement ................................. 3.3.5. Model building and refinernent

3.4. Human apo-IMPDH II mode1 analysis .................................... 3.4.1. Global Fold .......................................................... 3.4.2. Active Site ............................................................

......................................... 3.5. Amino acid sequence alignments .................................................. 3 5 .1 . Overall sequence

3.5.2. Active site ............................................................ ......................................................... 3.5.3. Sub-domain

4 . Discussion ................................................................................. 4.1. Molecular Biology ...............................................................

............................. 4.1.1. Cloning of human IMPDH II cDNA ........................... 4.1.2. Sub-cloning human IMPDH II cDNA

4.1.3. Expression of human IMPDH II cDNA ........................ 4.2. Biochemistry ....................................................................

4.2.1. Purification of human IMPDH II ................................ ................................................... 4.2.2. Enzyme kinetics

...................................................... 4.3. Protein Crystallography 4.3.1 . Preliminary crystallization screens ............................ 4.3.2. Crystallization of human apo-IMPDH II ....................... 4.3.3. X-ray diffraction data collection and processing ............

........................................... 4.3.4. Molecular replacement 4.3.5. Model building and refinernent .................................

.................................... 4.5. Human apo-IMPDH II mode1 anaiysis 4.5.1. Global Fold ..........................................................

......................................................... 4.5.2. Sub-domain 4.5.3. Active Site ............................................................

4.6. Future work on human IMPDH II ................................. .... .....

................................................................................. 5 . References

6 . Appendix ................................................................................... 6.1. Cloning and protein expression of human IMPDH I cDNA ....... 6.2. Crystallization of IMPlMPA complexed human IMPDH II ......... 6.3. Expression . purification . and crystallization of E.coli IMPDH ....

List of Tables

Table 1 List of percentages of IMPDH sequence arnino acid identities .........

Table 2 Purification table for human IMPOH II .........................................

Table 3 Summary of reflection intensities and R., values by resolution shell .

Table 4 Summary of x-ray diffraction observation redundancies .................

Table 5 AMORE molecular replacement solutions with the highest peaks ....

Table 6 Final refinement statistics ........................................................

Table 7 Km and kat values for human type II IMPDHs ...............................

Table 8 List of published IMPDH crystal structures ...................................

List of Figures

Figure 1 Branch-point of the de novo purine biosynthetic pathway ..............

Figure 2 Molecular structures of potent IMPDH in hibitors ..........................

Figure 3 PCR amplification of human lMPDH II cDNA ..............................

Figure 4 Plasrnids isolated frorn positive E . coli transfomants ...................

Figure 5 EcoRI digest sampies of recombinant ligation products ................

Figure 6 Recombination site DNA sequence ..........................................

Figure 7 Expression analysis of pSE420-human IMPDH II recombinants .....

Figure 8 Analysis of the purification of human IMPDH II ...........................

Figure 9 Elution profile of the Heparin-65OM column ................................

Figure 10 Elution profile of the IMP-sepharose column .............................

Figure 1 1 Human apo-IMPDH II microcrystals ........................................

Figure 12 lmproved human apo-IMPDH II crystals ...................................

Figure 13 Large human apo-IMPDH II crystal ..........................................

Figure 14 Two orientations of the hurnan apo-IMPDH II monomer model ......

Figure 15 Two orientations of the human apo-IMPDH II tetramer model .........

Figure 16 Human apo-IMPDH II octameric structure in the 1422 crystal .........

Figure 17 B-factors of the a-carbon atoms of the human IMPDH II tetramer .

Figure 18 Electron density map of human apo-IMPDH II active site heiix ......

Figure 19 Electron density map of human apo-IMPDH II active site flap ........

Figure 20 Overlay of u/P barre1 active site residues ..................................

Figure 21 Electron density map of human apo-IMPDH II C-terminal .............

Figure 22 SDS-PAGE analysis of a re-dissolved human apo-IMPDH II crystal .

Figure 23 Sequence alignments of structurally known IMPDHs ..................

Figure 24 Multiple sequence alignment of the active site helix region ...........

Figure 25 Multiple sequence alignrnent of the active site flap region ............

Figure 26 Multiple sequence alignment of the phosphate-binding region .......

......................... Figure 27 Multiple sequence alignment of the sub-domain

................................. Figure 28 Superposition of various IMPDH structures

Figure 29 Hurnan IMPDH II electron density map in the area of the subdomain . 91

Figure 30 Structural overlays of the phosphate-binding region ...................

............................. Figure A l PCR amplification of human IMPDH I cDNA

..... Figure A2 Expression analysis of pET2l a-human [MPDH I recombinants

Figure A3 Analysis of pET2l a-human IMPDH I - BL21 (DE3) cell lysis .........

............................... Figure A4 Analysis of heparin-650M column fractions

......... Figure A5 A crystal of human IMPDH II complexed with MPA and IMP

............................... Figure A6 Analysis of the purification of E . coli IMPDH

........................................................ Figure A7 An E . coli IMPDH crystal

List of abbreviations

AMP,

AMoRe,

APRT,

ATP,

PME,

BLAST,

8-factor,

CD,

6-CI-IMP,

CTAB,

CTP,

dATP,

dCTP,

dGTP,

DNA,

Dnase,

DTT,

dTTP'

E. coli,

EDTA,

IF1 *

FAD,

adenosine 5'-monophosphate

automated package for molecular replacement (corn puter program package)

adenine phosphoribosyl transferase

adenosine 5'-triphosp hate

P-mercaptoethanol

basic local alignment search tool (computer program package)

isotropic thermal factor

circular dich romisrn

6-chloropurine riboside 5'-monophosphate

hexadecyltrimethylammonium bromide

cytidine 5'-triphosphate

deoxyadenosine 5'-triphosphate

deoxycytosine 5'-triphosphate

deoxyguanosine 5'-triphosphate

deoxyribonucleic acid

deoxyribonuclease

dithiothreitol

deoxythymidine 5'-triphosphate

Eschenchia coli

ethylenediaminetetraacetic acid

structure factor amplitude

flavin adenine dinucleotide

GMP,

GTP,

HGPRT,

IMP,

IPTG,

MES,

MPA,

MPYD.

NAD,

NADH,

PAGE,

PCR,

PEG,

PMSF,

PDB,

PRPP,

RMSD,

RNA,

SAD,

SDS,

TAD,

TAE,

TRIS,

guanosine 5'-monophosphate

guanosine 5'-triphosphate

hypoxanthine-guanine phosphoribosyl transferase

inosine 5'-monophosphate

isopropylthiogalactoside

morpholinoethyl sulfonic acid

mycophenolic acid

1 methyl-2-pyrrolid inone

nicotinamide adenine dinuclueotide, oxidized form

nicotinamide adenine dinuclueotide, reduced form

polyacrylamide gel electrophoresis

polyrnerase chah reaction

polyethylene glycol

phenylmethylsulfonyl fiuoride

Protein Data Bank

5-phosphoribosyl-1 -pyrophosphate

root mean squared deviation

ribonucleic acid

selenazole-4-carboxamide adenine dinucleotide

sodium dodecyl sulfate

thiazole-4-carboxamide adenine dinucleotide

TRIS, acetate, EDTA

Tris(hydroxymethyl)aminomethane

xiii

TTP,

UMP,

UTP,

X-Gal,

XMP,

thymidine 5'-triphosphate

uracil 5'-monophosphate

uracil 5'-triphosp hate

5-bromo-4-chloro-3-indolyl-beta-D-galactoside

xanthosine 5'-monophosphate

xiv

1. Introduction

1.1. Biological Overview

The biosynthesis of nucleotides is fundamental to the existence of life on

Earth. These compounds are involved in many key roles in almost al1

biochemical processes. Not only are they the activated precursors of

deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), they are also the

activated precursors in many biosynthetic reactions, act as metabolic regulators

and energy carriers, and are the major components of the coenzymes NAD.

FAD, and CoA (Stryer, L.. 1988). The de novo biosyntheses of both purine and

pyrimidine nucleotides have been well-characterized (Hoffee, P .A.. and Jones.

M.E.. 1978) and involve many catalytic steps and metabolic intermediates.

The pathways that lead to the purine and pyrimidine nucleotides are

distinctly different. In the de novo pyrimidine biosynthetic pathway, the

pyrimidine ring is synthesized first from carbamoyl phosphate and aspartate and

is then attached to 5-phosphoribosyl-1 -pyrophosphate (PRPP) to form uridine-5'-

monop hop hate (UMP). Cytidine-5'4riphosphate (CTP) is formed by the

amination of uridine-5'-triphosphate (UTP) and the methylation of the uracil ring

produces the thymine ring.

Ribose-S'phosphate

lnosine monophosphate (IMP)

Asp + GTP

GDP + adenylosuccinate synthetase

Adenylosuccinate

adenylosuctmate iyase

fumarate 1

Ribose-S'phosphate

Adenosine monophosphate (AMP)

IMP dehydrogenase

Xanthosine monophsphate (XMP)

Gln + ATP + i+O

GMP synthase

Glu + AMP + PF:

Ribose-S'phosphate

Guanosine monophosphate (GMP)

Figure 1. Branch-point of the de novo purine biosynthetic pathway.

3

In the de novo purine biosynthetic pathway, the purine ring, in contrast. is

assembled on the ribose phosphate moiety PRPP itself. The purine ring is

formed from atoms frorn CO2, aspartate. glycine, glutamine, and N10-

formyltetrahydrafolate via ten enzymatic steps beginning with PRPP to produce

inosine-5'-monophosphate (IMP). IMP is then shuttled into the two distinct

pathways that lead to the formation of adenosine-5'-monophosphate (AMP) and

guanosine-5'-monop hosp hate (GMP) (Figure 1 ). Deoxyribonucleotides are

subsequently synthesized by the reduction of ribonucleotide diphosphates

(Stryer, L.. 1988).

There are also secondary purine nucleotide biosynthetic pathways called

the purine salvage pathways. One such pathway involves the direct attachment

of free purine bases to the ribose phosphate moiety PRPP. Adenine

phosphoribosyl transferase (APRT) catalyzes the formation of AMP from

adenine and PRPP, and hypoxanthine-guanine phosphoribosyl transferase

(HGPRT) catalyzes the formation of both IMP and GMP. Another salvage path

involves the nicotinamide adenine dinucleotide phosphate (NADPH)-dependent

reduction of GMP to IMP catalyzed by GMP reductase (Stryer, L., 1988).

IMP, AM?, and GMP are al1 feedback inhibitors of purine nucleotide

biosynthesis (Hershfield and Seegmiller. 1976, Dixon et al., 1970. Henderson

and Mercer. 1966). These three nucleotides control levels of PRPP by inhibiting

5-phosphoribosyl-1 -pyrophosphate synthetase (PRPPS). AMP and GMP inhibit

PRPP arnidotransferase, the enzyme that catalyzes the first step in the purine

biosynthetic pathway leading from PRPP to IMP. Other sites of feedback

inhibition are the reactions that lead away from inosinate. AMP and GMP,

respectively. inhibit the formation of adenyisuccinate and XMP from IMP.

As mentioned above, nucleotides act as metabolic regulators. Adenine

and guanine nucleotides are used in molecular regulation more frequently than

other nucleotides and act to modulate important biochemical reactions in al1

aspects of cellular processes (Pall, M.L.. 1985). Specifically, ATP and GTP

function as essential components of growth signal transduction pathways by

providing the high energy output of the phosphate bond cleavage to affect

macromolecular conformational changes (Lehninger. A.L. 1975). Covalent

phosphoryltransfer is preferentially employed in ATP-dependent mechanisms

(Hunter. T. 1995) whereas phosphate hydrolysis is primarily used in GTP-

dependent rnechanisms (Chant, J. and Stowers. L. 1995). These nucleotides

also act as noncovalent allosteric effecton. Due to the central role played by

ATP and GTP in signal transduction. their metabolism should be significant in

cellular signaling processes.

1.2. lnosine 5'-monophosphate dehydrogenase (IMPDH)

1.2.1. Catalytic Reaction

The mechanistic motif common to the de novo AM? and GMP specific

pathways is the displacement of a carbonyl group with an amino group (Figure

1). The first, and committed step in the pathway leading to the formation of GMP

is the oxidation of the C2 carbon atom of IMP to form xanthosine-5'-

monophosphate (XMP). Inosine-5'-monophosphate dehydrogenase (IMPDH; EC

1.1.1.205) is the enzyme that catalyzes the nicotinamide adenine dinucleotide

(NAD)-dependent oxidation of IMP to XMP.

The reaction is initiated by the attack of a nucleophilic cysteine residue

(Cys 331 in human IMPDH I & II) on the C-2 position of IMP, resulting in hydride

transfer and the formation of an enzyme-XMP* intermediate, which is

subsequently hydrolyzed to XMP (Huete-Perez et al 1996, Link and Straub,

1995; Sintchak et al., 1996). K' ions are required for catalysis for al1 IMPDHs

with the exception of the IMPDH from the anaerobic protozoan parasite

Tntnchornonas foetus (Xiang et al., 1996; Verham et al, 1987). Product inhibition

studies have led to the conclusion that the reaction follows an ordered bi bi

kinetic rnechanism where IMP binds before NAD, and NADH is released prior to

XMP (Holrnes, et a1.,1974; Carr, et al., 1993; Verham, et al., 1987; Anderson and

Sartorelli, 1968; Xiang, et al., 1996). This order of substrate association and

product dissociation would be opposite to other NAD-dependent

dehydrogenases where cofactor binding causes conformational changes that

promote substrate binding and catalysis (Cantor and Schimmel. 1980).

However, recent studies focusing on human IMPDH, utilizing deuterium isotope

effects. have suggested, while product dissociation is ordered, substrate

association is random (Wang and Hedstrom, 1997).

1.2.2. Amino acid sequence conservation

The significant role that IMPDH plays in the fundamental mechanisms of

nature is reflected in the conservation of IMPDH amino acid sequences between

a wide range of species. Table 1 shows the percentage of identities (in

descending order) from IMPDH arnino acid sequence alignments between

species with IMPDH sequences deposited in the SWISS-PROTEIN database.

Amino acid sequences from the three kingdoms of life are represented.

Phylogenetic analysis of the sequences revealed that the general evolutionary

relationships of IMPDH sequences are maintained, with the exception of the

apparently strongly divergent sequence from Trifrichamonas foetus (Collart et al.,

1996). The numbers indicate that al1 IMPDH s adopt the sarne global fold.

1.2.3. Human lsozymes

IMPDH activity in hurnans has been shown to be the product of two

different, but highly conserved enzymes (Natsumeda. Y.. et al.. 1990). These

Table 1. List of percentages of IMPDH sequence amino acid identities (asterisks denote putative IMPDH sequences).

classificalion soecies

eukaryolae Honio sapieris type II Cricetulus grrseus type II Mus niusculus type I I Homo sapens type I Mus niusculus type I

Drosophrla melanogasler

Candrda albicans'

S~cct)eromyces cerevrsrese'

Pneumocystrs cartn~i

Trypanosome brucer brtrcei

Leishrnariin dorioverir

Arabidopsis thalraria

Borrelrs bergdorlen

Trilrrchomorias loetus

eubacteria Bactllus subl~lrs

Mycobaclerrun~ lubercuksrs

Mycobacterruni loprae

Acrnefobacter calcoacetrcus

Escherrchra colr Slreptococcus pyogeries

Helrcobacter pylori

Haemophrlus nfluenzae

archae bacleria Mett~ariococcus~aririasct~~~

Pyrococclls funolrslls

isozymes have been named type I and type II, and both types have also been

found in mice as well (Table 1). Two separate genes located on different

chromosomes encode these proteins: type I and type II on chromosomes 7 and

3, respectively (Gu. J.J.. et al.. 1994 and Glesne, D., et al.. 1993). Phylogenetic

and gene sequence analysis indicated that the genes for these proteins diverged

prior to the division of rodents and humans by gene duplication (Collart et al.,

1996; Zimmermann, A., et al.. 1996). 80th isozymes have been shown to be

homotetrameric and are indistinguishable with respect to their catalytic activity,

substrate affmities, and K, values for known IMPDH inhibitors (Konno, Y.. et ai.,

1991 ; Carr. S.. et al., 1993; Hagar, P., et al., 1995).

1.2.4. Differentially regulated isozyme expression

Differentially regulated expression of type I and type II isozymes has

significant functional importance for mammalian cells. Studies of the expression

levels of IMPDH specific mRNA revealed relatively high levels of the type I

transcript in kidney. pancreas. colon, peripheral blood leukocytes, fetal heart,

brain, and kidney (Senda, M. and Natsumeda, Y.. 1994). Three promoters have

been identified in the type I gene that are involved in its differential regulation at

the transcriptional level in a highly tissue- or cell-specific manner (Gu. J.J., et al..

1997).

Expression of the type II transcript was shown to Vary less with different tissue

types. but generally had higher expression levels than type I mRNA (Nagai. M.,

et al.. 1992). More interestingly, increased human IMPDH type II mRNA

expression and IMPDH activity has been obsewed during cellular proliferation

(Jackson, R.C.. and Weber, G.. 1975). It decreased sharply in response to

induced cellular differentiation, while type I was shown to be constitutively

expressed. (Nagai. M., et al., 1991; Nagai, M.. et al., 1992). It has been

suggested that the roles of the two isoforms are divided between "housekeeping"

duties. performed by the type I isoform when a small amount of de novo GTP

synthesis is required in differentiated cells and "production" duties, carried out by

the type II isoform, to provide a higher rate of GTP synthesis for cellular

proliferation. (Yalowitz. J.A., and Jayaram,H.N.. 2000). Regulation of human

IMPDH II gene expression has been shown to be transcriptional in nature as a

result of post-translational modification of pre-bound transcription factors andlor

secondary protein-protein interactions (Zimmermann, A., et al.. 1995;

Zimmermann, A., et al., 1997). lncreased expression. however, of both type I

and type II transcripts. with a concomitant 15-fold increase in IMPDH activity, has

been shown to accompany T lymphocyte activation (Dayton, J.S., 1994).

The role of the p53 gene in cell growth regulation has been well

characterized (Levine and Momand, 1990; Donehower and Bradley. 1993;

Gottlieb and Oren. 1996) and mutations that eliminate wild-type p53 function are

the most prevalent genetic defect observed in a diverse number of human tumon

(Hollstein et al., 1991). Recently, an association has been found between

IMPDH and p53. Initially, induced p53 expression was associated with a

reduction in guanine ribonucleotide biosynthesis due to the reduction in the

expression of IMPDH. As well, the increased formation of guanine

ribonucleotides, by the addition of nucleoside precursors, prevented growth

suppression in the absence of IMPDH function (Sherley, 1991 ; Sherley, 1995).

Most recently, IMPDH has been shown to be a rate-determining mediator

of p53-dependent growth regulation (Liu, et al.. 1998). A gene transfer strategy

was used to demonstrate that the transfection of a constitutively expressed

IMPDH cDNA elirninated p53-dependent growth suppression despite growth-

suppression levels of wild-type p53 protein. Although the normal cellular

functions of p53 are still debated, it has been suggested that one of its primary

functions is to regulate IMPDH activity by controlling IMPDH gene expression

that modulates the levels of guanine ribonucleotides which in turn are involved in

the molecular regulation of cell growth signals (Sherley, 1991 ; Sherley, 1996; Liu,

et al., 1998). This makes IMPDH an attractive target for the purpose of

modulating cell growth by modulating IMPDH activity.

1.3. Inhibition of IMPDH

1 . X I . Effects of IMPDH inhibition

The fundamental role that IMPDH plays in the biosynthesis of guanine

nucleotides and in cell division control is reflected in the observation that

inhibition of IMPDH with specific IMPDH inhibitors causes cell growth arrest in

the late G1 phase of the cell cycle (Cohen et al.. 1981; Cohen and Sadee, 1983;

Lui. 1984; Lee et al.. 1985: Turka et al., 1991). It also induces differentiation. in

vitro. in a wide variety of cell types (Kiguchi et a1.,1990a; Kiguchi et al.. 1990b;

Olah et al.. 1988; Sololoski et al., 1986; Dayton, 1992). These characteristics of

IMPDH inhibition are of particular importance in the treatment of cancer, where

elevated levels of 1 MPDH expression and activity. associated with cellular

proliferation. have been observed to be linked to neoplasia and malignancy

(Jackson et al.. 1975; Jackson et al., 1976; Proffitt et al.. 1983; Konno et al..

1991; Collart et al.. 1992; Weber et al., 1992; Nagai et al, 1991; Nagai et al.

1992). These data prompted the search for. and development of IMPDH specific

inhibitors to be used in the treatment of cancer.

Tiazofurin

One of the best-characterized IMPDH inhibitors is the C-nucleoside

tiazofurin (2-P-D-ribofuranosylthiazole-4-carboxamine) (Figure 2). Tiazofurin is a

pro-drug that is converted by sensitive cells in two enzyrnatic steps to the active

meta bolite thiazole-+carboxamide adenine dinucleotide (TAD) (Fig ure2). TAD

acts to inhibit IMPDH by interacting with its NAD binding site with orders of

magnitude higher affinity than NAD itself (K, approximately 700 nM) (Weber.

1983; Yamada et al., 1988). As well. TAD was shown to be uncornpetitive with

respect to NAD. which is consistent with the view that XMP binding and product

release precedes NAD binding and NADH release, respectively. Other studies

have indicated that TAD binds to IMPDH with 1 to 2 orders of magnitude higher

affinity than to other dehydrogenase enzymes again implying specificity

(Goldstein et al.. IWO).

A Tiazofurin

HO OH

I/ ATP

1) Nicotinamide kinase 2) NMN:ATP-adenylyl transferase

4 o o II O-P-O-P-O h~ 1' AH -,$

HO OH HO OH

MPA

I

TAD

Figure 2. Molecular structures of potent lM PDH inhibitors. A, Tiazofurin reacts (enzymatically) with adenosine triphosphate (ATP) which produces 2-9-0- ribofuranosylthiazole4-carboxamide (TAD) and inorganic phosphate (P,). 8, Mycophenolic acid (MPA).

Crystal structures of tiazofurin and its analogues have revealed a close

intermolecular contact between the thiazole sulfur atom and the furanose ring

oxygen (Goldstein et al., 1983; Goldstein et al., 1983: Burling and Goldstein,

1989). It had been suggested that this interaction is maintained in the NAD

binding site of IMPDH, establishing a low energy conformation of TAD that would

be disrupted when binding to other dehydrogenases (Goldstein et al., 1990).

ln vitro, tiazofurin has been shown to be effective against human lung,

breast, colon, pancreatic, and lymphoid tumor cell lines (Earle and Glazer. 1983;

Carney et al.. 1985: Jabobson et al.. Szekeres et al.. 1992: Sidi et al., 1990) and

in vivo, was curative for murine Lewis lung carcinoma (Robins et al., 1982).

More significantly, however, tiazofurin has been effective in the treatment of

human myeloid leukemias (Tricot et al. 1987). In vitro studies on the human

leukemic cell lines HL-60 (promyelocytic leukemia) and K562 (erythriod

leukemia) have shown that treatment with tiazofurin decreased IMPDH specific

activity and GTP concentrations, and induced differentiation (Lucus et al, 1983;

Sokowski et al., 1986: Knight et al., 1987; Olah et al. 1988) and apoptosis (Vitale

et al., 1997) in a tirne- and dose-dependent rnanner.

Down-regulation of two proto-oncogenes, c-rnyc and c-Ha-ras, were also

observed as a result of tiazofurin in human K562 cells, and human and rat

hepatoma cell lines (Olah et al., 1989; Olah et al.. 1990). The c-myc gene

product is a DNA-binding, nuclear phosphoprotein involved in cellular

proliferation and DNA synthesis (Bishop, 1987) and the ras oncogene products

are associated with the plasma membrane and share structural and biochemical

properties with the guanine nucleotide binding regulatory G-proteins (Hurley et

al.. 1984). In al1 of the above studies. the addition of exogenous guanine

nucleotides abrogated the tiazofurin-induced differentiation and apoptosis.

illustrating the critical role that the levels of these nucleotides play in cell

signaling and growth.

In clinical studies. the sarne correlation between the emergence of a

differentiated phenotype and IMPDH activity and GTP concentrations was

observed (Tricot et al., 1990) as well as the down-regulation of c-ras and c-myc

expression (Weber et al., 1991). The most consistent responses to tiazofurin

occurred in patients with chronic myeloid leukemia (Tricot et al.. IWO). This

response was amplified by the addition of allopurinol. which induces high levels

of serum hypoxanthine that inhibited HGPRT activity in the purine salvage

pathway as described above (Weber et al.. 1994). Approximately 30% of

patients attained a complete remission. 7% showed hematological improvement.

and 13% showed a marked anti-leukemic effect (Tricot, 1989; Tricot et SI.. 1990).

A review of the clinical trials reported that the most consistent side effects were

neurotoxic, such as strong headaches, agitation, seizures. sudden coma. and

ventricular fibrillation (Tricot. 1 989).

lncreased IMPDH expression and activity have also been observed in

proliferating B- and T-lymphocytes (Dayton, J.S., 1994; Natsumeda and Carr,

1993). Moreover, the purine salvage pathway catalyzed by HGPRTase was not

required for lymphocyte proliferation, meaning that the de novo pathway is critical

(Allison et al.. 1975; Allison et al., 1977). HGPRTase and PRPP

amidotransferase (the enzyme that catalyzes the first committed step in the de

novo purine biosynthetic pathway , as described above) expression was observed

to be tissue-dependent, with the brain cells showing the greatest dependence on

the salvage pathway and lymphocytes showing the least (Stryer, 1988; Allison et

al.. 1975; Allison et al.. 1977). This singular dependence on the de novo

pathway for guanine nucleotides has marked IMPDH as a target for

immunosuppression.

1 3.3. Mycophenolic acid

Mycophenolic acid (MPA) (Figure 2 ) is another well-characterized l MPDH

selective inhibitor. MPA was first isolated as an antimicrobial agent from

fermentation products of several Penicillium species (Gosio, 1896) and later was

shown to inhibit the proliferation of cultured lymphocytes (Allison and Eugai,

1993; Wu. 1994). MPA has high affinity for IMPDH, with Ki's for the type I and

type II isoforms deterrnined to be 11-37 nM and 6-10 nM, respectively (Carr et

al.. 1993; Hagar et al., 1995). The antiproliferative effects of MPA are to

decrease the cellular pools of guanine nucleotides. Consequently, the addition of

guanine reverses the effects of MPA (Allison et al., 1993).

Interestingly. MPA had no effect on the early signal transduction systems

in T-lymphocytes (Eugui et al.. 1991; Dayton et al, 1992) but inhibited the transfer

of fucose and mannose moieties to glycoproteins (Allison et al., 1993). This may

prevent the interaction of lymphocytes with target cells. Also, complete inhibition

of antibody formation by polycionally activated human B-lymphocytes was

observed by the addition of 100 nM MPA (Eugai et al., 1991). The recent

approval by the U.S. Federal Drug Administration (FDA) of the oral prodrug of

mycophenolic acid. mycophenolate rnofetil. for use in combination with other

immunosuppressive agents to prevent acute rejection of kidney transplants

(Shaw et al.. 1995; Sollinger, 1995) has illustrated the clinical proof-of-principle

for IMPDH as a viable molecular target.

1.4. Thesis proposal

At the beginning of this study. there was no structural information available

on IMPDH. As described above, most of the studies on IMPDH had focused on

its role as an anti-proliferation target for tiazofurin. Although the cDNAs for both

type I and type II human IMPDH had been cloned. (Collart and Huberman, 1988;

Natsumeda et al.. 1990) an atternpt to overexpress the proteins in E. coii as

lacZ'-fusion proteins produced only very modest results (Konno et al.. 1991). 1

decided to attempt to obtain the cDNA for the isozymes by polymerase chain

reaction (PCR) amplification based on the published nucleotide sequences

(Collart and Hubeman, 1988; Natsumeda et al., 1990). The cDNA comprising

only the coding region would be sub-cloned into a high output protein expression

plasmid and the proteins would be overexpressed in E. coli cells. isolated, and

screened for conditions that would produce single protein crystals suitable for X-

ray diffraction. X-ray crystallographic techniques would be applied to solve the

three-dimensional structures of both isozymes and the resulting structural

information would be analyzed. Structural information on IMPDH should be

important in the development of chemotherapeutic agents in the treatment of

cancer and immunosuppression.

Currently, 5 X-ray crystal structures of IMPDH have been solved: human

l M PDH type I I ternary corn plex with selenazole-4-carboxamide adenine

dinucleotide (SAD) and 6-chloropurine riboside 5'-monophosphate (6-CI-IMP)

(Colby et al.. 1999). Chinese hamster IMPDH type II ternary complex with

mycophenolic acid (MPA) and the partially turned over inosine 5'-

monophosphate intenediate (IMP), xanthosine 5'-monophosphate* (XMP*)

covalently bound to the active site (Sintchak et al., 1996), Borrelia bergdorfen

IMPDH complexed with SOa (McMillan et a1.,2000), Tntnchomonas foetus IMPDH

both apo- and XMP-complexed (Whitby et al., 1997), and Streptococcus

pyogenes IMPDH with IMP (Zhang et al., 1999).

These structures have shown that the basic fold of IMPDH is an dp barrel

with a small flanking domain dubbed the sub-domain which is inserted between

the second u-helix and the third p-strand of the dB barrel. As well, there

appears to be considerable structural variation in the vicinity of the active site.

Two regions in particular, named the 'active site helix' and the 'active site flap'.

have been observed to have basic differences in their backbone structures when

the active site is occupied by either substrates or other ligands. This has been

reported for the ternary complexes of both the human- and hamster-IMPDH type

Il (Colby et al., 1999. Sintchak et al., 1996), whereby the amino acid sequence of

these two proteins are virtually identical to each other (Table 1).

There is independent evidence that there are significant structural

differences between the ternary complex of IMPDH II and its apo form. In vitro

proteolytic susceptibility, hydrophobic fluorescent dye binding, far-UV circular

dichromism spectra and urea-induced denaturation experiments have shown that

IMPDH II undergoes conformational changes and is stabilized by ligand binding

and MPA inhibition (Nimmesgern et al., 1996). High-precision titration

microcalorimetry has revealed allosteric properties of IMPDH II upon IMP and

MPA binding (Bruuese and Connelly, 1997). As well, the temperature

dependence of the heat capacity function associated with the ligand binding

reaction suggested that an equilibrium exists between at least two structural

forms of apo-IMPDH II (Bruuese and Connelly. 1997). Therefore. the structural

detenination of the unliganded forrn of IMPDH can provide significant details as

to the structural differences between the cornplexed and free forms of IMPDH

with respect to its conformation and allosteric behavior. Also, sequence

alignments and structural comparisons between IMPDHs and other proteins may

reveal amino acids that are critical to structure and function of IMPDH.

I report here the successful amplification, sub-cloning, and overexpression

of the cDNAs for both type I and type II human IMPDH. As well. the type II

isozyme was purified to homogeneity, crystallized and the crystal structure of the

apo form of this enzyme was solved. However, as reported in the appendix. the

type I isozyme was insoluble in aqueous media also reflected in its accumulation

in bacterial inclusion bodies. Also described in the Appendix is the crystallization

of the human IMPDH II complexed with MPA and IMP, and the expression,

purification, and crystallization of IMPDH from E. coli.

2. Materials and Methods

2.1. Molecular Biology

2.1.1. Cloning of human IMPDH Il cDNA

cDNA containing the coding region of human IMPDH II was amplified by

the polyrnerase chah reaction (PCR) (Sambrook et al.. 1989) from a human

peripheral blood leukocyte i.gtl0 cDNA library (Invitrogen). The RNA source for

the library were peripheral blood leukocytes from an adult fernale with acute

promyelocytic leukemia (HL 60) (Collins, 1990).

The sequence of primer A was 5'-CAGCCTGGTTAAGTCCAA-

GCTGAATTC-3' and was complimentary to the sequence immediately upstream

of the Eco RI cloning site of ÀgtlO. The sequence of primer B was

5'-CCGAGGAGGTGTTCTAGATCCC-3' and was complirnentary to the sequence

imrnediateiy downstream of the termination codon of the human IMPDH II

encoding cDNA.

2.5 pl aliquots of the lambda phage preparation at 2.0 X 10" pfulml were

added to 72.5 pl of distilled water. Sarnples were incubated at 70°C for 5 minutes

and transferred to wet ice for cooling. 25 pl of a 4 X PCR master buffer

(Sambrook et al., 1989) containing buffer. salts, gelatin, dNTPs, primers, and

Taq polymerase were added. Three 100 pl reaction samples were mixed, each

contained 5. 10. and 15 mM MgCI2, as well as 50 mM KCI, 10 mM TRlSlHCl (pH

8.3). 0.01% gelatin. 0.20 mM each of dATP. dCTP. dGTP, and dTTP, 1.0 pM

each of oligonucleotide primer and overlaid with 100 pl of mineral oil. 0.5U of

Taq polymerase was used. The reaction vessels were incubated at 95OC for 1

minute and 20 seconds. 65OC for 2 minutes, and 7 2 ' ~ for 3 minutes. This was

repeated 29 times. 10 pl aliquots of the final reaction mixtures were applied to a

1% agarose gel. Two 5 pl aliquots of the PCR product from the sample that

contained 15 mM MgCl* were each incubated with the restriction enzymes Eco

RI and Pst I for analysis.

The remaining PCR reaction mixture was treated with 2U of Klenow

polymerase in the presence of 40 FM each of dATP. dCTP, dGTP, and dTTP.

The PCR reaction products were ligated by blunt-end ligation to pTZ19R

(BlueWhiteScreening) digested with Hinc II and dephosphorylated with alkaline

phosphotase. The total volume of the ligation reaction was 15 pl and contained

ligation buffer. 200ng of PCR product, 200 ng of pTZ18R. 1 U of T4 ligase. and

was incubated at 16OC for 16 hours. 5 pl of the ligation reaction mixture were

added to 80 pl electrocompetent TG2 E m l i cells in water. After electroporation.

1 ml of LB (Lucia's Broth: 10 gil tryptone, 5 gll Yeast extract, 5 gll NaCl) was

added to the cells and the suspension was incubated at 37OC for 1 hour. 200 pl

of cell suspension were spread on LBiagar plates treated with 0.1 mglrnl

ampicillin, 20 pl of 50 mM IPTG, and 50 pl of 2% X-Gal. The plates were

incubated overnight at 37OC. 10 white E. coli colonies were picked and added to

3 ml of LB containing 0.1 mglm1 ampicillin. These were allowed to grow

overnight at 37OC. The plasmid DNAs frorn each of the overnight growth

suspensions were isolated by mini-prep (Sambrook et al., 1989) and an aliquot

of each sarnple was applied to a 1 % TAE-agarose gel.

Selected sarnples were digested with EcoRl and applied to a 1% agarose

gel. Samples that produced the correct fragment sizes were sequenced by the

T7 sequencing method (Kristensen et al.. 1988). One plasmid. pTZ19R-

HIMPDH 11Tr8. found to contain the complete hurnan IMPDH II coding region

without mutations was isolated in large quantities by maxi-prep (Sambrook et al..

1989). An overview of the cloning strategy is outlined in Scheme 1.

2.1.2. Sub-cloning of human IMPDH II cDNA.

The pTZ19R-HIMPDH 11K8 plasmid was digested to completion by the

restriction endonuclease Hind III. The resulting DNA was partially digested with

Ncol (5U Ncolll pg of DNA) for 10 minutes at 37OC. The reaction was stopped

by the addition of EDTA to a final concentration of 20 mM. The digest was

applied to a 1 % agarose preparation gel and the 1,600 bp fragment was excised

and

EcoRl EcoRl

Hurnan peripheral blood leukocyte ÀgtlO cDNA library

PCR Amplification

Human IMPDH II coding cDNA :=

Blunt-end Iigation to Hincll digested pTZ19R

Scheme 1. Cloning strategy for human IMPDH II cDNA. A and 6 represent the PCR primers which were used to amplify hurnan IMPDH II cDNA from the human peripheral blood leukocyte Àgtl0 cDNA library. Following amplification. the product was ligated to the pTZ1 SR plasrnid. The resulting plasmid ( pTZ19R-HIMPDH II) is shown. bla (ApR). ampicillin resistance gene; rep (pMB1). E. coli origin of replication; f l (IG). f l phage origin of replication; IacZ. P-lactosidase gene.

Ncol partial digest / fragment purification

- - d

O u O 8 o .- c Z z Z Z

Hind III digested

Human IMPDH Il coding cONA

pTZ19R-HIMPDH II 5'

Ligated to NcollHind Ill digested pSE420

3'

niiiii-cistroii

Hiinidri

bla (ApR)

Scheme 2. Subtloning strategy for human IMPDH II cDNA. Hind III digested pTZ19R-HIMPDH II was subjected to a Ncol partial digest to isolate the entire coding cDNA of human IMPDH II. This fragment was ligated to a NcollHindlll digested pSE420 plasmid. The resulting plasmid (pSE420-HIMPOH II) is shown. Trp. trp promoter; Lac. lac operator; bla (ApR). ampicillin resistance gene; ColEl. E. coli origin of replication; laclq. lac repressor gene.

purified from the agarose by gel extraction (Sambrook et al.. 1989). The 1,600

bp fragment was ligated to an Nco IlHind III digested pSE420 expression plasmid

using T4 DNA ligase. The ligation mixture was transformed into E. coli TOP10

cells by electroporation and spread on LBlagar plates treated with 0.1 mg1 ml

ampicillin. The plates were incubated at 37OC for 16 hours. Positive

transformant colonies were selected, grown, and the plasmids isolated by mini-

prep (Sambrook et al.. 1989). The plasmids were separately digested with the

restriction endonucleases EcoRl and Pst I and aliquots of the digests were

applied to a 1% TEA-agarose gel. An overview of the sub-cloning strategy is

outlined in Scheme 2.

2.1.3. Expression of human IMPDH II

E. coli TOP10 suspensions with the pSE420 plasmids that contained the

human IMPDH II coding cDNA were tested for expression. 1.0 ml of the E. coli

TOP10 (pSE420-HIMPDH II) suspensions were added to 50 ml of 2XYT (16 gll

tryptone, 10 gll yeast extract. 5 gll NaCI) containing 0.1 mglml ampicillin and

incubated with shaking at 37'C until the optical density (O.D.) was 0.8, measured

at 600 nm. IPTG was added to a final concentration of 1 mM and the cells were

allowed to grow for 3 hours. 1 ml aliquots were removed and the cells were

collected by centrifugation. The cells were resuspended in 100 pl of distilled

water and 100 pl of 2X SDS-PAGE sample buffer (50 mM TRISICI, pH 7.5, 2%

SDS, 100 mM PME, and 0.01% bromophenol blue). The samples were

incubated at 95OC for 3 minutes and applied to a 12% SDS-PAGE gel. The

remaining cells were collected by centrifugation and resuspended in a buffer

containing 10% glycerol. 10% urea, 150 mM NaCI, 50 mM TRISIHCI (pH 8.0), 2

mM EDTA. 2 mM PME. 1 mM PMSF, 1 pglml pepstatin. 1 pglml leupeptin, 0.1

mglml lysozyme, and 0.1 mglml DNase. The suspension was passed through a

French press 3 times and the cellular debris was removed by centrifugation. The

soluble cell extracts were tested for IMPDH activity. Samples that showed the

over-expression of recombinant human IMPDH II al1 had IMPDH activity and

were mixed with 116 volume of sterile 100% glycerol, shock frozen in liquid

nitrogen. and stored at -70°C.

2.2. Biochemistry

2.2.1. Purification of human IMPDH II

E. coli TOP10 (pSE420-HIMPDH II) cells were thawed and spread on an

LB plate treated with 0.1 mglml ampicillin and incubatec: at 37OC for 16 hours. A

single colony was picked and added to 1.0 ml of LB broth with 0.1 mglml

ampicillin and incubated at 37OC for 6 hours. The 1 .O ml suspension was added

to 20 ml of 2XYT with 0.1 mglml ampicillin and grown for 16 hours. The 20 ml

suspension was added to 1 .O L of 2XYT with ampicillin and the cells were grown

at 37% with shaking until the absorbance at 600 nm was approximately 0.8.

IPTG was added to a final concentration of 1 mM and the cells were grown for

3.5 hours at 37OC. The cells were collected by centrifugation and resuspended in

a buffer solution as described in the small-scale expression experiments above

(2.1.3.).

The soluble cell extract was applied directly to a heparin-650M column (30

ml) equilibrated with 20 mM Na phosphate buffer (pH 7.2). 2 mM DTT, and 5%

urea. The column was washed with 4 volumes of buffer and the protein was

eluted with a O - 500 mM NaCl gradient over 200 ml. Fractions were assayed for

IMPDH activity by adding a 20 pl aliquot to a 1 .O ml assay solution containing

100 mM TRlSlHCl (pH 8.0). 100 mM KCI. 3 mM EDTA. 2 mM DTT and 1 mM

each of IMP and NAD. The reaction was monitored by the increase in the

absorbance at 340 nm due to the formation of NADH. Fractions containing

IMPDH activity were pooled, concentrated. and applied to an IMP - sepharose

column (100 ml) equilibrated with a buffer solution containing 20 mM TRlSlHCl

(pH 8.0), 2 mM DTT. 5% urea. The column was washed with 4 column volumes

of buffer and the IMPDH was eluted with the buffer containing 10 mM IMP.

Fractions containing IMPDH activity were pooled, concentrated. and dialyzed

against 10 mM TRISIHCI (pH 8.0). 300 mM KCI. 2 mM EDTA, and 2 mM PME.

Aliquots from the soluble cell extract, and the pooled fractions each from the

Heparin-65OM and the IMP-sepharose columns, were applied to a 12% SDS-

PAGE gel for analysis.

2.2.2. Enzyme kinetics

All assays were carried out with 100 mM TRlSlHCl (pH 8.0), 100 mM KCI.

3 mM EDTA. and 5 mM D I T at 23OC. IMP and NAD coiicentrations were varied

from 5 to 200 pM and the enzyme concentrations used varied from 10 to 100 nM.

The data were collected by measuring the change in absorbance at 340nm per

unit tirne, following the reduction of NAD (Ultraspec 2000 UVNisible

Spectrophotometer - Amersham Pharmacia Biotech). Total assay volume was

1.0 ml and the Km and V,,, values were detenined by steady-state kinetic

methods (Cleland. 1 979).

2.3. Protein Crystallography

2.3.1. Prelirninary crystallization screens

Human lMPDH II was dissolved at 5 mglrnl in the dialysis buffer described

above. Hampton Research's Crystal Screen and Crystal Screen 2, as well as

their Grid Screen and the Detergent Screen were used in the initial screens for

crystallization conditions.

2.3.2. Crystallization of human apo-IMPDH II

Purified human IMPDH II was dissolved to 20 mglml in a buffer solution

containing 10% glycerol, 10 mM TRlSlHCl (pH 8.0), 300 mM KCI, 2 mM EDTA.

and 2 mM PME. 2 pl of protein preparation was added to 4 pl of a reservoir

soluiion containing 100 mM MES (pH 5.8). 8-12% PEG 6000, 0.8-1.2 M LiCI, 1

mM EDTA, 40 mM PME. 2% methyl pyrrolidinone [v/v] (MpyD). The drop was

incubated above 0.5 ml of the reservoir solution for 4-6 weeks. The crystals grew

as elongated rectangular bricks whereby two dimensions where equal and the

crystal grew out along the third dimension.

2.3.3. X-ray diffraction data collection and processing

A large single crystal (1 .O mm X 0.5 mm X 0.5 mm) was dipped into the

well solution that also contained 15% glycerol and was Rash-frozen in a liquid N2

stream at 100°K. The x-ray source was synchrotron radiation from the CHESS

bearnline at Cornell University and the diffraction data were recorded by a Fuji

image plate detector. 45 frames of data were collected using a I0oscillation

angle. The data from one frame was corrupted and was discarded. The data

were processed using the programs DENZO and SCALEPACK (Otwinowski.

1993).

2.3.4. Molecular replacement

A complete model of the Chinese Hamster IMPDH monomer structure

(Syntchack et al.. 1996) were used as the search model. The molecular

replacement program used was AMORE (Navaza, 1994). The resolution range

used was 15.0 to 4.0 A and the interatomic vector cut-off was 20 A. Molecular

replacement calculations were performed both with the coordinates of the

subdomain included and removed from the search model.

2.3.5. Model building and refinement.

The best AMORE rotation and translation matrices were applied to the

hamster IMPDH II coordinates. AH of the residues in the resulting coordinate file

were converted to alanine residues to minimize model bias. The program O

(Kleywegt et al., 1994 and Jones et al., 1991) was used for graphical

representations of electron density and protein models. A 40 step rigid body

refinernent was performed and a 2 X (FOI - IF,I electron density map was

calculated (Brunger et al., 1987, Brunger et al., 1990, Brunger, 1992 and Brunger

et al., 1997). Using the program O (Kleywegt et al.. 1994 and Jones et al..

1991), alanine residues were mutated to the appropriate human IMPDH II

residues whenever electron density was seen extending beyond the p-carbon of

those residues. CNS was used for model refinement, which included a bulk

solvent correction and an overall anisotropic B-factor correction (Brunger et al.,

1987, Brunger et al., 1990, Brunger, 1992. Brunger et al., 1997).

All refinements were conducted within a resolution range from 10.0 A to

3.2 A. A 40 step positional refinement was performed following each round of

modeling. Residues were removed where no electron density was visible. As

well, residues of the N-terminus and sub-domain, that were not part of the search

model but showed electron density. were added and refined. Simulated

annealing and group B-factor refinements were also employed. The initial model

was overlaid with the modified model and regions of significant structural

variability were selected. These regions were then omitted for simulated

annealing refinement and electron density map calculation. Appropriate

structural adjustments were made to the initial model and multiple rounds of

simulated annealing-, positional-, and group B-factor-refinements were

performed. The "cross-validated maximum likelihood function" was used as the

refinement target.

2.4. Amino acid sequence alignments

Sequence alignments were perfomed by using the Gapped-BLAST

(Altschul et al., 1997) program as implemented at the NCBl lnternet page

(www.ncbi.nlm.nih.gov).

2.5 Human apo-IMPDH II model analysis

Structural analysis and comparisons were done using the programs O

(Kleywegt et al., 1994 and Jones et al., 1991) and Swiss-PDB Viewer (Guex and

Peitsch, 1996).

3.1 . Molecular Biology

3.1 . l . Cloning of human IMPDH II cDNA

The PCR products were visualized on a TEA-agarose gel. stained with 5

mglml ETBr. and viewed under U.V. light. Figure 3 shows the PCR products

along with the DNA markers Hind III and Bst 1 digested i. DNA. DNA with an

approximate size of 1,600 base pairs (bp) was produced from the reactions

containing 10 and 15 mM MgCI2. The higher stringency sample, containing 5

mM MgCI2, did not show DNA amplification.

The products were further analyzed by EcoRl and Pstl restriction digest

and TEA-agarose gel electrophoresis (data not shown). The EcoRl digest

produced fragments with the approximate size of 1,200 bp and 300 bp. These

fragments match the expected fragment sizes (1,278 bp and 294 bp ) by EcoRl

digestion of the coding region for human IMPDH II. The fragments produced

from the Pstl digest were approximately 1.000 bp and 450 bp. These fragments

also match the expected fragment sizes (965 bp, 467 bp, and 140 bp) for Pstl

digestion.

Figure 3. PCR amplification of human IMPDH II cDNA. Visualized an a 1% TEA-agarose gel, stained with 5 mg/ml ethiduim bromide. Lane 1: A Hind III markers (500 ng), lane 2: PCR-1 (20 pl) (5 rnM MgCl*). lane 3: PCR-2 1 (20 pl) (10 mM MgC12), lane 4: PCR-3 1 (20 pl) (15 mM mgC12), lane 5: i. BstE II markers (500 ng) (bp, base pairs).

Figure 4. Plasmids isolated from positive E. coli transforrnants. Ligation products of PCR fragments to Hinc II digested pTZ19R. Lane 1: Hind Ill markers (500 ng), lane 2: pTZl9R undigested plasmid (1 00 ng), lane 3-1 2: samples #1-10 (1 0 pl), lane 13: pTZ19R undigested, lane 14: h Hind III markers (500 ng) (bp, base pairs).

Based on the restriction enzyme digest results, the PCR products were

ligated to the pTZ19R plasmid via blunt-ended ligation. Plasmids isolated from

positive transformants are shown in Figure 4. Samples #2 and # I O were

religated plasmids. The remaining samples al1 showed recombination. Samples

#1, 3. 4. 8, and 9 were selected for EcoRl restriction enzyme digest analysis.

The resulting fragments are shown in Figure 5.

Sample #1 was not cleaved by EcoRl digestion. The remaining samples

(#3, 4. 8. and 9) were al1 cleaved by EcoRl digestion. The fragments produced

(approx. 4100 bp and 300 bp ) were consistent with the human IMPDH II coding

DNA inserted into the multicloning site of the pTZ19R. oriented with the human

IMPDH II start codon at the 5' end of the multicloning site. The opposite

orientation would have produced fragments with the approximate sizes of 3100

and 1300 bp. The insertion region of samples #3, 4, 8, 9 were completely

sequenced. Sample #8 was found to contain the entire coding region for hurnan

IMPDH II with no mutations (the remaining sample al1 showed nucleotide

changes). Figure 6 shows the sequence of the region surrounding the

recombination sites between the ?CR products and the pTZI9R plasmid. These

results confirm the above restriction enzyme digest experiments with respect to

gene insertion and orientation.

Figure 5. EcoRl digest samples of recombinant ligation products. Lane 1: É. BstE II markers (500 ng), lane 2-6: samples #1, 3, 4, 8, 9, resp. (20 pl), lane 7: EcoRl digested pTZ19R (100 ng), lane 8: h Hind Ill markers (500 ng) (bp, base pairs).

** r t p i 2 1 SR muitidoning site r- W HIMPOH II coding ONA

Recombinatian site

HIMPDH II coding DNA - pTZ19R rnulttdoning site

Pst t Hind III +\ rch7

5'- GGCmC~~GGGGGATCTAGAACACCTCCTCGGACCTGCAGGCATGCAAGCTTTCCCTA

Stop codon t Recombinatton sile

Figure 6. Recombination site DNA sequence. DNA sequence at the 5'- and 3'- regions of the PCR products and the pTZ19R plasrnid. A. Start codon region, B. Stop codon region.

3.1.2. Sub-cloning of human IMPDH II cDNA

Due to the Ncol restriction site located at the start codon for the human

IMPDH II gene (Figure 6), Ncol digestion of the Hind III digested pTZ19R-human

IMPDH II produced a fragment of approximately 1600 bp containing the entire

human IMPDH II coding region. However, additional Ncol sites at positions 208

and 1258 of the human IMPDH II gene made a simple Ncol digest unavailable.

Thus, a partial digest protocol was designed and irnplemented. The 1600 bp

fragment was isolated and ligated to an NcollHindlll digested pSE420 plasmid.

Plasmids isolated from the positive transformants of the ligation reaction were

screened by EcoRl and Pstl restriction digestion (data not shown). AH samples

showed the correct size of fragments consistent with presence of the human

IMPDH II gene inserted into the pSE420 plasmid in the correct orientation for

expression. Positive recombinants were screened for expression in small

quantities.

3.1.3. Expression of human IMPDH II cDNA

Aliquots of the induced cells were applied to an SDS-PAGE gel and are

shown in Figure 7. Negative controls for expression (TOP10 cells and TOP10

cells with the pSE420 plasmid) showed no expression as expected. Three of the

four samples show expression in both the uninduced and ind uced aliquots,

although more protein was evident in the induced samples. Following cell lysis,

al1 three samples that showed over-expression had IMPDH activity.

Figure 7. Expression analysis of pSE420-human IMPDH II recombinants. 12% SDS-PAGE gel with 20 LLI samples from the expression of pSE420-hurnan IMPDH II recombinants in E. coli TOPlO cells. Lane 1: TOPlO cells uninduced, lane 2: TOPlO cells induced. lane 3: pSE420rTOP10 cells-uninduced, lane 4: pSE420KOP10 cells-induced, lane 5: sarnple #1- uninduced, lane 6: sarnple #1-induced, lane 7: sample #2-uninduced, lane 8: sample #2-induced. lane 91: sample #3-uninduced, lane 10: sample #3-induced. lane 11: sample #4 uninduced, lane 12: sample #4-induced, Iane 13: Molecular weight markers (1 2 pg).

3.2. Biochemistry

3.2.1, Purification of human IMPDH II

Figures 8, 9, 10, and Table 2 describe the process involved in the

purification of human IMPDH 11. 10% urea was required to ensure a significant

amount of human IMPDH II dissolved in the soluble cell lysate.

Figure 8. Analysis of the purification of human IMPDH 11. 12% SDS-PAGE gel with sarnples (20 pg) from the purification of human IMPDH II. Lane 1: Molecular weight markers (30 pg)? lane 2: soluble ce11 extract, lane 3: pooled fractions following the Heparin-650M column. Iane 4: pooled fractions following the IMP-sepharose column.

IMPDH Activity

f-5

20 40 60 Fraction number

Figure 9. Elution profile of the Heparin-650M colurnn. 5.0 ml fractions were collected at a flow rate of 2.5 rnllrnl. The NaCl gradient began at fraction #30. IMPDH activity was detected in fractions 62 to 74.

IMPDH Activity

20 40 60 Fraction num ber

Figure 10. Elution profile of the IMP-sepharose column. 5.0 ml fractions were collected at a flow rate of 2.5 rnlfmin. The [NaCl] was increased to 0.3M between fractions 15 to 44. IMPDH activity was detected in fractions 55 to 64. Note: the increase in absorbance at 280nm after fraction 55 was due to the IMP in the column buffer. IMPDH eluted with the IMP.

Table 2. Purification table for human IMPDH II. Enzyme kinetic data was obtained by the method described in section 2.2.2. 1 mM of IMP and NAD were used in these assays. SCL, soluble cell lysate. Samples frorn columns are the pooled fractions. 1 Unit = 1 prnol/min.

SCL

Heparin column

IMP column

Lane 2 in Figure 8 shows the large band of human IMPDH Il under

denaturationlreducing conditions with an approximate molecular weight of 55000.

Heparin was reported to interact strongly with nucleotide binding enzymes

(Muszynska et al., 1985). Human IMPDH II eluted from the Heparin-65OM

column at approximately 300 mM NaCI. Washing the column with 1.0 M NaCl

showed little protein that remained bound following human lMPDH II elution

(Figure 9). A significant reduction in the amount of bacterial proteins is evident

from lane 3 of the SDS-PAGE gel and the corresporiding kinetic data in Table 2.

The elution profile for this column (Figure 9) shows a single peak eluting with

IMPDH activity. The elution profile for the IMP-sepharose column (Figure 10)

shows contaminating proteins flowing through the column without binding.

lncreasing the concentration of NaCl to 0.3 M removed proteins that were non-

specifically bound. Lane 4 of the gel (Figure 8) shows the pooled fractions from

the IMP-sepharose column. Most of the remaining contaminating bacterial

proteins were removed leaving a highly purified preparation of human IMPDH II.

Volume [Protein] Protein Unitslml Units,,, Unitslmg % Purification (m 1) (mglml) (mg) Yield fold

26. O 10.0 260 O. 57 14.8 0.057

46.0 0.92 42.3 0.26 12.0 0.28 81 4.9

36.0 O. 74 26.6 0.25 9.0 0.34 61 6.0

Between 25 mg and 30 mg of purified hurnan IMPDH II were isolated from

each 1 .O L suspension of E. coli TOP1 01pSE420-human IMPDH II. Following

dialysis, the highest concentration of human IMPDH II achieved was 5 mgfml.

When the protein was incubated on ice at this concentration, it was obsewed to

form a gel. This state dissolves following a 5 to 10 minute incubation at roorn

temperature (23OC). Aliquots of human IMPDH II that were stored at -70°C did

not show reduction in activity upon thawing, however when the protein was

stored at 4OC. a 50% reduction in activity was obsewed over a 24 hour period.

The crystals grew as elongated rectangular bricks whereby two dimensions were

equal and the crystal grew out along the third dimension.


Michaelis-Menten enzyme kinetics were done to detemine if the human

IMPDH II had comparable Km and Ka values to other recombinant IMPDHs and

human IMPDH II isolated from tissue sources. The Km values for IMP and NAD

were determined to be 6.4 pM (+/-2.0 pM) and 32 pM (+/- 3.0 FM), respectively.

The kat was found to be 0.91 s-' .

3.3. Protein Crystallography

3.3.1. Preliminary crystallization screens

Microcrystals were produced from Crystal Screen 2. condition #48 which

contained 0.1 M bicine (pH 9.0), 10 % PEG 20K, and 2 % dioxane (Figure 11).

Variations in the concentration and molecular weight of PEG. pH and buffer type.

dioxane concentration and organic solvent type had no effect on crystal size and

shape. The addition of 2% CTAB from the Detergent Screen produced slightly

larger microcrystals. Similar microcrystals were produced from Crystal Screen 2,

condition #IO which contained 0.1 M Na acetate (pH 4.6). 30 % MPD. and 0.2 M

NaCI. Variations in MPD concentration, pH and buffer type, and NaCl

concentration had no effect on crystal size and shape. Microcrystals were also

produced from Crystal Screen 2, condition #41 which contained 0.1 M TRlSlHCl

(pH 8.5). 1.0 M LiCI, and 0.01 M NiCI. Again, variations in each of the

components had no effect on crystal size and shape.

Srnall twinned brick-shaped crystals were produced from the pH vs.

[PEGILiCI] Grid Screen. Variations of pH, buffer type, PEG concentration and

size. and LiCl concentration were attempted. The conditions that produced the

largest crystals of these were 0.1 M MES (pH 6.0), 1.0 to 1.2 M LiCI, and PEG

4K to 8K from 6 % to 12 % (Figure 12). Variations in crystallization method,

protein

Figure 11. Human apo-IMPDH II microcrystals. Photograph of the type of microcrystals produced from the initial screening of apo-human IMPDH II.

Figure 12. lmproved human apo-IMPDH II crystals. Photograph of the Iargest microcrystals grown. Average size of the crystals is approximately 100p X 20p X 20p. These crystals grew using the hanging drop rnethod with a well solution containing 0.1 M MES (pH 6.0), 1.0 M LiCI, and 8% PEG 4K. 2 pl of protein solution plus 2 pl of well solution were mixed and incubated at 23 OC for 5 days.

concentration, and temperature did not improve the size and shape of the

crystals.


The addition of 10% glycerol to the dialysis buffer allowed for a more

concentrated preparation of human IMPDH II. The addition of between 2% and

5% 1-methyl-2-pyrrolidinone (MPyD) [vlv] to the above conditions that produced

the small twinned brick-shaped microcrystals (from pH vs. [PEGILiCI] Grid

Screen) produced larger twinned crystals. The twinning was eliminated by the

addition of 20 mM to 50 mM PME. The largest single crystals were grown at

room temperature and when the well volume was decreased to 0.5 ml (Figure

13).

Figure 13. Large human apo-IMPDH II crystal. Photograph of an apo-human IMPDH II crystal ( 6 0 0 ~ X 200~1 X 2 0 0 ~ ) grown by hanging drop vapor diffusion with a well solution containing O. 1 M MES, pH 5.8, 10% PEG 4000, 1.0 M LiCi, 40 mM PME, 2% MPyD. 4 pl of protein (dissolved in 10 mM TRISICI. pH 8.0, 0.3 M KCI, 10% glycerol, 1 mM EDTA, 2 mM PME at 20 mglml) was mixed with 2 LAI of well solution and incubated at 23OC for 4 to 6 weeks.

3.3.3. X-ray diffraction data collection and processing .

The crystal form, obtained under the conditions found in 3.3.3., was

tetragonal with unit cell dimensions a = b = 145.90 A, c = 129.35 A, and angles u

= p = 7 = 90". Based on symmetry of reflection intensities and systematic

absences, the space group was detemiined to be 1422. Table 3 shows the data

redundancies and Table 4 shows the final statistics from the data processing.

The data were processed from 15.0 A to 2.8 A and found to be essentially

complete. However, below 3.15 A the data were weak and the Rsym values were

above 40%.

Table 3. Summary of reflection intensities

Resolution shell (A)

and R,, values by resolution shell.

All data 1 1 327.40 1 60.70 1 1.47 1 0.08

Table 4. Summary of X-ray diffraction observation redundancies.

Rsy, 0.03 0.04

Resolution shell (A) % of reflections with given number of observations.

chi2 0.67 0.99

Low Limit 40.00 6.03

Avg. error 147.30 89.80

High Limit 6.03 4.79

Avg. I 4398.50 3000.40


Table 5 shows the best four AMORE rotation and translation solutions

deterrnined by using the coordinates of hamster IMPDH II as a search model.

The correlation coefficient and the R-factor were slightly better when the

coordinates of the sub-dornain were removed (data not shown). The next

highest correlation coefficient from the molecular replacement calculations was

24.4 %. The solution with the highest correlation coefficient from the rnolecular

replacement calculation was applied to the coordinates and subsequently refined

against the apo-human IMPDH II data. The initial crystallographic R-factor was

0.46 and the R-free was 0.48.

Solution 1 Euler Rotation Angles 1 Translation Correlation j R-factor l #

, I (4 i (A) 1 1 ( O h )

Coefficient (Oh) 1 I I I I I

Table 5. AMORE rnolecufar replacement solutions with the highest peaks. The top 4 molecular replacement solutions from AMORE output files are listed. Solution #1 was applied to the hamster IMPDH II model.

3.3.5. Model building and refinement

Due to the rigid body refinement protocol built into the AMORE program,

an XPLOR rigid body refinement had no effect on the R-factors of Model A.

Following an initial simulated annealing refinement, the R-factor dropped to 0.38,

however the R-free value minimized at 0.42 and increased to a final value of

0.44. To determine the correctness of the structure without introducing phase

bias, the model was converted to a poly alanine structure and a 2 X IF,I - IF,I

electron density map was calculated. Where electron density was visible

extending beyond the alanine P-carbon atom, the alanine residue was mutated

to the appropriate human IMPDH II amino acid residue. Following the 40 step

positional refinement. both R-factors were observed to decrease. A new electron

density map was calculated. alanine residues were again mutated, and the

model was refined. This was repeated until al1 observable amino acid side chains

were included in the model. Additions and deletions were done and multiple

rounds of refinernent were perfoned to produce a model of human IMPDH II.

Table 6 shows the refinement statistics for the final apo-human IMPDH II model.

Table 6. Final refinement statistics

Resolution range: 8.00 to 3.15 A

Theoretical total number of refi. in resolution range Number of unobserved reflections (no entry or IFoI = 0) Number of reflections rejected (Fo,$sigrna c 2.0) Total number of reflections used Total number of reflection in the working set Total number of reflections in the test set Number of non-hydrogen atoms

Crystaltographic R-factor Cross validated R-factor

Bond RMSD (A) Angle RMSD (Deg) Average 0-factor (overall) (À2) Average 0-factor (backbone) (A) Average 8-factor (sidechains) (À )

Continuous electron density was not observed for residues 11 1 to 232.

326 to 337, 398 to 449, and 495 to 514. Discontinuous electron density was

observed in the region of active site helix (326 to 337), however the resolution

limit prevented unambiguous assignment of amino acid residues. Discontinuous

density was also found in the area where the sub-domain would be expected.

Again. residues were not assigned. Electron density was observed extending

beyond GLY 17, which was the N-terminal residue of the hamster IMPDH II

model, and residues 12 to 16 were added accordingly.

3.4. Human apo-IMPDH II model analysis

3.4.1. Global fold

The global fold of human apo-IMPDH II is consistent with the human and

hamster IMPDH II ternary cornplex models. The larger domain of the protein

consists of an u/p barrel type fold with overall dimensions of approximately 40 X

40 X 50 A3 (Figure 14). The tetramer is then generated by a crystallographic 4-

fold rotation of the u/P barrel about the z-axis (Figure 15). The majority of

tetramer-related contacts form between residues that are part of or close to the

active site and residues from the N- and C-terminus of an adjacent monomer. In

particular, an N-terminal p-strand forms a three-stranded antiparallel P-sheet with

two P-strands from an adjacent subunit (Figure 15). Two face to face tetrameric

rings generate an octameric assembly in the 1422 crystal lattice (Figure 16).

Figure 17 is an image of the human apo-IMPDH II tetramer colored by 6-

factors of the backbone u-carbon atoms. The B-factors are lowest in the regions

that make tetramer contacts. and show significant increases surrounding the

regions that are structurally undefined. especially in the vicinity of the sub-

domaiti.

Figure 14. Two orientations of the human apo-IMPDH II monomer model. a-helices are in red and P-sheets are in yellow. Orientations are related by a 90' rotation about the axis parallel to the horizontal of the page. The program Swiss-PDBViewer 3.51 (Guex and Peitsch, 1996) was used to generate the images.

Figure 15. Two orientations of the human apo-IMPDH II tetramer model. The upper image viewed down the z-axis with y-axis parallet to the horizontal of the page. The lower image is representing a 90' rotation of the upper image about the y-axis. The program Swiss-PDBViewer 3.51 (Guex and Peitsch, 1996) was used to generate the images.

Figure 16. Human apo-IMPDH II octameric structure in the 1422 crystal form. The monomers are colored differently for ease of identification. The program Swiss-PDBViewer 3.51 (Guex and Peitsch, 1996) was used to generate this image.

Figure 17. B-factors of the a-carbon atoms of the tetrameric human apo-IMPDH II model. The residues with the lowest B-factors (< 20 A') are colored blue and the residues with the highest 8- factors (w 40 A2) are colored red. The program Swiss-PDBViewer 3.51 (Guex and Peitsch. 1996) was used to generate this image.

The second dornain, inserted between U-helices 2 and 3, partially seen in

the hamster and human IMPDH II structures, and not seen in the Tritrichomonas

foetus IMPDH crystal structure, was not observed in the human apo-IMPDH II

crystal structure and was presurned to be disordered in the crystal. The only

observable IMPDH subdomain as been in the Streptococcus Pyogenes IMPDH

crystal structure. A large void was observed in the crystal lattice that could

accomrnodate the subdomain.

3.4.2. Active site

The active site residues of IMPDH are mainly at the C-terminal end of the

polypeptide chain. A consetved phosphate binding motif, consisting of a P-

strand. u-helix. D-strand conformation is apparent from residues 359 to 396 as

expected. Ala 338. Cys 339, and Gly 340 are the only residues of the 'so-called'

active site helix (usually extending from Gly 326 to Gly 340) for which electron

density is found in the human apo-IMPDH II crystal structure (Figure 18). This

includes Cys 331, the active site nucleophile that forms a covalent bond with

XMP* (Sintchak et al., 1996). The residues (338 to 340) extended approxirnately

9 A above the dp barre1 main body and made contacts with the backbone atoms

of Ile 37 from an adjacent monorner. The lack of electron density around the a-

carbon of Gly 340 (Figure 18) suggests a flexible spot at this residue.

Ala 33û

Figure 18. Human apo-IMPDH II active site helix electron density map. Electron density map (contoured at o = 1.0) and refined amino acid residues showing the lack of electron density between Met 325 and Ala 338. Also note the lack of electron density around the a-carbon of Gly 340. The program Swiss-PDBViewer 3.51 (Guex and Peitsch, 1996) was used to generate this image.

Lvs 450

Figure 19. Human apo-IMPDH II active site flap electron density map. Electron density rnap (contoured at a = 1.0) and refined arnino acid residues showing the lack of electron density between Pro 397 and Lys 450. The program Swiss-PDBViewer 3.51 (Guex and Peitsch, 1996) was used to generate this image.

The discontinuous electron density found where the helix was expected

may represent some stable portions of the missing amino acid residues.

However. the relatively low resolution of the maps did not allow for unambiguous

identification of this part. The active site flap, consisting of residues 400 to 450

following p-strand 8 of the phosphate-binding motif. are also not observed

(Figure 19). The electron density is not seen beyond Pro 337 and resumes after

Lys 450.

Residues of the active site that are part of the dP barrel do not

significantly shift positions when compared to the ternary cornplex of human

IMPDH II. Figure 20 shows five active site residues that make contacts with

substrate ligands, in this case, the XMP* and MPA from the hamster IMPDH II

structure are shown. Significant changes in the position of Asp 274 are

apparent. As well. the C-terminus density, consisting of residues 495 to 514, is

not apparent (Figure 21). The N-terminus extends away from the dP barrel. This

region, especially Tyr 12. forms contacts between two tetramers at the octarneric

assembly interface (Figure 16).

Figure 20. Overlay of a/p barrel active site residues. Shown here are active site residues that are part of the df3 barrel. Cyan, apo-IMPDH II (human); Green, ternary-IMPDH Il (human); Red. ternary-IMPDH II (hamster). XMP' and MPA models were taken from the ternary hamster IMPDH 11. The program Swiss-PDBViewer 3.51 (Guex and Peitsch, 1996) was used to generate this image.

Figure 21. Human apo-IMPDH II C-terminal electron density map. Electron density map (contoured at o = 1.0) and refined amino acid residues stiowing the lack of electron density extending beyond Thr 494. The program Swiss-PDBViewer 3.51 (Guex and Peitsch, 1996) was used ta generate this image.

Crystals that were re-dissolved in dialysis buffer showed l MPDH activity

(data not shown) and SDS-PAGE analysis demonstrated that there was no

significant evidence of proteolytic digestion (Figure 22).

67000 Da .' , Re-dissolved human apo-IMPDH II crystal

Figure 22. SDS-PAGE analysis of a re-dissolved human apo-IMPDH II crystal. The crystal was removed from the mother liquor and placed in 10% glycerol, 10 mM TRISIiW (pH 8.0), 300 mM KCI. 2 mM EDTA. and 2 mM PME. The sample was incubated overnight and applied to an SDS- PAGE gel. Lane 1. Low molecular weight markers; Lane 2, 20 pl of dissolved crystal.

3.5. Amino acid sequence alignments

3.5.1. Overall sequence

Figure 23 shows the sequence alignments of IMPDH proteins with known

three-dimensional structures. The regions that show the highest amino acid

sequence conservation are in the loop regions that connect the a-helices and P-

strands of the U@ barrel. Regions that show the greatest sequence variability

include the subdomain and active site flap.

3.5.2. Active site

Figure 24 shows the sequence alignments concentrating on the active site

helix. Clearly, there is a very high degree of sequence conservation in this

region. Four of the 20 surveyed residues are conserved glycines; three of which

(Gly 324, Gly 326, and Gly 328) are N-terminal to the active site nucleophile

Cysdl l . As mentioned above, most of the residues between and including Gly

326 and Gly 340 are disordered in the human apo-IMPDH II structure.

Figure 25 shows the sequence alignment with respect to human IMPDH II

residues 390 to 453 that represent the active site flap reg ion. There are highly

conserved glycine residues at 398 and 450. In the human apo-IMPDH II

structure, residues in between these glycines are structurally undefined.

Although these glycines are 52 amino acids apart in the primary structure, they

reside approximately 13 A away from each other in the tertiary structure.

Another interesting feature apparent from the sequence alignment is the various

insertions of amino acids between Met 420 and Lys 438. This region is also

structurally undefined in both human IMPDH II and substratelinhibitor complexed

hamster IMPDH II (Sintchak et al., 1996). It includes the highly conserved

residue Tyr 430. Despite these insertions, al1 IMPOH proteins from various

species show greater than 40% sequence identity throughout the active site flap

region. especially P-strand L and u-helix E. The loop between p-strands M and N

is also highly conserved. GMP reductase is the only non-IMPDH protein that

showed significant sequence sirnilarity to human IMPDH II in this region.

Figure 26 shows the alignment centered around human IMPDH II residues

359 to 416 that represent the phosphate-binding motif. All currently known

IMPDH enzyme sequences were included as well as other non-IMPDH

sequences that aligned well with this stretch of human IMPDH II. With the

exception of GMP reductase, al1 non-IMPDH proteins show no sequence

similarity beyond Glu 399, the N-terminus of the active site flap region. The

consensus sequence as defined by Bork et. al, 1995 is also shown. Five highly

conserved glycine residues were observed to align with human IMPDH II

glycines 365, 366, 382, 387. and 398. In addition, Pro 360, Asp 364, Ile 367, and

Ala 383 appear to be highiy conserved between IMPDHs of different species as

well as other phosphate binding proteins. Wlh the exception of Asp 364. al1 the

amino acids in P-strand 7 are conserved non-polar residues.

Figure 27 shows the sequence alignments of the residues from the

subdomain region of human IMPDH II with other IMPDH-, and non-IMPDH

proteins. There are six regions of conserved amino acids. These include

residues Gly 113 and Pro 123, Gly 141 and Asp 146, Arg 153 and Ile 163, Leu

175 and Val 186, Pro 189 and Leu 151, and Lys 208 and Ile 221.

Figure 23. Sequence alignments of stnicturally known IMPDHs. H. Il.. human type II IMPOH; CH. II, chinese hamster type II IMPOH: S.p. . S. Pyogenes IMPDH; T f . . T foetus JMPDH. Filled-in black represents amino acid identities and filled-in gray represents amino acids wrth similar chernical properties. The top Iine shows the secondary structural elements as defined by the hamster IMPOH structure (Sinchak etA. 1996).

Human II Mouse II L. donoveril Tb. bruce1 C albicans S cerevrsrae Hamster I I Mouse I Human I Fruit fly P. cadnii A thaliane T. foetus 6 bergdoderi

Figure 24 Mulliple sequence alignment of Ihe active sile helix region The top Iine shows the secondary structural elements as defined by the hamster IMPDH structure (Sintchak et al , 1996) Filled-in black repersenls amino acid identities and f~lled-in gray represents amino acids wilh sirnilar chernical properties aslericks denoles the adive sile nucleo~hile Cvs 31 llhumanl

342 34 2 338 3 36 344 347 342 342 342 36 1 274 332 329 240

The

Human II* Hamster 11" Mouse II Human l Mouse l Ffuil Fly S cerevisrae P cannrr C albicans A fhahana T b brucer L donovan1 M leprsa M tubarculos~s H pykrr M jannaschu A calcoace!icus E cok H mf/usnzae P furiosus B subtrl~s S pyogenes El burgdorferi ' T foetus' H pylori (GR) Human(GR) A lumbr~cordes (GR) E col! (GR) Spinach(G0)' A fulgidus (2ND) S lycopersicum (GO) M cryslallrnrum (GO) A vindans (LO) P pullda (MD) E cob (ThiC) M l a lrophicum (GS) H nfulenzea (1.D) S cerevisiae (Cyb2)' E col1 (TrpC)' Consensus

Figure 26 Multiple sequence alignrnent ot lhe phosphate-binding region Pfoleins olher than LMPDH are identified by brachels GR. GMP teductase. GO. glycolale oxidase, 2ND, 2-nitropropane dehydrogenase, 10, lactate oxidase, MD, mandelale dehydrogenase. GS. glutamale synthase. LD. lactate dehydrogenase. Cyb2. cyîochfome b,. TrpC. indoleglycerolphosphate synthase The top Iine shows the secondary structural elements as defined by human and hamster IMPDH II structure (Sinchak e l al. 1996) Filled-in black fepresents amino and idenlities and fiiled-in gray represents amino acids with similar chemical prowflies The bottom Iine shows Ihe consensus (Boik et al, 1995) capitals. amino acids conserved in almost al1 of the sequences. h. mainly non-polar, p. macnly polar Asterisks represenl proleins wdh known lhree dimensional structures and are described in Figure 27

4. Discussion

4.1. Molecular Biology

4.1.1. Cloning of human [MPDH II cDNA

A human peripheral blood leukocyte ÀgtlO cDNA library from a HL-60 cell

line was chosen as the source of hurnan type II IMPDH cDNA because of the

high level of human IMPDH II mRNA present in the cells, as judged by Northern

blot analysis (Konno et al.. 1991). This study described a large increase in the

2.3 kb human IMPDH Il mRNA of leukemic cells relative to normal human

lymphocytes. Consistent with this is the significant amplification of human IMPDH

II cDNA directly from the lambda phage stock following 30 cycles of PCR (see

2.1).

PCR primer sites were chosen to be complementary to flanking regions of

human IMPDH II cDNA. 8ecause the cDNA library was constructed by

recombination of cDNA fragments and lambda DNA at an EcoRl restriction

enzyme site and human IMPDH II cDNA sequence has a EcoRl restriction

enzyme recognition site at position 294, it was unclear whether the 5' end of the

coding sequence was present. Therefore, the upstream primer was designed to

be complementary to the sequence at the EcoRl cloning site of ÂgtlO. The

downstream primer was designed to be complernentary to the sequence

immediately 3' to the human IMPDH II stop codon. The amplification of a 1,600

bp fragment (Figure 3) appeared to indicate that the entire coding sequence was

present (1,542 bp). The high stringency sample (containing 5 mM MgCI2) did not

show DNA amplification and the low stringency sample (containing 15 mM

MgC12) produced a small fragment in addition to the main 1600 bp fragment

indicating some non-specific binding of the PCR primers. The sample containing

10 mM MgCl2 produced a single DNA fragment. Repetition of this experiment

invariably led to the amplification of pg quantities of the 1600 bp fragment.

The fragments produced following digestion with the restriction enzymes

Pst1 and EcoRl were consistent with the expected fragments for the human

IMPDH II gene. These results prompted the attempt to recombine the PCR

generated fragment to the standard cloning vector pTZ19R. Due to the low

efficiency of ligating DNA fragments with blunt-ends, a blue-white screening

protocol was used to identify positive transformants containing recombinant DNA.

Plasmids were isolated from white colonies and visualized on an agarose gel

(Figure 4). Samples that migrated differently from pTZ1 SR were subjected to

digestion with EcoRI. The EcoRl digestion results were used to identify possible

pTZ19WPCR insert recombinants and the orientation of the inserts. Figure 5

shows that samples 3, 4. 8, and 9 appeared to be pTZ19Rlhuman IMPDH II

recombinants. DNA sequencing of these samples confirmed the identity and

orientation of the PCR product inserts of al1 four samples to be human IMPDH II

cDNA.

The sequence surrounding the recombination sites of sample #8 is

detailed in Figure 6. Interestingly, the 5' end of the insert begins 3 bp 5' to the

human IMPDH II start codon. The primer sequence or any other of the predicted

upstream DNA sequences of human IMPDH cDNA are absent. As well, 2 bp are

missing from the 3' end of the of the downstream primer sequence. These types

of alterations are present in al1 four recombinant samples. Bases are also

missing from the vector sequence. Most likely, the long incubation time of the

ligation reaction (16 hours) and contaminating exonuclease activity caused some

degradation of both the vector and insert.

Sample #8 had a coding DNA sequence that was identical to the

previously published sequence for human IMPDH II cDNA (Natsumeda. Y., et al..

1990). Three of the four recombinant clones had point mutations in their DNA

sequences that would result in predicted amino acid sequence changes. These

mutations are the result of the replicatative infidelity of Taq polymerase.

Originally. due to expected mutations in the PCR products when using Taq

polymerase, the amplified fragments were going to be used as templates to

generate random primed probes for screening the lambda library by

hybridization. However, when one clone was determined to be error-free, this

approach was abandoned. For reproducibility without mutations. higher fidelity

polymerase should be used.

4.1.2. Sub-cloning of human IMPDH II cDNA

Konno et al, 1991 reported the expression of human IMPDH II by sub-

cloning the human IMPDH II cDNA into a pUC based expression plasmid as a

fusion protein with 11 additional residues at the N-terminus. This procedure,

however. produced only pg quantities of protein, far below the production level

required for the screening of conditions suitable for the growth of protein crystals.

An expression protocol was designed such that the first amino acid residue

expressed was the hurnan IMPDH II native Met start residue. pSE420

(Invitrogen) is a prokaryotic expression plasmid designed to express mammalian

genes in prokaryotic cells. An Ncol restriction enzyme recognition sequence

(CCATGG) is available so that the start codon of a gene can be placed

immediately downstream of the genetic elernents required for the over-

expression of a protein (Scheme 2).

Analysis of the human IMPDH II cDNA sequence revealed three Ncol

recognition sequences present in the gene, including one at the start codon. The

Ncol partial restriction enzyme digest protocol (Section 2.2) was implemented to

isolate a cDNA fragment that had no 5' sequence beyond the start codon. This

fragment was then ligated to the pSE420 plasmid and the resulting recombinant

plasmids were screened by Pstl and EcoRl restriction enzyme digests. Al1

samples screened showed recombination in the correct orientation for expression

(Figure 5).

4.1.3. Expression of human IMPDH II cDNA

Screening for expression was initially done on a small scale for analysis

as described in section 3.2. Figure 7 demonstrates that three of the samples

picked showed over-expression of a protein of approximately 55 kDa. The lanes

where both induced and uniduced samples were loaded showed expression of

this protein indicating a lack of complete repression. This, however, did not have

any detrimental effects on protein expression or cell growth. as IMPDH is not

toxic to bacterial cell growth. The observation of significant levels of IMPDH

activity relative to the controls indicated that human IMPDH II was over-

expressed as expected.

4.2. Biochemistry

4.2.1. Purification of human IMPDH II

The method used to purify human IMPDH II was based on the

method used by Carr et al, 1994. This method employed a heparin cation

exchange column whereby the soluble cell extract protein was loaded directly.

Figures 8, 9, 10 and Table 2 show that this highly reproducible technique was

very effective in eliminating the majority of contarninating proteins. The final step

involved a substrate-based ( 1 MP) affinity chromatograp hy column. The

combination of these two columns proved to be an effective and efficient method

to purify human IMPDH II. Due to the significant reduction in specific activity

upon storage, this protocol, from cell lysis to purified protein, was completed in a

single day, yielding 25-30 mg of purified human IMPDH II per liter of E. coli

growth media, clearly sufFicient for the crystallization studies.


Table 7 shows kinetic constants for human apo-IMPDH II derived in this

study and by others. The Km values for both substrates were consistently in the

low micromolar range however the Lt values showed some variation. Perhaps

the decrease in activity observed when the protein was stored at 4OC may be

refiected in the reported values. All of the human IMPDH II proteins listed in the

table below are recombinantly produced. As there are no reports of human

IMPDH II isolated and characterized from human tissue, it is not known whether

tissue source enzyme would have similar kinetic constants. Recombinant hurnan

IMPDH 1 has been shown to have similar Km and kat values as human IMPDH II

(Konno, Y.. et al., 1991; Carr, S., et al.. 1993; Hagar, P.. et al., 1995).

REFERENCE

Table 7. K, and L, values for human type II IMPDHs.

This study

Wang and Hedstrorn

Fleming et al.

Carr et al.

4.3. Protein crystallography

KI,I IMp (PM)

4.3.1. Preliminary crystallization screens.

Kt, NAD (PM)

6.4

4.0

7.2

9.3

The Hampton Research crystallization screens were used to screen for

conditions that lead to the growth of human IMPDH II crystals suitable for X-ray

analysis. Several conditions produced microcrystals in a short period of time (15-

360 minutes). The largest of the microcrystals grew in spaces within the

precipitated protein in the drops. Srnaller variations in the parameters had little

or no effect on the protein solubility or the growth of these crystals. The best

microcrystals ap peared in the PEGlLiCl crystal screen. These crystals were

brick-shaped (Figure 12) and had straight, clean edges and grew as single

entities. However, despite exhaustive parameter searches, no conditions were

found that produced large single crystals.

These crystallization experiments indicated that human lMPDH II had a

strong tendency to aggregate. Both high and low concentrations of precipitants

32

36

37

32

0.91

O. 39

0.76

1.3

(PEGs, salts, and organics) produced extensive amorphous aggregation.

Intermediate ranges of precipitants (3-12% PEGs, 0.5-1.5M salts, and 1-3%

organics) tended to moderately increase the protein's solubility. These

conditions tended to grow most of the microcrystals. Very few conditions

produced crystalline aggregates and in those that did, the crystals were no longer

than 30 microns along the longest edge.


Va rious water-misable organic solvents were added to the d ialysis buffer

in order to improve the solubility of the enzyme prior to crystallization

experiments. 10% glycerol added to the dialysis buffer allowed the protein to be

concentrated as high to as 50 mglml without any aggregation. Despite screening

for crystallization at higher protein concentrations, no change in crystal size was

observed. Crystal size was finally increased with the addition of 1-methyl 2-

pyrollidinone at concentrations betweer. 1% and 7% (wlv). Most likely, due to its

amphiphilic character. this compound improved the solubility of human IMPDH II

enough to reduce the number of nucleation events within the crystal drop so

single large crystals could grow. However, al1 crystals grown under these

conditions were twinned. The addition of 10 - 40 mM P-mercaptoethanol (PME)

effectively eliminated the twinning. As there are 12 cysteine residues in the

human IMPDH II amino acid sequence and no reported disulfide bonds in the

hamster IMPDH II structure, the twinning was probably due to disulfide bond

formation of free cysteine(s) on the surface of the molecules. The addition of

PME prevented this to allow single crystals to grow. Following these conditions,

small changes in temperature and well-and drop-volume were screened to

maximize the size of the crystals. Eventually, excellent, large single crystals

were grown reproducibly (Figure 1 3).

4.3.3. X-ray diffraction data collection and processing .

All data were collected from one large single human IMPDH II crystal

(0.8mm X 0.4mm X 0.4mm). frozen in a liquid nitrogen stream. The crystal

belonged to the tetragonal space group 1422. Complexed human and hamster

IMPDH II crystals. as well as lMPDH crystals from Borrelia bergdorfe', were also

tetragonal. however their space groups were both reported as 14 (Sintchak et al..

1996. Colby et al.. 1999. MacMillan et al., 1998. unpublished data). IMPDH

crystals from Tritrichomonas foetus were of the cubic space group P432. In al1

cases, a 4-fold crystallographic rotation of an IMPDH monomer around the

crystallographic c-axis created the IMPDH tetramer.

The tables of redundancies (Table 3) indicates that the data set was

almost complete to 2.8 A. However, the table of reflection intensities and Rsy,

values clearly (Table 4) shows that below 3.1 5 A the intensities of the reflections

dropped significantly, and consequently, the Rsym values increased dramatically.

As a result. no useful signal can be observed beyond this resolution and no data

were used below this value. Possibly. the disorder of the subdomain and other

parts of human apo-IMPDH II caused this. Another example of such behavior

would be mercuric ion reductase (Schiering et al. 1991). but in accordance, the

maximum resolution obtained with the human ternary-IMPDH II crystals was 2.9

A. Nevertheless, the data up to this level were good and the overall R,, value

was low (6.0%).


The molecular replacement program AMORE was used to produce an

initial model of apo-human IMPDH II from the coordinates of the hamster IMPDH

II as a search model. Calculations were done both with the coordinates of the

sub-domain present and removed from search model. This was done because

the IMPDH sub-domain from Borrelia bergdofen and Tntnchornonas foetus were

disordered in the crystal, indicating that this part of the molecule may be

disordered in other IMPDH structures. If this were the case, false coordinates

may have significantly reduced the correlation factor between the data and the

search model. The results of the calculations (Table 5) showed that the

correlation factor, when the sub-domain coordinates were removed from the

search model, was higher, although the difference was small. These correlation

factors were greater than 15 - 20% above the next highest peak solution and the

R-factors were around 40%. indicating a correct solution. The translationlrotation

solution found without the coordinates of the sub-domain was applied to the

search model to generate the first model of apo-human IMPDH II. Molecular

replacement calculations using the coordinates from the B. bergdorfen, and T.

foetus IMPDH structures (generously provided by Dr. G. Petsko and Dr. F.

Whitby, respectively) were atternpted prior to receiving the hamster IMPDH

coordinates. Although some potential rotation solutions were identified.

translation solutions were not found.

4.3.5. Model building and refinement

A rigid body refinernent followed by a simulated annealing refinement of

the AMORE solution mode1 (Model A) resulted in a low &,si-factor and high

Rh,-factor. The electron density maps that were calculated from a poly-alanine

model of Model A clearly showed areas of electron density extending from the P-

carbon atoms that matched expected amino acids. This was indicative of model

correctness that was supported by decreasing residuals throughout the model

building process. A stage was reached however. when the electron density did

not improve further and the residuals began to diverge following refinement.

Regions of the poly-alanine model that had little or no electron density were

deleted from the model. Residues that were removed included the active site

helix and flap residues as well as residues from the C-terminus. As the

refinement model did not include subdomain and N-terminal residues, some

amino acids were added to the model where electron density clearly indicated

their presence. Following several rounds of refinement, the lowest achievable

values of the RCqst- and Rfree-factors were 23.0% and 28.9%. respectively (Table

6). These values were similar to those of the human ternary-IMPDH II structure

(the Rcqst- and Rr,,-factors were 24.9% and 27.0%, respectively; Colby et al.,

1999). The resolution was too low to include water molecules in the model. The

RMSD values for bond lengths and angles were within acceptable ranges. An

overall B-factor of 37.9 A2 was high for a protein structure that was deterrnined

from data that was collected from a liquid N2 frozen crystal. This suggests a high

amount of structural variability throughout the human apo-IMPDH Il structure or

displacement from their lattice points.

4.5. Human apo-IMPDH II model analysis

4.5.1. Global Fold

The structural studies on IMPDH have determined that this protein is a

cyclically symrnetric C4 tetramer (Figure 15) composed of four identical

monomers. Each rnonorner is a single polypeptide chain that can be divided into

two distinct structural domains, a large domain and a small or flanking domain.

The overall fold of the large dornain is an cJP barrel (Figure 14). This fold is

characterized by an eight-stranded parallel P-barre1 surrounded by eight u-

helices. Presently, approximately 10% of al1 enzymes with known tertiary

structures contain at least one d p barrel domain and are typically found in

metabolic enzymes (Farber & Petsko, 1990; Branden, 1991 ; Farber, 1993). In

particular, clusters of u/P barrel motifs are found in enzymes that are involved in

purine biosynthesis as well as tryptophan, histidine, and thiamine biosynthesis -

enzymes whose substrates are heterocyclic compounds. Many of these

enzymes have in common a phosphate binding motif at the C-terminal region of

the polypeptide (as described in section 4.5.2.) suggesting that these enzymes,

des pite low ove rail sequence identity, have evolved via a divergent pathway from

a common ancestor (Bork et al., 1996).

To date, five IMPDH crystal structures have been solved. Table 8 lists

some details of these crystal structures.

Organism Human type II Chinese hamster tv~e II

Table 8. List of pu blished IMPDH crystal structures. (6-Cl-IMP, analogues 6-chloropurine riboside 5'-monophosphate; SAD, and selenazole-&carboxamide adenine dinucleotide)

-- - -

c or relia bergdofen Tntnchomonas foetus Stre~tococcus Pvoaenes

Figure 28 (A-E) shows the overlays of the monomer backbone structure of

apo-human type II with ternary-human type II, ternary-hamster type II IMPDH,

Streptococcus pyogenes I MPDH, T. foetus IMPDH , and B. bergdorfen I M PDH ,

respectively and Figure 23 shows amino acid sequence alignment of these

proteins. Overall, the u/P barrel core of the molecule is maintained in al1 of these

IMPDH structures. There is some displacement of a-helicies of the u/P barrel

Ligand 6-CI-IMP and SAD XMP and MPA s a Apo. XMP IMP

Reference Colby et al., 1999

PD6 # 1630

McMillan et a1.,2000 Whitby et al., 1997 Zhana et al.. 1999

Sintchak et al.. 1996 1 NIA 1 EEP 1AK5 lZFJ

between the mammalian enzymes and the microbial enyzmes, however the

active site region of the barrel is structurally maintained. The main differences

are the missing amino acids from the active site (discussion to follow), sub-

domain position and completion (discussion to follow), and some loops and

helices around the outer perimeter of the barrel.

The N-terminal region of the human apo- and ternary-IMPDH II are very

similar, however the microbial IMPDH N-termini extend in a different direction.

Crystal packing forces may influence the conformation of this region, as this

peptide is observed at the interface of two tetramers in al1 of these IMPDH

structures.

Figure 28. Superposition of various IMPDH structures. Figures A through E show the overlays of the backbone structure of human apo-IMPDH type II (Hllaj (dark blue) with: A, human ternary-IMPDH type II (Hllt). overall RMSD=0.46 A. B. hamster ternary-IMPDH type II (Chllt). overall RMSDr0.54 A. C. Streptococcus pyogenes IMPDH (Sp). overall RMSD=1.1 A. O. Tfoetus IMPDH (Tf). overall RMSD=1.1 A. E. B. bergdorferi IMPDH (Bb). overall RMSD=0.99 A. The N- and C- terminais are labeled as well as the sub-domain (SD), and the active site helices and flaps. The location of the IMPDH active site is indicated by a yellow dot. Images are colored by RMSD values between U-carbon atom coordinates. The blue color represents RMSD values < 1 .O A and the red color represents RMSD values > 4.0 A (missing amino acids). Intermediate colors represent intermediate RMSD values. The program Swiss-PDB Viewer 3.51 (Guex and Peitsch, 1996) was used to generate the images and to calculate RMSD values.

~ e l i x (Hllt)

(Hlla, Hllt)

SD

Flap (Chll

tielix (Sp) Y

Flap (1

/ Flap (Bb)

Helix (Bb) &

As rnentioned above, the protein is a cyclically symmetric C4 tetramer

composed of four identical monomers, as seen clearly in Figure 15. This

appears in al1 reported IMPDH structures. In fact, al1 structures (except T. foetus

IMPDH), f o n tetragonal crystals whereby the C4 symmetry is about the c-axis.

T. foetus IMPDH crystals were cubic but still had the C4 symmetry about one of

the equivalent crystal axes. The side view of the tetramer (Figure 15) shows that

the tetramer forms a bowl-like structure. The active site region is at the

monomer-monomer interface. Colby et al. 1999 reported that the binding of the

adenosine end of SAD (analagous to NAD) takes place between the a3 helix-p3

strand junction of one monomer and the PC-PD strand junction of the adjacent

monomer. This region showed the lowest B-factor values of the human apo-

IMPDH II structure (Figure 17). The stability of this portion of the protein

suggests that the monomer-monomer interface may be of fundamental

importance in the stability of the entire tetramer and for NAD binding.

The low B-factor values at the monomer-monomer interface as well as the

high B-factor values surrounding the sub-domain attachment site are also

apparent in the human ternary-IMPDH II structure (Colby et al., 1999). Although,

the overall 6-factor values for the ternary complex are lower than those of the

apo form of the enzyme. This may reflect higher overall polypeptide disorder in

the absence of ligands.

Evidence for the existence of a functional tetramer in solution has corne

from equilibrium sedirnentation analysis on the T. foetus and human IMPDHs

(Whitby et al.. 1997 and Carr et al., 1994, resp.). Interestingly, the data from the

former study can be fitted best to a tetramer-octamer association model with a

dissociation constant of 1.4 +/- 0.5 FM. The space group of human apo-IMPDH

II and Streptococcus pyogenes IMPDH is 1422, in which two tetramers form an

octameric assembly (Figure 16). In the human ternary-IMPDH II and T. foetus

IMPDH structures. there is a large 75 A X 100 A 'hole" located in between two

other tetramers along the z-axis. Colby et al.. 1999 had speculated that this is

sufficient to accommodate another tetramer. These data suggest that the

formation of an IMPDH octarner is common among IMPDHs. As well. the large

unoccupied cavities observed in these crystals and the relatively high B-factor

values attest to the amount of structural variation in the IMPDH structure.

The second domain, named the sub-domain, is an approximately 120

amino acid long piece of polypeptide chain inserted between the second u-helix

and the third p-strand of the clip barre1 (Figure 28). The function of the sub-

dornain is not known and the removal of this domain has no effect on the

catalytic activity of the enzyme (Sintchak et al., 1996). As well. the sub-domain is

not found in the amino acid sequence of B. bergdorfen IMPDH. This domain is

structurally completely undefined in the human type II apo-IMPDH (Figure 29).

and the T.foetus IMPDH crystal structure (Whitby et al., 1997). Only half of the

amino acids are structurally defined in the human and hamster IMPDH II ternary

complex structures (Colby et al.. 1999 and Sintchak et al.. 1996). The only

IMPDH structure with a fully defined sub-domain is the one from Streptococcus

pyogenes. The sub-domain polypeptide has been shown to project outward from

the corners of the tetramer-square. However, the global position of the domain is

different in the human and hamster IMPDH II ternary complex- and

Streptococcos pyogenes- structures due to a hinge region at the N- and C-

terminal portions of the subdornain (Glu l 11 and Tyr 233. resp.) (Colby et al..

1999. Sintchak et al.. 1996. and Zhang et al., 1999).

Figure 29. Human IMPOH II electron density rnap in the area of the subdomain. Electron density map (contoured at a = 1 .O) and refined amino acids showing the lack of electron density between Glu 11 1 and Tyr 233. The program Swiss-PD6 Viewer 3.51 (Guex and Peitsch, 1996) was used to generate this image.

Figure 18 shows the amino acid sequence alignment of the human IMPDH

II sequence with other proteins. Most hits came from other IMPDHs however

there were also hits from other proteins. The sequence conservation of this

domain from a wide range of organisms would point to a potentially important

function, although its function with respect to IMPDH is entirely unknown.

Interestingly, the IMPDH sub-domain amino acid sequences show similarity to

the CBS domain (Corpet et al., 1998, Kruger and Cox, 1994). The CBS

designation arises from the original identification of this folding motif in the

enzyme cystathionine beta-synthase (CBS) (Baternan, 1997). It has been

reported that the CBS domain is responsible for the binding of S-

adenosylmethionine, an allosteric regulator of cystathionine b-synthase (Taoka,

S. et al., 1999). Mutations in the CBS protein cause elevated levels of

methionine and homosysteine and lead to the human disease hornocystinuria, a

rare, in herited rnetabolic disease (Abbott et al.. 1987).

There are two CBS motifs found in the subdomain of IMPDH proteins from

al1 three kingdoms of life. These two motifs are related by approximate twofold

symmetry (u-carbon RMSD = 2.7 A, Zhang et al.. 1999). Each CBS motif has a

characteristic sheet/helix/sheet/sheet/helix topology. Other proteins containing 2

CBS domains are bacterial ABC transporters (2 proteins), hurnan voltage-gated

chloride channel proteins (6 proteins), and a variety of hypothetical proteins from

the archaebacteria Methanococcus jannaschii (1 5 proteins) (Bateman. 1 997).

The IMPDH structure from Streptococcus pyogenes is the first reported complete

structure of a CBS dimer domain. This structure in cornparison to the other

IMPDH sub-dornain structures shows a different global position relative to the u/p

barrel. These positions may be due to crystal packing forces. although its overall

movement May have an effect on enzymatic activity as this domain is situated

next to the active site. Perhaps the sub-domain binds allosteric affector

molecules andlor other proteins that are involved in the regulation of IMPDH

activity. In fact, a recent publication identified a protein the interacts directly with

IMPDH. A protein kinase called PKBlAkt was found to interact with human

IMPDH II via its pleckstrin homology (PH) domain (Ingley. E. and Hemmings.

B.A.. 2000). This domain is found in a variety of molecules involved in cellular

regulation including the GTPase regulators ras-GTP and SOS (Haslam, et al..

1993, lngley and Hemmings, 1994). This association was found to enhance

lMPDH activity and that most of the IMPDH structure was required for

association to be seen. The authors suggest that the PH domain associates with

the sub-domain and the entire IMPDH molecule is required for proper folding of

the sub-domain. In the same way. other molecules may interact with the sub-

domain to affect IMPDH function. As this domain appears to be a separate and

independent molecule attached to IMPDH, this sub-domain peptide could be

expressed separately and its structure and function be studied to try to determine

the role that it plays in IMPDH biology.

4.5.3. Active Site

The IMPDH active site, located at the C-terminal end of the polypeptide.

has been shown to contain both structurally conserved and highly variable parts.

The variability was found with the active site helix a-D (between Met 326 and Ala

337) (Figure 24) and the active site Rap, including p-strands J. K. L. M. and N, as

well as helix u-E (between Pro 397 and Lys 450) (Figure 25). The helix. that

contains Cys 331, was found to be disordered in apo-IMPDH II (Figure 18) but

not in the human- and hamster- ternary-IMPDH II. Colby et al. (1999) reported

that the human ternary-IMPDH II active site helix conformation was different from

the hamster ternary-IMPDH II helix, despite nearly identical amino acid

sequences. IMP waç covalently bound to Cys 331 in both cases and the former

had a more extended helix (Figure 28). The same helix in the Streptococcus

pyogenes IMPDH structure also had more helical character than the human

ternary-IMPDH II structure (Zhang et al., 1999) but here, only IMP was bound

(i.e., no other ligands) and non-covalently. The helix is also visible in the B.

bergorferi IMPDH structure where a S04 molecuie occupies the phosphate

binding site (McMillan, F.M.. et al.. 2000). Here, the helix is identified as "loop 6".

The authors suggest that this helix acts like a "hinged lid", trapping the substrate

with a concerted motion, similar to other alb barre1 enzymes previously reported

by Joseph et al., 1990. The apo-IMPDH structure reported here would indicate

that this was not the case for the human IMPDH, however, the discontinuous

electron density observed in this region rnay attest for some structural stability of

this helix in the absence of ligands. Perhaps the "hinged lid" is too flexible in

human IMPDH for stable electron density to be viewed. All of these data

combined indicated that IMP binding is essential for the stable formation of the

active site helix in human IMPDH II.

Amino acid sequence alignments for this region (Figure 24) show that

there are highly conserved glycine residues located at both ends of the helix.

The lack of electron density around the U-carbon atom of Gly 340 (Figure 18)

implies flexibility. As well, 3 highly conserved glycine residues are located at the

N-terminal end of the helix in the region were the electron density is absent. This

suggested that these residues play the role of "weak spotsn whereby flexibility is

required for IMP binding.

The same type of motif was observed for the active site fiap that forms a

two-stranded p-sheet over the active site. The electron density was absent in

this region in the human apo-IMPDH II structure (Figure 19), but present in

ternary corn plexes of hamster-, Streptococcus pyogenes-, and T. foetus -

IMPDHs (Figure 28). However, most of the fiap is undefined in the human

ternary-IMPDH II structure despite the presence of SAD. Colby et al. (1999)

reported that side chain density was observed here, but unambiguous residue

assignment could not be made at the resolution obtained. Some residues of the

flap that made contacts with the adenosine portion of the dinucleotide were

assigned. It appears that in the absence of dinucleotide ligands, the flap is

disordered.

Sequence alignments of the flap (Figure 25) show areas with high amino

acid sequence conservation as well as peptide insertions (between residues 420

and 440). Again, two highly conserved glycine residues (Gly 398 and Gly 451)

are located at the N- and C-terminal parts of the flap suggesting these residues

are a "weak spot" that provides flexibility important for ligand binding. The

structure of the flap region in this case does not appear to be rigid like loop 6 of

8. bergdorfen IMPDH.

Figure 20 shows the overlay of five conserved residues that make

important substrate-inhibitor contacts and are part of the u/P barre1 domain. For

the most part, these residues are rigid when compared to the helix and flap

regions. The fold of the u@ barrel in the active site showed very little structural

variation (Figure 28) between the apo- and complexed-forms of IMPDH, as well

as the IMPDHs among different species. There is also no evidence of any global

conformational change on ligand binding in the monomers or the tetramer. In a

way, the cc/P barrel provides a solid base for ligand association and the helix and

fiap act like a flexible cover to further intensify the interaction for catalysis to

proceed.

The C-terminal end (Ser 495 to Phe 514) was absent in the hurnan apo-

IMPDH II structure (Figure 21). In contrast, the residues of the C-terminal tail in

the hamster ternary-IMPDH II have been assigned (Figure 28). It appears to

point away from the monomer structure into solvent. However, when the tetramer

was generated, the C-terminal tail provided a third P-strand to add to the fiap P-

sheet of an adjacent monomer. It is assumed that this interaction stabilizes the

association between the ligand and the flap. This tail is not observed in the

human ternary-IMPDH II structure (Figure 28) but is seen in the Streptococcus

pyogenes IMPDH structure with the same conformation as adopted by the tail

from the hamster IMPDH II structure. This suggests that this conformation is

necessary for ligand binding. Once again, the non-liganded, apo-form of the

protein is disordered and the conformation is ordered upon substrate binding.

As mentioned above, there is a sheet/helix/sheet motif at the C-terminal

end that is common to many dB barrel proteins. In human IMPDH II, this motif

includes P-strands 7 and 8 and inserted between the P-strands is a-helix 7. It is

responsible for binding of the phosphate of the IMP molecule. Figure 26 shows

the results of the amino acid sequence alignment of human IMPDH II phosphate-

binding motif with other proteins. There are many conserved residues among

IMPDHs as well as other proteins that bind ligands with phosphate groups.

Figure 30 shows a structural overlay of the a-carbon backbone atoms of this

motif from IMPDH- and non-IMPDH proteins and associated RMSD values. The

conserved residues, as seen in Figure 26, are highlighted. Also shown is IMP

with its phosphate interacting with this region.

/ 1 T. foetus IMPDH 1 0.76 11 1,

Human ternary-IMPDH II

Hamster ternary-IMPDH 11

S. pyogenes lMPDH

[I Yeast cytochmrne b2 1 1.12 11

0a3'

Spinach qlycolate oxidase

Figure 30. Superposition of the phosphate-binding region. Black, human apo-IMPDH II; blue, human ternary-IMPDH II; green, hamster temary4MPDH II; yellow, T.foetus IMPDH; red, S. pyogenes IMPDH; purple, spinach glycolate oxidase; orange, yeast cytochrome b2. Also shown is the IMP moiety from the human temary-IMPDH Il structure (cyan). Highlighted are the conserved amino acid residues. lnset is a table with the RMSD values for Ca-atoms of other proteins with this motif calculated against the human apo-IMPDH II structure. The program Swiss-PDB Viewer 3.51 (Guex and Peitsch, 1996) was used to generate the image and to calculate RMSD values.

1 . 0.48

0.78

1

1

1

Bork et al.. (1996) have defined a consensus sequence for this motif

(Figure 26) and argued that this common structure, despite low overall sequence

identity, reflects the fact that u i P barrel proteins that bind phosphate groups have

evolved from a common ancestor. The conserved hydrophobic amino acids are

situated on the inner-part of U-helix 7 and associate with other hydrophobic

amino acids that are on the inner-parts of the 2 P-strands. Highly conserved Asp

364 makes contacts with the hydroxyl groups of the IMP ribose while backbone

amides and carbonyls make contacts with the phosphate moiety (Colby et al..

1999). It is evident that there are no major structural changes in this motif

following ligand binding, consistent with the view that cr/P barrel residues that are

part of the active site are fairly rigid.

It is clear that, upon substrate binding. there are conformational changes

caused by the ordering to the IMPDH structure. As no major changes were

observed between apo- and ternary-IMPDH II of the uiP barrel core. the majority

of these changes can be attributed to the active site helix and flap, as well as the

C-terminal tail. The sub-domain may also be involved due to its shifting position

among different IMPDHs. There is, however, no clear proof that the latter is the

case.

There is considerable functional evidence for conformational changes in

IMPDH upon ligand binding as well. Nimmesgern et al., (1996) have reported

both conformational changes and stabilization associated with ligand binding to

hamster IMPDH II. They used a variety of techniques including in vitro

proteolytic susceptibility, hydrophobic fluorescent dye binding, far-UV circular

dichromism spectra and urea-induced denaturation. Their evidence indicated

that there was no NAD binding independent of IMP and XMP binding and that

IMP and XMP stabilized a closed conformation that has a higher affinity for NAD.

This is consistent with product inhibition studies of IMPDH enzymes from a

variety of sources showing that IMP is first to bind and XMP is the last to be

released (Holmes. et a1.J 974; Carr, et al., 1993; Verharn, et al., 1987; Anderson

and Sartorelli, 1968; Xiang, et al., 1996). Although. enzyme kinetic studies using

NAD analogues, isotope effects, hydride exchange, and pre-steady state kinetics

indicated that substrate association is random (Wang and Hedstrom, 1997).

Evidence from Nimmesgern et al., (1996) also suggested that the protein

remained closed throughout the catalytic process and reverted to the open form

with XMP release. In the absence of ligands. the protein adopts the open

conformation that is less stable then the closed form. It was also found that MPA

had little affinity for the open form of IMPDH II and that binding of MPA followed

IMP or XMP binding. stabilizing the protein even more. They concluded that

localized conformational changes occurred during the reaction of IMPDH and

upon MPA binding. This view is consistent with the study presented here.

Another important study of the events that take place when ligands bind to

IMPDH utilized high-precision titration microcalorimetry (Bruuese and Connelly,

1997). The authors monitored stepwise changes in the enthalpy, entropy. free

energy, and the heat capacity of IMP binding to the hamster IMPDH II tetramer.

This study has revealed allosteric properties of IMPDH II upon IMP and MPA

binding and it presents a therrnodynamic argument that identifies a temperature

dependent change in the heat capacity of binding as a marker of a

conformational equilibrium of distinct structural forms of apo-IMPDH.

The discovery of evidence that indicated allosteric be havior of IMPDH is

new. Bruzzese and Connelly (1 997) introduce data (intrinsic binding constants

and associated enthalpies) that show the first three IMP molecules bind with

equal affinity, but the fourth molecule had significantly weaker binding. With

respect to IMP, this is an example of negative homotropic cooperativity in

IMPDH. The data, however, are inconsistent with the standard models for

allosteric proteins. The two standard models to describe this behavior are the

Monod-Wyman-Changeux (MWC) pre-existing confornational equilibrium model

(Monod et al., 1965) and the Koshland-Nemethy-Fermi (KNF) induced fit model

(Koshland et al., 1966). The MWC model is based on the equilibria between two

macromolecular forms R and T. whereby each form binds a ligand non-

cooperatively but with different affÏnity. The model explicitly states that the two

forms of the protein exist prior to the binding of the ligand. The distinguishing

feature of this model is the temperaturedependence of the heat capacity upon

ligand binding. The temperature-dependence of the heat capacity upon IMP

binding indicated that there appears to be a pre-existing conformational

equilibrium prior to binding. However

homotropic cooperativity, which does

cooperativity seen with IMP binding to

this model can only account for positive

not account for the negative homotropic

MPDH.

The KNF induced fit model (Koshland et al., 1966) states that each

subunit of a multisubunit protein exists in two structural forms based on its

ligation states. Depending on the degree of occupancy of the protein. the

interactions among the binding sites are a consequence of interactions arnong

the subunits that change. The data presented by Bruzzese and Connelly.

however, have ruled out the KNF model. They found that the binding curve

around the median ligand was asymmetric, which is inconsistent with the KNF

mode1 (Wyman and Gill. 1989). As well. the large temperature-dependence of

the heat capacity upon IMP binding indicated that the KNF model is insufficient.

As a consequence, Bruuese and Connelly suggest a nested allosteric

model (Robert et al., 1987 and Connelly et al., 1989 a. b). This is a combination

of the MCW and KNF models. That is, for IMPDH, there are two overall

quarternary conformations (R and T). each form behaving according to the KNF-

like tetramers nested with the two overall conformations of R and T. When IMP

binds to IMPDH, there would be localized negative subunit to subunit interactions

as well as a concerted conformational change involving the whole tetramer.

But how does the structural data reflect what has been found by the

functional data? The lack of order observed for the apo-IMPDH II in the active

site region (active site helix and flap, and the C-terminal tail) suggested that more

than one structural form of the free enzyme existed. The temperature-

dependence of the heat capacity upon IMP binding shows that there are at least

two structural forms of apo-IMPDH, which is consistent with what has been found

by the study herein. The susceptibility of the apo-fom to protoelytic enzymes as

described by Nimmesgern et al (1996) is also consistent with apo-IMPDH having

disordered regions. The ordering of stretches of polypeptide chah upon ligand

binding would decrease the ability of the proteases to act on them. Comparing

the apo-form to the liganded-form, however, has not showed structural evidence

for allosteric behavior as described above. The structural overlays did not show

significant changes in the u/p barre1 fold between the two structures. Although

the resolution obtained for the ternary- and apo-enzyme is insufiicient to account

for any subtle structural changes that may be able to explain these results. As

the active site of IMPDH, however, is close to the monomer-monomer interface,

localized structural changes in one monorner may effect the ligand binding on the

adjacent monomer. Given the tetrameric space group containing only one

monomer in the asymmetric unit, global structural changes of the tetramer cannot

be observed. Therefore, in order to test the global allosteric behavior of IMPDH

by structural studies. the protein structures would have to be solved at a lower

level of symmetry where the whole tetramer was part of the asymrnetric unit and

therefore unrestrained by crystallographic symmetry. Nevertheless, it is clear

that significant conformational changes occur when IMPDH associates with

ligands. at least on a localized scale. Amino acid sequence conservation in

regions with a high amount of flexibility argues for these structural changes being

an integral part of IMPDH activity. not only in the human enzyme. but in general.

4.6 Future work on hurnan IMPDH II

IMPDH has been part of the scientific literature for over 25 years. however. it

has only been recently that its fundamental role as a cell growth modulator has

been fully appreciated. It appears now that IMPDH is the key downstream

modulator of p53-dependant growth regulation (Liu et al.. 1998). acting by

controlling the intracellular levels of guanylates. This makes lM PDH a

particularily attractive target for cancer chernotherapy. As p53 mutation is the

single most common observation in oncogenesis (DeVita et al, 1997; Soussi et

al., 2000; and Calin et al.. 1999). inhibition of IMPDH should effectively stop cell

growth in the absence of p53 function. lnhibiting an enzyme that is highly

expressed in response to cell proliferation would also serve to increase the

therapeutic effectiveness, that is, only targeting the protein responsible for cell

growth.

The most interesting finding recently has been the association of IMPDH with

the pleckstrin homology domain of PKBIAM, a protein kinase involved in signal

transduction (Ingley and Hemmings, 2000). They found that IMPDH is

phosphorylated by PKBlAkt in vitro which leads to the suggestion that PKBlAkt

regulates IMPDH in vivo via phosphorylation. Or. in more general terms, purine

rnetabofism rnay be regulated in part or in whole by phosphorylation. As the

progression of cell from the G1 phase to the S phase is promoted by PKBIAkt

pathway activation (Muise-Helmericks et al., 1998), PKBlAkt rnay activate

IMPDH which in turn prepare the cell to transition to the S phase by increase

GTP pools that are a requirement for signal transduction G-proteins.

The association between this signal transduction protein and IMPDH and its

effect of enhanced enzymatic activity suggests that the flexible nature of IMPOH

rnay be a conserved feature. That is, association with other proteins rnay confer

structural stability to the enzyme, thereby decreasing molecular disorder and

enhancing activity. Possible even providing stability to the highly flexible regions

of the active site helix and fiap. As this enzyme, and its flexible characteristics. is

highly conserved throughout nature, Rexibility appears to be a necessary feature.

Future investigation into the associations between IMPDH and other cellular

molecules rnay show a more pronounced role for IMPDH fiexibility. For example.

a crystal structure of IMPDH complexed with a PH domain containing protein

such as PKBlAkt rnay show enhanced structural stability relative to the free form.

Another consequence of this study is information that can be used for the

design of new inhibitors. The multiple, local conformational changes observed

upon substrate binding rnay be problematic when trying to design ligands that are

substrate mimics. As the u/p barrel core appears to remain conformationally

stable, this study would suggest that ligands should be designed to bind to

regions of the active site that are part of the barrel or other parts of the barrel that

my impead substrate association. As well, finding stable barrel regions that show

sequence heterogeneity with respect to the type 1 isoform may help in the design

of isozyme selective inhibitors.

4.7 Summary

A method was developed to clone human IMPDH II cDNA by PCR from a

cDNA ;.-phage library generated from a cell line that expressed high amounts of

RNA. Following recombination with a cloning plasmid, a simple partial restriction

enzyme digest was done to sub-clone the human IMPDH II coding region into a

bacterial expression plasmid with high efficiency. Milligram quantities of protein

were expressed and purified by a two-step, affinity chromatography protocol with

a high degree of reproducibility. This provided enough protein for the screening

and determination of the conditions to reproducibly grow large, single human

IMPDH II crystals suitable for x-ray diffraction analysis. Synchotron X-ray

radiation was used to obtain a diffraction data set with a maximum usable

resolution of 3.15 A. A hamster IMPDH II atomic model was used as a molecular

replacement search model and a solution was found and applied to obtain an

initial model of human apo-IMPDH II. Multiple cycles of model building and

refinement were employed to solve the human apo-IMPDH II structure.

Analysis of the human apo-IMPDH II model revealed many unique

structural properties. The main core of the enzyme follows an dB barrel fold with

highly flexible regions surrounding the active site. These regions are called the

active site helix and the active site flap. They become ordered in the presence of

ligands such as IMP, XMP, and MPA, while the u/P barrel core rernains rigid

throughout. Functional evidence describing multiple conformational forms of

apo-IMPDH II is consistent with the structural data, although evidence for

allosteric behavior is not. The high degree of amino acid sequence conservation

among species from al1 three kingdoms of life indicated that the flexible character

of the enzyme is a necessary element of IMPDH function. This flexible character

may extend to the sub-domain, as its presence and sequence conservation.

signifies an important role in IMPDH biology, although its exact function is

unknown. The phosphate-binding domain was found to be highly conserved

between IMPDHs and several other proteins that also bind phosphate-containing

molecules. The IMPDH II monomers were found to be related by C4 rotational

symmetry to generate the functional tetramer, and in the crystal, the tetramers

formed on octameric complex.

5. References

Abbott, M. H.; Fo!stein, S. E.; Abbey, H.; Pyeritz, R. E. (1987). Psychiatric manifestations of homocystinuria due to cystathionine beta-synthase deficiency: prevalence, natural history, and relationship to neurologie impairment and vitamin B(6)-responsiveness. Am. J. Med. Genet. 26, 959-969.

Adams. P.D., Pannu, N.S.. Read, R.J.. Brunger, A.J. (1997). Cross-validated maximum likelihood enhances crystallographic refinement. Proc. Natl. Acad. Sci USA 94, 501 8-5023.

Allison. A C . Hovi. T.. Watts, R.W.E.. Webster, A.D.B. (1975). lmmunological observations on patients with the Lesch-Nyhan syndrome, and on the role of de novo purine synthesis in lymphocyte transformation. Lancet 2, 1 179-1 183.

Allison, A.C , Hovi. T.. Watts, R.W.E., Webster, A.D.B. (1 977). The role of de novo purine synthesis in lymphocyte transformation. Ciba Found. Symp. Purine Pyrimidine Metab. 48. 207-223.

Allison, A.C. and Eugai. E.M. (1 993). Immunosuppressive and other effects of mycophenolic acid and an ester prodrug. mycophenolate mofetil. Immunol. Rev. 136, 5-28.

Allison, AC.. Kowalski. W.J.. Muller, C.D.. Eugai. €.M. (1 993). Mechanisms of action of rnycophenolic acid. Ann. N Y Acad. Sci 696, 63-87.

Altschul, S.F.. Madden T.L., Schaffer A.A., Zhang J.. Zhang Z., Miller W., and Liprnan D.J. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database searchprograrns. Nucleic Acids Res. 25. 3389-3402.

Anderson, A.C., and Sartorelli. A. (1968). lnosinic acid dehydrogenase of sarcoma 180 cells. J. Biol. Chem. 243, 4762-4768.

Bateman, A. (1997) The structure of a domain common to archaebacteria and the homocystinuria disease protein. Trends Biochem. Sci. 22, 1 2-1 3.

Bishop, J.M. (1987). The molecular genetics of cancer. Science 235. 305.

Bork. P.. Gellerich, J., Groth, H., Hooft, R., and Martin, F. (1995) Divergent evolution of a Plcl - barre1 subclass: Detection of numerous phosphate-binding sites by motif search. Protein Science 4, 268-274.

Brunger, A.J., Kuriyan. J., Karplus, M. (1 987). Crystallographic refinement by rnolecular dynamics. Science 235. 458-460.

Brunger. A. J., Krukowski, A., Erickson. J. (1 990). Slow-cooling protocols for crystallographic refinement by simulated annealing . Acta. Cvst. A46, 585-593.

Brunger. A.J. (1 992). The free R value: a novel statistic quantity for assessing the accuracy of crystal structures. Nature 355, 472-474.

Brunger, A.J., Adams, P.D., Rice, LM. (1997). New applications of simulated annealing in X-ray crystallography and solution NMR. Structure 5, 325-336.

Bruuese, F.J., & Connelly. P.R. (1997) Allosteric properties of inosine monophosphate dehydrogenase revealed through the thermodynamics of binding of inosine 5'-monophosphate and mycophenolic acid. Temperature dependent heat capacity of binding as a signature of ligand-couplcd conformational equilibria. Biochemistry 36, 10428-1 0438.

Burling. F.T. and Goldstein. B.M. (1 989). Prog. Abstr: Am. Crystallogr. Assoc. 17, 49.

Calin G.. Ivan, M.. Stefanescu D. (1999) The difference between p53 mutation frequency in haematological and non- haematological malignancies: possible explanations. Med. Hypotheses 53, 326-328.

Cantor, C.. and Schirnmel. P.R. (1980). "The conformation of biological macromolecules." Freeman, San Fransisco, CA.

Carney. D.N.. Ahluwalia. G.S., Jayaram, H.N., Cooney, D.A.. Johns, D.G. (1985). Relationships between the cytotoxicity of tiazofurin and its metabolism by cultured hurnan lung cancer cells. J. Clin. Invest. 75. 175-182.

Carr, S.F., Papp, E., Wu, J.C., Natsumeda, Y. (1993). Characterization of human type l and type II IMP dehydrogenase. J. Biol. Chem. 268.27286-27290.

Chant. J. and Stowers, L. (1995). GTPase cascades choreographing cellular behavior: movement, morphogenesis, and more. Ce11 81. 1-4.

Cleland. W.W. (1979) Statistical analysis of enzyme kinetic data. Methods Enzymol. Vol. 63, 103-1 37.

Cohen, M.B., and Sadee, W. (1983). Contributions of the depletions of guanine and adenine nucleotides to the toxicity of purine starvation in the mouse T lymphorna cell line. Cancer Res. 43, 1587-1 591.

Cohen, M.B.. Maybaum, J., Sadee, W. (1983). Guanine nucleotide depletion and toxicity in mouse T lymphoma (s-49) cells. J. Biol. Chem. 256, 871 3-8717.

Colby, T.D., Vanderveen, K., Strickler, M.D., Markham, G.D., and Goldstein, B.M. (1999) Crystal structure of human type II inosine monophosphate dehydrogenase: Implications for ligand and drug design. Proc. Natl. Acad. Sci. USA 96, 3531 -3536.

Collart, F.R., Chubb, C.B., Mirkin, B.L., Huberman, E. (1 996). lncresed inosine- 5'-monophosphate dehydrogenase gene expression in solid tumor tissue and tumor ceIl Iines. Cancer Res. 52, 5826-5828.

Collart, F.R., Osipiuk, J., Trent, J., Olsen, G.J., Huberman, E. (1996). Cloning, characterization and sequence comparison of the gene coding for IMP dehydrogenase from Pyrococcus furiousus. Gene 174, 209-21 6.

Collins. S. J., Gallo, R.C., Gallagher, R.E. (1 977) Continuous growth and differentiation of human myeloid leukaemic cells in suspension culture. Nature, 270(5635), 347-349.

Connelly, P.R., Johnson, C.R., Robert, CH., Bak, H.J., and Gill. S.J. (1989a) Binding of oxygen and carbon monoxide to the hemocyanin from the spiny lobster. J. Mol. Biol., 207(4), 829-832.

Connelly, P.R., Gill, S.J., Mi1le.r KI., Zhou, G., and van Holde, K.E. (1 989b) ldentical linkage and cooperativity of oxygen and carbon monoxide binding to Octopus dofleini hemocyanin. Biochemistry, 28(4), 1835-1 843.

Corpet, F.. Gouzy, J. and Kahn. D. (1998) The ProDom database of protein domain families. Nucleic Acid Res. 26, 323-326.

Dayton, J.S., Turka, L.A., Thompson, C.B., Mitchell. B.S. (1 992). Cornparison of the effects of mizoribine with those of azathioprine, 6-mercaptopurine, and mycophenolic acid on T lymphocyte proliferation and purine ribonucleotide pools. Mol. Phannacol. 41, 671-676.

Dayton, J.S., Lindsten, T., Thompson, C.B., Mitchell, B.S. (1994). Effects of human lymphocyte activation on inosine monophosphate dehydrogenase expression. J. Immunol. 152, 984-991.

Devita, V.T. Jr., Hellman. S., Rosenberg, S.A. (1997) Cancer: Principles & Practice of Oncology, 5'h ~ d .

Dixon, G.J., Dulmadge, E.A., Brockman, R.W., Shaddix. S.C (1 970). Feedback inhibition of purine biosynthesis in adenocarcinorna 755 and sarcoma 180 cells in culture. J.Natl. Cancer Inst. 45, 681 -685.

Doggett, N.A., Callen, D.F., Chen, Z.L., Moore, S., Tesmer, J.G., Duesing, L.A., and Stallings, R.L. (1993). Identification and regional localization of a human IMP dehydrogenase-like locus (IMPDHL 1) at 16p 13.13. Genomics 18, 687-689.

Dowehower, L.A., and Bradley, A. (1993). The tumor suppressor p53. Biochim. Biophys. Acta 1155, 181-205.

Earle, M. and Glazer, R. (1983). Activity and metabolism of 2-P-D- ribofuranosylthiazole-4-carboxamide in human lymphoid tumor cells in culture. Cancer Res. 43, 1 33-1 37.

Eugui, E.M., Almquist, S., Muller, C.D., Ailison, A.C. (1991). Lymphocyte- selective cytostatic and immunosuppressive effects of mycophenolic acid in vitro: role of deoxyguanosine nucleotide depletion. Scand. lmmunol. 33. 161 -1 73.

Fleming, M.A., Chambers. S.P., Connelly, P.R., Nimmesgern. E., Fox, T., Bruuese, F.J., Hoe, S.T., Fulghum, J.R., Livingston, D.J., Stuver. C.M.. Sintchak, M.D.. Wilson, K.P., Thomson, JA. (1996). Inhibition of IMPDH by mycophenolic acid: dissection of fonvard and reverse pathways using capillary electrophoresis. Biochemistry 35, 6990-6997.

Glesne, D.A.. Collart, F.R., Huberman, E. (1991). Regulation of IMP dehydrogenase gene expression by its end products, guanine nucleotides. Mol. and Cell Bio. 11, 541 7-5425.

Glesne. D.A., Collart, F.R., Varkony, T., Drabkin, H., Huberman, E. (1993) Chromosomal location and structure of the human type II dehydrgenase gene (IMPDH2). Genomics 16, 274-277.

Goldstein, B.M., Takusagawa, F., Berman, H.M., Srivastava,P.C., Robins, R.K. (1983). J. Am. Chem. Soc. 105, 7416-7422.

Goldstein. B.M.. Mao, D.T., Marquez, V.E. (1988). Ara-tiazofurin: conservation of structural feôtures in an unusual thiazole nucleoside. J. Med. Chem. 31. 1026-1 031.

Goldstein, B.M., Bell, J.E., Marquez, V.E. (1990). Dehydrogenase binding by tiazofurin anabolites. J. Med. Chem. 33, 1 123-1 127.

Gosio, B. (1 896). Riv. lgiene Sanita Pubbl. Ann. 7, 825.

Gottlieb, T.M., and Oren, M. (1996) p53 in growth control and neoplasia. Biochim. Biophys. Acta 1287, 77-1 02.

Gu. J.J.. Kaiser-Rogers, K., Rao, K., Mitchell. B.S. (1994). Assignment of the hurnan type I IMP dehydrogenase gene (IMPDH1) to chromosome 7q31.3-q32). Genomics 24. 1 79-1 8 1 .

Gu, J.J., Spychala, J., Mitchell, B.S. (1 997). Regulation of the human inosine 5'- monophosphate dehyrogenase type I gene. J. Biol. Chem. 272,4458-4466.

Guex, N and Peitsch, M.C. (1996) Swiss-PdbViewer: A Fast and Easy-to-use PDB Viewer for Macintosh and PC. Protein Data Bank Quaterly Newsletter 77, 7.

Hagar, P.W., Collart, ER., Huberman, E.. Mitchell, B.S. (1995). Recombinant hurnan inosine monophosphate dehydrogenase type I and type II proteins: purification and characterization of inhibitor binding. Biochem. Pharmacol. 49, 1323-1 329.

Haslam, R.J.. Koide. H.B. and Hemmings. B.A. (1993). Pleckstrin homology domains. Nafure 363, 309-310.

Hedstrom, L., and Wang, W. (1997). Kinetic mechanism of human inosine 5'- monophosphate dehyrogenase type II: random addition of substrates and ordered release of products. Biochemistry 36, 8479-8483.

Henderson. J.F. and Mercer, N.J (1966). Feedback inhibition of purine biosynthesis de novo in rnouse tissues in vivo. Nature 212. 507-508.

Hershfield, M.S. and Seegmiller, J.E (1976). Regulation of de novo purine biosynthesis in human lymphoblasts. Coordinate control of proximal (rate- determining) steps and the inosinic acid branch point. J. Biol. Chem. 251, 7348- 7354.

Hoffee, P.A.. and Jones, M.E., (eds.), 1978. Purine and pyrimidine nucleotide metabolism. Volume 51. Methods of Enzymology. Acedemic Press.

Hollstein, M.. sidransky, D., Vogelstein, B., Harris, C.C. (1991). p53 mutations in human cancers. Science 253.49-53.

Holmes, E., Pehlke, D., Kelley, W. (1974). IMP dehydrogenase: kinetics and reg ulatory properties. Biochim. Biophys. Acta 364, 209-2 1 7.

Huete-Perez, J.A., wu, J.C., Whitby, F.G.. Wang, C.C. (1995). Identification of the IMP binding site in the IMP dehydrogenase from Tritrichmonas foetus. Biochemistry 34, 13889-1 3894.

Hunter, T. (1995). Protein Kinases and phosphotases: the yin and yang of protein phosphorylation and signaling. Cell80, 225-236.

Hurley, J.B.. Simon, M.I., Teplow, D.B.. Robinshaw, J.D., Gilrnan, A.G. (1984). Homologies between signal transducing G-proteins and ras gene products. Science 226, 860.

Ingley, E. and Hemmings, B.A. (2000). PKAIAkt interacts with inosine 5'- monophosphate dehydrogenase through its pleckstrin homology domain. FEBS Letters 478, 253-259.

Ingley, E. and Hemmings, B.A. (1994). Pleckstrin homology (PH) domains in signal transduction. J. Cell. Biochem. 56, 436-443.

Jackson, R.C., Morris, H.P., Weber, G. (1 977). Partial purification, properties, and regulation of inosine 5'-monophosphate dehyrogenase in normal and malignant rat tissues. Biochem. J. 166, 1-10.

Jackson, R.C., and Weber. G. (1975). IMP dehydrogenase: an enzyme linked with proliferation and maglignancy. Nature 256, 331-333.

Jacobson. S.J.. Page, T., Diala, E.S., Nyhan, W.L., Robins, R.K., Mangum, J.H. (1987). Synergistic activity of purine metabolism inhibitors in cultured human tumor cells. Cancer Lett. 35, 97-1 04.

Jones, T.A., Zou, J.Y., Cowan, S.W. and Kjeldgaard, M. (1991) lmproved methods for the building of protein models in electron-density maps and the location of errors in these models. Acta Ciyst. A47, 11 0-1 19.

Kiguchi, K., Collart, F.R., Henning-Chubb, C., Huberman, E. (1990). Cell differentiation and altered IMP dehydrogenase expression induced in human T- lymphoblastoid leukemia cells by mycophenolic acid and tiazofurin. Exp Ce11 Res. 187, 47-53.

Kiguchi, K.. Collart, F.R., Henning-Chubb, C., Huberman, E. (1990). Induction of cell differentiation in melanoma cells by inhibitors of IMP dehydrogenase: altered patterns of IMP dehydrogenase expression and activity. Cell Growth and Differ. 1, 259-270.

Kleywegt, G.J.. Brunger. A.J. (1 996). Checking your imagination: applications of the free R value. Structure 4, 897-904.

Kleywegt, G.J. and Jones, T.A. (1 994). Halloween ... Masks and Bones. ln From the First Map to Final Model. (Bailey, S.. Hubbard, R. and Waller, D., eds.), SERC Daresbury Laboratory, Warrington, U.K., 59-66.

Knight, R.D., Mangum, J., Lucas, D.L.. Cooney, D.A., Khan, E.C., Wright, D.G. (1 987). Inosine monophosphate dehydrogenase and myeloid cell maturation. BIood 69, 634.

Kristensen, T., Voss, H., Schwager, C., Stegemann, J., Sproat, B., Ansorge, W (1988). T7 DNA polymerase in automated dideoxy sequencing. Nucleic Acids Res. 16, 3487-3496.

Konno, Y., Natsumeda, Y.. Nagai, M., Yarnaji, Y., Ohno, S., Suzuki, K., Weber, G. (1991). Expression of human IMP dehydrogenase type I and II in Escheria coli and distribution in human normal lymphocytes and leukemic cell lines. J. Biol. Chem. 266, 506-509.

Koshland, D.E. Jr, Nemethy, G., and Filmer, D. (1966). Comparison of experimental binding data and theoretical rnodels in proteins containing subunits. Biochernistry. 5(1), 365-385.

Kruger, W.D. and Cox, D.R. (1994) A yeast system for expression of human cystathionine beta-synthase: structural and functional conservation of the human and yeast genes. Proc. Natl. Acad. Sci USA 91, 661 4-661 8.

Lee, H.-J., Pawlak, K., Nguyen. B.T., Robins, R.K., Sadee, W. (1985). Biochemical differences among four inosinate deydrogenase inhibitors, mycophenolic acid, ribavirin, tiazofurin, and selenazpfurin. studied in mouse lymphoma cell culture. Cancer Res. 45. 551 2-5520.

Lehninger, A. L. (1 975). Biochemistw, 2nd ed., New York: Worth Publishers.

Levine, A.J. and Momand, J. (1990). Tumor suppresspr genes: the p53 and retinoblastorna sensitivity genes and gene products. Biochim. Biophys. Acta 1032, 1 19-1 36.

Li, H., Hallows. W.H., Punzi, J.S.. Marquez. V.E., Carrell, H L , Pankiewicz, K.W., Watanabe, K.A.,Goldstein, B.M. (1994). Crystallographic studies of two alcohol dehydrogenase-bound analogues of thiazole-4carboxamide adenine dinucleotide (TAO), the active anabolite of the antitumor agent tiazofurin. Biochernistry 33, 23-32.

Lucas, D.L., Webster, H.K., Wright. D.G. (1983). Purine metabolism in rnyeloid precursor cells during maturation. J. Clin. Invest. 72, 1889.

Link, J.O., and Straub, K. (1 996). Trapping of an IMP dehydrogenase-substrate covalent intermediate by mycophenolic acid. J. Am. Chem. Soc. 118. 2091- 2092.

Liu, Y ., Bohn, S.A., Sherley, J.L. (1 998) lnosine 5'-monophosphate dehydrogenase is a rate-detenining factor of p53-dependent growth regulation. Mol. Biol. Cell 9, 1 5-28.

Lui, Y.. Faderan, M.A., Liepnieks. J.J., Natsumeda, Y., Olah. E.. Jayaram, H.N.. Weber, G. (1984). Modulation of IMP dehydrogenaçe activity and guanylate metabolism by tiazofurin (2-p-D-ribofuranosylthiazole-4carboxamine). J. Biol. Chem. 259, 5078-5082.

McMillan, F.M.. Cahoon. M., White, A., Hedstrom, L., Petsko, G.A., Ringe. O. (2000) Crystal structure at 2.4 A resolution of Borelia Burgdorfen inosine 5'- monophosphate dehydrogenase: evidence of a substrate-induced hinged-lid motion by loop 6. Biochernist~ 39, 4533-4542.

Muise-Helmericks, R.C., Grimes, H.L., Bellacosa. A., Malstrom. S.E.. Tsichlis. P.N ., Rosen. N. (1 998). Cyclin D expression is controlled post-transcriptionally via a phosphatidylinositol 3-kinase1Akt-dependent pathway. J. Biol. Chem. 273. 29864-29872.

Nagai, M., Natsumeda. Y., Konno, R.. Hoffman, S., Irino, Weber, G. (1991). Selective-upregulation of type II inosine 5'-monophosphate dehydrogenase messenger RNA expression in human leukemias. Cancer Res. 51, 3886-3890.

Nagai, M., Natsumeda. Y., Weber, G. (1992). Proliferation-linked regulation of type II IMP dehydrogenase gene in human and normal lymphocytes and HL-60 leukemic cells. Cancer Res. 52, 258-261.

Natsumeda. Y. and Carr, S.F. (1993). Human type I and II IMP dehydrogenase as drug targets. Ann. N Y Acad. Sci 696, 88-93.

Natsumeda, Y., Ohno, S., Kawasaki, H., Konno, Y.. Weber. G., Suzuki, K. (1990). Two distict cDNAs for human IMP dehydrogenase. J. Biol. Chem. 265. 5292-5295.

Navaza, J. (1 994). AMoRe: an Automated package for molecular replacement. Acta Crystallography A50, 1 57-1 63.

Nimmesgern, E.. Fox,T., Fleming. M.A.. Thomson, J.A. (1996) Conformational changes and sta bilization of inosine 5'-monop hosphate de hyd rogenase associated with ligand binding and inhibition by mycophenolic acid. J. Biol. Chem. 271, 19421 -1 9427.

Olah, E., Natsumeda. Y., Ikegami. T., Kote, Z.. Horanyi. M., Szelenyi, J., Paulik, E., Kremmer. T.. Hollan, SR.. Sugar, J., Weber. G. (1988). Induction of erythroid differentiation and modulation of gene expression by tiazofurin in K562 leukemia cells. Proc. Natl. Acad. Sci USA 85. 6533-6537.

Olah, E. (1 989). Pattern of oncogene expression in hepatoma cells. In Keppler. D., Bannasch, P., Weber, G. (eds.), Liver Ce11 Carcinoma. MTP Press Ltd. Lancaster, U. K., 423-436.

Olah, E., Kote, 2.. Natsumeda, Y., Yamaji, Y., Jarai, G., Lapis, E., Financsek, I., Weber, G. (1 990). Down-regulation of c-myc and c-Ha-ras gene expression by tiazofurin in rat hepatoma cells. Cancer Biochem. Biophys. 11, 107-1 17.

Otwinowski, Z. (1 993) Oscillation data reduction program. In Proceedings of the CCP4 Study Weekend (Sawyer, L., Isaacs, N. and Bailey, S., eds.), SERC Daresbury Laboratory, Warrington, U.K., 56-62.

Pall, M.L. (1985). GTP: A central regulator of cellular anabolism. Curr. Top. Cell. Regul. 25, 1-20.

Pannu, N.S. and Read, R.J. (1996). lmproved structure refinement through maximum likelihood. Acta. Cwst. A52, 659-668.

Proffitt, R.T., Pathak, V.K., Villacorte, DG., Presant, C.A. (1 983). Sensitive radiochernical assay for inosine 5'-monophosphate dehydrogenase and determination of activity in murine tumor tissue extracts. Cancer Res. 43, 1620- 1623.

Read, A.T. (1986). lmproved fourier coefficients for maps using phases from partial structures with errors. Acta. Cg&. A42, 140-149.

Rice, LM. and Brumger. A.J. ('1994). Torsion angle dynarnics: reduced variable conformational sampling enhances crystallographic structure refinement. Proteins: Stucture, function, and genetics. 19, 277-290.

Robins. R., Srivastava, P.C., Narayanan, V.I., Plowman, J., Paull, K.D. (1982). 2-b-ribofuranosylthiazole-4-carboxamide, a novel potential antitumor agent for lung tumors and metastases. J. Med. Chem. 25, 1 07-1 08.

Robert, C.H., Decker, H., Richey, B., Gill, S.J., and Wyman, J. (1987) Nesting: hierarchies of allosteric interactions. Proc. Nat. Acad. Sci U S A. 84(7), 189% 1895.

Sambrook. J., Fritsch, E.F., and Maniatis, T. (1989) Molecular cloning - a laboratory manual (2" edition), Cold Spring Harbor Laboratory Press, USA.

Schiering, N., Kabsch, W., Moore, M.J.. Distefano, M.D., Walsh, C.T., Pai, E.F. (1991). Structure of the detoxification catalyst mercuric ion reductase from Bacillus SP. strain RC607. Nature 352, 168-72.

Shaw, L.M., Sollinger, H.W., Halloran, P., Morris, R.E., Yatscoff, R.W., Ransom, J., Tsina, I., Keown, P., Holt, D.W., Lieberman, R., Jaklitsch, A., Potter, J. (1995). Mycophenolate mofetil: A report of the consensus panel. Theraeut. Drug Monitor. 17, 690-699.

Senda, M. and Natsumeda, Y. (1994). Tissue-differential expression of two distict genes for human imp dehydrogenase. Life Sci. 54, 191 7-1 926.

Sherley. J.L. (1991). Guanine nucleotide biosynthesis is regulated by cellular p53 concentrations. J. Biol. Chem. 266, 2481 5-24282.

Sherley, J.L., Stadler, PB., johnson, D.R. (1995). The p53 anti-oncogene induces guanine nucleotide-dependent stem cell division kinetics. Roc. Natl. Acad .Sei USA 92, 136-140.

Sherley. J.L. (1996). The p53 tumor suppressor gene as a regulator of somatic stem cell renewal division. Cope 12, 9-10.

Sidi, Y., Panet, C.. Wasserman, L., Cyjon, A., Novogrodsky, A., Nordenberg, J. (1988). Growth inhibition and induction of phenotypic alterations in MCF-7 breast cancer cells by an IMP dehydrogenase inhibitor. Br. J. Cancer. 58, 61.

Sintchak, M.D.. Fleming, M.A., Futer, O.. Raybuck, S.A., Chambers. S.P., Caron, P.R., Murcko. M.A., Wilson, K.P. (1996). Structure and mechanism of inosine monophosphate dehydrogenase in complex with the immunosuppressent mycophenolic acid. Ce// 85, 921 -930.

Sokiloski, J.A., Blair, O.C.. Sartorelli, A.C. (1986). Alterations in glycoproteinsynthesis and guanosine triphosphate levels associated with the differentiation of HL-60 leukemia cells produced by inhibition of inosine 5'- monophosphate dehydrogenase. Cancer Res. 46,231 4-231 9.

Sollinger, H.W. (1995). Mycophenolate rnofetil for the prevention of acute rejection in primary cadaveric renal allog raft recipients (US Renal Transplant Mycophenolate Mofetil Study Group). Transplantation 60. 225-232.

Soussi, T., Dehouche, K., Beroud, C. (2000) p53 website and analysis of p53 gene mutations in human cancer: forging a link between epiderniology and carcinogenesis. Hum. Mutat 15, 105-1 13.

Stryer, L. (1 988). Biosynthesis of nucleotides. In Biochemistry, 3rd. edii, W.H. Freeman, N.Y., N. Y., 602-626.

Szekeres, T., Cho-chung, Y.S.. Weber, G. (1 992). Action of tiazofurin and 8-CI- CAMP in human colon and pancreatic cancer cells. Cancer Biochem. Biophys. 1 3, 67-74.

Tricot, G.J., Jayaram, H.N., Nichols, C.R., Pennington, K., Lapis, E., Jayaram. H.N., Weber. G., Hoffman, R. (1987). Hematological and biochemical action of tiazofurin in a case of refractory acute myeloid leukemia. Cancer Res. 47, 4988- 4991.

Tricot, G.J.. Jayaram, H.N.. Lapis, E., Natsumeda, Y., Yamada, Y.. Nichols. CR., Kneebone. P., Heerema, N., Weber, G.. Hoffman, R. (1989). Biochemically directed therapy of leukemia with tiazofurin, a selective blocker of inosine 5'-monophosphate dehydrogenase activity. Cancer Res.. 49, 3696- 3701.

Tricot, G.J., Jayaram. H.N.. Weber. G., Hoffman, R. (1 990). Tiazofurin: biological effects and clinical uses. Int. J. Ce11 Cloning 8, 161 -1 70.

Turka. L.A.. Dayton, J., Sinclair. G., Thompson, C.B., Mitchell, B.S. (1991). Guanine ribonucleotide depletion inhibits T cell activation: Mechanism of action of the immunosupressive drug mizobine. J. Clin. Invest. 87, 940-948.

Verham, R., Meek., T.D.. Hedstrom, L.. Wang, C.C. (1978). Purification. characterization, and kinetic anlysis of inosine 5'-monophosphate dehydrogenase of Tritrichomonas foetus. Mol. Biochem. Parasitol. 23, 2727- 2735.

Verham. R., Meek.. T.D.. Hedstrom, L.. Wang, C.C. (1 987). Purification. characterization, and kinetic analysis of inosine 5'-monophosphate dehydrogenase of Tritrichornonas foetus. Mol. Biochem. Parasitol. 24, 1-1 2.

Vitale. M., Zamai, L., Falcieri. E.. Zauli, G., Gobbi, P., Santi, S.. Cinti. C., Weber. G. (1997). IMP dehydrogenase inhibitor, tiazofurin, induces apoptosis in K562 human erthrolcukemia cells. Cytometry 30, 61 -66.

Wang, W. and Hedstrom. L. (1997). Kinetic mechanism of human inosine 5'- monophosphate dehydrogenase type II: random addition of substrates and ordered release of products. Biochemistry 36. 8479-83.

Weber, G. (1977) Enzymology of cancer cells. New England J. Med. 296, 486- 493.

Weber, G. (1983). Biochemical strategy of cancer cells and the design of chemotherapy. Cancer Res. 43, 3466-3492.

Weber. G., Nagai, M., Natsumeda, Y.. Eble, J.N.. Jayaram, H.N.. Paulik. E. (1991). Tiazofurin down-regulates expression of c-Ki-ras in a leukemic patient. Cancer Commun, 3,6 1-66.

Weber, G., Nakamura, H.. Natsumeda, Y.. Szekeres, T., Nagai. M. (1992). Reg ulation of GTP biosynthesis. Advan. Enzyme Regul. 32, 57-69.

Weber, G., Hata, Y., Noemi, P. (1 994). Role of differentiation induction in action of purine antirnetabolites. Phamacy World & Science l6(2): 77-83. Review.

Whitby, F.G., Luecke. H.. Kuhn, P., Somoza, J.R., Huete-Perez,J.A., Phillips, J.D., Hill, C.P.. Fletterick. R.J., Wang, C.C. (1997) Crystal structure of Tritrichomonas foetus inosine-5'-monophosphate dehydrogenase and the enzyme-product com plex. Biochemistv 36, 1 0666-1 0674.

Wu. J .C. (1 994). Perspect. Dmg Discovery Res. 2, 1 84-204.

Wyman, J., and Gill, S.J. (1 990) Binding and linkage, University Science Books, Mill Valley, CA.

Xiang. B., Taylor, J.C., Markham, G.D. (1996). Monovalent cation activation and kinetic mechanism of inosine 5'-monophosphate dehydrogenase. J. Biol. Chem. 271, 1435-1440.

Yalowitz, J.A. and Jayaram, H. N. (2000). Molecular targets of guanine nucleotides in differentiatian, proliferation. and apoptosis. Anticaner Res. 20, 2329-2338.

Yamada. Y., Natsumeda, Y., Weber, G. (1988). Action of the active metabolites of tiazofurin and ribavirin on purified I MP dehydrogenase. Biochemistv 27, 21 93-21 96.

Zhang, R.. Evans. G., Rotella. F.J., Westbrook, E.M.. Beno, D., Huberman. E., Joachimiak, A., Collart. F.R. (1999) Characteristics and crystal structure of bacterial inosine-5'- monophosphate dehydrogenase. Biochemistry 38, 4691- 4700.

Zimmermann, A., Spychala, J., Mitchell, B.S. (1995). Characterization of the human inosine-5'-monophosphate dehydrogenase type II gene. J. Biol. Chem. 270, 6808-6814.

Zimmermann, A., Gu, J.J.. Spychala, J.. Mitchell, B.S. (1996). lnosine monophosphate dehydrogenase expression: transcriptional regulation of the type 1 and type II genes. Adv. Enz. Reg. 36, 75-84.

Zimmermann. A., Wright, K.L., Ing, J.P.Y., Mitchell, B.S. (1 997). Regulation of inosine-5'-monophosphate dehydrogenase type II gene expression in human T cells. J. Biol. Chem. 272, 2291 3-22923.

6. Appendix

6.1. Cloning and protein expression of human IMPDH I cDNA

The cDNA for the human IMPDH I coding region was amplified by PCR

from a human spleen ÀgtlO cDNA libraiy (Collart and Huberman, 1988) by

methods as described in section 2.1 .l. Primer A was 5'-

CCGTTCAGAACTATCTTCAGTGG-3' and primer B was 3'-

GTGGACACCTCAGTTATGGAGG-3'. The primers (A and 8) were

complimentary to the 5'- and 3'-ends of the hurnan IMPDH I coding region.

Figure A l shows the PCR product as visualized on a 1% TAE-agarose gel

stained with 5 pglml ethidium bromide. A product with the predicted size (1700

base pairs) was evident. ?CR products were ligated to the pTZ19R plasrnid as

described in section 2.2.1. Positive recombinants were sequenced and al1 were

found to contain a 13-bp insertion mutation. This was removed by in vitro

deletion mutagenesis using the sculptorTM in vitro mutagenesis system from

Amersharn Life Science. It was not known why the gene contained an insertion

mutation. There has been, however, a reported case of human IMPDH I-like

pseudo-gene. Doggett et al., 1993 identified an IMPDH-like locus on

chromosome 16. The locus is most similar to IMPDH 1, but is sufficiently

diverged from both IMPDH I and II, implying a new gene called IMPDHLI. Within

the gene there is an intron and frame shift mutations which suggest an

unprocessed pseudo-gene.

Figure A i . PCR amplification of human IMPOH I cDNA. Visualized on a 1% TEA-agarose gel, stained with 5 mg/ml ethiduim bromide. Lane 1: h Hind III markers (500 ng), lane 2: PCR product sample (20 ~d), lane 3: h BstE II rnarkers (500 ng) (bp, base pairs).

Figure A 2 Expression analysis of pET2la-human IMPOH I recombinants. 12% SDS-PAGE gel with 20 pl samples from th? expression of pET2la-hurnan IMPDH I recombinants in E. coli EL21 (DE3). Lane 1 : Molecular weight markers (1 2 pg), lane 2: pSE420-HIMPDH II induced, lane 3 - 8: induced positive transformants (pET2la-HIMPDH I inBL21 (DE3) cells) samples #l-6, lane 9: induced pET2la in BL21 (DE3) cells only, lane 10: Molecular weight rnarkers (12 pg).

The insertion in IMPDH I as reported here, though, was amplified by PCR from a

cDNA library which in turn originated from transcribed mRNA.

The pTZ19R-HIMPDH l (wild-type) plasrnid was then digested with the

restriction enzymes Bfa I and Hind III and the resulting fragment was ligated into

a pET2la plasmid digested with Nde I and Hind III. The ligation mixture was

transfomed in to E. coli BL2 1 (DE3). Transforrned bacte ria were tested for

expression of IMPDH I as in section 2.1.3. The results are shown in Figure A2.

Most samples showed evidence of IMPDH I expression.

Samples showing expression were selected and grown in large quantities

as described in section 2.2.1. The cells were lysed and tested for IMPDH activity.

The soluble cell lysate was applied to a heparin-650M column. Fractions that

contained human IMPDH 1 were applied to an SOS-PAGE gel as shown in Figure

A4. None of the fractions from the heparin-650M column showed IMPDH

activity. As well, the soluble part of the cell extract did not show IMPDH activity.

The insoluble part of the cell lysate was dissolved in an 8.OM urea solution and

both fractions were applied to a SDS-PAGE gel (figure A3). A protein that CO-

migrated with the expressed human IMPDH I was observed in the insoluble part

of the cell lysate but not in the soluble part of the cell lysate. These results

indicated that the expressed human IMPDH I was insoluble in the aqueous

media that was used (despite containing 10% urea) and appeared to be in the

inclusion bodies of the bacterial cell.

Figure A3. Analysis of pET2la-HIMPDH I - BL21 (DE3) cell iysis. 12% SOS-PAGE gel. Lane 1: Molecular weight markers (1 2 ug). lane 2: induced pET2l a-HIMPDH I inBL2l (DE3) cells (50 big). lane 3: soluble cell extract (20 pg). lane 4: insoluble cell extract (5 ug). lane 5: insoluble cell extract (50 ~ g )

Figure A4. Analysis of heparin45OM column fractions. 12% SDSPAGE gel. Lane 1: induced pET2la-HIMPDH 1 inBL2l (DE3) cells (50 pg). lane 2: soluble cell extract (50 pg). lane 3-1 1 : fractions 52, 54, 56. 60, 62. 64, 66, 68, resp.. lane 12: Molecular weight markers (12 pg).

As work on the hurnan IMPDH II was successful, this line of enquiry was

terminated.

6.2. Crystallization of the IMPlMPA complexed IMPDH II.

Human IMPDH II was complexed with IMP and MPA as described with the

hamster IMPDH II (Fleming et al., 1996). Crystals were grown in the same

conditions as with apo-IMPDH II. Crystals were mounted at room temperature

and under cryo-conditions as described for human apo-IMPDH II. Hexagonally

shaped crystals were grown (Figure A5). Upon exposure to x-ray radiation, the

large crystals (0.2 mm X 0.3 mm X 0.3 mm) showed no appreciable diffraction at

room temperature or under cryo-conditions. Michael Sintchak from Vertex

Pharmaceuticals Inc. reported (personal communication) that there was a

hexagonal shaped crystal form of human IMPDH II that showed very little

diffraction and had a unit cell with dimensions greater than 300 A and a

câ~culated 48 IMPDH tetramers in the unit cell. The type of crystal grown here

may correspond to this type of crystal form.

Figure A5. Crystats of human IMPDH II complexed with MPA and IMP. Photograph of human IMPDH II crystals with MPA and IMP ( 2 0 0 ~ X 200p X 1 0 0 ~ ) grown by hanging drop vapor diffusion with a well solution containing 0.1 M MES, pH 5.8, 10% PEG 4000, 1.0 M LiCI, 40 mM PME. 2% MPyD. 4 pl of protein (dissolved in 10 mM TRISICI, pH 8.0, 0.3 M KCI, 10% glycerol, 1 mM EDTA. 2 mM PME at 20 mglml) was mixed with 2 pl of well solution and incubated at 23'C for 4 to 6 weeks.

6.3. Expression. purification. and crystallization of E. coli IMPDH.

Recombinant E. coli IMPDH was cloned by Michael Wittmer (M.D. thesis.

1987 University of Heidelberg) from the Max Plank Institute for Medical Research

in Heidelberg, Germany. lt was supplied as a LBlAgar via1 stabbed with Ecoli

MRE5059 cells containing a pBR322 plasmid with the E.coli IMPDH gene

(guaB). Cells were grown in 2XYT overnight to obtain a seed stock culture.

Cells were added to fresh media at 10% vlv and grown for 3.5 hours at 37OC.

The cells were collected by centrifugation and resuspended in a buffer containing

20 mM TRlSlHCl (pH 8.0). 3 mM EDTA, 10% glycerol plus 1 mM PMSF. 1 uglml

pepstatin, 1 uglml leupeptin, 0.1 mglml lysozyme, and 0.1 mg/ml DNase. The

cells were lysed and cleared by centrifugation. Solid ammonium sulfate was

added to the soluble cell extract to 38% saturation at O°C. The suspension was

stirred on ice for 30 minutes and the precipitate was collected by centrifugation.

The precipitate was dissolved in a buffer containing 20 mM sodium phosphate

buffer (pH 6.8) with 2 mM DTT and the solution was applied to a

diethylaminoethyl (DEA€)-sepharose column (100 ml) equilibrated with the

same buffer solution. The column was washed with pure buffer and then with

buffer containing 150 mM NaCI. The proteins were eluted with an NaCl gradient

from 150 mM to 350 mM. Fractions containing IMPDH actvity were pooled.

concentrated by ammonium sulfate precipitation and dissolved in a buffer

containing 10 mM TRlSlHCl (pH 8.0). 3 rnM EDTA. 10 mM KCI. 2 mM DTT. and

20% glycerol. The solution was applied to an adenosine 5'-monophosphate

(AMP)-agarose column (30ml) equilibrated with the same buffer. The column

was washed and the protein was eluted with buffer containing 20 rnM AMP.

Fractions with IMPDH activity were pooled, concentrated by ammonium sulfate

precipitation and dialyzed against a solution containing the above buffer and

stored at -70°C in aliquots. Samples frorn the purification were analyzed by

SDS-PAGE gel as viewed in Figure A6.

Aliquots were thawed on ice and dialyzed against 10 mM TRISJHCI (pH

8.0). 10 rnM KCI. and 2 mM DTT at 4OC. The concentration of enzyme was

adjusted to 8.0 mglml. 2 pl of protein solution was added to 2 pl of a reservior

solution containing 100 mM citratelHC1 (pH 5.6-6.0). 10-1 2% t-amyl-alcohol, 10%

PEG 1000 (wlv) and 4 mM D m . The drop was incubated above 1.0 ml of

resewoir solution for 3 to 4 weeks. Crystals were mounted at 4OC. Crystals were

exposed to an X-ray beam on beamline BL6A at the Photon Factory Synchrotron

in Tsukuta. Japan.

Figure A7 shows a picture of hexagonally shaped E. coli apo-IMPDH

crystal. A large crystal (0.25 mm X 0.30 mm X 0.35 mm) was mounted and

exposed to x-rays. The reflections observed were weak and they extended to a

maximum resolution of approximately 7 A. This crystal form may also be related

to the type grown for human IMPDH II complexed with IMP and MPA.

-9 + E. coli IMPDH 43000 Da

Figure A6. Analysis of the purification of E coli IMPDH. 12% SDS-PAGE gel. Lane 1: Molecutar weight markers (30 ug), lane 2: soluble cell extract (40 pg), lane 3: redissolved ammonium sulfate pellet (20 ug), lane 4: pooled fractions following the DEAE-sepharose column (12 ug), lane 5: pooled fractions following the AM?-agarose column (10 pg).

Figure A7. An E. coli IMPDH crystal (300~ X 200p X 200~). The protein was dissolved at 8.0 mglml in 10 mM TRlSlHCl (pH 8.0). 10 mM KCI. and 2 mM DTT at 4OC. 2 pl of protein solution was added to 2 pl of a reservoir solution containing 100 mM citratdHC1 (pH 56-60), 10% t-amyl- alcohol, 10% PEG 1000 (wlv) and 4 rnM DlT. The drop was incubated above 1 .O ml of reservoir solution for 3 to 4 weeks at 23'C.

structure determination of the apo-form … · 2010-12-10 · structure determination of the...

Documents