strepococcus group a
TRANSCRIPT
A STUDY ON“PCR AMPLIFICATION OF emm GENE FOR THE CONFIRMATION OF DRUG RESISTANCE
GROUP A STREPTOCOCCUS PYOGENES(DR - GAS)”.
A project report submitted to Periyar University
in partial fulfillment for the requirement
of the award of degree of
MASTER OF SCIENCE
BY
ONDARI NYAKUNDI ERICK
REGD NO: 09 BBG 1122
Under The Guidance Of
R. RAJALAKSHMI.. M.Sc., M. Phil,
FACULTY GUIDE
DEPARTMENT OF BIOTECHNOLOGY
AVS COLLEGE OF ARTS & SCIENCE.
(Affiliated to Periyar University)
SALEM-636106
1
2
ACKNOWLEDGEMENT In pursuit of this academic endeavour, I feel that I have been singularly fortunate, inspired, guided and directed. In cooperation, love and care which came along my way in abundance and it seems almost an impossible task to acknowlegde the same. In the name of God, the Compassionate and Merciful, I Recite, in the name of God who created: Created man from dust, made the heaven and the earth, uttered and all forms of the living and non living things made. The most Gracious, Who taught by the pen, Taught man what he knew not. To the Almighty God who has granted me support, blessings and whose power and mercy abode for the realization of my inspiration. The heavenly grace have defined and given meaning to my existence. To Him I extend and accredit my heart felt special thanks. I would like to thank Principal Dr. K.A Murugesan M. A, M.Phil., PhD and the entire management for providing the necessary facilities and good infrastructure on which I found treasure and all I needed for my course. I am grateful to Miss. R. Rajalakshmi M.Sc., M.Phil., Head of dept, Department of Biotechnology AVS College of Arts and Science Salem 636-106, for her vast understanding, everlasting moral support and continuous encouragement. My gratitude also extends to all faculty members for their kind support and undying cooperation for extending a hand of help for their motivations, recommendations and for imparting to me a very precious knowledge throughout the study period. Yes, I shall be failing in my duty if I do not record my profound sense of indebtedness and heart felt gratitude to my guide, Dr. R. Saravanan, M.Sc., PhD who guided and inspired me in pursuance of this work. His association will remain a beacon light to me throughout my career. I am obliged to Dr. Damodharan for providing the samples at convenience and providing vast valuable informstion that was of paramount use. In the same regard I thank Dr. E. Rani for her profound sense of humour, immense guidance and peace of mind all through. I am grateful to Miss. Preeti P for a wonderful co-ordination all through tirelessly and offering me necessary support not forgetting the entire BMERF scholars. I am also thankful those who could not find a separate name but helped me directly or indirectly. Equally I am indebted whole heatedly to the support, encouragement and good wishes of my parents and family members, without whom I would not have been able to complete my academia.
3
4
DECLARATION I do hereby declare that the dissertation entiltled as ‘’PCR AMPLIFICATION OF emm GENE FOR THE CONFIRMATION OF DRUG RESISTANCE GROUP A STREPTOCOCCUS PYOGENES’’submitted to Periyar University in partial fulfillment of the requirements for the award of degree Master of Science in Biotechnology is a record of original research done by me under the supervision and guidance of Dr. Saravanan, The Director Biomedical Engineering Research Foundation, The Gene Tech Administrative block Udayapatti, Salem 636 140, M.Sc, PhD,Miss. Rajalakshmi, M.Sc, M.Phil, Head in Biotechnology Department, AVS College of Arts and Science, Salem 636-106 and it has not formed for the award of any degree/diploma/associate/fellowship or other similar title to other candidate of our university. Date: Signature of the candidate. Place: (ONDARI NYAKUNDI ERICK)
5
6
I would like to dedicate this work in honor of my family. They blazed a path so bright that all I had to do was to follow. They not only gave me the opportunity to dream, but to realize those dreams. It is on their backs and because of their prayers and strength that I have arrived at this point. For them and everything I am and will be, I give all thanks and praise to God. My beloved family, all that I do and that I am is a direct reflection of your love and is always dedicated to you, thanks for the peace of mind in knowing that you are always there.
7
8
AbstractIntroduction: The endeavor of the current research aimed at amplifying emm gene for the drug resistant Streptococcus pyogenes which causes a spectrum of diseases devastating the health and the economy. GAS (Group A Streptococcus) is responsible for supurative diseases i.e. pharyngitis, impetigo, cellulitis, necrotizing fasciitis, scarlet fever, otitis media and sinusitis among many others and non-supurative diseases i.e. STSS,ARF,RHD,AGN and its sequelae which is uncertain is overwhelming. Dreadful about GAS is the report of “flesh eating bacteria”. The heterogeneity of emm gene, infectivity of the multivalent drug, increased number of emm types and high M protein non-typeabililty challenges the globe in coming up with the efficacy drug for therapy of the carriers, new infections and vaccination and this points specifically to the developing countries and indigenous populations of the developed nations. To accomplish all needs, faster, accurate, cheap and efficient epidemiology is of paramount to ensure complete custody of this important pathogen. In mind with such vast problems, the present work provides useful information for a reliable method for diagnosis and vaccine development.
Keywords: GAS, supurative and nonsupurative diseases, sequelae, M protein, emm gene.
Materials and methodology: Totally 5 samples were collected for processing in BMERF, The Gene Tech Research Admnistrative Block. NBA plates were used for hemolysis test. Presumptive tests included: Gram staining, Catalase test and Bacitracin which was used as a confirmatory test for GAS. DNA isolation by Modified Jeffrey’s method was adopted. PCR amplicons of the emm gene was done as per CDC protocols. Primers used: the forward primer CAGTATTCGCTTAGAAAATTAAAA, and reverse primer CCCTTACGGCTTGCTTCTGA. The control parameters: denaturation at 94°c for 2min 30 sec, annealing at 58°c for 30 sec (as calibrated from Finnzymes software) and extension at 72°c for 1 min 30 sec repeated for 30 cycles.PCR products were run (AGE) at 0.8% agarose at 50 volts for 45 min. DNA bands were observed under UV trans-illuminator and photos taken for analysis.
Results and discussion: One type of primer was used to amplify the emm gene, the sample showed consistence of the emm PCR product. Strongly this proves that same species is infectious as samples were collected from one place as opposed from the previous findings of heterogeneity which differ from place to place.
Conclusion: Data indicate that the relationship between emm type and genetic background is similar from the samples collected, and selection pressure acting on emm appear to be strongest for the ENT specialists. The PCR findings may have important implications for aboriginal vaccine design and vaccination strategies and advantageous method of diagnosis in developing nations.
9
Abbreviations
AAFP - American Academy of Family physicians
AAP – American Academy of pediatrics
AGE – Agarose Gel Electrophoresis
AGN – Acute Glomerulonephritis
AMI – Antibody-mediated Immunity
AOM – Acute otitis Media
APC - Antigen-presenting Cell
ASO – Anti-streptolysin O
CA-MRSA – community-acquired methicillin resistant staphylococcus aureus
CHF – Congestive heart Failure
CMI – Cell-mediated Immunity
DC – Direct Current
ddNTPs - Dideoxyribonucleoside triphosphate precursors
dNTPs – Deoxyribonucleoside triphosphate precursors
ECG – Electrocardiogram
ELISA – Enzyme Linked Immuno-sorbent Assay
ESR – Erythrocyte Sedimentation Rate
ESRD – End-stage renal disease
F protein – Fimbrial protein
GABHS – Group A Beta Hemolytic Streptococcus
GFR – Glomerular filtration Rate
HLA – Human Leukocyte Antigen
IL – Interleukin
LTA – Lipoteichoic acid
M protein – Myocardial protein
MEE – Middle ear effusion
10
MHC – Major histo-compatibilty molecule or complex
MPGN – Membrano-Proliferative GN
MSSA – Methicillin sensitive
NETs – Neutrophils Extarcellular Traps
NF – Necrosis Fever
OME – Otitis Media with effusion
PCR – Polymerase Chain reactions
PSGN – Post Streptococcal Glomerulonephritis
PYR – Pyrolidonyl arylamidase
RADTs – Rapid Antigen Detection Tests
RF – Rheumatic fever
RHD - Rheumatic heart disease
SDS – Sodium dodecyl sulphate
SPEs – Streptococcal pyrogenic exotoxins
SSA – Streptococcal superantigen
STSS – Streptococcal Toxic Shock Syndrome
TAE – Tris Acetate EDTA
TE – Tris EDTA
TSST -1 – TSS toxin type-1
URI – Upper Respiratory Infection
11
List of tables
Numbering Title headingOutline 2.1 Cell surface structure of GAS
Outline 2.2 Pathogenesis pathways
Table 2.1 Summary of virulence factors
Table 2.2 Forms of impetigo
Table 3.1 Summary of amplification steps
Table 3.2 PCR reaction mixture
Fig. 1 Hemolysis test
Fig. 2 Bacitraccin test
Fig. 3 Finnzymes Tm calculator
Fig. 4 Mastercycler PCR
Fig. 5 PCR amplification of emm gene from GAS
12
13
CONTENT TABLE
Abbreviations
Abstract
1.0 Introduction
Aims and objectives8
2.0 Literature review
2.1 General characteristics of GAS
2.2 Historical perspectives
2.3 classification of GAS
2.4 Spectrum of diseases due to GAS
2.5 Pathophysiology
2.6 a) Interaction between host and pathogen
b) Bacterial adherence factors
c) Extracellular products and toxins
d) Pyrogenic exotoxins
e) Nucleases
f) Other enzymes
2.7.1 Pathogenesis
2.7.2 Host defenses
2.8 Suppurative diseases spectrum
I. Pharyngitis
II. Impetigo
III. Cellulitis
IV. Necrotizing fasciitisV. Scarlet fever
VI. Otitis media and sinusitis
2.9 Non suppurative complications
a. Streptococcal toxic shock syndrome 40
b. Acute rheumatic fever
14
c. Acute glomerulonephritis 49
d. Rheumatic fever
e. Rheumatic heart disease
2.9.1 Identification of GAS
1) Throat culture
2) Lancefield group
3) Serological diagnosis
4) Molecular approaches
2.9.2 Vaccination
2.9.3
3.0 Materials and methodology
3.1 Hemolysis test
3.2 Gram stain
3.3 Catalase test
3.4 Bacitracin test
3.5 emm typing
A. Lysate preparation
B. Polymerase chain reaction
C. Resolution of PCR products on AGE
Results and discussion
Conclusion
Bibliography
15
1.0 INTRODUCTION
Streptococcus pyogenes (Group A streptococcus) is a Gram-positive, non-motile, non-
spore forming coccus that occurs in chains or in pairs of cells. Individual cells are round-to-
ovoid cocci, 0.5–1.2 micrometer in diameter. Streptococci divide in one plane and thus occur in
pairs or chains of varying lengths. The metabolism of Streptococcus pyogenes is fermentative;
the organism is a catalase-negative aero tolerant anaerobe (facultative anaerobe), and requires
enriched medium containing blood in order to grow. Group A streptococci typically have a
capsule composed of hyaluronic acid and exhibit beta (clear) hemolysis on blood agar
(Schottmueler et al., 1919).
GASGroup A streptococci (GAS) are strict parasites of humans, and Streptococcus pyogenes is
one of the most frequent pathogens of humans. It is estimated that between 5–15% of normal
individuals harbor Streptococcus pyogene, usually in the respiratory tract, without signs of
disease and children of age between 5–15 years are vulnerable. When the host defenses are
compromised, or when the organism is able to exert its virulence, or when it is introduced to
vulnerable tissues or hosts, an acute infection occurs.
For more than four score years, extensive clinical, epidemiological and laboratory
research efforts have focused on understanding group A streptococcal infections and their
sequelae. Despite these many decades of research, a complete understanding of the pathogenetic
mechanisms of Streptococcus pyogenes (GAS) remains elusive. Both laboratory research and
epidemiological studies will continue to be crucial for understanding the role of unique microbial
properties along with human susceptibility factors in pathogenesis (Dwight et al., 2005).
In the last century, infections by Streptococcus pyogenes claimed many lives especially
since the organism was the most important cause of puerperal fever (sepsis after childbirth).
Scarlet fever was formerly a severe complication of streptococcal infection, but now, because of
antibiotic therapy, it is little more than streptococcal pharyngitis accompanied by rash.
17
Similarly, erysipelas (a form of cellulitis accompanied by fever and systemic toxicity) is less
common today (Edward et al., 2003; Gonzalez et al., 2003). However, there has been a recent
increase in variety, severity and sequelae of Streptococcus pyogenes infections, and a resurgence
of severe invasive infections, prompting descriptions of "flesh eating bacteria" in the news
media. A complete explanation for the decline and resurgence is not known. Today, the
pathogen is of major concern because of the occasional cases of rapidly progressive disease and
because of the small risk of serious sequelae in untreated infections. These diseases remain a
major worldwide health concern, and effort is being directed toward clarifying the risk and
mechanisms of these sequelae and identifying rheumatogenic and nephritogenic strains of
streptococci (Bisno et al., 2000).
SIGNS AND SYMPTOMSTopical increase in variety, severity and sequelae of Streptococcus pyogenes infections
and resurgence of severe invasive infections, may present as pharyngitis (strep throat), scarlet
fever (rash), impetigo (infection of the superficial layers of the skin) or cellulitis (infection of the
deep layers of the skin). Invasive, toxigenic infections can result in necrotizing fasciitis,
myositis and streptococcal toxic shock syndrome. Patients may also develop immune–mediated
post streptococcal sequelae, such as acute rheumatic fever, rheumatic heart disease and acute
glomerulonephritis, following acute infections caused by Streptococcus pyogenes.
DIAGNOSISWith the necessity of better understanding this important pathogen several methods have
been proposed to enhance effective, economical, accurate and rapid identification Streptoccocus
pyogenes for diagnosis, development of vaccine to combat the streptococci infections whose
sequelae remains uncertain.
Throat culture (Gold Standard)
This depends on susceptibility on bacitracin and the positive PYR test (Facklam et al., 1997).
18
Lancefield Group Serotyping
Lancefield typing is based on immunological differences of the cell wall polysaccharides.
Groups A, B, C, F and G, lipoteichoic acid group D (Koneman et al., 1997). Lancefield capillary
precipitin technique and slide agglutination tests are carried out. However, these methods utilize
standardized grouping antisera that is difficult to prepare and costlier making it unyielding.
Serological diagnosis
The host responds immunologically to streptococcal infection with a plethora of
antibodies against many streptococcal cellular and extracellular components. Host responses
against the M protein serotype protect against re-infection with that particular serotype.
Routinely, serotype specific antibodies are measured only for research purposes only and not for
diagnosis. Responses against other cellular components are observed which includes: antibodies
against cell wall mucopeptide, carbohydrate moieties N-acetylglucosamine and rhamnose, R and
T cell wall protein antigens. Serological diagnosis is based on the extracellular products i.e.
Anti-streptolysin O (ASO) (Todd et al.., 1932), Anti- DNase B, Anti-Hyaluronidase and Anti–
Streptokinase which induce a strong immune response in the infected host
(Stollerman et al., 1975).
Serological diagnosis also has limitations in that none of the cell wall antigens are used in
the routine diagnosis of GAS infections, ASO test does not demonstrate a detectable rise in the 1-
3 years old that have had few previous GAS infections (Markowitz et al., 1972)., and all the
extracellular streptococcal enzymes may become significantly elevated over normal levels of
infection and to enhance a confirmed test; titers of antibodies against extracellular products
parallel each other. Exceptions noted: pyoderma or nephritogenic strains. Anti- DNase B titers
have been found to be reliable streptococcal infection indicators (Stollerman et al., 1975).
Infection of the skin does not always elicit a strong ASO response, Rheumatic fever confirmation
is imperative since streptococci cannot be cultured from pharynx (Bison et al.., 1995). Most
acute rheumatic fever demonstrates an elevated ASO titer with some exceptions which require
more than one antibody test to detect previous GAS infections.
19
To overcome the barrier of extracellular products Streptozyme test was developed as a
heamagglutination assay for the detection of multiple antibodies against the extracellular
products (Bison et al.., 1995).
Molecular biology approaches
With the vast need to develop a more efficient accurate, reliable and faster technique for
analysis of streptococci organism, several molecular approaches have been adopted which
includes; M protein serotype has been developed recently by rapid PCR analysis
(Beall et al., 1996). This technique has advantages over hybridization techniques, where
problems arise in the identification of new genes or hybrid M protein molecules which results
from inter-strain recombination, Enzyme electrophoresis polymorphism (Musser et al., 1992;
Haase et al., 1994; Bert et al., 1995)., Rapid Amplification of Polymorphic DNA
(RAPD) (Sappala et al., 1994)., Restriction Fragment Length polymorphism (RFLP)
(Patric et al., 1988; Bingen et al., 1992 ; Desai et al., 1998 & 1999), Vir typing
(Gardiner et al., 1995&1996). DNA hybridization using N-terminal sequences of the M protein
gene (emm) as oliginucleotide probes (Kaufhold et al., 1994; Penny et al., 1995)., Polymerase
Chain Reaction-Enzyme Linked Immunosorbant Assay (PCR-ELISA) (Saunders et al., 1997).,
PCR M typing using specific oligonucleotide primers for PCR amplification of N-terminal
region of emm gene (Vitali et al., 2002)., Polymerase Chain Reactions-Restriction Fragment
Length Polymorphism (PCR-RFLP and it has overcome technical problems such as it only
requires one pair of primer and the PCR products can be discriminated using standard PAGE
which is easy to perform, interpret and less time consuming. In addition, compared with
M protein typing PCR-RFLP is technically less demanding and more economical
(Nonglak et al., 2005; Stanley et al., 1996; Dicuonzo et al., 2001; Beall et al., 2001;
Perea-Mejia et al., 2002)., Multilocus Sequence Typing (MLST) and can be used on any
bacterial analysis (Enright et al., 2001; Urwin et al., 2003)., N-terminal sequencing of the
M protein gene (emm), however, is the conclusive method for typing of GAS. Conversely, it is
not an option in developing countries laboratories (Beall et al., 1996; Brandt et al., 2001).
In addition, various problems have been encountered such as ambiguity in the results, time
consuming, discovery of new M types making it hard for M-specific serotype preparation
20
demanding high costs (Facklam et al., 1997)., difficult in obtaining high tittered antisera against
opacity factor and lipoproteinase which causes various types of mammalian serum to increase in
opacity (Widdowson et al., 1970-71).
VACCINATIONIn soughting long-term immunity for therapy, to cater new infections and the carriers,
different strategies have been incorporated for efficacious drugs against invasion, colonization
and sequelae. M protein targets type specific N-terminal region (shown to induce protective
bactericidal and opsonic antibody against specific M protein serotype) and or the highly
conserved carboxy-terminal region of the M protein molecule (has protected against multiple
serotypes and prevented colonization at mucosal surfaces) (Bessen et al., 1990 & 1997;
Fischetti, 1989; Medaglini et al., 1995). The following problems must be overcome for
development of the vaccine. First, it should not exacerbate the given disease that the vaccine
would be designed to prevent. M proteins sites associated with tissue cross reactivity or tissue
infiltrates should be avoided, and selected sites should be thoroughly tested in animals. Second,
the immune response should provide lasting protection. Third, because more than 80 different
M serotypes cause infections, only a limited number of M serotypes are practical for a type
specific vaccine (aboriginal vaccine). In addition it has been observed that M serotypes which
cause infection are cyclic in populations and also that different M serotypes are responsible for
rheumatic fever in different parts of the world (Hauser et al., 1991; Kaplan, 1991). Multivalent
vaccine though it appears to be effective, it is not applicable to all regions of the world due to
heterogeneity of the M serotypes which differ from place to place (Dale et al., 1996).
Recombinant vaccines containing many M type sequences have shown to be effective against
multiple serotypes and prevention of colonization, mucosal immunity administered has too been
observed as effective (immunization with synthetic peptides corresponding to conserved epitope
found in the carboxy–terminal region of M protein) and on the contrary peptides from conserved
region given intranasally did not induce an opsonic antibody response or protect against systemic
infection, they reduced colonization at the nasopharyngeal mucosal surface (Dale et al., 1996).
C5a peptidase is another promising vaccine. It is antigenically stable and 95 to 98% identical
among different types that would presumably produce protection against all serotypes. Other 21
vaccine candidates include antigens such as streptococcal proteinase (pyrogenic exotoxin B),
carbohydrate protein conjugates (Ji et al., 1997).
The decline and resurgence of GAS is not yet ascertained necessitating major concern because of
the occasional causes of rapidly progressive disease and risk paused to humans by sequelae in
untreated infections. More than 225 emm types have been identified by the Centers for Disease
Control and Prevention (CDC) thus far in addition to the new ones which are being reported
continuously causing an obstacle for development of effective vaccines.
Accurate identification and typing of GAS is essential for epidemiological, pathogenesis
studies and vaccine development owing to infectivity of multivalent drug in the tropicals and
developing countries. Though M typing and emm concurs almost 1:1, M typing however is
limited to supply of antisera and high nontypeability (Benard et al., 1996;
Pruksakorn et al., 2000). For this reason, emm (N-terminal hypervaraiable region of M protein
gene) based on sequence analysis of PCR products is employed which will serve as a basis for
information for long the term evolutionary study of the local Streptococcus pyogenes strains and
development of specific N-terminal (emm gene) based vaccines to combat the streptococcal
infections especially acute rheumatic fever and rheumatic heart disease which have no drug and
resistance due to mutations and genetic background (Debra et al., 2008).
In quest of a resolution keeping in mind the drawbacks mentioned above the present research
work has been entitled as “emm” gene amplification for the confirmation of Drug Resistance
Group A Streptococcus (DR–GAS).
22
AIMS AND OBJECTIVES OF STUDYING STREPTOCOCCUS PYOGENES.
The purpose of this study was therefore:
(i) To isolate and identify the prevalent Streptococci of the pharynx of Salem children.
(ii) To become familiar with the principle characteristics used for the classification of various
groups of the important Streptococci.
(iii)To amplify the emm (N-terminal region of M protein) gene for the confirmation of drug
resistance GAS.
24
25
2.0 LITERATURE REVIEW 2.1 General characteristics of GAS
Kingdom: Bacteria
Phylum: Firmicutes
Class: Bacilli
Order: Lactobacillales
Family: Streptococcaceae
Genus: Streptococcus
Species: S. pyogenes
Streptococci are a large group of gram-positive, non-motile,
Non–spore-forming cocci that usually form irregular clusters,
They often grow in pairs or chains, are oxidase- and catalase-negative.
Chain forms due to division in one plane and failure of daughter cell to separate
completely,
About 0.5-1.2 µm in size with low G+C content,
Require enriched media with blood, serum or ascitic fluid for their growth,
Facultative anaerobes(aerobes) with beta hemolytic,
Ferments lactose, glucose, salicin, sorbitol, maltose, dextrin, and produce acid only, no
gas , do not ferment mannitol
Colonize the upper respiratory tract and is highly virulent as it overcomes the host
defense system.
26
Cause pyogenic infections with characteristic tendency to spread,
The most common forms of Streptococcus pyogenes disease include respiratory and skin
infections, with different strains usually responsible for each form.
The cell wall of Streptococcus pyogenes is very complex and chemically diverse. The
antigenic components of the cell are the virulence factors. The extracellular components
responsible for the disease process include: invasins and exotoxins.
Also it produces hemolysins, erythrogenic, streptokinase, deoxyribosenuclease and
protease toxins,
The outermost capsule is composed of hyaluronic acid, which has a chemical structure
resembling host connective tissue, allowing the bacterium to escape recognition by the
host as an offending agent. Thus, the bacterium escapes phagocytosis by neutrophils or
macrophages, allowing it to colonize,
Lipoteichoic acid and M proteins located on the cell membrane traverse through the cell
wall and project outside the capsule,
Resistant to crystal violet, susceptible to sulfonamide,
Destroyed by heat at 56˚c,
Survives in dust for several weeks if protected from sunlight.
Streptococcus pyogenes (Group A streptococcus) is a Gram-positive, nonmotile, non-spore
forming coccus that occurs in chains or in pairs of cells. Individual cells are round-to-ovoid
cocci, 0.6-1.0 micrometer in diameter. Streptococci divide in one plane and thus occur in pairs or
in chains of varying lengths. The metabolism of Streptococcus pyogenes is fermentative; the
organism is a catalase-negative aero-tolerant anaerobe (facultative anaerobe), and requires
enriched medium containing blood in order to grow. Group A streptococci typically have a
capsule composed of hyaluronic acid and exhibit beta (clear) hemolysis on blood agar
(Schottmueller et al., 1919).
27
Streptococcus pyogenes is beta-hemolytic bacterium that belongs to Lancefield serogroup A,
also known as group A streptococci (GAS). GAS, a ubiquitous organism, causes a wide variety
of diseases in humans and is the most common bacterial cause of acute pharyngitis, accounting
for 15%-30% of cases in children and 5%-10% of cases in adults (Schroeder et al, 2003).
During the winter and spring in temperate climates, up to 20% of asymptomatic school-aged
children may be GAS carriers (Bisno et al., 2002).
GAS usually causes pharyngitis or impetigo but, in rare cases, can also cause invasive
diseases such ascellulitis, bacteremia, necrotizing fasciitis, and toxic shock syndrome (TSS).
Along with Staphylococcus aureus, GAS is one of the most common pathogens responsible for
cellulitis.
2.2 Historical perspectives
Streptococcus pyogenes was first described by Billroth in 1874 in patients with wound
infections. In 1883, Fehleisen isolated chain-forming organisms in pure culture from
perierysipelas lesions. Rosebach named the organism Streptoccocus pyogenes in 1884. Studies
by Schottmueller in 1903 and J.H. Brown in 1919 led to knowledge of different patterns of
hemolysis described as alpha, beta, and gamma hemolysis.
A later development in this field was the Lancefield classification of beta-hemolytic
streptococci by serotyping based on M-protein precipitin reactions. Lancefield established the
critical role of M protein in disease causation. In the early 1900s, Dochez, George, and Dick
identified hemolytic streptococcal infection as the cause of scarlet fever. The epidemiological
studies of the mid 1900s helped establish the link between GAS infection and acute rheumatic
fever (ARF) and acute glomerulonephritis (Graziella et al., 2001).
The traditional Lancefield M-protein classification system, which is based on serotyping,
has been replaced by emm typing. This gene-typing system is based on sequence analysis of
the emm gene, which encodes the cell surface M protein. Approximately 200 emm types have
been identified by the Centers for Disease Control and Prevention (CDC) thus far.
28
2.3 Classification of Streptococci Hemolysis on blood agar
The type of hemolytic reaction displayed on blood agar has long been used to classify the
streptococci:
a) Beta –hemolysis - is associated with complete lysis of red cells surrounding the colony,
b) Alpha–hemolysis - is a partial or "green" hemolysis associated with reduction of red
cell hemoglobin.
c) Gamma-hemolytic – Non-hemolytic colonies.
Hemolysis is affected by the species and age of red cells, as well as by other properties of the
base medium. Group A streptococci are nearly always beta-hemolytic; related Group B can
manifest alpha, beta or gamma hemolysis. Most strains of S. pneumoniae are alpha-hemolytic
but can cause β-hemolysis during anaerobic incubation. Most of the oral streptococci and
enterococci are non hemolytic. The property of hemolysis is not very reliable for the absolute
identification of streptococci, but it is widely used in rapid screens for identification of
Streptococcus pyogenes and Streptococcus pneumoniae.
Antigenic types
The cell wall structure of Group A streptococci is among the most studied of any bacteria.
The cell wall is composed of repeating units of N-acetyl glucosamine and N-acetylmuramic acid,
the standard peptidoglycan. Historically, the definitive identification of streptococci has rested
on the serologic reactivity of cell wall polysaccharide antigens as originally described by
Rebecca Lancefield. Eighteen group-specific antigens (Lancefield groups) were established.
The Group A polysaccharide is a polymer of N-acetyl glucosamine and rhamnose. Some group
antigens are shared by more than one species.
2.4 Spectrum of diseases due to group A streptococcal infections
29
In the pre-antibiotic era, streptococci frequently caused significant morbidity and were
associated with significant mortality rates. However, in the post-antibiotic period, diseases due to
streptococcal infections are well-controlled and uncommonly cause death. GAS can cause a
diverse variety of both suppurative diseases and nonsuppurative postinfectious sequelae.
The suppurative spectrum of GAS diseases includes the following: Pharyngitis with or without
tonsillopharyngeal cellulitis or abscess, Impetigo (purulent honey-colored crusted skin lesions),
Pneumonia, Necrotizing fasciitis, Streptococcal bacteremia, Osteomyelitis, Otitis media,
Sinusitis, Meningitis or brain abscess (a rare complication resulting from direct extension of an
ear or sinus infection or from bacteremic spread).
The nonsuppurative sequelae of GAS infections include the following: Acute rheumatic
fever (ARF; defined by Jones criteria), Rheumatic heart disease (chronic valvular damage,
predominantly mitral valve), Acute glomerulonephritis (AGN).
Superantigen-mediated immune response may result in the following entities:
Streptococcal TSS (STSS) characterized by systemic shock with multi-organ failure, with
manifestations of respiratory failure, acute renal failure, hepatic failure, neurological symptoms,
hematological abnormalities, and skin findings, among others. This is predominantly associated
with M types 1 and 3 that produce pyrogenic exotoxin A, exotoxin B, or both
(Stevens et al., 1995), Scarlet fever (characterized by upper-body rash, generally following
pharyngitis).
2.5 Pathophysiology
Streptoccocus pyogenes tends to colonize the upper respiratory tract and is highly virulent
as it overcomes the host defense system. The most common forms of Streptococcus
pyogenes disease include respiratory and skin infections, with different strains usually
responsible for each form.
The cell wall of Streptococcus pyogenes is very complex and chemically diverse. The
antigenic components of the cell are the virulence factors. The extracellular components
30
responsible for the disease process include invasins and exotoxins. The outermost capsule is
composed of hyaluronic acid, which has a chemical structure resembling host connective tissue,
allowing the bacterium to escape recognition by the host as an offending agent. Thus, the
bacterium escapes phagocytosis by neutrophils or macrophages, allowing it to colonize.
Lipoteichoic acid and M proteins located on the cell membrane traverse through the cell wall and
project outside the capsule.
2.6 Interaction between the host and pathogen
a. Bacterial virulence factors
The cell wall antigens include capsular polysaccharide (C-substance), peptidoglycan and
lipoteichoic acid (LTA), R and T proteins, and various surface proteins, including M protein,
fimbrial proteins, fibronectin-binding proteins (e.g., protein F), and cell-bound streptokinase.
The C-substance is composed of a branched polymer of L-rhamnose and
N -acetyl-D-glucosamine. It may have a role in increased invasive capacity. The R and T
proteins are used as epidemiologic markers and have no known role in virulence.
M protein, the major virulence factor, is a macromolecule incorporated in fimbriae
present on the cell membrane projecting on the bacterial cell wall. More than 50 types
of Strepoccocus pyogenes M proteins have been identified based on antigenic specificity, and the
M protein is the major cause of antigenic shift and antigenic drift among GAS
(Musser et al., 1991). The M protein binds the host fibrinogen and blocks the binding of
complement to the underlying peptidoglycan. This allows survival of the organism by inhibiting
phagocytosis. Strains that contain an abundance of M protein resist phagocytosis, multiply
rapidly in human tissues, and initiate disease process. After an acute infection, type-specific
antibodies develop against M protein activity in some cases.
In addition to M protein, Streptococcus pyogenes possesses additional virulence factors,
such as C5A peptidase, which destroys the chemo-tactic signals by cleaving the complement
component of C5A.
31
b. Bacterial adherence factors
At least 11 different surface components of GAS have been suggested to play a role in
adhesion. In 1997, Hasty and Courtney proposed that GAS express different arrays of adhesins in
various environmental niches. Based on their review, M protein mediates adhesion to HEp-2
cells in humans, but not buccal cells, whereas FBP54 mediates adhesion to buccal cells, but not
to HEp-2 cells. Protein F mediates adhesion to Langerhans cells, but not keratinocytes.
The most recent theory proposed in the process of adhesion is a two-step model. The
initial step of overcoming the electrostatic repulsion of the bacteria from the host is mediated by
LTA rendering weak reversible adhesion.
The second step is firm irreversible adhesion mediated by tissue-specific M protein,
protein F, or FBP54, among others. Once adherence has occurred, the streptococci resist
phagocytosis, proliferate, and begin to invade the local tissues (Courtney et al., 1997). GAS
show enormous evolving molecular diversity, driven by horizontal transmission among various
strains. This is also true when compared with other streptococci. Acquisition of prophages
accounts for much of the diversity, conferring not only virulence via phage-associated virulence
factors but also increased bacterial survival against host defenses.
c. Extracellular products and toxins
Various extracellular growth products and toxins produced by GAS are responsible for
host cell damage and inflammatory response. Streptolysin S, a 28 residue peptide, is an oxygen-
stable leukocidin toxic to polymorphonuclear leukocytes, RBCs, and platelets. Streptolysin S is
responsible for RBC lysis observed on sheep blood agar. Streptolysin O is an oxygen-labile
leukocidin that is toxic to neutrophils and induces a brisk antibody response. Measurement of
antistreptolysin O (ASO) antibody titer in humans is used as an indicator of recent streptococcal
infection.
Other extracellular products include NADase (leukotoxic), hyaluronidase (which digests
host connective tissue, hyaluronic acid, and the organism's own capsule), streptokinases
(proteolytic), and streptodornase A-D (deoxyribonuclease activity) ( Stevens et al.,1997)
32
d. Pyrogenic exotoxins
GAS produces 3 different types of exotoxins (A, B, C) (Musser et al., 1991). These
toxins act as super antigens and are responsible for inciting systemic immune response and acute
disease caused by the sudden and massive release of T-cell cytokines into the blood stream.
The superantigens bypass processing by antigen presenting cells and cause T-cell
activation by binding class II MHC molecules directly and nonspecifically.
The streptococcal pyrogenic exotoxins (SPEs) are responsible for causing scarlet fever,
pyrogenicity, and STSS. The mechanism is similar to that of staphylococcal TSS
(Fraser et al., 2008).
e. Nucleases
Four antigenically distinct nucleases (A, B, C, and D) assist in the liquefaction of pus and
help to generate substrate for growth.
f. Other enzymes
In addition, streptococci produce proteinase, nicotinamide adenine dinucleotidase,
adenosine triphosphatase, neuraminidase, lipoproteinase, and cardiohepatic toxin.
The table below represents summary of virulence factors.
Name Description
Streptolysin OAn exotoxin that is one of the bases of the organism's beta-hemolytic
property.
Streptolysin S A cardiotoxic exotoxin that is another beta-hemolytic component.
Streptolysin S is not immunogenic and O2 stable. A potent cell poison
affecting many types of cell including neutrophils, platelets, and sub-
cellular organelles, streptolysin S causes an immune response and detection
33
of antibodies to it; antistreptolysin O (ASO) can be clinically used to
confirm a recent infection.
Streptococcal
pyogenic exotoxin
A (SpeA) Superantigens secreted by many strains of S. pyogenes. This pyrogenic
exotoxin is responsible for the rash of scarlet fever and many of the
symptoms of streptococcal toxic shock syndrome (STSS).Streptococcal
pyogenic exotoxin
C (SpeC)
StreptokinaseEnzymatically activates plasminogen, a proteolytic enzyme, into plasmin,
which in turn digests fibrin and other proteins.
Hyaluronidase
It is widely assumed hyaluronidase facilitates the spread of the bacteria
through tissues by breaking down hyaluronic acid, an important component
of connective tissue. However, very few isolates of S. pyogenes are capable
of secreting active hyaluronidase due to mutations in the gene that encode
the enzyme. Moreover, the few isolates that are capable of secreting
hyaluronidase do not appear to need it to spread through tissues or to cause
skin lesions.
Streptodornase Most strains of S. pyogenes secrete up to four different DNases, which are
sometimes called streptodornase. The DNases protect the bacteria from
being trapped in neutrophil extracellular traps (NETs) by digesting the
NET's web of DNA, to which are bound neutrophil serine proteases that
can kill the bacteria.
C5a peptidase C5a peptidase cleaves a potent neutrophil chemotaxin called C5a, which is
produced by the complement system. C5a peptidase is necessary to
34
minimize the influx of neutrophils early in infection as the bacteria are
attempting to colonize the host's tissue.
Streptococcal
chemokine
protease
Patients with severe cases of necrotizing fasciitis are devoid of neutrophils.
The serine protease ScpC, which is released by S. pyogenes, prevents the
migration of neutrophils spreading infection. ScpC degrades
the chemokine IL-8, which would attract neutrophils to infection site. C5a
peptidase, although required to degrade the neutrophil chemotaxin C5a in
the early stages of infection, is not required for S. pyogenes to prevent the
influx of neutrophils as the bacteria spread through the fascia.
Table 2.1 Summary of virulence factors.
Outline 1.1 Cell surface structure of Streptococcus pyogenes and secreted products involved in virulence.
35
2.7 PathogenesisStreptococcus pyogenes owes its major success as a pathogen to its ability to colonize and
rapidly multiply and spread in its host while evading phagocytosis and confusing the immune
system. Acute diseases associated with Streptococcus pyogenes occur chiefly in the respiratory
tract, bloodstream, or the skin.
Streptococcal disease is most often a respiratory infection (pharyngitis or tonsillitis) or a skin
infection (pyoderma). Streptococcocus pyogenes is the leading cause of uncomplicated bacterial
pharyngitis and tonsillitis commonly referred to a strep throat. Streptoccocus pyogenes
infections can also result in sinusitis, otitis, mastoiditis, pneumonia, joint or bone infections,
necrotizing fasciitis and myositis, meningitis or endocarditis.
Streptoccocus pyogenes also infects the skin. Infections of the skin can be superficial (impetigo)
or deep (cellulitis). Scarlet fever and streptococcal toxic shock syndrome are systemic responses
to circulating bacterial toxins. Two post streptococcal sequelae (rheumatic fever following
respiratory infection and glomerulonephritis following respiratory or skin infection), occur in 1-
3% of untreated infections. These conditions and their pathology are not attributable to
dissemination of bacteria, but to aberrent immunological reactions to Group A streptococcal
antigens.
In Group A streptococci, the R and T proteins are used as epidemiologic markers and
have no known role in virulence. The M proteins are clearly virulence factors associated with
both colonization and resistance to phagocytosis. More than 50 types of Streptococcus
pyogenes M proteins have been identified on the basis of antigenic specificity, and it is the M
protein that is the major cause of antigenic shift and antigenic drift in the Group A streptococci.
The streptococcal M protein, peptidoglycan, N-acetylglucosamine, and group-specific
carbohydrate portions of the cell surface all have antigenic epitopes that mimic those of
mammalian muscle and connective tissue. The cell surface of recently emerging (flesh-eating)
strains of streptococci is distinctly mucoid (indicating that they are highly encapsulated) and rich
in M protein. Protein F, thought involved in attachment to fibronectin, is presumably a non–
fimbrial adhesin located on the bacterial cell surface.
36
The capsule of Streptococcus pyogenes is non antigenic since it is composed
of hyaluronic acid, which is chemically similar to that of host connective tissue. This allows the
bacterium to hide its own antigens and to go unrecognized as antigenic by its host. The
cytoplasmic membrane of Streptoccocus pyogenes contains some antigens similar to those of
human cardiac, skeletal, and smooth muscle, heart valve fibroblasts, and neuronal tissues,
resulting in molecular mimicry and a tolerant or suppressed immune response by the host.
Colonization of tissues by Streptoccocus pyogenes is thought to result from a failure in
the innate defenses (normal flora and other nonspecific defense mechanisms) which allows
establishment of the bacterium at a portal of entry (often the upper respiratory tract or the skin)
where the organism multiplies and causes an inflammatory purulent lesion. Some strains of
streptococci show a predilection for the respiratory tract and others, for the skin. Generally,
streptococcal isolates from the pharynx and respiratory tract do not cause skin infections.
There is abundant evidence that Streptococcus pyogenes utilizes lipoteichoic acids in the
cell wall as adhesins. The lipoteichoic acid (LTA) is anchored to proteins on the bacterial
surface, including the M protein. Both the M proteins and lipoteichoic acid are supported
externally to the cell wall on fimbriae and appear to mediate bacterial adherence to host
epithelial cells. It has been proposed that both LTA and the M protein are needed for attachment
to mucosal surfaces and that this explains the role of the M protein as a determinant of virulence
(Nonetheless, the M protein is a proven determinant of virulence since it inhibits phagocytic
ingestion of non-opsonized streptococci). A non–fimbrial protein (Protein F) has also been
shown to mediate streptococcal adherence to the amino terminus of fibronectin on mucosal
surfaces.
Colonization of the upper respiratory tract and acute pharyngitis may spread to other
portions of the upper or lower respiratory tracts resulting in infections of the middle ear (otitis
media), sinuses (sinusitis), or lungs (pneumonia). In addition, meningitis can occur by direct
extension of infection from the middle ear or sinuses to the meninges or by way of bloodstream
invasion from the pulmonary focus.
Bacteremia can also result in infection of bones (osteomyelitis) or joints (arthritis). During these
aspects of acute disease the streptococci bring into play a variety of secretory proteins that
mediate their invasion.
37
For the most part, streptococcal invasins and protein toxins interact with mammalian
blood and tissue components in ways that kill host cells and provoke a damaging inflammatory
response. The soluble extracellular growth products and toxins of Streptococcus pyogenes, have
been studied intensely. Streptolysin S is an oxygen-stable leukocidin; Streptolysin O is an
oxygen-labile leukocidin. NADase is also leukotoxic.
Hyaluronidase (the original spreading factor) can digest host connective tissue
hyaluronic acid as well as the organism's own capsule. Streptokinases participate in fibrin lysis.
Streptodornases A-D possesses deoxyribonuclease activity; Streptodornases B and D possess
ribonuclease activity as well.
Protease activity similar to that in Staphylococcus aureus has been shown in strains
causing soft tissue necrosis or toxic shock syndrome. This large repertoire of products is
important in the pathogenesis of Streptoccocus pyogenes infections. Even so, antibodies to these
products are relatively insignificant in protection of the host.
Three pyrogenic exotoxins (formerly known as Erythrogenic toxin) of Streptoccocus
pyogenes (SPEs) are recognized: types A, B, C. toxins which act as superantigens by a
mechanism similar to those described for staphylococci. As antigens, they do not require
processing by antigen presenting cells. Rather, they stimulate T cells by binding class II MHC
molecules directly and nonspecifically. With superantigens about 20% of T cells may be
stimulated (vs 1/10,000 T cells stimulated by conventional antigens) resulting in massive
detrimental cytokine release. SPEs A and C are encoded by lysogenic phages; the gene for SPE B
is located on the bacterial chromosome. Re-emergence in the late 1980's of these exotoxin
producing strains has been associated with a toxic shock-like syndrome similar in pathogenesis
and manifestation to staphylococcal toxic shock syndrome and other forms of invasive disease
associated with severe tissue destruction.
38
Outline 2.2 Pathogenesis of Streptococcus pyogenes infections. (Adapted from Baron's Medical Microbiology
Chapter 13, Streptococcus by Maria Jevitz Patterson).
Host defenses
Streptoccocus pyogenes is usually an exogenous invader following viral disease or
disturbaces in the normal bacterial flora. In the normal human the skin is an effective
barrier against invasive streptococci, and nonspecific defense mechanisms prevent
bacteria from penetrating beyond the superficial epithelium of the upper respiratory tract.
These mechanisms include: mucociliary movement, coughing, sneezing and epiglottal
reflexes.
The host phagocytic system is a second line of defense against streptococcal invasion.
Organisms can be opsonized by activation of the classical or alternate complement pathway and
39
by anti-streptococcal antibodies in the serum. Streptoccocus pyogenes is rapidly killed following
phagocytosis enhanced by specific antibody. The bacteria do not produce catalase or significant
amounts of superoxide dismutase to inactivate the oxygen metabolites (hydrogen peroxide,
superoxide) produced by the oxygen-dependent mechanisms of the phagocyte. Therefore, they
are quickly killed after engulfment by phagocytes.
The hyaluronic acid capsule, of course, allows the organism to evade opsonization. The
capsule is also an antigenic disguise that hides bacterial antigens and is non antigenic to the host.
Actually, the hyaluronic acid outer surface of Streptoccocus pyogenes is weakly antigenic, but it
does not result in stimulation of protective immunity. The only protective immunity that results
from infection by Group A streptococcus comes from the development of type-specific antibody
to the M protein of the fimbriae, which protrude from the cell wall through the capsular structure.
This antibody, which follows respiratory and skin infections, is persistent. Presumably, protective
levels of specific IgA are produced in the respiratory secretions while protective levels of IgG are
formed in the serum. Sometimes, intervention of an infection with effective antibiotic treatment
precludes the development of this persistent antibody. This accounts, in part, for recurring
infections in an individual by the same streptococcal strain. Antibody to the erythrogenic toxin
involved in scarlet fever is also long lasting.
The occurrence of cross-reactive antigens in Streptoccocus pyogenes and various
mammalian tissues possibly explains the autoimmune responses that develop following some
infections. The antibody mediated immune (AMI) response (i.e., level of serum antibody) is
higher in patients with rheumatic fever than in patients with uncomplicated pharyngitis.
In addition, cell-mediated immunity (CMI) seems to play a role in the pathology of acute
rheumatic fever.
2.8.1 Suppurative Disease Spectrum
40
I. Pharyngitis
Streptococcus pyogenes causes up to 15%-30% of cases of acute pharyngitis
(Maltezou et al., 2008). Accurate diagnosis is essential for appropriate antibiotic selection.
Common respiratory viruses account for the vast majority of cases and these are usually self-
limited. Bacteria are also important etiologic agents, and, when identified properly, may be
treated with antibacterials, resulting in decreased local symptoms and prevention of serious
sequelae.
The most common and important bacterial cause of pharyngitis is Streptococcus
pyogenes. When suspected, bacterial pharyngitis can be confirmed with routine diagnostic tests
and treated with various antibiotics. If left untreated, GAS pharyngitis may lead to local and
distant complications.
Pathophysiology
Beta-hemolytic streptococci have the ability to cause large zones of hemolysis on blood
agar, aiding in microbiological identification. Lancefield antigens, carbohydrates in the cell wall,
provide further differentiation of streptococci. Streptoccocus pyogenes, which contains group A
antigens and displays beta-hemolysis, is the most common species referred to as a group A beta-
hemolytic streptococci (GABHS).
Perhaps the most important virulence factor of GABHS is the M protein. This protein,
located peripherally on the cell wall, is required for invasive infection. T cells exposed to this M
protein are postulated to cross-react with similar epitopes on human cardiac myosin and laminin,
contributing to the pathogenesis of rheumatic heart disease. This protein provides a potential
target for a GABHS vaccine, although successful widespread implementation of such a vaccine
remains elusive. More than 100 M-protein serotypes have been described. Although individuals
often develop lifelong immunity to one serotype, re-infection with a different serotype may cause
disease (Kumar et al., 2007).
GABHS contains a hyaluronic acid capsule, which also plays an important role in
infection. Bacteria that produce large quantities of this capsule exhibit a characteristic mucoid
appearance on blood agar and may be more virulent.
41
Certain GABHS exotoxins act as superantigens by up-regulating T cells
(Abbas et al., 2004). These superantigens can prompt a release of proinflammatory cytokines
and may synergize with lipopolysaccharide. It has been speculated that these superantigens
evade the pharyngeal immune response, resulting in proliferation of GABHS while permitting
immune-mediated elimination of commensal organisms.
Adhesins enable GABHS attachment at sites such as the pharynx. This attachment
allows for colonization and competition with normal host flora.
Some strains produce erythrogenic toxins, which cause the rash of scarlet fever in
susceptible hosts. GABHS is spread from person to person through large droplet
nuclei. Consequently, close quarters (e.g., barracks, daycares, and dormitories) facilitate
transmission. In temperate regions, the prevalence of GABHS infection increases in the colder
months, presumably because of the tendency of people to congregate indoors. Spread within
families is common. The risk of acquiring GABHS from an infected family member is 40%, and
nearly one in four of infected individuals eventually exhibit symptoms. Twenty-four hours after
appropriate antibiotics are initiated, the patient is no longer considered contagious.
GABHS is also a common cause of erysipelas, cellulitis, and necrotizing fasciitis and has
been reported as a cause of pneumonia, toxic shock syndrome, and lymphangitis. The vast
majority of these manifestations do not occur in the setting of pharyngitis.
Frequency
United States
Acute pharyngitis accounts for approximately 12 million annual ambulatory care visits in
the United States. It ranks within the top 20 most-common primary diagnosis groups.
International
An estimated 616 million cases of GABHS pharyngitis occur annually worldwide. Rheumatic heart disease, which may be a consequence of GABHS pharyngitis, is estimated to
cause about 6 million years of life lost annually. The burden of rheumatic heart disease
42
disproportionately affects populations from developing countries. In terms of estimated global
mortality, GABHS is one of the top 10 pathogens, behind HIV infection and malaria and ahead
of tetanus and pertussis.
Mortality/Morbidity
Although GABHS pharyngitis is usually a self-limited entity, on average, a single
episode in a child results in 1.9 days absence from school and a parent missing 1.8 days from
work to care for the child. Children with GABHS pharyngitis experience symptoms for an
average of 4.5 days.
In addition to symptoms localized to the oropharynx, GABHS pharyngitis may also cause the
following suppurative and nonsuppurative complications:
• Invasion of nearby structures may cause suppurative complications such as otitis
media, sinusitis,peritonsillar abscess, retropharyngeal abscess, and cervical adenitis.
• Nonsuppurative complications of bacterial pharyngitis include rheumatic heart disease
andpoststreptococcal glomerulonephritis. These entities are discussed in Complications.
Race
GABHS pharyngitis affects all races.
Sex
GABHS pharyngitis has no sexual predilection.
Age
GABHS pharyngitis is most common in individuals aged 5-15 years, although both
infants and adults may also acquire the disease.
Clinical
The signs and symptoms listed below may be seen with many non-GABHS etiologies.
Furthermore, individuals with GABHS pharyngitis may have only a few or mild features listed.
Conjunctivitis, cough, hoarseness, coryza, diarrhea, anterior stomatitis, discrete ulcerative
lesions, and a viral exanthem are all more consistent with an etiology other than GABHS.
• Sore throat, usually with sudden onset
• Odynophagia
• Headache43
• Nausea, vomiting, and abdominal pain
Physical
• Fever
• Tonsillopharyngeal erythema
• Exudates (patchy and discrete)
• Beefy red swollen uvula
• Lymphadenopathy (tender anterior cervical nodes)
• Petechiae on the palate
• Scarlatiniform rash (In susceptible hosts, this usually manifests within the first two days
of symptoms and causes a finely papular, blanching, and erythematous rash. The neck is
often first affected and then spreads along the trunk and limbs. Resolution, often at 3-4
days, occurs in roughly the same order of appearance and often results in desquamation
of the involved areas.)
Predictive models can help determine the likelihood of GABHS pharyngitis based on the
presence of fever, swollen tender anterior cervical lymph nodes, and tonsillar exudates and the
absence of cough. Scores have been used to distinguish which patients merit further laboratory
evaluation or treatment. The use of such clinical algorithms has been the source of much debate.
Causes
• GABHS accounts for 15%-30% of pharyngitis cases in children and 5%-10% of cases in
adults (Bisno, 2001).
• The following are bacteria other than GABHS that may cause pharyngitis:
Group C and G streptococci: Like GABHS, these pathogenic bacteria cause beta-
hemolysis, form large colonies, and produce an M protein, yet neither are detected
with rapid antigen detection tests (RADTs). Pharyngitis caused by either of these
non-GABHS streptococci have a clinical presentation similar to that of GABHS
pharyngitis and should be considered in patients with worsening symptoms and an
initial negative RADT result. Diagnosis can be achieved with a normal bacterial
throat culture and identification based on Lancefield antigens. These bacteria are
an uncommon cause of acute pharyngitis in pediatric patients.
44
II. Impetigo
Impetigo is an acute, contagious, superficial pyogenic skin infection that occurs most
commonly in children, especially those who live in hot humid climates. Clinically, physicians
recognize two separate forms of impetigo: bullous and nonbullous. Bullous impetigo is caused
almost exclusively by Staphylococcus aureus, whereas nonbullous impetigo is caused
by Staphyloccocus aureus, group A Streptococcus (Streptococcus pyogenes), or a combination of
both. The bacterial toxins cause proteolysis of epidermal and sub-epidermal layers, allowing the
bacteria to spread quickly along the skin layers, thereby causing blisters or purulent lesions.
Pathophysiology
Impetigo most often develops at a site of minor trauma or insult in which the integrity of
the skin is disrupted. Causative organisms enter the epidermis. Alternatively, scratching may
directly inoculate bacteria beneath the skin surface, causing impetiginization.
The sequence of spread of the two causative organisms differs. Streptoccocus pyogenes is
spread from a person who is infected or colonized with the bacteria onto the skin of another
individual, where it may cause impetigo. The organism then colonizes the nose and
throat. Staphylococcus aureus, in contrast, spreads first to the nose. It then spreads to the skin,
where it may cause impetigo.
Race
Impetigo can affect people of all races.
Sex
In adults, impetigo is more common in men.
Age
Non-bullous impetigo can affect all ages, but it most commonly affects children aged 2-5
years.
Bullous impetigo affects all ages, but, historically, it occurs more often in newborns and
older infants.
Clinical 45
• Patients with impetigo may report a history of minor trauma, insect bites, scabies, herpes
simplex, varicella, or eczema at the site of infection, and any history of preexisting skin
disease should raise the clinician's index of suspicion.
Physical
Nonbullous impetigo Bullous impetigo
Lesions first begin as thin-walled vesicles or
pustules on an erythematous base. The
lesions promptly rupture, releasing their
serum, which dries and forms a light brown,
honey-colored crust.
Multiple lesions generally occur at the same
site, often coalescing. The affected area of
skin may enlarge as the infection spreads
peripherally.
Skin on any part of the body can be involved,
but the face and extremities are affected most
commonly.
Pruritus of infected areas may result in
excoriations due to scratching.
As the lesions resolve, either spontaneously
or after antibiotic treatment, the crusts slough
from the affected areas and heal without
scarring.
If the course of disease is prolonged and
patients do not seek treatment, as many as
90% will develop regional lymphadenopathy.
Caused by both Staphyloccocus aureus and
Streptoccocus pyogenes.
Lesions may form on grossly normal or
previously traumatized skin.
The vesicles do not rupture as easily or
quickly as in nonbullous lesions, but they do
enlarge into bullae that are usually 1-2 cm in
diameter. The bullae initially contain a clear
yellow fluid that subsequently turns cloudy
and dark yellow.
After 1-3 days, the lesions rupture and leave a
thin, light brown, varnish like crust.
Central healing results in circinate lesions.
In contrast to nonbullous impetigo, bullous
impetigo may involve the buccal mucous
membranes, but regional lymphadenopathy is
rare.
Caused by Staphyloccocus aureus.
46
Table 2.2 Forms of impetigo disease.
III. Cellulitis
Cellulitis refers to an inflammatory process caused by bacterial infection of the dermis
and underlying subcutaneous tissues of the skin. A local and systemic host immune response
leads to signs of inflammation in the affected tissue.
Pathophysiology
The human integument provides a very effective barrier against environmental pathogens.
Squamous epithelial cells, with their tight intercellular bonds, are the first line of defense against
the outside environment. When this barrier is breached owing to trauma or underlying
dermatitis, bacteria are able to penetrate to the deeper dermis, where infection occurs. Bacteria
commonly found on the skin are most often the cause of cellulitis, although bacteria from the
environment may also cause disease.
Frequency
United States
Recent evidence suggests that the incidence of cellulitis is increasing in the United States.
Outpatient visits for cellulitis increased from 32 to 48 per 1000 population from 1997 to
2005 (Ludlam et al., 1986).
Mortality/Morbidity
The vast majority of cellulitis and soft-tissue infections can be treated on an outpatient
basis with oral antibiotics and do not result in lasting sequelae. However, just as the incidence of
cellulitis is increasing, so is the severity. Although the exact reason for this is unknown, certain
host and pathogen factors play a role in increasing the risk of severe infection.
Perhaps the most important contribution to the increasing severity of cellulitis is the emergence
of community-acquired methicillin-resistant Staphylococcus aureus (CA-MRSA), specifically
the USA 300 clone, as a leading pathogen in cellulitis and soft-tissue infections associated with
47
purulence (Cunha et al., 2005). Infections caused by CA-MRSA tend to be more severe and are
resistant to many of the antibiotics commonly used to treat cellulitis.
Certain strains of bacteria, most notably group A beta-hemolytic Streptococcus (GABHS)
and Staphyloccocus aureus, produce toxins. These toxins may mediate a more severe systemic
infection, leading to septic shock and death (Dajani et al., 1972; Dajani et al., 1973).
Certain host factors predispose to severe infection. Individuals with comorbid conditions
such as diabetes mellitus, immunodeficiency, cancer, venous stasis, chronic liver disease,
peripheral arterial disease, and chronic kidney disease appear to be at a higher risk for both
recurrent and more severe infection owing to an altered host immune response. Concurrent
intravenous or subcutaneous “skin popping” drug use also predisposes to cellulitis. Infections in
this setting are most often polymicrobial, but CA-MRSA is also a common pathogen.
Race
Cellulitis has no predilection for any race or ethnic group.
Sex
Cellulitis has no predilection for either sex.
Age
• In general, no specific age group is at a higher risk for cellulitis but more common in
adults older than 50 years. Perianal cellulitis, usually with GABHS, occurs in children
younger than 3 years.
• Group B Streptococcus cellulitis occurs in infants younger than 6 months.
• Elderly patients with cellulitis are predisposed to thrombophlebitis.
Clinical
Cellulitis develops several days after the inciting trauma; this intervening period often
means that the patient does not recollect any trauma, which is often minor, at the time of
presentation. Rapid progression is concerning sign of a more severe infection, such
as necrotizing fasciitis, and should be managed promptly.
48
Physical
The physical examination should first focus on the area of concern. Most skin and soft-tissue
infections have the four cardinal signs of infection: erythema, pain, swelling, and warmth.
Several physical examination findings may help the clinician to identify the most likely pathogen
and to assess the severity of the infection, facilitating appropriate treatment.
• Skin infection without underlying drainage, penetrating trauma, eschar, or abscess is most
likely caused by streptococci. On the other hand, Staphylococcus aureus, often CA-
MRSA, is the most likely pathogen when these factors are present (Elias et al., 1976).
• Lymphangitic spread (red lines streaking away from the area of infection), crepitus, and
hemodynamic instability are indications of severe infection, requiring more aggressive
treatment.
• Circumferential cellulitis or pain that is disproportional to examination findings should
prompt consideration of more severe soft-tissue infection.
Causes
The most common cause of cellulitis is infection with gram-positive cocci, specifically
GABHS and Staphylococcus aureus, whether it is MRSA or methicillin-
sensitive Staphylococcus aureus (MSSA).
IV. Necrotizing Fasciitis
Necrotizing fasciitis (NF) is an insidiously advancing soft tissue infection characterized
by widespread fascial necrosis. A number of bacteria in isolation or as a polymicrobial infection
can cause necrotizing fasciitis (Kihiczak et al., 2006). The organisms most closely linked to
necrotizing fasciitis are in group A beta-hemolytic streptococci, although the disease may also be
caused by other bacteria or different streptococcal serotypes.
A few distinct necrotizing fasciitis syndromes should be recognized. The 3 most
important are type I (saltwater containing a Vibrio species), or polymicrobial; type II or group A
streptococcal; and type III gas gangrene, or clostridial myonecrosis.
Pathophysiology
Organisms spread from the subcutaneous tissue along the superficial and deep fascial
planes, presumably facilitated by bacterial enzymes and toxins. This deep infection causes
49
vascular occlusion, ischemia, and tissue necrosis. Superficial nerves are damaged, producing the
characteristic localized anesthesia. Septicemia ensues with systemic toxicity.
Important bacterial factors include surface protein expression and toxin production. M-1
and M-3 surface proteins, which increase the adherence of the streptococci to the tissues, also
protect the bacteria against phagocytosis by neutrophils.
Streptococcal pyrogenic exotoxins (SPEs) A, B, and C are directly toxic and tend to be
produced by strains causing necrotizing fasciitis. These pyrogenic exotoxins, together with
streptococcal superantigen (SSA), lead to the release of cytokines and produce clinical signs such
as hypotension. The etiological agent may also be a Staphylococcus aureus isolate harboring the
enterotoxin gene cluster seg, sei, sem, sen, and seo but lacking all common toxin genes,
including Panton-Valentine leukocidin (Morgan et al., 2007).
Single-nucleotide changes are the most common cause of natural genetic variation among
members of the same species.
They may alter bacterial virulence; a single-nucleotide mutation in the group
A Streptococcus genome was identified that is epidemiologically associated with decreased
human necrotizing faciitis (Olsen et al., 2010).
Mortality/Morbidity
The mortality rate for necrotizing fasciitis can be as high as 25%. Cases of necrotizing fasciitis
with sepsis and renal failure have a mortality rate as high as 70%.
Age
Approximately half of the cases of streptococcal necrotizing fasciitis occur in young and
previously healthy people.
Clinical
Necrotizing fasciitis tends to begin with constitutional symptoms of fever and chills.
After 2-3 days, erythema is noted, and supralesional vesiculation or bullae formation ensues.
Sero-sanguineous fluid may drain from the affected area. Necrotizing fasciitis may develop
after skin biopsy; at needle puncture sites in those use illicit drugs; and after episodes of
frostbite, chronic venous leg ulcers, open bone fractures, insect bites, surgical wounds, and skin
abscesses. However, in many cases, no association with such factors can be made. Necrotizing
50
fasciitis may also occur in the setting of diabetes mellitus, surgery, trauma, or infectious
processes.
Causes
Group A beta-hemolytic streptococci is not the only cause of necrotizing
fasciitis. Haemophilus aphrophilus and Staphyloccocus aureus are also associated with the
condition, and some patients have mixed infections involving multiple species of bacteria,
including mycobacterium, or fungi (Tang et al., 2000; Sendi et al., 2009).
V. Scarlet FeverScarlet fever is an infection caused by toxin-producing group A beta hemolytic
streptococci (GABHS) found in secretions and discharge from the nose, ears, throat, and skin.
Scarlet fever may follow streptococcal wound infections or burns, as well as upper respiratory
tract infections, but food-borne outbreaks have been reported (Dong et al., 2008 ;
Yang et al., 2007).
Pathophysiology
As the name scarlet fever implies, an erythematous eruption is associated with a febrile
illness.
The circulating toxin, often referred to as erythemogenic toxin, causes the rash as a consequence
of local production of inflammatory mediators and alteration of the cutaneous cytokine milieu.
This results in a sparse inflammatory response and dilatation of blood vessels, leading to the
characteristic scarlet color of the rash (Cunningham et al., 2000).
Mortality/Morbidity
Historically, scarlet fever resulted in death in 15-20% of those affected. Since the advent
of antibiotic therapy, the mortality rate for scarlet fever is less than 1%. Although uncommon,
case reports describe patients, including adults, who are severely affected (Sandrini et al., 2009).
Morbidity and mortality associated with scarlet fever is usually minimal. Known complications,
such as septicemia, vasculitis, hepatitis, or rheumatic fever, should be considered on a case-by-
case basis as determined by the presence of clinical history and examination findings suggestive
of those diseases (Gomez-Carrasco et al., 2004; Guven et al., 2002). Localized soft tissue
51
infections may suggest the presence of underlying osteomyelitis, but scarlet fever may occur
from cellulitis alone (Lau et al., 2004). When scarlet fever has been determined to be due to a
soft tissue infection over or near bone, evaluation for bony involvement should be considered.
Race
No racial or ethnic predilection is reported for group A streptococcal infection.
Age
The infection usually occurs in children, with the peak age incidence from 1–10 years.
However, it can occur in older children and adults. As depicted from a case study that antecedent
streptococcal infection can increase the likelihood of children developing certain
neuropsychiatric disorder including Tourette syndrome, attention- deficit/hyperactivity disorder,
and major depressive disorder (Leslie et al., 2008).
Clinical
The cutaneous eruption of scarlet fever accompanies a streptococcal infection at another
anatomic site, usually the tonsillopharynx. Abrupt onset of fever, headache, vomiting, malaise,
chills, and sore throat occurs. Rash appears 1-4 days after the onset.
Physical
The mucous membranes usually are bright red, and scattered petechiae and small red
papular lesions on the soft palate are often present.
Causes
The overwhelming majority of cases of scarlet fever are caused by beta hemolytic
Lancefield group A streptococcus (GABHS). Differential diagnosis includes other causes of
fever accompanied by erythematous eruptions. Other bacteria that cause pharyngitis and similar
rash include: Staphylococcus aureus, Haemophilus influenza, Arcanobacterium haemolyticum
and Clostridium species (Gaston et al., 2007). Recurrent cases of scarlet fever have been
reported from reinfection with strains unrelated to Streptococcus pyogenes (Sanz et al., 2005).
VI. Otitis media and sinusitis52
The American Academy of Pediatrics (AAP) and the American Academy of Family
Physicians (AAFP) define acute otitis media as an infection of the middle ear with acute onset,
presence of middle ear effusion (MEE), and signs of middle ear inflammation. Acute otitis
media most commonly occurs in children and is the most frequent specific diagnosis in children
who are febrile. Clinicians often over diagnose acute otitis media. They are caused by spread of
organisms via the eustachian tube (otitis media) and direct spread to sinuses (sinusitis).
Distinguishing between acute otitis media (AOM) and otitis media with effusion (OME)
is important. Otitis media with effusion is more common than acute otitis media. When otitis
media with effusion is mistaken for acute otitis media, antibiotics may be prescribed
unnecessarily. Otitis media with effusion is fluid in the middle ear without signs or symptoms of
infection.
Otitis media with effusion is usually caused when the eustachian tube is blocked and fluid
becomes trapped in the middle ear. Signs and symptoms of acute otitis media occur when fluid in
the middle ear becomes infected.
Recurrent acute otitis media is defined as 3 episodes within 6 months or 4 or more
episodes within 1 year.
Pathophysiology
Acute otitis media usually arises as a complication of a preceding viral upper respiratory
infection (URI). The secretions and inflammation cause a relative obstruction of the eustachian
tubes. Normally, the middle ear mucosa absorbs air in the middle ear. If this air is not replaced
because of obstruction of the eustachian tube, a negative pressure is generated, which pulls
interstitial fluid into the tube and creates a serious effusion. This effusion of the middle ear
provides a fertile media for microbial growth. If growth is rapid, a middle ear infection develops.
Frequency
United States
Acute otitis media is the most frequent diagnosis made by pediatricians, second only to
the common cold. Two thirds of all American children have had at least one episode of
AOM prior to 1 year of age, and 80% have had one by 3 years of age (Teele et al., 1989).
Despite advances in public health and medical care, middle ear infections are still
prevalent around the world, and the incidence in the United States has actually increased
53
over the past 10-20 years. AOM is the most common indication for antimicrobial therapy
in children in the United States (American Academy of Pediatrics 2004;
McCaig et al., 2002).
In 2006, 9 million children aged 0-17 years were reported to have an ear infection or
AOM of those, 8 million children reported visiting a physician or obtaining a
prescription drug to treat the condition. As such, the diagnosis and management of AOM
has a significant impact on the health of children, the direct cost of health care, and the
overall use of antibacterial agents (Soni et al., 2008).
Mortality/Morbidity
• Mortality is rare in countries where treatment of complications is available, and it is not
frequent in countries where treatment is not available.
• Morbidity may be significant for infants in whom persistent middle ear effusion (MEE)
develops. Chronic MEE may lead to hearing deficits and speech delay.
• After an episode of acute otitis media (AOM), as many as 45% of children have
persistent effusion at 1 month, but this number decreases to 10% after 3 months.
• Most spontaneous perforations eventually heal, but some persist. Cholesteatoma
formation with destruction of the ossicles is a serious but infrequent complication.
• AOM is not considered a major source of bacteremia or meningeal seeding, but
local brain abscess and mastoiditis are potential sequelae, demonstrating that it is
possible for AOM to extend.
Race
Otitis media is more frequent in certain racial groups (e.g., Inuit and American Indians);
this is likely due to anatomic differences in the eustachian tube.
Sex
Boys are affected more commonly than girls, but no specific causative factors have been
found. Male sex is a minor determinant of infection.
54
Age
Ear infections occur in all age groups, but they are considerably more common in
children, particularly those between ages 6 months to 3 years than in adults. This age
distribution is presumably due to immunologic factors (e.g., lack of pneumococcal antibodies)
and anatomic factors (e.g., a low angle of the eustachian tube with relation to the nasopharynx).
Children with significant predisposing factors (e.g., cleft palate, Down syndrome) acquire
infections so frequently that some authors advocate the routine placement of polyethylene tubes
in their tympanic membranes to maintain aeration of the middle ear.
Clinical
Patients who can communicate usually describe feelings of pain or discomfort in the affected
ear. However, most cases occur in children who are unable to communicate specific complaints.
History alone is a poor predictor of acute otitis media, especially in young children.
Observations include:
• Accompanying or precedent upper respiratory infection (URI) symptoms (very common)
• Earache/fullness
• Decreased hearing
• Fever (not required for the diagnosis)
• Otorrhea
• Infants may be asymptomatic or irritable.
• Infants may present with pulling/tugging of the ear.
Physical
If the ear canal is clean and if the patient is cooperative, physical examination is generally
easy. If the ear canal is occluded with cerumen or debris, if the canal is anatomically small, or if
the patient is unable to cooperate, examination may be difficult.
2.8.2 Non–suppurative Complications
a) Streptococcal toxic shock syndrome (STSS)
55
STSS is a severe systemic immune response mediated by superantigens. Toxic shock
syndrome (TSS) is a toxin-mediated acute life-threatening illness, usually precipitated by
infection with either Staphylococcus aureus or group A Streptococcus (GAS). It is
characterized by high fever, rash, hypotension, multi-organ failure (involving at least 3 or more
organ systems), and desquamation, typically of the palms and soles, 1-2 weeks after the onset of
acute illness.
The clinical syndrome can also include severe myalgia, vomiting, diarrhea, headache, and non
focal neurologic abnormalities. TSS was first described in children in 1978 (Odd et al., 1980). Subsequent reports identified an association with tampon use by menstruating women
(Shands et al., 1989; Davis et al., 1980; Ellies et al., 2009). Menstrual TSS is more likely in
women using highly absorbent tampons, using tampons for more days of their cycle, and keeping
a single tampon in place for a longer period of time. Over the past two decades, the number of
cases of menstrual TSS (1 case per 100,000) has steadily declined; this is thought to be due to the
withdrawal of highly absorbent tampons from the market.
An increasing number of severe GAS infections associated with shock and organ failure have
been reported. These infections are termed streptococcal TSS (Lappin et al., 2009).
Pathophysiology
Toxic shock syndrome (TSS) is caused from intoxication by one of several
related Staphylococcus aureus exotoxins. The most commonly implicated toxins include TSS
toxin type-1 (TSST-1) and Staphylococcal enterotoxin B.
Almost all cases of menstrual TSS and half of all the non-menstrual cases are caused by
TSST-1. Staphylococcal enterotoxin B is the second leading cause of TSS. Other exotoxins such
as enterotoxins A, C, D, E, and H contribute to a small number of cases. Seventy to 80% of
individuals develop antibody to TSST-1 by adolescence, and 90-95% have such antibody by
adulthood. Apart from host immunity status, host-pathogen interaction, local factors (pH,
glucose level, magnesium level), and age all have a direct impact on the clinical expression of
this toxin-mediated illness.
M protein is an important virulent determinant of GAS; strains lacking M protein are less
virulent. M protein is a filamentous protein anchored to the cell membrane, which has
56
antiphagocyte properties. M types 1, 3, 12, and 28 are the most common isolates found in
patients with shock and multi-organ failure; furthermore, 3 distinct streptococcal pyrogenic
exotoxins (i.e., A, B, C) also have been identified. These toxins induce cytotoxicity and
pyrogenicity and enhance the lethal effects of endotoxins.
Recently, the streptococcal super antigen, a pyrogenic exotoxin, has been isolated from an M-3
strain. In some studies, strains producing exotoxins B and C have been implicated in this
syndrome, to a lesser extent.
Mechanism of shock and tissue destruction
Colonization or infection with certain strains of Staphyloccocus aureus and GAS is
followed by the production of one or more toxins. These toxins are absorbed systemically and
produce the systemic manifestations of TSS in people who lack a protective antitoxin antibody.
Possible mediators of the effects of the toxins are cytokines, such as interleukin 1 (IL-1) and
tumor necrosis factor (TNF). Pyrogenic exotoxins induce human mononuclear cells to
synthesize TNF-alpha, IL-1-beta, and interleukin 6 (IL-6).
TSS likely relates to the ability of pyrogenic exotoxins of GAS and enterotoxins of
Staphyloccocus aureus to act as superantigens. Superantigens are molecules that interact with
the T-cell receptor in a domain outside of the antigen recognition site and hence are able to
activate large numbers of T cells resulting in massive cytokine production. Normally, an antigen
has to be taken up, processed by an antigen-presenting cell and expressed at the cell-surface
along with class II major histo-compatibility complex (MHC). By contrast, superantigens do not
require processing by antigen-presenting cells but instead interact directly with the class II MHC
molecule. The superantigen-MHC complex then interacts with the T-cell receptor and stimulates
large numbers of T-cells to cause an exaggerated, dysregulated cytokine response.
In the case of TSS, the implicated exotoxins and several staphylococcal toxins (e.g.,
TSST-1) can stimulate T-cell responses through their ability to bind to both the class II major
histocompatibility complex (MHC) of antigen-presenting cells (APC) and T-cell receptors. These
toxins simultaneously bind to the beta chain variable region (V-beta) elements on T-cell receptors
and the class II major histo-compatibility antigen-processing cells. This mechanism bypasses the
57
classical antigen-processing procedures and results in excessive T-cell proliferation.
The conventional antigens activate only about 0.01% to 0.1% of the T-cell population, whereas,
the superantigens set in motion 5-30% of the entire T-cell population.
The net effect is massive production of cytokines that are capable of mediating shock and tissue
injury. As part of this T cell response, interferon–gamma is also produced, which subsequently
inhibits polyclonal immunoglobulin production. This failure to develop antibodies may explain
why some patients are predisposed to relapse after a first episode of TSS.
Frequency
United States
Estimates from population-based studies have documented an incidence of invasive GAS
infection of 1.5–5.2 cases per 100,000 people annually (Lappin et al., 2009).
Approximately 8-14% of these patients also will develop TSS (Davies et al.,
1996). A history of recent varicella infection markedly increases the risk of infection
with GAS to 62.7 cases per 100,000 people per year. Severe soft tissue infections,
including necrotizing fasciitis, myositis, or cellulitis, were present in approximately half
of the patients.
STSS is much more common, although data on prevalence do not exist. In the United States,
from 1979-1996, 5296 cases of STSS were reported. The number of cases of menstrual STSS is
estimated at 1 per 100,000. The incidence of non-menstrual STSS now exceeds menstrual STSS
after the hyper-absorbable tampons were removed from the market.
Mortality/Morbidity
Mortality rates for streptococcal TSS are 30-70%. Morbidity also is high; in one series,
13 of 20 patients underwent major surgical procedures, such as vasectomy, surgical
debridement, laparotomy, amputation, or hysterectomy (Eriksson et al., 1998; Stevens et
al., 1992).
The case fatality rates for menstrual-related STSS have declined from 5.5% in 1980 to 1.8% in
1996.
Race
58
TSS has occurred in all races, although most cases have been reported from North
America and Europe.
Sex
STSS most commonly occurs in women, usually those who are using tampons.
Age
STSS have no predilection for any particular age for either the streptococcal TSS or
STSS. However, studies have reported STSS to be more common in older individuals with
underlying medical problems. In a Canadian survey, STSS accounted for 6% of cases in
individuals younger than 10 years compared with 21% in people older than 60 years.
Furthermore, menstruation-associated STSS occurred in younger women who were using
tampons.
Clinical
Although the clinical manifestations of TSS can be diverse, the possibility of toxic shock
should be considered in any individual who presents with sudden onset of fever, rash,
hypotension, renal or respiratory failure, and changes in mental status (Demers et al., 1993).
Common presenting symptoms and frequency of STTS are as follows: pain (44-85%),
vomiting (25-26%), nausea (20%), diarrhea (14-30%), and influenza like symptoms (14-20%),
headache (10%) and dyspnea (8%).
The following risk factors have been reported to be associated with STSS:
o Patients with HIV, diabetes, cancer, ethanol abuse, and other chronic diseases
o Patients with a recent history of varicella infection (chicken pox)
o Patients who used nonsteroidal anti-inflammatory drugs (NSAIDs)
Physical
• Fever is the most common presenting sign, although patients in shock may present with
hypothermia. Shock is apparent at the time of hospitalization or within 4-8 hours for all
patients. Patients become severely hypotensive and do not respond to intravenous fluid
administration.
59
Renal dysfunction progresses or persists in all patients, precedes shock in many patients,
and is apparent early. Acute respiratory distress syndrome occurs in 55% of patients and
requires mechanical ventilation.
• Confusion is present in 55% of patients, and coma or agitation may occur. Alteration in
mental status disproportionate to the degree of hypotension can occur with or without
seizures. Persistent neuropsychiatric sequelae manifested by memory loss, and poor
concentration have been reported.
• Common presenting symptoms and frequency of STTS are as follows: tachycardia
(80%), fever (70-81%), hypotension (44-65%), confusion (55%), localized erythema
(44-65%), localized swelling and erythema (30-75%) and scarlatini form rash (0-4%).
Causes
Risk factors for the development of STSS are tampon use, vaginal colonization with toxin-
producing Staphylococcus aureus, and lack of serum antibody to the staphylococcal toxin
(Matsuda et al., 2008). STSS also has occurred following use of nasal tampons for procedures of
the ears, nose, and throat.
b) Acute Rheumatic Fever
The incidence of acute rheumatic fever (ARF) has declined in most developed countries, and
many physicians have little or no practical experience with the diagnosis and management of this
condition. Occasional outbreaks in the United States make complacency a threat to public health.
Diagnosis rests on a combination of clinical manifestations that can develop in relation to
group A streptococcal pharyngitis. These include chorea, carditis, subcutaneous nodules,
erythema marginatum, and migratory polyarthritis. Because the inciting infection is completely
treatable, attention has been refocused on prevention.
Pathophysiology
The earliest and most common feature is a painful migratory arthritis, which is present in
approximately 80% of patients. Large joints such as knees, ankles, elbows, or shoulders are
typically affected. Sydenham chorea was once a common late-onset clinical manifestation but is
60
now rare. Carditis (with progressive congestive heart failure, a new murmur, or pericarditis) may
be the presenting sign of unrecognized past episodes and is the most lethal manifestation.
Genetics may contribute, as evidenced by an increase in family incidence. No significant
association with class-I human leukocyte antigens (HLAs) has been found, but an increase in
class-II HLA antigens DR2 and DR4 has been found in black and white patients, respectively.
Evidence suggests that elevated immune-complex levels in blood samples from patients with
ARF are associated with HLA-B5 (Yoshinoya et al., 1980).
Frequency
United States
The incidence of an acute rheumatic episode following streptococcal pharyngitis is
0.5–3%. The peak age is 6-20 years. Although the incidence of ARF has steadily
declined, the mortality rate has declined even more steeply. Credit can be attributed to
improved sanitation and antibiotic therapy. Several sporadic outbreaks in the United
States could not be blamed directly on poor living conditions. New virulent strains are
the best explanation.
International
Most major outbreaks occur under conditions of impoverished overcrowding where
access to antibiotics is limited. Rheumatic heart disease accounts for 25–50% of all cardiac
admissions internationally. Regions of major public health concern include the Middle East, the
Indian subcontinent, and some areas of Africa and South America. As many as 20 million new
cases occur each year. The introduction of antibiotics has been associated with a rapid
worldwide decline in the incidence of ARF. The incidence continues to be 13.4 patients per
100,000 hospitalized children per year (Chun et al., 1987).
Mortality/Morbidity
• Mortality rates are steadily improving because of better sanitation and health care.
• The current pattern of morbidity is difficult to measure because the first attack of
rheumatic fever follows an unpredictable course. As many as 90% of episodes are
clinically contained within 3 months.
61
• Carditis causes the most severe clinical manifestation because heart valves can be
permanently damaged. The disorder also can involve the pericardium, myocardium, and
the free borders of valve cusps. Death or total disability may occur years after the initial
presentation of carditis.
Race
An association between certain class-II HLA antigens (DR2 in blacks and DR4 in whites)
and ARF has been reported.
Sex
No general clear-cut sex predilection for the syndrome has been reported, but its
manifestations seem to be sex variable. For example, certain clinical manifestations (i.e., chorea
and tight mitral stenosis) are predominant in women, while men are more likely to develop aortic
stenosis.
Age
• The initial attack of ARF occurs most frequently in persons aged 6-20 years and rarely
occurs in persons older than 30 years.
• The disease may cluster in families.
• In some countries, a shift into older groups may be a trend.
Clinical
Diagnosis is challenging for several reasons, as follows:
o Approximately 70% of older children and young adults recollect pharyngitis.
However, only approximately 20% of young children recollect pharyngitis.
Therefore, younger children who present with signs or symptoms consistent with
acute rheumatic fever (ARF) merit a higher index of suspicion.
o The rate of isolation of group A streptococci from the oropharynx is extremely
low in all populations.
o Usually, a latent period of approximately 18 days occurs between the onset of
streptococcal pharyngitis and ARF. This latent period is rarely shorter than 1 week
or longer than 5 weeks.
62
o Typically, the first manifestation is a very painful migratory polyarthritis. Often,
associated fever and constitutional toxicity develop.
o Acute attacks usually resolve within 12 weeks.
o Guidelines for diagnosis published more than 50 years ago by T. Duckett Jones
has been slightly revised by the American Heart Association (AHA)
(Jones, 1944). Prior history of a preceding group A streptococcal infection is
helpful but not required (Digenea et al., 1993). In addition, 2 major
manifestations or 1 major and 2 minor manifestations must be present.
o Major manifestations include carditis, polyarthritis, chorea, erythema marginatum,
and subcutaneous nodules.
o Minor manifestations include arthralgias and fever. Laboratory findings include
elevated levels of acute-phase reactants (erythrocyte sedimentation rate [ESR] and
C-reactive protein) and a prolonged PR interval. A prolonged PR interval is not
specific and has not been associated with later cardiac sequelae. The utility of
echocardiography is also controversial.
o The Jones criteria should be viewed as a guide to determine who is at high risk but
cannot be used to define diagnosis with absolute certainty.
o An exception includes chorea, which can present as the sole manifestation of
ARF, in spite of negative laboratory results.
o Another possible exception is indolent carditis.
o A throat culture with results positive for Streptococcus is found in approximately
25% of patients at the time of presentation.
Physical
Suspicious signs for carditis include new or changing valvular murmurs, cardiomegaly,
congestive heart failure, and/or pericarditis. When present, Sydenham chorea is seldom evident
at the time of initial presentation.
Causes
63
• Although the mechanism by which streptococcal organisms cause disease is not entirely
clear, overwhelming epidemiologic evidence suggests that ARF is caused by
streptococcal infection, and recurrences can be prevented with prophylaxis.
• Strains of group A streptococci that are heavily encapsulated and rich in M protein
(signifying virulence in streptococcal strains) seem to be most likely to result in infection.
• Group A Streptococcus is thought to cause the myriad of clinical diseases in which the
host's immunologic response to bacterial antigens cross-react with various target organs
in the body, resulting in molecular mimicry. In fact, auto–antibodies reactive against the
heart have been found in patients with rheumatic carditis. The antibody can cross-react
with brain and cardiac antigens, and immune complexes are present in the serum. The
problem has been the uncertainty of whether these antibodies are the cause or result of
myocardial tissue injury.
c) Acute Glomerulonephritis
Acute glomerulonephritis (AGN) was initially described by Bright in 1927. Acute post-
streptococcal glomerulonephritis (PSGN) is the archetype of acute GN. Acute nephritic
syndrome is the most serious and potentially devastating form of various renal syndromes.
Acute GN is characterized by the abrupt onset of hematuria and proteinuria, often accompanied
by azotemia (i.e., decreased glomerular filtration rate [GFR]) and renal salt and water retention.
Pathophysiology
Acute GN has 2 components: structural changes and functional changes.
Structural changes
• Cellular proliferation: This leads to an increase in the number of cells in the glomerular
tuft because of the proliferation of endothelial, mesangial, (Jones, 1944) and epithelial
cells. The proliferation could be endocapillary (i.e., within the confines of the glomerular
capillary tufts) or extracapillary (i.e., in the Bowman space involving the epithelial cells).
64
In extracapillary proliferation, proliferation of parietal epithelial cells leads to the
formation of crescents, a feature characteristic of certain forms of rapidly progressive
glomerulonephritis.
• Leukocyte proliferation: This is indicated by the presence of neutrophils and monocytes
within the glomerular capillary lumen and often accompanies cellular proliferation.
• Glomerular basement membrane thickening: This development appears as thickening of
capillary walls using light microscopy. Using electron microscopy, this may appear as
the result of thickening of basement membrane proper (e.g., diabetes) or deposition of
electron-dense material, either on the endothelial or epithelial side of the basement
membrane.
• Hyalinization or sclerosis: These conditions indicate irreversible injury.
• Electron-dense deposits: Such deposits could be subendothelial, subepithelial,
intramembranous, or mesangial, and they correspond to an area of immune complex
deposition.
• These structural changes could be focal, diffuse or segmental, and global.
Functional changes
Functional changes include proteinuria, hematuria, reduction in GFR (i.e., oligoanuria),
and active urine sediment with RBCs and RBC casts. The decreased GFR and avid distal
nephron salt and water retention result in expansion of intravascular volume, edema, and,
frequently, systemic hypertension.
Frequency
United States
AGN comprises 25-30% of all cases of end-stage renal disease (ESRD). About one fourth
of patients present with acute nephritic syndrome. Most cases that progress do so relatively
quickly, and end-stage renal failure may occur within weeks or months of acute nephritic
syndrome onset. Asymptomatic episodes of PSGN exceed symptomatic episodes by a ratio of
3-4:1.
International
65
Geographic and seasonal variations in the prevalence of PSGN are more marked for
pharyngeally associated GN than for cutaneously associated disease (Anochie et al., 2009;
Becquet et al., 2010; Wong et al., 2009).
Race
Post–infectious GN has no predilection for any racial or ethnic group. A higher incidence
(related to poor hygiene) may be observed in some socioeconomic groups.
Sex
Acute GN predominantly affects males (i.e., 2:1 male-to-female ratio).
Age
Post–infectious GN can occur at any age but usually develops in children. Outbreaks of
PSGN are common in children aged 6-10 years.
Clinical
Identify a possible etiologic agent (e.g., streptococcal throat infection (pharyngitis), skin
infection (pyoderma): Recent fever, sore throat, joint pains, hepatitis, travel, valve
replacement, and/or intravenous drug use may be causative factors. Rheumatic fever
rarely coexists with acute PSGN.
Physical
• Signs of fluid overload
o Periorbital and/or pedal edema
o Edema and hypertension due to fluid overload (in 75% of patients)
o Crackles (i.e., if pulmonary edema)
o Elevated jugular venous pressure
o Ascites and pleural effusion (possible)
• Rash (i.e., vasculitis, Henoch-Schönlein purpura)
• Pallor
• Renal angle (i.e., costovertebral) fullness or tenderness, joint swelling, or tenderness.
66
Causes
The causal factors that underlie this syndrome can be broadly divided into infectious and
noninfectious groups.
• Infectious
o Streptococcal: Poststreptococcal GN usually develops 1-3 weeks following acute
infection with specific nephritogenic strains of group A beta-hemolytic
streptococcus. The incidence of GN is approximately 5-10% in persons with
pharyngitis and 25% in those with skin infections.
o Nonstreptococcal postinfectious glomerulonephritis
Bacterial - Infective endocarditis, shunt nephritis, sepsis, pneumococcal
pneumonia, typhoid, secondary syphilis, meningococcemia, and infection
with methicillin-resistant Staphylococcus aureus (MRSA)
Viral - Hepatitis B, infectious mononucleosis, mumps, measles, varicella,
vaccinia, echovirus, parvovirus, and coxsackievirus
Parasitic - Malaria, toxoplasmosis
• Noninfectious
o Multisystem systemic diseases - Systemic lupus erythematosus, vasculitis,
Henoch-Schönlein purpura, Goodpasture syndrome, Wegener granulomatosis
o Primary glomerular diseases – Membrano–proliferative GN (MPGN), Berger
disease (i.e., immunoglobulin A (IgA) nephropathy), "pure" mesangial
proliferative GN (Wen et al., 2010).
o Miscellaneous - Guillain-Barré syndrome, radiation of Wilms tumor, diphtheria-
pertussis-tetanus vaccine, serum sickness
d) Rheumatic Fever
Acute rheumatic fever (ARF) is an autoimmune inflammatory process that develops as a
sequela of streptococcal infection. ARF has extremely variable manifestations and remains a
clinical syndrome for which no specific diagnostic test exists.
67
Persons who have experienced an episode of ARF are predisposed to recurrence following
subsequent (rheumatogenic) group A streptococcal infections. The most significant complication
of ARF is rheumatic heart disease, which usually occurs after repeated bouts of acute illness.
Pathophysiology
ARF is characterized by nonsuppurative inflammatory lesions of the joints, heart,
subcutaneous tissue, and central nervous system. An extensive literature search has shown that,
at least in developed countries, rheumatic fever follows pharyngeal infection with rheumatogenic
group A streptococci (Abbas et al., 2004). The risk of developing rheumatic fever after an
episode of streptococcal pharyngitis has been estimated at 0.3-3%. More recent investigations of
rheumatic fever occurring in the aboriginal populations of Australia suggest that streptococcal
skin infections might also be associated with the development of rheumatic fever. In Oceania
and Hawaii, streptococcal strains that are not typically associated with rheumatic fever have been
found to cause the disease.
Molecular mimicry accounts for the tissue injury that occurs in rheumatic fever. Both the
humoral and cellular host defenses of a genetically vulnerable host are involved. In this process,
the patient's immune responses (both B- and T-cell mediated) are unable to distinguish between
the invading microbe and certain host tissues. The resultant inflammation may persist well
beyond the acute infection and produces the protean manifestations of rheumatic fever.
Frequency
United States
The incidence of ARF has declined markedly in the past 50 years in both the United
States and Western Europe.
Most Western physicians see only the late sequelae of rheumatic heart disease; the diagnosis of
an acute case is usually reason enough for a ground rounds presentation. This
remarkable decline of rheumatic fever likely reflects improved socioeconomic
conditions, as well the decline in prevalence of the classically described rheumatogenic
strains of group A streptococci.
International
68
In developing countries, the magnitude of ARF is enormous. Recent estimates suggest
that 15.6 million people worldwide have rheumatic heart disease and that 470,000 new cases of
rheumatic fever (approximately 60% of whom will develop rheumatic heart disease) occur
annually, with 230,000 deaths resulting from its complications. Almost this entire toll occurs in
the developing world. The incidence rate of rheumatic fever is as high as 50 cases per 100,000
children in many areas. Areas of hyper-endemicity (e.g., indigenous populations of Australia and
New Zealand) see an incidence of 300-500 cases per 100,000 children, while the rates are
approximately 50-fold lower in their non–indigenous compatriots. Rheumatic fever in the 21st
century appears to be largely a disease of crowding and poverty.
In India
Rheumatic fever in India accounts for 27-100 people in 100,000 yearly (Chopra et al., 2007).
Mortality/Morbidity
Cardiac involvement is the most serious complication of rheumatic fever and causes
significant morbidity and mortality. As stated above, about 60% of the approximately 470,000
patients diagnosed with ARF annually eventually develop carditis, joining the approximately 15
million worldwide with rheumatic heart disease. Those with rheumatic heart disease are at a
high risk for additional cardiac damage with subsequent bouts of ARF and require secondary
prophylaxis.
Morbidity due to congestive heart failure (CHF), strokes, and endocarditis is common among
individuals with rheumatic heart disease, and about 1.5% of persons with rheumatic
carditis die of the disease annually.
Race
ARF is predominantly a disease of developing countries and is concentrated in areas of
deprivation and crowding. It is rampant in the Middle East, in sub-Saharan Africa, in the
Indian subcontinent, in certain areas of South America, in Polynesia, and among the
indigenous populations of Australia and New Zealand. Although a genetic predisposition
to ARF clearly exists, the disease does not seem to have a major racial predisposition, as
69
it was once common in the United States and Europe and seems to decline in any locale
where living conditions improve.
Sex
Rheumatic fever does not have a clear-cut sexual predilection, although certain clinical
manifestations, such as mitral stenosis and Sydenham chorea, are more common in
females who have gone through puberty.
Age
ARF is most common among children aged 5–15 years. It is relatively rare in infants and
uncommon in preschool-aged children. ARF occurs in young adults, but the incidence of
first episodes of ARF falls steadily after adolescence and is rare after age 35 years.
The lower rate of ARF in adults may represent a decreased risk of streptococcal pharyngitis in
this cohort. Recurrent episodes, with their predisposition to cause or exacerbate valvular
damage, occur until middle age.
Clinical
Rheumatic fever manifests as various signs and symptoms that may occur alone or
in various combinations.
• Sore throat: Although estimates vary, only 35%-60% of patients with rheumatic fever
recall having any upper respiratory symptoms in the preceding several weeks.
• Many symptomatic individuals do not seek medical attention, go undiagnosed, or do not
take the prescribed antibiotic for acute rheumatic fever (ARF) prevention.
• Polyarthritis: Overall, arthritis occurs in approximately 75% of first attacks of ARF. The
likelihood increases with the age of the patient, and arthritis is a major manifestation of
ARF in 92% of adults.
o The arthritis of ARF is usually symmetrical and involves large joints, such as the
knees, ankles, elbows, and wrists. Tenosynovitis is common in adults and may be
severe enough to suggest a diagnosis of disseminated gonococcal disease.
o The evolution of arthritis in individual joints tends to overlap; therefore, multiple
joints may be inflamed simultaneously, causing more of an additive than a
migratory pattern.
70
o In most instances, the entire bout of polyarthritis subsides within 4 weeks without
any permanent damage. If not, a different diagnosis should be entertained.
• Carditis: Of first attacks of ARF, carditis occurs in 30%-60% of cases. It is more common
in younger children but does occur in adults (Steven et al., 2007).
o Severe inflammation can cause congestive heart failure (CHF).
o Patients with carditis may present with shortness of breath, dyspnea upon
exertion, cough, paroxysmal nocturnal dyspnea, chest pain, and/or orthopnea.
Carditis may also be asymptomatic and may be diagnosed solely by auscultation
or, perhaps, echocardiography.
• Sydenham chorea: This occurs in up to 25% of ARF cases in children but is very rare in
adults. It is more common in girls. Sydenham chorea in ARF is likely due to molecular
mimicry, with auto-antibodies reacting with brain ganglioside.
o Sydenham chorea may occur with other symptoms or as an isolated finding. It
typically presents 1-6 months after the precipitating streptococcal infection and
usually has both neurologic and psychological features.
o In the isolated form, laboratory evidence of a preceding streptococcal infection
may be lacking.
o Like the polyarthritis, Sydenham chorea usually resolves without permanent
damage but occasionally lasts 2-3 years and be a major problem for the patient
and her family.
• Erythema marginatum: In first attacks of ARF in children, erythema marginatum occurs
in approximately 10%. Like chorea, it is very rare in adults.
o Patients or parents may report a non-pruritic, painless, serpiginous, erythematous
eruption on the trunk. It is usually noted only in fair–skinned patients.
o The lesions may persist intermittently for weeks to months.
• Subcutaneous nodules are rarely noticed by the patient.
• Other symptoms may include fever, abdominal pain, arthralgia, malaise, and epistaxis.
Physical
• Polyarthritis: Joint involvement in ARF may range from arthralgia to frank polyarthritis
characterized by swelling, redness, warmth, and joint tenderness.71
• Carditis is the only manifestation of ARF with significant potential to cause long-term
disability and/or death. It is usually a pancarditis involving the pericardium, myocardium,
and endocardium. The signs of carditis include the development of new murmurs,
cardiac enlargement, CHF, pericardial friction rub, and/or pericardial effusion.
• Sydenham chorea: This is a neurological disorder characterized by emotional lability,
personality change, muscular weakness, and uncoordinated, involuntary, purposeless
movements.
• The average duration of an untreated ARF attack is 3 months. Chronic rheumatic fever,
generally defined as disease persisting for longer than 6 months, occurs in less than 5% of
cases.
Causes
• Group A beta-hemolytic streptococcal infection may lead to rheumatic fever. The overall
attack rate after streptococcal pharyngitis 0.3-3%, but certain genetically predisposed
individuals, comprising perhaps 3%-6% of the population, account for those who develop
rheumatic fever.
• Studies in developed countries have established that rheumatic fever followed only
pharyngeal infections and that not all serotypes of group A streptococci cause rheumatic
fever. For example, some strains (e.g., M types 4, 2, 12) in a population susceptible to
rheumatic disease do not result in recurrences of rheumatic fever. The classic
rheumatogenic serotypes are thought to include 3, 5, 6, 14, 18, 19, and 24. More recent
data, largely from studies of the indigenous peoples of Australia, suggest that skin
infections (pyoderma) can predispose to ARF and that various other serotypes may be
involved.
• Two basic theories have been postulated to explain the development of ARF and its
sequelae following group A streptococcal infection: (1) a toxic effect produced by an
extracellular toxin of group A streptococci on target organs such as the myocardium,
valves, synovium, and brain and (2) an abnormal immune response to streptococcal
components. Increasing and compelling evidence now strongly favors the autoimmune
explanation. It seems clear that an exaggerated immune response in a susceptible
individual leads to rheumatic fever. This probably occurs through molecular mimicry, in
72
which the immune response fails to differentiate between epitopes of the streptococcal
pathogen and certain host tissues.
e) Rheumatic Heart Disease (RHD)
Rheumatic heart disease is the most serious complication of rheumatic fever. Acute
rheumatic fever follows 0.3% of cases of group A beta-hemolytic streptococcal pharyngitis in
children. As many as 39% of patients with acute rheumatic fever may develop varying degrees
of pan-carditis with associated valve insufficiency, heart failure, pericarditis, and even death.
With chronic rheumatic heart disease, patients develop valve stenosis with varying degrees of
regurgitation, atrial dilation, arrhythmias, and ventricular dysfunction. Chronic rheumatic heart
disease remains the leading cause of mitral valve stenosis and valve replacement in adults in the
United States.
Acute rheumatic fever and rheumatic heart disease are thought to result from an autoimmune
response, but the exact pathogenesis remains unclear. Although rheumatic heart disease was the
leading cause of death 100 years ago in people aged 5-20 years in the United States, incidence of
this disease has decreased in developed countries. Worldwide, rheumatic heart disease remains a
major health problem. Chronic rheumatic heart disease is estimated to occur in 5-30 million
children and young adults; 90,000 individuals die from this disease each year. The mortality rate
from this disease remains 1-10%. A comprehensive resource provided by the World Health
Organization (WHO) addresses the diagnosis and treatment (WHO et al., 2004).
Pathophysiology
Rheumatic fever develops in some children and adolescents following pharyngitis
with group A beta-hemolytic Streptococcus (i.e., Streptococcus pyogenes). The organisms attach
to the epithelial cells of the upper respiratory tract and produce a battery of enzymes allowing
them to damage and invade human tissues. After an incubation period of 2-4 days, the invading
organisms elicit an acute inflammatory response with 3-5 days of sore throat, fever,
malaise, headache, and an elevated leukocyte count.
In 0.3-3% of cases, infection leads to rheumatic fever several weeks after the sore throat
has resolved. Only infections of the pharynx initiate or reactivate rheumatic fever. The organism
73
spreads by direct contact with oral or respiratory secretions, and spread is enhanced by crowded
living conditions.
Patients remain infected for weeks after symptomatic resolution of pharyngitis and may serve as
a reservoir for infecting others. Penicillin treatment shortens the clinical course of streptococcal
pharyngitis and, more importantly, is effective in decreasing the incidence of major sequelae.
Rheumatogenic strains are often encapsulated mucoid strains, rich in M proteins, and
resistant to phagocytosis. These strains are strongly immunogenic, and anti-M antibodies against
the streptococcal infection may cross-react with components of heart tissue (i.e., sarcolemmal
membranes, valve glycoproteins). M protein is felt discriminating due to increased number
(Pickering et al., 2009).
Acute rheumatic heart disease often produces a pancarditis characterized by endocarditis,
myocarditis, and pericarditis. Endocarditis is manifested as valve insufficiency. The mitral valve
is most commonly and severely affected (65-70% of patients), and the aortic valve is second in
frequency (25%). The tricuspid valve is deformed in only 10% of patients and is almost always
associated with mitral and aortic lesions.
The pulmonary valve is rarely affected. Severe valve insufficiency during the acute phase
may result in congestive heart failure and even death (1% of patients). Whether myocardial
dysfunction during acute rheumatic fever is primarily related to myocarditis or is secondary to
congestive heart failure from severe valve insufficiency is not known. Pericarditis, when
present, rarely affects cardiac function or results in constrictive pericarditis.
Chronic manifestations due to residual and progressive valve deformity occur in 9-39%
of adults with previous rheumatic heart disease. Fusion of the valve apparatus resulting in
stenosis or a combination of stenosis and insufficiency develops 2-10 years after an episode of
acute rheumatic fever, and recurrent episodes may cause progressive damage to the valves.
Fusion occurs at the level of the valve commissures, cusps, chordal attachments, or any
combination of these. Rheumatic heart disease is responsible for 99% of mitral valve stenosis in
adults in the United States. Associated atrial fibrillation or left atrial thrombus formation from
chronic mitral valve involvement and atrial enlargement may be observed.
Frequency
74
United States
At this time, rheumatic fever is uncommon among children in the United States.
Incidence of rheumatic fever and rheumatic heart disease has decreased in the United
States and other industrialized countries in the past 80 years. Prevalence of rheumatic
heart disease in the United States now is less than 0.05 per 1000 population, with rare
regional outbreaks reported in Tennessee in the 1960s and in Utah, Ohio, and
Pennsylvania in the 1980s. In the early 1900s, incidence was reportedly 5-10 cases per
1000 population. Decreased incidence of rheumatic fever has been attributed to the
introduction of penicillin or a change in the virulence of the Streptococcus.
International
In contrast to trends in the United States, the incidence of rheumatic fever and rheumatic
heart disease has not decreased in developing countries. Retrospective studies reveal developing
countries to have the highest figures for cardiac involvement and recurrence rates of rheumatic
fever. Estimations from Guilherme et al., 2007 worldwide are that at least 15.6 million children
and young adults have rheumatic heart disease, and 233,000 patients die from this yearly.
A study of school children in Cambodia and Mozambique with rheumatic fever
showed that rheumatic heart disease prevalence when echocardiography is used for screening is
10 fold greater compared with the prevalence when clinical examination alone is performed
(Marijon et al., 2007).
Mortality/Morbidity
Rheumatic heart disease is the major cause of morbidity from rheumatic fever and the
major cause of mitral insufficiency and stenosis in the United States and the world. Variables
that correlate with severity of valve disease include the number of previous attacks of rheumatic
fever, the length of time between the onset of disease and start of therapy, and sex. (The disease
is more severe in females than in males.) Insufficiency from acute rheumatic valve disease
resolves in 60-80% of patients who adhere to antibiotic prophylaxis.
Race
Native Hawaiian and Maori (both of Polynesian descent) have a higher incidence of
rheumatic fever (13.4 per 100,000 hospitalized children per year), even with antibiotic
75
prophylaxis of streptococcal pharyngitis. Otherwise, race (when controlled for
socioeconomic variables) has not been documented to influence disease incidence.
Sex
Rheumatic fever occurs in equal numbers in males and females, but the prognosis
is worse for females than for males.
Age
Rheumatic fever is principally a disease of childhood, with a median age of 10 years,
although it also occurs in adults (20% of cases).
Clinical
A diagnosis of rheumatic heart disease is made after confirming antecedent rheumatic
fever. The modified Jones criteria (revised in 1992) provide guidelines for the diagnosis of
rheumatic fever (Jones, 1992).
The Jones criteria require the presence of 2 major or one major and two minor criteria for
the diagnosis of rheumatic fever. The major diagnostic criteria include carditis, polyarthritis,
chorea, subcutaneous nodules, and erythema marginatum. The minor diagnostic criteria include
fever, arthralgia, prolonged PR interval on ECG, elevated acute phase reactants (increased
erythrocyte sedimentation rate ESR, presence of C-reactive protein, and leukocytosis.
Additional evidence of previous group A streptococcal pharyngitis is required to diagnose
rheumatic fever. One of the following must be present:
• Positive throat culture or rapid streptococcal antigen test result.
• Elevated or rising streptococcal antibody titer.
• History of previous rheumatic fever or rheumatic heart disease.
These criteria are not absolute; the diagnosis of rheumatic fever can be made in a patient with
chorea alone if the patient has had documented group A streptococcal pharyngitis.
After a diagnosis of rheumatic fever is made, symptoms consistent with heart failure, such as
difficulty breathing, exercise intolerance, and a rapid heart rate out of proportion to fever, may be
indications of carditis and rheumatic heart disease.
Physical
76
Physical findings in a patient with rheumatic heart disease include cardiac and non-
cardiac manifestations of acute rheumatic fever. Some patients develop cardiac manifestations
of chronic rheumatic heart disease. Other cardiac manifestations include congestive heart failure
and pericarditis.
Heart failure may develop secondary to severe valve insufficiency or myocarditis. The
physical findings associated with heart failure include tachypnea, orthopnea, jugular venous
distention, rales, hepatomegaly, a gallop rhythm, edema, and swelling of the peripheral
extremities. Increased cardiac dullness to percussion and muffled heart sounds are consistent
with pericardial effusion. A paradoxical pulse (and accentuated fall in systolic blood pressure
with inspiration) with decreased systemic pressure and perfusion and evidence of diastolic
indentation of the right ventricle on echocardiogram reflect impending pericardial tamponade. In
this clinical emergency, the pericardial effusion should be evacuated by pericardiocentesis.
Common non–cardiac (and diagnostic) manifestations of acute rheumatic fever include
polyarthritis, chorea, erythema marginatum, and subcutaneous nodules. Other clinical,
noncardiac manifestations include abdominal pain, arthralgias, epistaxis, fever, and rheumatic
pneumonia.
Causes
Rheumatic fever is thought to result from an inflammatory autoimmune response.
Rheumatic fever only develops in children and adolescents following group A beta-hemolytic
streptococcal pharyngitis, and only streptococcal infections of the pharynx initiate or reactivate
rheumatic fever. Genetic studies show strong correlation between progression to rheumatic
heart disease and human leukocyte antigen (HLA)-DR class II alleles and the inflammatory
protein-encoding genes MBL2 and TNFA (Guilherme et al., 2007). Furthermore, both clones of
heart tissue–infiltrating T cells and antibodies have been found to be cross-reactive with beta-
hemolytic streptococcus. Interferon (IFN)-gamma, tumor necrosis factor (TNF)-alpha, and
interleukin (IL)-10-(+) cells are consistently predominant in valvular tissue, whereas IL-4
regulatory cytokine expression is consistently low.
The proposed pathophysiology for development of rheumatic heart disease is as follows:
Cross-reactive antibodies bind to cardiac tissue facilitating infiltration of streptococcal-primed
77
CD4+ T cells, which then trigger an autoimmune reaction releasing inflammatory cytokines
(including TNF-alpha and IFN-gamma). Because few IL-4–producing cells are present in
valvular tissue, inflammation persists, leading to valvular lesions.
2.9.1 Identification of GASFor better treatment of GAS infections diagnosis plays a major role. This pauses an alarm
to lab technicians to ensure that the specific and exact pathogen is identified for proper
prescription for medication for complete elimination of the organism.
Throat culture (gold method)
Streptococcus species in a positive throat culture, group A streptococci appear as beta-
hemolytic colonies among other normal throat flora which are usually alpha- or nonhemolytic on
5% sheep blood agar. Streptoccocus pyogenes may appear as highly mucoid to nonmucoid;
colonies are catalase negative. Optimal recovery of group A streptococci may be achieved by use
of blood agar plates containing sulfamethoxazole-trimethoprim to inhibit some of the normal
flora and growth under anaerobic conditions to enhance streptolysin O activity. Throat culture is
still recognized as the most reliable method for detecting the presence of group A streptococci in
the throat. Presumptive identification of the beta-hemolytic group A streptococci relies on
susceptibility to bacitracin or a positive pyrrolidonylarylamidase test.
Lancefield group
The Lancefield serological grouping system for identification of streptococci is based on
the immunological differences in their cell wall polysaccharides (groups A, B, C, F, and G) or
lipoteichoic acids (group D). The group A carbohydrate antigen is composed of N-acetyl-b-
Dglucosamine linked to a polymeric rhamnose backbone. Confirmation of Streptoccocus
pyogenes is done by highly accurate serological methods, such as the Lancefield capillary
precipitin technique and the slide agglutination procedure, which utilize standardized grouping
antisera. These methods, including Streptex on primary plates (24 hours) or subculture
(48 hours), would confirm group A streptococci. For this reason, rapid tests which screen for the
presence of group A streptococci in the throat have been developed.
78
It is beyond the scope of this review to describe the many tests available for identification of
group A streptococci from throat swabs.
However, the most rapid tests take 5 to 30 min and use some form of nitrous acid or enzymatic
extraction of the group A carbohydrate. Fluorescent-antibody and genetic probe tests can be
performed directly on throat swabs but are not easily adapted to the clinical setting. Once
extracted, the group A carbohydrate antigen is detected by one of four methods, including slide
agglutination, enzyme-linked immunosorbent assay (ELISA), optical immunoassay, and a
modified one-step ELISA procedure (Facklam et al., 1997; Koneman et al., 1997).
Serological Diagnosis of Streptococcal Infection
(Anti-Streptolysin O, Anti-DNase B, and Other Diagnostic Antibodies)
The host responds immunologically to streptococcal infection with a plethora of
antibodies against many streptococcal cellular and extracellular components. Host responses
against the M protein serotype protect against re-infection with that particular serotype.
Routinely, serotype-specific antibodies are measured only for research purposes and not for
diagnosis of streptococcal infection. Responses against other cellular components are observed,
including antibodies against the cell wall mucopeptide, the group A streptococcal carbohydrate
moieties N-acetylglucosamine and rhamnose, and the other protein cell wall antigens R and T.
None of the cell wall antigens are used in the routine diagnosis of group A streptococcal
infections. Serological diagnosis of group A streptococcal infections is based on immune
responses against the extracellular products streptolysin O, DNase B, hyaluronidase, NADase,
and streptokinase, which induce strong immune responses in the infected host (Stollerman 1975).
Anti-streptolysin O (ASO) is the antibody response most often examined in serological tests to
confirm antecedent streptococcal infection (Todd 1932). An increase in the ASO titer of $166
Todd units is generally accepted as evidence of a group A streptococcal infection. In previous
studies it has been shown that infants are born with maternal levels of antistreptococcal
antibodies and that infants develop streptococcal infections after the first year of life. ASO
antibodies may not demonstrate a detectable rise in 1- to 3-year-olds, who have had few previous
group A streptococcal infections. At 2 years of age, .50% of the patients had ASO titers of, 50
79
Todd units, and none of the patients had titers above 166 (Markowitz et al., 1972). In the same
study, older school-age children developed higher ASO titers.
All five of the extracellular streptococcal enzymes may become significantly elevated over
normal levels during a streptococcal infection. Although the ASO titer is the standard serological
assay for confirmation of a group A streptococcal infection, assay of several of the enzymes
enhances the chance for a positive test if the patient did not produce high levels of antibody
against one or more of the extracellular enzymes. In general, the titers of antibodies against the
extracellular products parallel each other; however, exceptions maybe seen in infections with
pyoderma or nephritogenic strains, when the anti-DNase B titers have been found to be a reliable
indicator of streptococcal infection (Stollerman 1975). Infection of the skin does not always
elicit a strong ASO response. Confirmation of a group A streptococcal infection is imperative for
the diagnosis of rheumatic fever, since most often streptococci cannot be cultured from the
pharynx. In rheumatic fever, approximately 80% of the patients will have an elevated ASO titer
(.200 Todd units) at 2 months after onset (Bisno 1995). If an anti-DNase B or antihyaluronidase
assay is performed on sera from these patients, the number of patients with at least one positive
antistreptococcal enzyme titer rises to 95%. Thus, most acute rheumatic fever cases demonstrate
an elevated ASO titer with some exceptions which require more than one antibody test to detect
previous group A streptococcal infection. The streptozyme test was developed some years ago as
a hemagglutination assay for the detection of multiple antibodies against extracellular products
such as anti-streptolysin O, anti-DNase B, antihyaluronidase, antistreptokinase, or anti-NADase,
and it is used clinically in some laboratories as an additional diagnostic test (Bisno 1995).
PCR (molecular) approach
(M protein, T typing and emm gene)
Streptococcal M protein, which extends from the cell membrane of group A streptococci,
has been used to divide Streptoccocus pyogenes into serotypes. Quite a number of years ago,
Lancefield designed a serotyping system for the identification of the M protein serotypes
(Lancefield, 1928). The method consisted of treating group A streptococci grown in Todd-Hewitt
broth with boiling 0.1 N HCl. This method extracted the group A carbohydrate, M protein, and
cell wall, and the clarified extract was used in capillary precipitin tests to determine the M
protein serotype with standardized typing sera.
80
The N-terminal region of the M protein has been demonstrated to contain the type–
specific moiety and is recognized by specific typing sera in the precipitin test (Beachey, et al.,
1976; Fischetti, 1989; Jones et al., 1988; Lancefield 1962). There were several difficulties with
M serotyping, including ambiguities in the results, discovery of new M types, difficulty in
obtaining high-titered antisera against opacity factor-positive strains, and the availability and
high cost of preparing high-titered antisera for all known serotypes. Currently, more than 80
different serotypes of M protein have been identified (Facklam et al., 1997).
Because of the difficulty in preparation of M-typing antisera, an alternative to the
preparation of M-typing antisera has been developed. Approximately half of group A
streptococci produce opacity factor, a lipoproteinase which causes various types of mammalian
serum to increase in opacity. Antibodies against the opacity factor are type specific and correlate
with the M type. By using an opacity factor inhibition test, the M type of a group A
streptococcus can be determined by determining the type of opacity factor
(Widdowson et al., 1970 & 71). The T protein antigen is present at the surface of the group A
streptococci along with the M and R protein antigens. Although the genes for the M and T
protein (Jones 1944; Schneewind et al., 1990) have been investigated, the R protein sequence has
not been elucidated. Although there is homology between tee genes, there is a much greater
diversity among them compared with emm genes. Unlike the M protein, the most conserved
region appeared to reside in the amino terminal half of the T protein molecule. These
observations were made from comparison of 25 different T types (Jones 1944). In addition, the
T protein was not present in streptococcal groups C and G. In the laboratory, the T typing assay
is performed as an agglutination test. The T typing of group A streptococci has been important in
the investigation of epidemiology of group A streptococcal infections and has identified strains
associated with outbreaks when the M type was not identifiable. Because certain M and emm
types are associated with certain T types, testing for M or emm type can be shortened by
knowledge of the T type. Most (95%) group A streptococci have well defined T-type antigens,
and certain T serotypes are associated with each of the specific M protein serotypes (Beall et al.,
1997 & 98).
The use of T typing in addition to emm gene sequence analysis allows the identification
of strain diversity. This type of characterization of group A streptococcal isolates is extremely
important in the current climate of emerging invasive disease and sequelae. Recently, a
81
molecular biology approach has been developed for the identification of M protein serotypes
(Beall et al., 1996). In this study, the emm types of 95 known M serotypes (reference strains)
and 74 of 77 clinical isolates were identified by rapid PCR analysis. A nucleotide primer pair
was used for amplification and identification of the emm allele. Of the 95 reference strains
analyzed, 81 closely matched sequences in GenBank, in general, a good correlation was seen
between the known serotype and the identification by emm gene sequencing by the rapid PCR
technique. This technique has advantages over hybridization techniques, where problems arise
in identification of new genes or hybrid M protein molecules which result from interstrain
recombination (Whatmore et al., 1994). Recently, rapid hybridization techniques utilizing emm-
specific oligonucleotide probes have been shown to be useful in identification of M protein
serotypes (Kaufold et al., 1994). Enzyme electrophoresis polymorphism (Musser et al., 1992;
Haase et al., 1994; Bert et al., 1995)., Rapid Amplification of Polymorphic DNA (RAPD)
(Sappala et al., 1994)., Restriction Fragment Length polymorphism (RFLP)(Patric et al., 1988;
Bingen et al., 1992 ; Desai et al., 1998 & 1999), Vir typing (Gardiner et al., 1995&1996), DNA
hybridization using N-terminal sequences of the M protein gene (emm) as oliginucleotide probes
(Kaufhold et al., 1994; Penny et al., 1995)., Polymerase Chain Reaction-Enzyme Linked
Immunosorbant Assay (PCR-ELISA) (Saunders et al., 1997)., PCR M typing using specific
oligonucleotide primers for PCR amplification of N-terminal region of emm gene (Vitali et al.,
2002)., Polymerase Chain Reactions-Restriction Fragment Length Polymorphism (PCR-RFLP
and it has overcome technical problems such as it only requires one pair of primer and the PCR
products can be discriminated using standard PAGE which is easy to perform, interpret and less
time consuming. In addition, compared with M protein typing PCR-RFLP is technically less
demanding and more economical (Nonglak et al., 2005; Stanley et al., 1996; Dicuonzo et al.,
2001; Beall et al., 2001; Perea-Mejia et al., 2002)., Multilocus Sequence Typing (MLST) and
can be used on any bacterial analysis (Enright et al., 2001; Urwin et al., 2003)., N-terminal
sequencing of the M protein gene (emm), however, is the conclusive method for typing of GAS.
Conversely, it is not an option in developing countries laboratories (Beall et al., 1996; Brandt et
al., 2001).
In addition, various problems have been encountered such as ambiguity in the results,
time consuming, discovery of new M types making it hard for M-specific serotype preparation
demanding high costs (Facklam et al., 1997)., difficult in obtaining high titered antisera against
82
opacity factor and lipoproteinase which causes various types of mammalian serum to increase in
opacity (Widdowson et al., 1970-71).
2.9.2 Vaccination
Therapy of Streptococus pyogenes involves use of Penicillin or Amoxicillin is still
uniformly effective in treatment of GAS sequelae and the duration of treatment is well
established as being 10 days minimum (Falagas et al., 2008). There is no reported instance of
penicillin-resistance reported to date; although since 1985 there have been many reports of
penicillin-tolerance (Kim et al., 1985). It is important to identify and treat Group A streptococcal
infections in order to prevent sequelae. No effective vaccine has been produced. Certain strains
have developed resistance to macrolides, tetracyclines and clindamycin though they may be used
if the strain isolated has been shown to be sensitive, but resistance is much more common.
Preventive habits:
• Educate and create awareness to people.
• Good hand washing, especially after coughing and sneezing and before preparing foods
or eating
• Diagnosis of patients and if the test result shows strep throat, the person should stay home
from work, school, or day care until 24 hours after taking an antibiotic.
• All wounds should be kept clean and watched for possible signs of infection such as
redness, swelling, drainage, and pain at the wound site.
• A person with signs of an infected wound, especially if fever occurs, should seek medical
83
84
3.0 MATERIALS REQUIRED AND METHODOLOGY1. Hemolysis
2. Gram’s staining
3. Catalase test
4. Bacitracin test
5. Amplification of emm gene by PCR
3.1 Hemolysis Principle
The hemolytic reaction is particularly useful in the differentiation of the Streptococci.
The hemolytic reaction is determined on agar media containing 5% animal blood. The most
commonly used base medium is trypticase soy agar and the most commonly used blood is sheep
blood. Other base media may be substituted if control strains of all genera are tested for growth.
Sheep blood is used because of the convenience in testing throat swabs for β-hemolytic
streptococci. Sheep blood does not support the growth of Haemophilus haemolyticus which
appears similar to streptococci on agar containing rabbit, horse, or human blood.
Materials
1. Inoculum
2. Petri plates
85
3. Laminar chamber
4. Loop
5. Bunsen burner
6. CO2 incubator
Reagents
Peptone – 0.5 g
Beef extract – 0.5 g
NaCl – 1 g
Agar – 1.5 g
Distilled water – 100 ml
pH – 7.4
Human blood – 5%
Procedure
1. Measure the required quantity for preparation of the nutrient agar media.
2. Check the pH 7.4
3. Sterilize the media in autoclave at 121˚c 15 pounds for 15 minutes
4. When the media has reached hand bearable temperature pour blood
5. Mix gently and pour into the sterile grease free plates
6. Allow for solidification
7. Streak culture for isolation on NBA plate with 5% human blood.
8. Incubate plate at 35°C in CO2 for 24 hours.
3.2 Gram Stain Principle
The gram stain is used to differentiate between gram-positive and gram-negative bacteria.
Cellular morphology can also be determined. Gram-positive and gram-negative bacteria are both
stained by crystal violet. The addition of iodine forms a complex within the cell wall. Addition of
a decolourizer removes the stain from gram-negative organisms due to their increased lipid
content. These cells are stained pink with the counter stain safranin. 86
Material (Stored at room temperature)
1. Slides
2. Inoculating loop
3. Microscope with Immersion Objective
4. Culture
Reagents
1. Methyl Violet Stain (Hucker’s ammonium oxalate crystal violet)
Crystal violet - 2g
Ethyl alcohol- 120ml
Dissolve the dye completely
Ammonium oxalate - 0.8 g
Mix both the solutions
2. Gram’s Iodine
Potassium iodide 2g and dissolved in 10ml of distilled water.
Add 1g of iodine and dissolve completely. Make up the volume to 300ml with distilled
water.
3. Decolourizer Solution
4. Methanol or ethanol- 95%
5. Safranin 1 g is dissolved in 100ml of distilled water.
Procedure
1. Prepare smear by spreading single loop of culture from the nutrient broth to a microscope slide
over 1/3 to ½ to the total area of the slide.
2. The smear was set for air drying.
3. The slide was held slightly above the flame for fixation.
4. The bacterial smear was flooded with crystal violet stain and allowed to stand for 1 minute
then stain was washed gently off with a stream of cool tap water.
87
5. The smear was covered with grams iodine and allowed to stand for 1 minute. The stain is
washed off gently.
6. The bacterial smear was rinsed with decolourizer solution for 10 seconds and gently rinsed
with water.
7. The bacterial smear was then covered with safranin stain, and allowed to stand for 1 minute
and then the stain washed gently.
8. Blot air-dried with absorbent paper and examined under oil immersion lens.
3.3 Catalase Test Principal
Hydrogen peroxide is used (H2O2) to determine if the bacteria produce the enzyme
catalase.
2 H2O2 → 2 H2O + O2 (responsible for bubbling)
Materials and Reagents
1. Overnight culture or colony
2. 3% H2O2 (Hydrogen peroxide)
3. Pipette
4. Slides
5. Tubes
6. Overnight cultures or colony that is grown on a blood free media
Procedure
1. Flood the growth of the bacteria with 1 ml of 3% hydrogen peroxide (usually on an agar slant
but blood free agar plates can be used) or take a slide with colony and pour the reagent.
2. Observe for effervescence.
3.4 Bacitracin Test Principle
88
The bacitracin disk is sensitivity test used to differentiate the beta- hemolytic
Streptococcus.
Materials
1. Bacitracin disk
2. Nutrient agar
3. An overnight culture
Procedure
1. Select a beta-hemolytic colony and heavily inoculate a quadrant of a 5% human blood agar
2. Drop the disk in the heaviest zone of inoculation.
3. Tap disk lightly to ensure that it adheres to the agar.
4. Incubate plate overnight in CO2 at 35°C.
3.5 emm typing
A. Lysate preparation
Principle
The DNA purification is generally to homogenize the cells and to isolate the nucleic acid
from which the DNA is extracted. The purpose of TE buffer is to protect DNA or RNA from
degradation. It is the buffer for storage of DNA and RNA. Removal of proteins from the
membrane normally regulates the use of detergent such as the ionic (charged) detergent SDS
(which denature the proteins) lyse the nucleic and release DNA which causes the solution
viscosity to increase noticeably. The detergent also inhibits any nuclease activity in the
preparation. The major goal of subsequent purification step is to separate the DNA from the
contaminating materials such as RNA and proteins.
Deproteinisation is usually accomplished by shaking the mixture with a volume of
phenol. Phenol and chloroform is an active protein denaturant that causes protein preparation etc
lose their solubility and precipitation from solutions.
89
The DNA precipitation ammonium acetate and ethanol is used. Ethanol is a hydrating
agent. DNA is used by precipitating it. At last ethanol is evaporated and DNA concentration
observed.
Material required
1. Streptococcus pyogenes culture with Optical density more than 0.7
2. Cooling centrifuge
3. Eppendorff
4. Micropipettes and microtips
5. Distilled water
6. Discarding tray
Reagents
A. TE buffer
1M Tris Hcl – 7.85g
0.1M EDTA – 1.86g
Distilled water – 50 ml
B. 10% Sodium dodecyl sulphate (SDS) – 1g in 10 ml of distilled water
C. Phenol: chloroform at ratio 1:1
D. 3M ammonium acetate
E. 70% ethanol
pH – 8
Protocol
Harvesting Bacterial cells
1.5 ml bacterial culture was taken in 4 eppendorffs
Centrifuge at 5000 rpm for 2 minutes at 4˚c
90
Discard supernatant.
Lysis of the cell
To the pellet add 460µl of TE buffer and 30µl of 10% SDS
Mix gently
Keep it at 37˚C for one day (overnight).
Deproteinisation
To the tube 500µl of phenol: chloroform was added ratio 1:1
Centrifuge at 8000 rpm for 10 minutes at 4˚c
Transfer the aqueous phase to a sterile eppendorff tubes
DNA precipitation
To the aqueous phase add 40µl of 3M ammonium acetate and 250µl of 70% ethanol
Keep for incubation at 37˚c for 5˚c
Centrifuge at 10000 rpm for 10 minutes a 4˚c
Observe the pellet
DNA concentration
Air–dry the residual with ethanol
91
Suspend the pellet in 10µl of TE buffer and store at 4˚c till use
Quantification of DNA
Isolated DNA was quantified by measuring the absorbance at 260nm and at 280nm. The ratio of
absorbance was used to determine the quality of the isolated DNA. The concentration was
calculated using the following formula
(Concentration of DNA= OD260 x 50 x dilution factor=µg of DNA/ml)
Quantified DNA was diluted to 150 ng/µl and used for polymerase chain reactions.
B. Polymerase chain reaction (PCR)
PCR stands for “Polymerase Chain Reaction”, a process to replicate DNA and it was
invented by Karry Mullis in 1985 and Noble prize winner in 1993.
It allows exponential amplification of short DNA sequences (usually 100 to 600
bases) within a longer double stranded DNA molecule.
PCR is extremely a sensitive method as it can detect a single DNA molecule in a
sample.
PCR makes it possible to quickly and accurately obtain large quantities of DNA
needed in carrying out research in molecular biology, in clinical diagnosis, in criminal
investigations, forensic analysis and in viral disease research e.g. in the ongoing battle
against AIDS.
The PCR entails the repetition of a single cycle. Each cycle involves three steps:
Template denaturation > 90˚C
Primer annealing 55˚C to 65˚C
Extension of DNA from annealed primers 68˚C to 72˚C
Each step is controlled by different incubation temperatures, each cycle results
approximately doubling of DNA fragment of interest.
The above steps are achieved by incubating the samples at three different
temperatures:92
The three cycles form a cycle, whereby each cycle should amplify the target DNA
sequence two-fold.the amount of amplified product will be 2n number of copies of
target DNA, where n is the number of cycles.
Thermal profile
Denaturation In the first step, the target DNA is denatured by incubation at 94˚C.
Denaturation of the DNA causes the two strands to separate and remain in
solution until the temperature is lowered for the second step.
However, if the GC content is extremely high, the denaturation temperature
may need to be raised.Annealing During annealing step, the temperature is lowered to 37˚C to 65˚C which
allows the target DNA and the primers to anneal (hybridize) to
complimentary sequences.
There is a wide range in temperature at which annealing occurs. This is
because the annealing temperature is dependent on the length and the GC
content of the primers.Extension The DNA is extended from annealed primers in a 5’-3’ direction.
This step requires the DNA polymerase, the four deoxyribonucleoside
triphosphate precursors (dNTPs), and an incubation temperature of about
68˚C to 72˚C.This is the optimal temperature for Taq DNA polymeraseAmplification The three steps are repeated over and over
again for 25-30 cycles until the efficient DNA
is significantly produced.
Newly synthesized DNA fragments serve as
templates for the next cycle which amplifies
the template DNA exponentially.
Table 3.1 Summary of amplification processes.93
Ingredients
1. DNA template
2. Primers
3. Taq polymerase
4. dNTPs
5. Buffer
6. Mgcl2
Template DNA:
The template DNA is a single-stranded polynucleotide (or a region of polynucleotide)
that directs synthesis of a complementary polynucleotide (a specific sequence of the
DNA which is amplified).
Recommended amount of template DNA
Mammalian genomic DNA 100-200ngBacterial DNA 50-100ngPlasmid DNA 10-50ngYeast DNA 10ng
Primer (oligonucleotide):
Primers are synthetically produced oligonucleotides which are around16-24 bases
long.
Primes should be chosen very carefully. Poorly chosen primers can lead to
amplification of non-target sequences and primer artifacts, such as primer, dimers etc
Concentration of primers should be 10 picomoles/reaction.
Taq DNA polymerase
94
The PCR technique was dramatically improved with the introduction of thermostable
polymerase, taq DNA polymerase isolated from the thermophilic microorganism,
Thermus aquaticus which can grow at temperatures of above 70˚C
Taq DNA polymerase lacks 3’-5’ exonuclease activity but has 5’-3’ exonuclease
activity and 5’-3’ polymerase activity. For most amplification reactions, 1-2 units of
enzyme is recommended as higher enzyme concentration leads to non-specific
amplifications.
Deoxynucleotide triphosphatases (dNTPs)
They are the major source of phosphate groups in the reaction mixture and any
change in their concentration effects concentration of available Mg2+.
10X PCR buffer:
(100mM Tris-HCl pH 8, 500mM KCl, 15mM MgCl2 or 25mM MgCl2)
MgCl2
All thermo stable DNA polymerase require free divalent cations, usually Mg2+ which
influence enzyme activity and increase Tm (melting temperature) of double stranded
DNA.
Excess of Mg2+ in the specific reaction can increase non-specific primer binding and
increase background of the reaction.
Preparation of 1X TAE buffer:
Take 20ml of 50X TAE in a measuring cylinder and make up the volume to 1000ml
with sterile autoclaved water.
Procedure
All the components should be kept on ice before setting up of the PCR reaction.
To amplify the template DNA, add the following reaction components to a PCR tube
in the given order. Place the tube on ice and add enzyme as the last component.
95
Reaction mixture
Nuclease free water (deionized water) 10µlPCR Assay buffer 10µlDNA template 30µlForward primer 10µlReverse primer 10µldNTP mixture 10µlTaq DNA polymerase 10µlTotal reaction volume 90µl
Mix the contents gently and carry out amplification using the reaction parameters
required.
Parameters
Initial denaturation - 94˚C, 2 min
Denaturation - 94˚C, 30sec.
Annealing - 58˚C, 30sec.
Elongation - 72˚C, 1 min 30sec.
Number of cycles – 29
PCR products are stored at -20˚C until use
C. Resolution of PCR products on standard agarose gelsMaterials
• Electrophoresis buffer(1X TAE)
• Ethidium bromide solution (0.5mg/ml)
• Electrophoresis-grade agarose
• 6X loading buffer
• DNA molecular weight markers
• Gel electrophoresis apparatus
• Gel casting platform
• Gel combs(slot formers)
96
• DC power supply
Preparation of gel
1. Weigh 260 mg of agarose (0.8%) and dissolve in a mixture of 15ml of distilled water
and 15ml of TAE buffer.
2. Boiled at 100- 110°c till it becomes a clear liquid (Avoid making bubbles in the
molten agarose. This creates electrical seepage during the run which results in
deformed DNA banding pattern).
3. Once it becomes a clear liquid it is allowed to cool down to temperature of about
50-60°c (hand bearable)
4. 8µl ethidium bromide was added (Ethidium is a carcinogen hence should be handled
with care).
5. Mix the molten agarose with ethidium bromide.
6. The gel is poured to the platform which has already been covered at the periphery
with cellophase tape with the comb for wells formation.
7. Allow it to solidify for 10-15 minutes.
8. Once the solidified agarose is ready remove the cello-tape and keep the agarose
platform in the gel tank.
9. Pour the tank buffer 1X TAE (pH 8)
10.Allow the gel to sink in the tank buffer.
11. Keep the wells near the cathode side since the DNA carries negative charge.
12.Take the sample by micropipette 30-40µl and fill it gently by pressing the
micropipette.
13.Connect the apparatus to DC and run the gel at 50 volts for 40 minutes.
14.By seeing the tracking dye front on the gel, switch off when it has reached ¾ th of the
agarose.
15.Remove the gel from the platform
16.Observe the gel under UV transilluminator.97
98
RESULTS AND DISCUSSIONHemolysis test
Majority of the samples collected from the infected patients were beta-hemolytic as exhibited by complete clearing around the colony and presumptively categorized as GAS.
Gram staining
Gram positive cocci are observed in a form of grape structure showing pairs (tetrads) in chains which are attached to each other. The gram stain aids in the differentiation of the gram positive cocci for negative organisms. The arrangement of the cells is what helps to differentiate the genera. This test confirms GAS nature.
Catalase testBubbling was observed which is interpreted as a positive test. Presence of bubbles shows
that catalase enzyme is produced which hydrolyses down the hydrogen peroxidase thereby releasing water and oxygen responsible for bubbling confirming presence of GAS nature.
Bacitracin testZone of inhibition is seen which is considered a positive test (sensitive test). No organism
grows around the bacitracin antibiotic disk. Bacitracin test positivity confirmated GAS strains nature as they are the most sensitive.
Amplification of emm gene and AGE analysis.
99
Single pair of primers was used to amplify the emm gene. The PCR products achieved indicates presence drug resistance GAS. The consistency of the DNA bands strongly indicates same infectious streptococcus since the samples were collected from the same location as opposed from the earlier findings of heterogeneity differing from one place to another. This implication may have significance in aboriginal drug designing for the control of this important pathogen. There is need for drug development to cater the infections, carriers and vaccination. The sequelae is uncertain and more dreadful is the report of flesh eating bacteria in the news media today. The modern and molecular findings especially the emm gene will pave away for drug development and it’s accuracy is advantageous as the diagnostic tool that can be adopted by the developing nations.
100
101
102
103
104
CONCLUSION PCR could be a powerful and rapid technique for the confirmation of GAS to manage the problem successfully. The emm gene is a possible candidate for aboriginal drug designing for eradication of GAS. The emm gene analysis also provides information the could determine any heterogeneity due to envinornemtal and biological stresses.
105
106
BIBLIOGRAPHY
Abbas and Lechtman (2004). Basic Immunology: Functions and Disorders of the
Immune System.
American Academy of Pediatrics. Diagnosis and management of acute otitis media.
Pediatrics. May 2004; 113(5):1451-65.
Anochie I, Eke F, Okpere A. Childhood acute glomerulonephritis in Port Harcourt,
Rivers State, Nigeria. Niger J Med. Apr-Jun 2009; 18(2):162-7.
Beall B, Facklam R, Thompson T: Sequencing emm-specific PCR products for routine
and accurate typing of group A streptococci. J Clin Microbiol 1996, 34:953-958.
Beall B, Facklam RR, Elliott JA, Franklin AR, Hoenes T, Jackson D, Laclaire L,
Thomson T, Viswanathan R: Streptococcal emm types associated with T agglutination
types and the use of conserved emm gene restriction fragment patterns for subtyping
group A streptococci. J Clin Microbiol 2002, 40:278-280.
Becquet O, Pasche J, Gatti H, et al. Acute post-streptococcal glomerulonephritis in
children of French Polynesia: a 3-year retrospective study. Pediatr Nephrol. Feb 2010;
25(2):275-80.
Bert F, Picard B, Lambert-Zechovsky N, Goullet P: Identification and typing of pyogenic
streptococci by enzyme electrophoretic polymorphism. J Med Microbiol 1995, 42(6):442-
51.
Bingen E, Denamur E, Lambert-Zechovsky N, Boissinot C, Brahimi N, Aujard Y, Blot P,
Elion J: Mother-to-infant vertical transmission and cross-colonization of Streptococcus
pyogenes confirmed by DNA restriction fragment length polymorphism analysis. J
Infect Dis 1992, 165:147-50.
Bisno AL (January 2001). "Acute pharyngitis". N Engl J Med 344 (3): 205–11.
107
Bisno AL, Gerber MA, Gwaltney JM Jr, Kaplan EL, Schwartz RH. Practice guidelines
for the diagnosis and management of group A streptococcal pharyngitis. Infectious
Diseases Society of America. Clin Infect Dis. Jul 15 2002; 35(2):113-25.
Bisno AL: Group A streptococcal infections and acute rheumatic fever. N Engl J Med
1991, 325:783-793.
Brandt CM, Spellerberg B, Honscha M, Truong ND, Hoevener B, Lutticken R: Typing of
Streptococcus pyogenes strains isolated from throat infections in the region of Aachen,
Germany. Infection 2001, 29:163-165.
Chopra P, Gulwani H. Pathology and pathogenesis of rheumatic heart disease. Indian J
Pathol Microbiol. Oct 2007; 50(4):685-97.
Chun LT, Reddy DV, Yamamoto LG. Rheumatic fever in children and adolescents in
Hawaii. Pediatrics. Apr 1987; 79(4):549-52.
Courtney HS, Ofek I, Hasty DL. M protein mediated adhesion of M type 24
Streptococcus pyogenes stimulates release of interleukin-6 by HEp-2 tissue culture cells.
FEMS Microbiol Lett. Jun 1 1997; 151(1):65-70.
Cunningham MW. Pathogenesis of group A streptococcal infections. Clin Microbiol Rev.
Jul 2000; 13(3):470-511.
Davies HD, McGeer A, Schwartz B. Invasive group A streptococcal infections in
Ontario, Canada. Ontario Group A Streptococcal Study Group. N Engl J Med. Aug
22 1996; 335(8):547-54.
Davis JP, Chesney PJ, Wand PJ. Toxic-shock syndrome: epidemiologic features,
recurrence, risk factors, and prevention. N Engl J Med. Dec 18 1980; 303(25):1429-35.
Demers B, Simor AE, Vellend H. Severe invasive group A streptococcal infections in
Ontario, Canada: 1987-1991. Clin Infect Dis. Jun 1993; 16(6):792-800;discussion 801-2.
Desai M, Efstratiou A, George R, Stanley J: High-resolution genotyping of
Streptococcus pyogenes serotype M1 isolates by fluorescent amplified-fragment length
polymorphism analysis. J Clin Microbiol 1999, 37(6):1948-1952.
Desai M, Tanna A, Wall R, Efstratiou A, George R, Stanley J: Fluorescent amplified-
fragment length polynorphism analysis of an outbreak of group A streptococcal invasive
disease. J Clin Microbiol 1998, 36(11):3133-3137.
108
Dicuonzo G, Gherardi G, Lorino G, Angeletti S, De Cesaris M, Fiscarelli E, Bessen DE,
Beall B: Group A streptococcal genotypes from pediatric throat isolates in Rome, Italy.
J Clin Microbiol 2001, 39:1687-1690.
Digenea AS, Ayoub EM. Guidelines for the diagnosis of rheumatic fever: Jones criteria
update 1992. Circulation 87. Circulation. 1993; 87:302.
Dong H, Xu G, Li S, et al. Beta-haemolytic group A streptococci emm75 carrying altered
pyrogenic exotoxin A linked to scarlet fever in adults. J Infect. Apr 2008; 56(4):261-7.
Dwight R. Johnson, Edward L. Kaplan, Amy VanGheem, Richard R. Facklam
and Bernard Beall. Characterization of group A streptococci (Streptococcus pyogenes):
correlation of M-protein and emm-gene type with T-protein agglutination pattern and
serum opacity factor.
Ellies E, Vallée F, Mari A, Silva S, Bauriaud R, Fourcade O, et al. [Toxic shock
syndrome consecutive to the presence of vaginal tampon for menstruation regressive after
early haemodynamic optimization and activated protein C infusion]. Ann Fr Anesth
Reanim. Jan 2009; 28(1):91-5.
Enright MC, Spratt BG, Kalia A, Cross JH, Bessen D: Multilocus sequence typing of
Streptococcus pyogenes and the relationships between emm type and clone. Infection
and Immunity 2001, 69(4):2416-2427.
Eriksson BK, Andersson J, Holm SE. Epidemiological and clinical aspects of invasive
group A streptococcal infections and the streptococcal toxic shock syndrome. Clin Infect
Dis. Dec 1998; 27(6):1428-36.
Facklam, R. R. 1997. Screening for streptococcal pharyngitis: current technology.
Infect. Med. 14:891–898. 171. Fast, D. J., P. M. Schlievert, and R. D. Nelson. 1989.
Toxic shock syndromeassociated.
Fischetti VA: Streptococcal M protein: molecular design and biological behavior. Clin
Microbiol Rev 1989, 2:285-314.
Fraser JD, Proft T. The bacterial superantigen and superantigen-like proteins. Immunol
Rev. Oct 2008; 225:226-43.
Gardiner D, Hartas J, Currie B, Mathews JD, Kemp DJ, Sriprakash KS: Vir typing: a
long-PCR typing method for group A streptococci. PCR Methods Appl 1995, 4:288-293.
109
Gardiner DL, Sriprakash KS: Molecular epidemiology of impetiginous group A
streptococcal infections in aboriginal communities of northern Australia. J Clin
Microbiol 1996, 34:1448-1452.
Gaston DA, Zurowski SM. Arcanobacterium haemolyticum pharyngitis and exanthem.
Three case reports and literature review. Arch Dermatol. Jan 1996; 132(1):61-4.
Gomez-Carrasco JA, Lassaletta A, Ruano D. [Acute hepatitis may form part of scarlet
fever]. An Pediatr (Barc). Apr 2004; 60(4):382-3.
Graziella O, Roberto N, Christina VH. Nevio Cimolai, ed. Laboratory Diagnosis of
Bacterial Infections. Informa Healthcare; 2001:258.
Guidelines for the diagnosis of rheumatic fever. Jones Criteria, 1992 update. Committee
on Rheumatic Fever, Endocarditis, and Kawasaki Disease of the Council. on
Cardiovascular Disease in the Young, the American Heart Association; JAMA 1992 Oct
21; 268(15):2069-73.
Guilherme L, Ramasawmy R, Kalil J. Rheumatic fever and rheumatic heart disease:
genetics and pathogenesis. Scand J Immunol. Aug-Sep 2007; 66(2-3):199-207.
Haase AM, Melder A, Mathews JD, Kemp DJ, Adams M: Clonal diversity of
Streptococcus pyogenes within some M-types revealed by multilocus enqyme
electrophoresis. Epidemiol Infect 1994, 113(3):455-62.
Jones TD. Diagnosis of rheumatic fever. JAMA. 1944; 126:481-85.
Kaufhold A, Podbielski A, Baumgarten G, Blokpoel M, Top J, Schouls L: Rapid typing
of group A streptococci by the use of DNA amplification and non-radioactive allele-
specific oligonucleotide probes. FEMS Microbiol Lett 1994, 119:19-25.
Kihiczak GG, Schwartz RA, Kapila R. Necrotizing fasciitis: a deadly infection. J Eur
Acad Dermatol Venereol. Apr 2006; 20(4):365-9.
Kim KS, Kaplan EL (1985). "Association of penicillin tolerance with failure to eradicate
group A streptococci from patients with pharyngitis". J Pediatr 107 (5): 681–4.
Kumar, Vinay; Abbas, Abul K.; Fausto, Nelson and Mitchell, Richard N. (2007).
Robbins Basic Pathology (8th ed). Saunders Elsevier. pp. 403-406 ISBN 978-1-4160-
2973-1.
110
Lappin E, Ferguson AJ. Gram-positive toxic shock syndromes. Lancet Infect Dis.
May 2009; 9(5):281-90.
Leslie DL, Kozma L, Martin A, et al. Neuropsychiatric Disorders Associated With
Streptococcal Infection: A Case-Control Study Among Privately Insured Children. J Am
Acad Child Adolesc Psychiatry. Aug 21 2008.
Maltezou HC, Tsagris V, Antoniadou A, Galani L, Douros C, Katsarolis I, et al.
Evaluation of a rapid antigen detection test in the diagnosis of streptococcal pharyngitis
in children and its impact on antibiotic prescription. J Antimicrob Chemother. Sep
30 2008;
Marijon E, Ou P, Celermajer DS, et al. Prevalence of rheumatic heart disease detected by
echocardiographic screening. N Engl J Med. Aug 2 2007; 357(5):470-6.
Matsuda Y, Kato H, Ono E, Kikuchi K, Muraoka M, Takagi K, et al. Diagnosis of toxic
shock syndrome by two different systems; clinical criteria and monitoring of TSST-1-
reactive T cells. Microbiol Immunol. Nov 2008; 52(11):513-21.
McCaig LF, Besser RE, Hughes JM. Trends in antimicrobial prescribing rates for
children and adolescents. JAMA. Jun 19 2002; 287(23):3096-102.
Minich LL, Tani LY, Pagotto LT, Shaddy RE, Veasy LG. Doppler echocardiography
distinguishes between physiologic and pathologic "silent" mitral regurgitation in patients
with rheumatic fever. Clin Cardiol. Nov 1997; 20(11):924-6.
Morgan WR, Caldwell MD, Brady JM, Stemper ME, Reed KD, Shukla SK.
Necrotizing fasciitis due to a methicillin-sensitive Staphylococcus aureus isolate
harboring an enterotoxin gene cluster. J Clin Microbiol. Feb 2007; 45(2):668-71.
Musser JM, Gray BM, Schlievert PM, Pichichero ME: Streptococcus pyogenes
pharyngitis: characterization of strains by multilocus enzyme genotype, M and T protein
serotype, and pyrogenic exotoxin gene probing. J Clin Microbiol 1992, 30(3):600-603.
Musser JM, Hauser AR, Kim MH, Schlievert PM, Nelson K, Selander RK.
Streptococcus pyogenes causing toxic-shock-like syndrome and other invasive diseases:
clonal diversity and pyrogenic exotoxin expression. Proc Natl Acad Sci USA. Apr
1 1991; 88(7):2668-72.
111
National Center for Immunization and Respiratory Diseases: Division of Bacterial
Diseases. Group A Streptococcal (GAS) Disease. April 3, 2008.
Odd J, Fishaut M, Kapral F. Toxic-shock syndrome associated with phage-group-I
Staphylococci. Lancet. Nov 25 1978; 2(8100):1116-8.
Olsen RJ, Sitkiewicz I, Ayeras AA, et al. Decreased necrotizing fasciitis capacity caused
by a single nucleotide mutation that alters a multiple gene virulence axis. Proc Natl Acad
Sci U S A. Jan 12 2010; 107(2):888-93.
Patric Cleary P, Kaplan EL, Livdahl C, Skjold S: DNA fingerprints of Streptococcus
pyogenes are M type specific. J Infect Dis 1988, 158(6):1317-1323.
Penney TJ, Martin DR, Williams LC, de Malmanche SA, Bergquist PL: A single emm
gene-specific oligonycleotide probe does not recognise all members of the Streptococcus
pyogenes M type 1. FEMS Microbiol Lett 1995, 130(2–3):145-9
Perea-Mejia LM, Inzunza-Montiel AE, Cravioto A: Molecular characterization of group
A Streptococcus strains isolated during a scarlet fever outbreak. J Clin Microbiol 2002,
40:278-280.
Pickering LK, et al. 2009 Red Book: Report of the Committee on Infectious
Diseases. 28th ed. Elk Grove Village, IL: American Academy of Pediatrics; 2009: 616-
628.
Pruksakorn S, Sittisombut N, Phornphutkul C, Pruksachatkunakorn C, Good MF, Brandt
E: Epidemiological analysis of non-M-typeable group A Streptococcus isolates from a
Thai population in northern Thailand. J Clin Microbiol 2000, 38:1250-1254.
Sandrini J, Beucher AB, Kouatchet A, Lavigne C. [Scarlet fever with multisystem organ
failure and hypertrophic gastritis]. Rev Med Interne. May 2009; 30(5):456-9.
Sanz JC, Bascones Mde L, Martin F, Saez-Nieto JA. [Recurrent scarlet fever due to
recent reinfection caused by strains unrelated to Streptococcus pyogenes]. Enferm Infecc
Microbiol Clin. Jun-Jul 2005; 23(6):388-9.
Saunders NA, Hallas G, Gaworzewska ET, Metherell L, Efstratiou A, Hookey JV, George
RC: PCR-enzyme-linked immunosorbent assay and sequencing as an alternative to
serology for Mantigen typing of Streptococcus pyogenes. J Clin Microbiol 1997,
35:2689-2691.
112
Schroeder BM. Diagnosis and management of group A streptococcal pharyngitis. Am
Fam Physician. Feb 15 2003; 67(4):880, 883-4.
Sendi P, Johansson L, Dahesh S, et al. Bacterial phenotype variants in group B
streptococcal toxic shock syndrome. Emerg Infect Dis. Feb 2009; 15(2):223-32.
Seppala H, Qiushui H, Osterblad M, Huovinen P: Typing of group A streptococci by
random amplified polymorphic DNA analysis. J Clin Microbiol 1994, 32(8):1945-1948.
Shands KN, Schmid GP, Dan BB. Toxic-shock syndrome in menstruating women:
association with tampon use and Staphylococcus aureus and clinical features in 52 cases.
N Engl J Med. Dec 18 1980; 303(25):1436-42.
Soni A. Ear Infections (Otitis Media) in Children (0-17): Use and Expenditures, 2006.
Rockville, MD: Agency for Healtcare Research and Quality; December 2008.
Stanley J, Desai M, Xerry J, Tanna A, Efstratiou A, George R: Highresolution genotyping
elucidates the epidemiology of group A streptococcus outbreaks. J Infect Dis 1996,
174:500-506.
Stanley J, Linton D, Desai M, Efstratiou A, George R: Molecular subtyping of prevalent
M serotypes of Streptococcus pyogenes causing invasive disease. J Clin Microbiol 1995,
33(11):2850-2855.
Steven J Parrillo, DO, FACOEP, FACEP. "eMedicine — Rheumatic Fever". Retrieved
2007-07-14.
Stevens DL, Tanner MH, Winship J. Severe group A streptococcal infections associated
with a toxic shock- like syndrome and scarlet fever toxin A. N Engl J Med. Jul
6 1989;321(1):1-7.
Stevens DL. Invasive group A streptococcus infections. Clin Infect Dis. Jan 1992;
14(1):2-11.
Stevens DL. The toxins of group A streptococcus, the flesh eating bacteria. Immunol
Invest. Jan-Feb 1997; 26(1-2):129-50.
Stevens DL. Streptococcal toxic-shock syndrome: spectrum of disease, pathogenesis,
and new concepts in treatment. Emerg Infect Dis. Jul-Sep 1995; 1(3):69-78.
113
Tang WM, Ho PL, Yau WP, Wong JW, Yip DK. Report of 2 fatal cases of adult
necrotizing fasciitis and toxic shock syndrome caused by Streptococcus agalactiae. Clin
Infect Dis. Oct 2000; 31(4):E15-7.
Teele DW, Klein JO, Rosner B. Epidemiology of otitis media during the first seven years
of life in children in greater Boston: a prospective, cohort study. J Infect Dis. Jul 1989;
160(1):83-94.
Vitali LA, Zampaloni C, Prenna M, Ripa S: PCR m typing: a new method for rapid
typing of group a streptococci. J Clin Microbiol 2002, 40:679-681.
Wen YK, Chen ML. The significance of atypical morphology in the changes of spectrum
of postinfectious glomerulonephritis. Clin Nephrol. Mar 2010; 73(3):173-9.
WHO. Rheumatic Fever and Rheumatic Heart Disease. 2004. WHO technical report
series.
Wong W, Morris MC, Zwi J. Outcome of severe acute post-streptococcal
glomerulonephritis in New Zealand children. Pediatr Nephrol. May 2009; 24(5):1021-6.
Yoshinoya S, Pope RM. Detection of immune complexes in acute rheumatic fever and
their relationship to HLA-B5. J Clin Invest. Jan 1980; 65(1):136-45.
114
Erick Nyakundi Ondari was born in 1987 and is a native and resident of Nyamira, Nyanza, Kenya. He received his high school education in the year of 2005 from Sameta High School, Box 500 Kisii, Kenya. He achieved his Diploma programs in Medical Laboratory Technology and Computer Applications respectively in 2007 and 2009 and on the same year, he obtained a Bachelor of Science degree in Biotechnology from KSR Arts and Science College Tiruchengode, Periyar University, Salem 636-011 Tamilnadu, India. In the fall of 2009, Erick enrolled M.Sc. Biotechnology at AVS Arts and Science College Periyar University in Salem, and M.Sc. Psychology Tamilnadu University, Tamilnadu, India. He is currently pursuing Master of
Science in Biotechnology and M.Sc. Psychology alongside P.G. Diploma in Bioinformatics. Upon receiving his M.Sc., Erick plans to expand his knowledge in the field of molecular biology and medical microbiology by enrolling in a Ph.D. program and other related programs in order to realize his dreams in the developed countries. His main interests focuses on molecular biology and biomedicine. During his spare time he enjoys reading novels, writing, watching movies and listening music and adventure to meet new friends. His long vision aspiration is to educate the sciences by opening research centre to benefit the underprivileged and all mankind regarding our motherland.
115
This earth is His, to Him belong those vast and boundless skies;Both seas within Him rest, and yet in that small pool He lies.
Believes in positive thinking for destiny, Beautiful hands are those that do Work that is earnest and brave and true, Moment by moment all The long day
through….116
117