st. patrick church worship center st. matthew … › onlinebulletins ›...

12
Rev. Edward F. Namiotka, Pastor Rev. Jose Manjakunnel, Parochial Vicar Rev. Hugh J. Bradley, Part-time Parochial Vicar In-residence Rev. Nicholas Dudo, Vicar for Clergy, In-residence Deacon Philip E. Giordano Deacon Vincent Latini Deacon Michael DAriano Ed Barry, Finance Council Chairperson Tom Sullivan, Parish Council Chairperson St. Patrick Church 86 Cooper Street Woodbury 08096 Worship Center 96 Green Avenue Woodbury 08096 St. Matthew Church Ministry Center 8 Green Avenue Woodbury 08096 Holy Angels Catholic School 211 Cooper Street Woodbury 08096 856-848-6826 Mrs. Patricia Paulsen, Principal [email protected] Family Faith Formation Office 81 Cooper Street Woodbury 08096 Phone: 856-845-6826 Fax: 856-845-6859 Mrs. Irene Clark, Dir. of Rel. Ed. [email protected] Please join us for live-stream Sunday Mass 10am from St. Patrick Church ~ go to Holy Angels Parish Facebook page~ https://www.facebook.com/HolyAngelsParish/ All daily and weekend Masses remain suspended throughout the Diocese. All Parish offices remain closed until further notice. A list of Diocesan/Parish Masses being live-streamed can be found on Page 4 of this weekends bulletin.

Upload: others

Post on 29-May-2020

6 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: St. Patrick Church Worship Center St. Matthew … › onlinebulletins › 635template.pdf4:30pm—St. Matthew Church COMMUNION CALLS For sick or homebound, please call the parish office

Rev. Edward F. Namiotka, Pastor

Rev. Jose Manjakunnel, Parochial Vicar

Rev. Hugh J. Bradley, Part-time Parochial Vicar In-residence

Rev. Nicholas Dudo, Vicar for Clergy, In-residence

Deacon Philip E. Giordano Deacon Vincent Latini

Deacon Michael D’Ariano

Ed Barry, Finance Council Chairperson Tom Sullivan, Parish Council Chairperson

BLESSED SACRAMENT ADORATION Monday: 7:00pm—St. Patrick Church

ANOINTING OF SICK Saturday: 5:00pm—Worship Center

6:30pm—St. Matthew Church

CONFESSIONS Monday—Friday: 9:30am—St. Patrick Church

Saturday: 3:00pm—Worship Center 4:30pm—St. Matthew Church

COMMUNION CALLS For sick or homebound, please call the parish office

MASS SCHEDULE Saturday: 9:00am—St.Patrick Church 4:00pm—Worship Center 5:30pm—St. Matthew Church

Sunday: 7:30am, 10:00am, 6:00pm—St. Patrick Church 9:00am—St. Matthew Church 9:30am, 11:30am—Worship Center

Monday—Friday: *6:45am & 9:00am—St. Patrick Church *(no 6:45am Mass on civic holidays) Holy Day Vigil: 7:00pm—St. Patrick Church 6:45am, 9:00am, 12:10pm—St. Patrick Church

St. Patrick Church 86 Cooper Street • Woodbury 08096

Worship Center 96 Green Avenue • Woodbury 08096

St. Matthew Church

Ministry Center 8 Green Avenue • Woodbury 08096

Holy Angels Catholic School 211 Cooper Street • Woodbury 08096

856-848-6826 Mrs. Patricia Paulsen, Principal

[email protected]

Family Faith Formation Office 81 Cooper Street • Woodbury 08096

Phone: 856-845-6826 Fax: 856-845-6859

Mrs. Irene Clark, Dir. of Rel. Ed. [email protected]

BLESSED SACRAMENT ADORATION Monday: 7:00pm—St. Patrick Church

ANOINTING OF SICK Saturday: 5:00pm—Worship Center

6:30pm—St. Matthew Church

CONFESSIONS Monday—Friday: 9:30am—St. Patrick Church

Saturday: 3:00pm—Worship Center 4:30pm—St. Matthew Church

COMMUNION CALLS For sick or homebound, please call the parish office

MASS SCHEDULE Saturday: 9:00am—St.Patrick Church 4:00pm—Worship Center 5:30pm—St. Matthew Church

Sunday: 7:30am, 10:00am, 6:00pm—St. Patrick Church 9:00am—St. Matthew Church 9:30am, 11:30am—Worship Center

Monday—Friday: *6:45am & 9:00am—St. Patrick Church *(no 6:45am Mass on civic holidays) Holy Day Vigil: 7:00pm—St. Patrick Church 6:45am, 9:00am, 12:10pm—St. Patrick Church

Please join us for live-stream Sunday Mass 10am from St. Patrick Church

~ go to Holy Angels Parish Facebook page~ https://www.facebook.com/HolyAngelsParish/

All daily and weekend Masses remain suspended throughout the Diocese.

All Parish offices remain closed until further notice.

A list of Diocesan/Parish Masses being live-streamed can be found on Page 4 of this weekend’s bulletin.

Page 2: St. Patrick Church Worship Center St. Matthew … › onlinebulletins › 635template.pdf4:30pm—St. Matthew Church COMMUNION CALLS For sick or homebound, please call the parish office

Page 2—635

Altar Flowers/Sanctuary Candles Parish Office 845-0123 Altar Linen Committee Parish Office 845-0123 Altar Servers Deacon Vince Latini 609-932-6170 [email protected] Arts & Environment Rich Iannitti 686-1484 [email protected] Barbara Worrell 848-7205 Eucharistic Ministers Luke Zappile 267-882-7313 [email protected] Lectors Angelo Minutillo 384-3269 [email protected] Music Ministry Michael Plunkett 534-9663 Sacristan Mark Chapman 845-0123 Ushers Joanne Brown 845-0123ext.115 [email protected]

Adult Scripture Study Jerry Washko 845-6944 [email protected] Family Faith Formation Irene Clark, D.R.E. 845-6826 [email protected] Administrative Assistant Angela Jack Safe Environment Coord. Jeannie McParland RCIA/Adult Education Deacon Vince Latini 609-932-6170 [email protected]

Art Club Jerry O’Donnell 534-0063 Coffee Klatch Dolores Deitrich & Ann Hink 845-0123 Eucharistic Ministers to sick David Misilewich, OFS 251-9086 [email protected] Ecumenical Ministry Michelle Schultes 845-3568 Gathering of Women Barbara Giordano 609-706-5696 Phylis Misilewich 251-9086 Grief Support Julia Rutherford 845-1846 Tasha Amendt 848-3942 Lorraine Woodring 534-9095 Hospitality Committee Cindy Trovato 853-8115 Life & Social Justice Jerry Washko 845-6944 Anne Connor 845-4182 Marriage Preparation Deacon Phil Giordano 609-706-8212 [email protected] Parish Nurse Barbara Gallagher 430-5803 Parish Photographer Janet Butler 853-8507 [email protected] Prayer Line/Cards Joanne Brown 845-0123ext.115 [email protected] Spiritual Life Ministry Jerry Washko 845-6944 Judy Principe 845-7507 St. Vincent de Paul Sue Sherrer 848-7744 Vocations Parish Office 845-0123

Youth Coordinator Allie Sanders 845-6826 [email protected] Performing Arts Jennifer Liberto 494-4206 [email protected]

Council #1994 Gerald O’Hare 609-221-4883 Council #11713 Marc Maahs 201-745-6366 [email protected]

Ministry Coordinator Joanne Brown 845-0123ext.115 [email protected] Parish Secretary Kathi Roswell 845-0123ext.106 [email protected] Office Assistant Michele McGuinness 845-0123ext.103 [email protected] Bookkeeper Rose Marie Martinelli 845-0123ext.101 [email protected] Parish Facilities Mgr. Rob Curtis 845-0123 [email protected]

All Holy Angels Events/Meetings Cancelled Until Further Notice:

Art Club , Knights of Columbus Meetings (Councils #11713, #1994, and 4th Degree)

Coffee Klatch, Gathering of Women Lunch HACS Sunday BINGO.

ASL Interpreted/Inclusion and Special Needs Mass - - - - - -

Holy Angels Catholic School and Family Faith Formation Offices are closed.

Confirmation and First Communion postponed.

Masses continue to be offered PRIVATELY by the priests of Holy Angels Parish ensuring all intention requests are honored.

Please continue to check our website for more up-to-date information regarding ongoing changes in the parishes as we are notified from the Diocese. www.holyangelsnj.org

NEED HELP WITH YOUR ELECTRIC BILLS? If you use Atlantic City Electric and need help paying your bills, call your local Catholic Charities Office:

Atlantic County Cape May County 609-345-3448 609-886-2662

Camden County Cumberland County 856-342-4193 856-691-1841

Gloucester County Salem County 856-845-9200 856-299-1296

FOR MORE INFORMATION, VISIT: catholiccharitiescamden.org/electric-bill-assistance

Catholic Charities, Diocese of Camden, has been awarded a grant from Atlantic City Electric Helping Hands and can financially assist those in need of assistance with their electric bills!

Page 3: St. Patrick Church Worship Center St. Matthew … › onlinebulletins › 635template.pdf4:30pm—St. Matthew Church COMMUNION CALLS For sick or homebound, please call the parish office

ST. VINCENT de PAUL SOCIETY Thank you for your generous support

throughout the year!

If you or someone you know needs assistance, please call our help line: 856-848-7744.

“Lord, hold our troops in your loving hands. Protect them as they protect us. Bless them and their families for the selfless acts they perform in our time of need.” We ask this in Jesus’ name. Amen

Page 3—635

Please pray for the repose of the souls of

† Anna F. Brown †

† Audrey D. Brown †

† Rev. Francis J. Gramigna †

May their souls and the souls of all the faithful

departed, through the mercy of God, rest in peace.

Amen.

Please know that NONE of our parish priests, parish staff members, our Bishop or any Diocesan priests/staffs will EVER contact you via email or text messages to ask that you “provide them with gift cards,” “assist them financially in a crisis situation” or “help them with a problem.”

If you receive an email or text message which is seemingly being sent by a priest or staff member requesting financial assistance of any kind, please report it to the parish office immediately.

SATURDAY, MAY 30 9:00am-stp Frances Fagan r/b Peg & Bill Riddle 4:00pm-wc James Bonner r/b Deacon Vince Latini 5:30pm-stm David Munyan r/b wife, Anne

SUNDAY, MAY 31 7:30am-stp Dec’d members of the Gazzola & Andaloro Families r/b Deacon Vince Latini 9:00am-stm Jane Giordano

r/b Tom & Nova Sullivan 9:30am-wc Ronald F. Svitak r/b Deacon Vince Latini 10:00am-stp Erich Stubits r/b Grandmom Stubits 11:30am-wc Jack Kunze r/b Family 6:00pm-stp Jerzy Ksiezniak –Bill & Kathi Roswell

MONDAY, JUNE 1 6:45am-stp People of the Parish 9:00am-stp Elizabeth Dandrow r/b Michael Dandrow

TUESDAY, JUNE 2 6:45am-stp Flora Gordon r/b Maryann DeGirolamo 9:00am-stp Rita DeRose r/b Mary Ellen Travaline

WEDNESDAY, JUNE 3 6:45am-stp Intentions of the Celebrant 9:00am-stp Edwardo Rodriguez r/b brothers & sisters

THURSDAY, JUNE 4 6:45am-stp Intentions of the Celebrant 9:00am-stp Andy Cabrielli r/b Barbara Muckley

FRIDAY, JUNE 5 6:45am-stp Kyle & Kody Dean r/b Family 9:00am-stp John & Joan Hurley r/b Family 4:00pm-wc Jaime S. Mercado r/b parents and sister 5:30pm-stm Diane Barnholt r/b Tom & Diane Rumaker

To obtain a Mass card, even though the parish office is closed, please call and leave a voice message on the parish secretary’s voice mail: 856-845-0123 ext.106.

Leave your name and phone number and she will call you back in a day or two to get the specific information for the card.

SUNDAY, JUNE 7 7:30am-stp MaryJane Smith r/b John & Lorraine Panepinto 9:00am-stm MaryJane Smith r/b Dcn Phil & Barbara Giordano 9:30am-wc Stephen & Mary Sinkovich r/b Donna Rupp 10:00am-stp Intentions of Paul Mainardi r/b Julia Gray 11:30am-wc Multiple Mass Intentions Dec’d members of the Latini & DiCamillo Families r/b Deacon Vince Latini Christian Brenner r/b Roseann Andaloro 6:00pm-stp John Gallagher r/b his children

SATURDAY, JUNE 6 9:00am-stp Purgatorial Mass Intentions

Jean Dickson, William Hanrahan, Lois Collins, Catherine Drum, Herbert & Mary Lodge, Anna & Jason Lodge, Michael J. McGuinness, Jr., Deacon Paul Parchinski, Leo & Jean Parchinski, Joseph & Concetta North, Frank & Pauline Parchinski, Leonard Piontkowski, Louis & Margaret Morrison, Madeline Kraczyk, Joseph McKeever, Pete Delancey, Jose Suarez, Carmine & Mary Penza, Paul LaBarca, Joseph W. Wilson, Timothy McNasby, Rev. Kenneth Johnston, Elias Karim Sayad, Deceased members of the Ambrose & Magee Families, Di-ane Feery, Marion R. Giordano, MaryJane Smith, Peter Za-none, Edward Ruggieri, John C. Murray, Audrey D. Brown

Bishop Dennis Sullivan To celebrate

Pentecost Sunday Mass—May 31 at 10:30am Cathedral of the Immaculate Conception, Camden,

without a congregation. Mass will be broadcast via live stream

https://www.facebook.com/DioceseOfCamden/ https://www.youtube.com/camdendiocese

https://twitter.com/camdendiocese

Page 4: St. Patrick Church Worship Center St. Matthew … › onlinebulletins › 635template.pdf4:30pm—St. Matthew Church COMMUNION CALLS For sick or homebound, please call the parish office

Thank You to those parishioners who have continued to support the Bishop’s Annual Appeal during these difficult and very trying times. The House of Charity ministries need our support as never before as they reach out to the less fortunate. For those in a position to do so, your gift at this time would be greatly appreciated.

Parishioners can access the online giving portal by using this link: https://16042.thankyou4caring.org/

It would be best for parishioners to mail House of Charity and Catholic Strong payments to the respective lock box below:

Page 4—635

RESOURCES IN LIEU OF ATTENDING PARISH MASSES

PARISH LIVE STREAM MASSES: Cathedral Parish of the Immaculate Conception

http://www.camdencathedral.com (via https://livestream.com/stjosephs)

Christ the Redeemer, Atco https://christtheredeemer.us/

Christ the King, Haddonfield https://ctkhaddonfield.org/webcam

Our Lady of Guadalupe Parish Shrine https://www.guadalupeshrinenj.org/

Saint Andrew, Gibbsboro https://churchofsaintandrews.org/

St. Charles Borromeo, Sicklerville 9am daily Mass https://churchofscb.org/live-mass/

Our Lady of the Blessed Sacrament, Newfield daily and weekday Masses https://www.olbsparishnj.com/

NON-DIOCESAN LIVE STREAM MASSES: Catholic TV Network

https://www.watchthemass.com/ Mass everyday from Sunday – Friday;

Mass in Spanish every Sunday

Catholic TV http://www.catholictv.org/masses/catholictv-

mass/masses-live-demand

EWTN https://www.ewtn.com/tv – daily Mass at noon

Perfil Latino TV – https://perfillatino.org/

MASS ON THE RADIO: Domestic Church Media

https://domesticchurchmedia.org/

Relevant radio Daily Audio Mass 1pm https://relevantradio.com/

Live stream: Weekdays at 1:00pm; Sundays 10:00am & 12:30pm

Please know you can easily find Diocesan audio Podcasts and YouTube resources from local Catholic experts, produced by the Office of Communications with the Catholic Star Herald, to share with others at: talking.catholicstarherald.org/

“To each is given the manifestation of the Spirit for the common good.” - -1 Corinthians 12:7 For Stewards to receive the gift of the Holy Spirit, we must open our hearts and invite Him in! Ask the Holy Spirit to guide your thoughts, words and actions every

day! Be grateful for all the gifts God has given you!

Regardless of our individual circumstances, God has given all of us many blessings. What we do with those gifts is our gift back to God! By generously sharing everything we have and everything we are, we become more “God-centered” and less “self-centered” and our lives truly reflect God’s light, love and mercy.

A sincere “THANK YOU” to all of our loyal sponsors, who year after year, continue to support our parish bulletin by placing ads in the back of our bulletin.

Please say “THANKS” to all of our sponsors for their generous support and mention their ad when doing business with them.

Page 5: St. Patrick Church Worship Center St. Matthew … › onlinebulletins › 635template.pdf4:30pm—St. Matthew Church COMMUNION CALLS For sick or homebound, please call the parish office

From the Pastor’s Desk

Come Holy Spirit!

Dear Parishioners,

This weekend, we prepare to celebrate the descent of the Holy Spirit upon the Apostles and the Blessed Virgin Mary—Pentecost Sunday. Unfortunately, it will be another important solemnity on the Catholic Church calendar where the doors of our Church will be closed for public Holy Mass. Please pray that we will soon be permitted to resume public Masses once again. In the meantime, you are invited to watch our live-stream on Facebook.

Wisdom, understanding, counsel, fortitude, knowledge, piety and fear of the Lord are the traditional seven spiritual gifts that the Holy Spirit gives to us. They are enumerated in the Book of the Prophet Isaiah. (11:2-3) According to the Catechism of the Catholic Church: “The moral life of Christians is sustained by the gifts of the Holy Spirit. These are permanent dispositions which make man docile in following the promptings of the Holy Spirit.” (1830)

Here’s a brief summary of the Gifts of the Holy Spirit (from Scott P. Richert) that I found helpful:

Through wisdom, we come to value proper ly those things which we believe through faith. The truths of Christian belief are more important than the things of this world, and wisdom helps us to order our relationship to the created world properly, loving Creation for the sake of God, rather than for its own sake.

While wisdom is the desire to contemplate the things of God, understanding allows us grasp, at least in a limited way, the very essence of the truths of the Catholic Faith. Through understanding, we gain a certitude about our beliefs that moves beyond faith.

Through the gift of counsel, we are able to judge how best to act almost by intuition. Because of the gift of counsel, Christians need not fear to stand up for the truths of the Faith, because the Holy Spirit will guide us in defending those truths.

Fortitude gives us the strength to follow through on the actions suggested by the gift of counsel. Fortitude is the virtue of the martyrs that allows them to suffer death rather than to renounce the Christian Faith.

Knowledge allows us to see the circumstances of our life the way that God seems them. Through this gift of the Holy Spirit, we can determine God's purpose for our lives and live them accordingly.

Piety takes the willingness to worship and to serve God beyond a sense of duty, so that we desire to worship God and to serve Him out of love.

Fear of the Lord gives us the desire not to offend God, as well as the certainty that God will supply us the grace that we need in order to keep from offending Him. Our desire not to offend God is more than simply a sense of duty; like piety, the fear of the Lord arises out of love.

These Gifts of the Holy Spirit “complete and perfect the virtues of those who receive them. They make the faithful docile in readily obeying divine inspirations.” (Catechism, 1831) By being open and receptive to these gifts of the Holy Spirit you will be pleasantly surprised where the promptings of the Holy Spirit lead you! Fr. Ed Namiotka, Pastor

Page 5—635

Page 6: St. Patrick Church Worship Center St. Matthew … › onlinebulletins › 635template.pdf4:30pm—St. Matthew Church COMMUNION CALLS For sick or homebound, please call the parish office

Page 6—635

Reading 1 Acts of the Apostles 2-1:11 When the time for Pentecost was fulfilled, they were all in one place together. And suddenly there came from the sky a noise like a strong driving wind, and it filled the entire house in which they were. Then there appeared to them tongues as of fire, which parted and came to rest on each one of them. And they were all filled with the Holy Spirit and began to speak in different tongues, as the Spirit enabled them to proclaim.

Now there were devout Jews from every nation under heaven staying in Jerusalem. At this sound, they gathered in a large crowd, but they were confused because each one heard them speaking in his own language. They were astounded, and in amazement they asked, “Are not all these people who are speaking Galileans? Then how does each of us hear them in his native language? We are Parthians, Medes, and Elamites, inhabitants of Mesopotamia, Judea and Cappadocia, Pontus and Asia, Phrygia and Pamphylia, Egypt and the districts of Libya near Cyrene, as well as travelers from Rome, both Jews and converts to Judaism, Cretans and Arabs, yet we hear them speaking in our own tongues of the mighty acts of God.”

Reading 2 1 Corinthians 12:3B-7 12-13

Brothers and sisters: No one can say, “Jesus is Lord,” except by the Holy Spirit.

There are different kinds of spiritual gifts but the same Spirit; there are different forms of service but the same Lord; there are different workings but the same God who produces all of them in everyone. To each individual the manifestation of the Spirit is given for some benefit.

As a body is one though it has many parts, and all the parts of the body, though many, are one body, so also Christ. For in one Spirit we were all baptized into one body, whether Jews or Greeks, slaves or free persons, and we were all given to drink of one Spirit.

Gospel John 20:19-23

On the evening of that first day of the week, when the doors were locked, where the disciples were, for fear of the Jews, Jesus came and stood in their midst and said to them, “Peace be with you.” When he had said this, he showed them his hands and his side. The disciples rejoiced when they saw the Lord. Jesus said to them again, “Peace be with you. As the Father has sent me, so I send you.” And when he had said this, he breathed on them and said to them, “Receive the Holy Spirit. Whose sins you forgive are forgiven them, and whose sins you retain are retained.” Reading I: Acts 2: 1-11 The exciting narrative shifts from a room in a “house” where tongues of fire appeared over Mary and the Apostles to an unidentified gathering place where people from many countries hear preaching in their own languages.

Reading II: I Corinthians 12: 3b-7, 12-13 The community learns that it is the Spirit who enables their belief in the lordship of Jesus. All gifts come from Him, and when the community works together for the spread of the Gospel, it functions just like the parts of the human body do.

The Gospel: John 20: 19-23 This section returns us to Easter evening, and the risen Jesus’ appearance in His glorified body. Then He confers His peace on the Apostles; shows them His scars, and then gives them a commission.

Monday: Gn 3:9-15, 20 or Acts 1:12-14; Ps 87:1-2, 3 and 5, 6-7; Jn 19:25-34 Tuesday: 2 Pt 3:12-15a, 17-18; Ps 90:2, 3-4, 10, 14 and 16; Mk 12:13-17 Wednesday: 2 Tm 1:1-3, 6-12; Ps 123:1b-2ab, 2cdef; Mk 12:18-27 Thursday: 2 Tm 2:8-15; Ps 25:4-5ab, 8-9, 10 and 14; Mk 12:28-34 Friday: 2 Tm 3:10-17; Ps 119:157, 160, 161, 165, 166, 168; Mk 12:35-37 Saturday: 2 Tm 4:1-8; Ps 71:8-9, 14-15AB, 16-17, 22; Mk 12:38-44 Sunday: Ex 34:4b-6, 8-9; Dn 3:52, 53, 54, 55, 56; 2 Cor 13:11-13; Jn 3:16-18

Page 8: St. Patrick Church Worship Center St. Matthew … › onlinebulletins › 635template.pdf4:30pm—St. Matthew Church COMMUNION CALLS For sick or homebound, please call the parish office

My Jesus, I believe that you are present in the Most Holy Sacrament. I love you above all things and I desire to receive you in my soul. Since I cannot at this moment receive you sacramentally, come at least spiritually into my heart.

I embrace you as if you were already there and unite myself wholly to you. Never permit me to be separated from you. Amen.

Page 8—635

On the feast of Pentecost, the Apostles were in the Upper Room where they held the Passover with Jesus. All of a sudden, the Holy Spirit descended on the Apostles in the form of wind and fire. “And they were all filled with the Holy Spirit and began to speak in other tongues, as the Spirit gave them utterance” (Acts 2:4).

Then the Apostles were emboldened and rushed out to preach the Gospel and baptized 3,000 people. We call this the “birthday” of the Church because this is the day when the Holy Spirit made the Church visible to the world. “For we do not have a high priest who is unable to sympathize with our weaknesses, but one who has similarly been tested in every way, yet without sin” (Hebrews 4:15). It is astounding to think that in his hu-man nature, Jesus experienced fear and suffering, just like we do. Even better, he wants to help.

In the Old Testament, the Ark of the Covenant was covered in blue (or “violet”) fabric for traveling (Numbers 4:5-6). God’s Presence would “rest” on the Ark as a king sits on his throne (Exodus 25:22).

When Mary agreed to be the Mother of Jesus (i.e. God), she became his living “resting place.” In art, Mary’s blue mantle signals she is the new Ark of the Covenant.

Blue also indicates Mary’s royal status. Jesus is the King of Heaven making Mary the Queen Mother. In Biblical times, the mother (not the wife) of the king was the queen. She wasn’t as powerful as the king, but her intercession with him had significant influence.

Mary is not God, but her intercessory prayers for us are powerful because she is Jesus’ mother. When we consider that Mary is also our mother by grace, her blue mantle invites us to entrust our concerns to her. Ra-ther than an obstacle to Jesus, Mary leads us directly to him by a sure, safe path.

When we watch a loved one suffer – or suffer ourselves – hearing “it’s God’s will,” can feel unsatisfying. The implication is that God directs us like chess pieces, and bad things result. In fact, germs, atmospheric conditions, human error, or just plain chance account for what is often outside of our control. It helps to remember that God is always present, he wills our good, and evil is not of his doing.

God is always present. Our Father loves us deeply, cares about our concerns r ight down to the hairs on our heads (Matthew 10:30). He urges us to respond well to a world we can’t control. If we let him, God will enable us to learn and grow through our experiences, no matter how overwhelming or unpleasant.

God wills our good. It is not God’s will that we suffer. The ways of the world aren’t always in harmony with his will. However, his plan for us will bring us the ultimate good. He loves us with true love and wants us prepped and ready for Heaven.

God doesn’t make evil. What we see as evil in the wor ld, God can use for good. When we cooperate with him, suffering becomes meaningful, struggle worthwhile, victory affirming, and even the acceptance of what we cannot overcome life-giving, as they were for Jesus.

Page 9: St. Patrick Church Worship Center St. Matthew … › onlinebulletins › 635template.pdf4:30pm—St. Matthew Church COMMUNION CALLS For sick or homebound, please call the parish office

Parish Giving offers secure flexible online giving for parishioners who would like to make their donations online using a credit card or bank transfer. You never have to bring cash or checks to church. Giving electronically also helps the church save money and plan the budget. Check out our website for benefits and details: www.holyangelsnj.org

Page 9—635

Suspension of public Masses, also suspends a great share of the income that Holy Angels Parish needs in order to carry on its mission of proclaiming the Gospel and meeting the spiritual needs of its parishioners. We are all facing difficult times, but please remember your parish as well. For your convenience, consider joining many of your fellow parishioners who already participate in electronic giving. If electronic giving is not an option for you, please continue your regular support of the parish, by dropping off your weekly contributions to the rectory office or sending them through the mail.

When using your collection envelopes please DO NOT use tape, staples, stickers, etc. as these items prolong the process of counting the collection each week and in some cases, ruin the integrity of the checks and or cash inside. Thank you for your assistance with this and for your much needed continued support of the parish.

THANK YOU to all of our parishioners who generously continue to support the parish. Your sacri-fice is greatly appreciated. See the info above on how to sign up for Parish Giving and help to ensure the ability of your parish to continue to serve you. Thank you again!

Page 10: St. Patrick Church Worship Center St. Matthew … › onlinebulletins › 635template.pdf4:30pm—St. Matthew Church COMMUNION CALLS For sick or homebound, please call the parish office

BLESSED VIRGIN MARY, MOTHER OF THE CHURCH

Page 10—635

Page 11: St. Patrick Church Worship Center St. Matthew … › onlinebulletins › 635template.pdf4:30pm—St. Matthew Church COMMUNION CALLS For sick or homebound, please call the parish office

635 Holy Angels - Woodbury, NJ (i) John Patrick Publishing Company • (800) 333-3166 (www.jppc.net)

Landscape Design & Maintenance

Pavers • Gardens • Decks • MulchLawncare • Cleanups • Soil • Gutters

Commercial & Residential

[email protected]

BREAKFAST& LUNCH

OPEN 7 DAYS 101 Cooper St.

Woodbury856-384-6700

685 Salina Road, Sewell, NJ856-468-2500 • AdvancedSubacute.com

NEWFIVE STAR FACILITY

West Deptford, NJ856-384-1075

$50 OffWith Coupon

Route 45 & Elm Ave. Woodbury Heights, NJRoute 45 & Elm Ave. Woodbury Heights, NJ (856) 251-0011 (856) 251-0011

www.hollywoodcafeandsportsbar.comwww.hollywoodcafeandsportsbar.com

Open 7 DaysOpen 7 Daysa Weeka Week

7AM - 2AM7AM - 2AM

B U I L D Y O U R B U I L D Y O U R C O M M U N I T YC O M M U N I T Y- Shop Local -

P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !

WEATHERTECHWATERPROOFING

800-683-8654NJ 13VH10050800 • PA 142329

Parishioner Owned & OperatedFully Licensed & Insured • 35+ Yrs Exp.

References Avail. • Quality WorkmanshipFree Estimates • Home Advisor Approved

Water Management SystemsConcrete & Structural Repairs

Crawlspace EncapsulationMold & Mildew Remediation

10% Off New ClientsSr. Citizen, Military Vets, Police &

Firefi ghter Discountswww.wtwaterproofi ng.com

920 N. Evergreen Ave., Woodbury, NJ 08096 • NJ Lic.#5829

(856) 845-6505PLUMBING • HEATING • AIR CONDITIONING • KITCHEN & BATH REMODELING

Wedding InvitationsWedding Invitations Holiday CardsHoliday Cards

Log onto Log onto www.JPPC.netwww.JPPC.net conveniently from your home or office.conveniently from your home or office.

ONLINE CATALOG - ONLINE ORDERING - ONLINE PROOFINGONLINE CATALOG - ONLINE ORDERING - ONLINE PROOFING

All Major Credit Cards Accepted All Major Credit Cards Accepted FREE UPS GROUND SHIPPINGFREE UPS GROUND SHIPPING!

Commercial Rates are at an All Time Low. Contact us today to get a free analysis to see if

we can help Save you money with your monthly payments on your commercial property.

Multi-Family, Retail, Offi ce Building, Apartment and Condos. Can close in as little as 45 days!

Four season customer service is our top priority.

www.duqfunding.com1650 Market Street - Suite 3600

Philadelphia, PA 19103

What’s My Name?

The #WHATSMYNAME

Movement asks everyone

to simply ask drivers

“What’s my name?” before

entering their vehicle to

make sure it is the car they

are supposed to enter.

In Remembrance of

Samantha Josephson

#WHATSMYNAME

In Our 4th Decade of Quality Service

French Drains • Foundation Repair • Mold Remediation

877-401-4777www.morganbasementwaterproofing.com

All Work Guaranteed

Advertise Your Business Here

800-333-3166 ext. 161or visit www.jppc.net

Page 12: St. Patrick Church Worship Center St. Matthew … › onlinebulletins › 635template.pdf4:30pm—St. Matthew Church COMMUNION CALLS For sick or homebound, please call the parish office

635 Holy Angels - Woodbury, NJ (b) John Patrick Publishing Company • (800) 333-3166 (www.jppc.net)

MARK J. BOUCHERManager~Owner

N.J. Lic. 3766

• Immediate Arrangements• Pre-Planning• Customized Funerals• Traditional & Cremation Services• Grief Support• Memorial Folders & Programs• Ample OFF Street Parking

M V A N C T F W S

www.boucherfuneralhome.com

LLC1757 Delsea Drive • Deptford, NJ 08096

856-464-1097856-464-1097

A Salon for the Entire Family!Deva Curly Hair Expertva Curly Hair Expert

Creative Coloring/HighlightsCreative Coloring/Highlights

Brazilian BlowoutBrazilian Blowout

Kids 10 & underKids 10 & under $10 $100000 Cuts Cuts

Tuesday - Senior Citizen Day!Tuesday - Senior Citizen Day!

14 S. Broad Street • Woodbury856-845-2245

Cannot be combined with other off ers or promotions • With coupon. Limited Time

Tarrach’sService Center

Complete Automotive Repair & Maintenance

Serving Woodbury Since 1931ASE Certifi ed Technicians

856-845-8330934 N. Evergreen Ave.

Woodbury

1-800-993-0888www.mcgfuneral.com

Remembering Life Every Day...

34 Hunter StreetWoodbury, NJ 08096856-845-0888

Richard A. BonczakManager

N.J. Lic. No. 4254

573 Egg Harbor RoadSewell (Wash. Twp.)

NJ 08080856-582-3800

Richard A. BonczakManager

N.J. Lic. No. 4254

58 West Barber Ave.Woodbury, NJ 08096

856-845-0776 • N.J. Lic. #01844A

Christy’sAuto Body, Inc.

Dr. Sharon M VerdinelliFamily Den stry

856.464.1141friendlysmiles.com

MISTER B’SAUTO REPAIR

Anthony J. Brasberger856-251-1777

www.misterbauto.com658 Green St., Woodbury

Romano, Garubo & Argentieri

Counselors at Law, LLC52 Newton Ave.

P.O. Box 456, Woodbury, NJ856.384.1515 Ext. 112

[email protected]

Serving Lunch & DinnerBanquets Available1075 Riverwinds Dr.West Deptford, NJ

856-579-7900www.theriverwindsrestaurant.com

Discover Deptford’s premier Assisted Living home.

Intimate, home-like environmentConcierge & companion careIn-home physiciansEngaging activitiesTasty menus

Mention this ad and receive a *$2,500 gift certificate for use towards suite rental.

*Certain restrictions apply. Call for details.

201-293-8985

GUTTER DOCTO609-586-2300

pitman-837.comfortkeepers.com

Companionship • Housekeeping

Laundry • Meal Preparation

Bathing Assistance

Transportation • Shopping

And Much More!

856-582-1054Screened, Bonded

& Insured Caregivers

Susan M. PurvinAttorney at Law

44 Cooper Street, Suite 105, Woodbury(856) 251-0909

www.purvinlawoffice.comParishioner of Holy Angels Parish - Parishioner Discount Off ered

Calise Painting LLCFamily Owned & Operated

for over 30+ YearsParishioner Discount

Joe Calise609-820-9548Licensed & Insured

Cosmetic & General Dentistry615 Salem Avenue (Kings Highway)

Woodbury, NJ 08096(856) 853-6444

www.keriirvingdmd.comWe are always happy to meet new patients!

Jennifer Budd WrightDirector • NJ Lic. No. 4288

522 Salem AvenueWoodbury, NJ

856.845.1310

Memorials • Cremation • Pre-Planning

157 Bridgeton Pike Mullica Hill, NJ 08062

Wanda Lee McIlvaineBUDD GROUP

NJ Licensed Real Estate Broker-SalespersonOffi ce: 856-843-6000Direct: 856-853-0111Cell: 609-805-8415

[email protected] Circle of Excellence 2001-2019

Planning an Event?Let us help!

No Room Rental Fee!We do all the work!

Hors D’oeuvres Available!Handicapped Accessible

32 Delsea Drive • Westville, NJ 856.456.2382www.EileensAboveThePub.com

Mallory’s Army FoundationUnited Together In The Fight Against Bullying...

Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com

(973) 440-8657 • [email protected] It’s easy to join our mailing list! Just send your email address by text message:

Text MALLORYSARMY to 22828 to get started.Message and data rates may apply.

Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Work-ers - Critical Manufacturing - Chemi-cal & Hazardous Materials Financial Service - Private & Public Healthcare - Law Enforcement, Public Safety - Of-fi cers & First Responders - Food & Agriculture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & G W k C i i l M

To all those essential workers keeping us safe,

yourservice is

invaluable & appreciated.

afety --- OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOf cercercercercececeFirst Responders - Food & d & d & d &d &d &d &d &d &d d d d d d AgAgAAAAgAgAgAgrAgrAgrAgAgAgrAg

y Sector - WaWaWaWaWaWaWaWaWaWaWaWaWaWaWastestestestestesteteestestestestestestest &Waterwaste - Transportatatatttttttttion ionion ionioionion ioniononion onion & L& L& L& L& L& L& L& Lo& L& L& L& L& & gis

cs - Public Works & - Infrnfrnfrnfrnfrnfrnfnfnfnfnfrnfrnfrnfrnfrastructuucucucucucucuc rCommunications & IIIIIIIIIIIIIIInfornfornfornfornfornfornfornfonfornfornfornfornfornfornformatimammmmmmammmmmm o

echnology Workers - ComComComComComComComComComComComComComComCommunimumumummmmmmm ty &Workers -s -s -s -s -s -s -s -s -s -s --- CriCriCriririririiiiriiticacaticacacaticaticaticaticaticaticaticaticaticatical Ml Ml Ml Ml Ml Ml Ml Ml Ml Ml Mal l Ml M n

acturing - Chemical &&&&&&&&&&&l & l & l &l & HazaHazaHazaHazaHazaHazaHazaHazaHazaHazaHHHH rdourdrdrdrdrdrdrrdrdrdrdncial Services - DDDDDDDDDefeeeeeeefefens

dustrial Base - Commercial Faciles Workerssrssssss - RResidesidesidesidesidesidesidesididesidesidesidesideentientientientientientientientientiential &aaaaaaaa Shelteervices & FFFFFFFFFFFFFFFaciaciacilacilacilacilacilacilacilcilaciacilacilacilacilitieitieitieitieitieitietieitietieitieies -s -s - - - - - HyHyHygiHyHyHyHyHyHyHyHyHH ene Prodcts & Services es esesesesesesesesessss - Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Priiiiivivivivivivivaivaivativ e & Publiealthcare - Lawawawawawawawawawaw EnfEnfEnfnfnfnffnfnffffffforcorcorcorcorcorcorcorcorcorcorcorceorc ment, Publiafety - Officercercercercerererercercers &&&s &s &s &s &s &s &s &s &s &s &s &s & FiFiFiFFirsFFFFFFFFF t ResponderFood & Agrgrgrgrrrrriculiculiculiculiculiculiculiculiculiculicuiculiculicic turturturturturturureturturturturturtutut - Energy Secr - Waste e eee ee & Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& ttttterwtttettt aste - Trans

ortation &&&&& & & & & &&&&&& LogiLogiLogiLogiLogiogiogiogiLogiLogLogLogiLogLogLog stististststststisticststststsss s - Public Work- Infrastrtrrrrrrrrrrrrrrucucucucucuctctctuucucucucuctucuc re -e e e ee e CommunicationInformatioatioatioiooooooioooooonnn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Technology Worker

CoCoCoCoCoCoCoCoCoCoCoCoCoCoCommunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunity ity ity ity ity ity ity ity ity ity ity ity ityityity & Go&&&&&&&&&&& vernment Works - CrCrCrCrCrCrCrCrCrCrCrCrCrCrCriticiticiticticiticiticticiticiticticiiticiticiticitical al Mal Mal Mal Mal Mal Mal Mal a anufacturing - Cheml l ll & Ha& Ha& H& H& H& H& H& H& H& H&&&&& zardzardzardzardzardzardardardardardardardzardardardooooooous ooooooo Materials Financia

ervrvrvvvvice ice ice ice ice iceicicice icicicicicic - P- Pr- Pr- P- P- P- P- - - P- - - - ivativaivivvvvvvv e & Public HealthcarLaw EnEEE forcforcforcffforcforcforforcforcforcforceement, Public Safety - O

To all those nforcement, Public Sanforcement, Public Sa

essentiallture - Energylture - EnergyWater aste TraWater aste Tra

workerscs - Public Wors - Public WorCommunicatioCommunicatio

keeping echnology Wochnology Woovernment Wovernment W

us safe,acturing Caterials Finanaterials Finan

yournicationnicationWorkerWorke

service isovernment Workovernment Workacturing Chemacturing Chem

invaluable &us Materials Financiaus Materials Financiae & Public Healthcare & Public Healthcar

ment, Public Safety - OSafety - Othan

k yo

u

g gyWatateatttatatatattaaaaaa rwaswaswawaswwaswwwwaswwaswwwwasswasawawaw ste -tettttttetttee Transportation & Log

cccscccccc - PPPPPPPPPPPPPPPubliubliubliubliublililublibubbliubuubuuubu c c WoWoc WoWWWoWoWoWWoWWWoWc oc WoWWc Woc WWc WWWWccc rks rksrrksrkskrrkkkkrrk & - & -& -&& -&& -&&&&&&& --&&&& -&&& -&&& InfrInfInfrnfrInfInfrnfrII ffI ffInI fnfI fInfnfInnfnfn astructuCCoCoCoCoCoCoCCoCCoCCCCoooCCCCCCC mmunmmunmmmmmmunmm nmmmm nmmmmm nmmmm nnm nm nmmmm nicaticacaticaticatcatcatcatcattcatcatcatcattcatcatcatccacatcccatcc ionsionsionsnsionononsonsiooionssonsonsonsionoonoooon & I&&& I&& I&&& I& II& I& I& I&& nfornfornfornfornfornforforfornfornfoforfnfnfornfornfornfornforfofornfornforrrrnnffforrrmatimatimatmatmatiamatimatmattimatiatitimatiattatmatmatimattattmattmmmati

echhhhhhhhhnolonononoonnoloonolonnoln lonnolonooolonolonolonnnn on oonoo ggy Wgggg orkers - Community