st. cecilia church · 2020. 12. 11. · alina gallagher amelia goberdhan george graf jocelyn...

8
ST. CECILIA CHURCH 13 December 2020 A man named John was sent from God. He came for testimony, to testify to the light, so that all might believe through him.

Upload: others

Post on 23-Jan-2021

0 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: ST. CECILIA CHURCH · 2020. 12. 11. · Alina Gallagher Amelia Goberdhan George Graf Jocelyn Higgins Brooklyn Hernandez Isabella Ismeal Sophia Jacoby Isaiah Jean Shea-Liz Jn Francois

ST. CECILIA CHURCH

13 December

2020

A man named John was sent from God.

He came for testimony, to testify to the light,

so that all might believe through him.

Page 2: ST. CECILIA CHURCH · 2020. 12. 11. · Alina Gallagher Amelia Goberdhan George Graf Jocelyn Higgins Brooklyn Hernandez Isabella Ismeal Sophia Jacoby Isaiah Jean Shea-Liz Jn Francois

#179 2

OFFICES Rectory 215.725.1240 Eleanor Kerwick Business 215.725.1240 Susan Wagner PREP 215.725.2821 Eileen Litka School 215.725.8588 Bobbie Mitchell Tuition 215.725.2201 Lisa Hnat Fax 215.725.2130

Website: www.stceciliafc.org School: scsfoxchase.org CYO Facebook: Saint Cecilia Catholic Youth Organization

Rectory Office Hours Currently closed ~ call 215-725-1240 for emergency.

Saint Cecilia Church 535 Rhawn Street

Philadelphia, Pennsylvania 19111

PASTOR Reverend Charles E. Bonner PASTOR EMERITUS Reverend Msgr. Francis X. Dreger PAROCHIAL VICAR Reverend Robert Lucas PERMANENT DEACON Deacon Patrick Diamond PRINCIPAL Sister Catherine Irene Masino , IHM VICE PRINCIPAL Sister Carolyn Elizabeth Braun, IHM

SACRAMENTS

Baptism First three Sundays of the month at 12:15pm. Arrangements must be made at least two weeks prior to the Baptism. Attendance at a Pre-Jordan class is required for first time parents. Please register for class by contacting the Rectory at 215-725-1240.

Marriage Couples must contact a priest six months prior to the wedding.

Reconciliation Saturdays from 4:00 to 4:45pm

Homebound Visitation Please contact the Rectory.

ST. CECILIA CHURCH Sunday

Vigil 5:00pm (Saturday) 6:30am, 8:00am, 9:30am, 11:00am

Monday through Friday 6:30 and 8:30 am

Saturday 8:30 am

Every Saturday ~ 4:00-4:45pm Wednesday, December 23

4:00-5:00pm & 6:00-7:00pm

Confessions have returned to the Confessional

Christmas Eve Thursday ~ December 24

4:00pm & 7:00pm

Christmas Day Friday ~ December 25

6:30, 8:00, 9:30, 11:00am & 12:30pm

No Confessions Christmas Eve

MASSES WILL BE LIVESTREAMED ON OUR WEBSITE

Christmas Eve: 4:00 & 7:00pm Christmas Day 8:00am, 9:30am, 11:00am

Love your neighbor as yourself

Please remember to wear a facemask in church

and practice social distancing by staying 6 feet apart.

9:30am every Sunday

Page 3: ST. CECILIA CHURCH · 2020. 12. 11. · Alina Gallagher Amelia Goberdhan George Graf Jocelyn Higgins Brooklyn Hernandez Isabella Ismeal Sophia Jacoby Isaiah Jean Shea-Liz Jn Francois

#179 3

Responsorial Psalm

My soul rejoices in my God.

FOCUS: Advent is a season of waiting in joyful hope for the coming of the Lord.

Gaudete Sunday affirms the value of rejoicing and gives reasons for our rejoicing: God has given hope to his people waiting for redemption. We wait with rejoicing for what God has already accomplished and will yet accomplish through Christ. LITURGY OF THE WORD: In the first reading, Isaiah rejoic-es as he brings glad tidings of God’s vindication for his people. In the second reading Paul encourages rejoicing as God prepares his people for the return of the Lord. In the Gospel, John testifies to the light and cries out in the desert to make straight the way of the Lord. REFLECTION: We are invited to stand with God who wants an end to injustice and all that afflicts God’s creatures. This Ad-vent text offers hope for personal and community transformation and assures us that God will work with us as we attempt to bring about what Isaiah envisioned and Christ came to fulfill – justice, healing and peace throughout the world. So we ask ourselves:

What “glad tidings” do I hear for myself this Advent?

How can I share that good news with others?

First Reading ~ Isaiah 61:1-2, 10-11

The spirit of the Lord GOD is upon me, because the LORD has anointed me; he has sent me to bring glad tidings to the poor, to heal the brokenhearted, to pro-claim liberty to the captives and release to the prison-ers, to announce a year of favor from the LORD and a day of vindication by our God.

I rejoice heartily in the LORD, in my God is the joy of my soul; for he has clothed me with a robe of salvation and wrapped me in a mantle of justice, like a bride-groom adorned with a diadem, like a bride bedecked with her jewels. As the earth brings forth its plants, and a garden makes its growth spring up, so will the Lord God make justice and praise spring up before all the nations.

The word of the Lord. Thanks be to God.

Second Reading ~ 1st Letter of Paul to Thessalonians 5:16-24

Brothers and sisters: Rejoice always. Pray without ceas-ing. In all circumstances give thanks, for this is the will of God for you in Christ Jesus. Do not quench the Spirit. Do not despise prophetic utterances. Test everything; retain what is good. Refrain from every kind of evil.

May the God of peace make you perfectly holy and may you entirely, spirit, soul, and body, be preserved blame-less for the coming of our Lord Jesus Christ. The one who calls you is faithful, and he will also accomplish it.

The word of the Lord. Thanks be to God.

Holy Gospel ~ John 1:6-8, 19-28

A man named John was sent from God. He came for testimony, to testify to the light, so that all might believe through him. He was not the light, but came to testify to the light.

And this is the testimony of John. When the Jews from Jerusalem sent priests and Levites to him to ask him, “Who are you?” He admitted and did not deny it, but ad-mitted, “I am not the Christ.” So they asked him, “What are you then? Are you Elijah?” And he said, “I am not.” “Are you the Prophet?” He answered, “No.” So they said to him, “Who are you, so we can give an answer to those who sent us? What do you have to say for yourself?” He said: “I am the voice of one crying out in the desert, ‘make straight the way of the Lord,’” as Isaiah the prophet said.” Some Pharisees were also sent. They asked him, “Why then do you baptize if you are not the Christ or Elijah or the Prophet?” John answered them, “I baptize with water; but there is one among you whom you do not recognize, the one who is coming after me, whose sandal strap I am not worthy to untie.” This happened in Bethany across the Jordan, where John was baptizing.

The Gospel of the Lord. Praise to you, Lord Jesus Christ.

Page 4: ST. CECILIA CHURCH · 2020. 12. 11. · Alina Gallagher Amelia Goberdhan George Graf Jocelyn Higgins Brooklyn Hernandez Isabella Ismeal Sophia Jacoby Isaiah Jean Shea-Liz Jn Francois

#179 4

Mass Schedule ~ December 19-20 Saturday (Vigil) Celebrant: Fr. Lucas 5:00pm Lector: Paula Potts 6:30am Celebrant: Fr. Bonner Lector: Ruem Tan 8:00am Celebrant: Fr. Bonner Lector: Celine Severino 9:30am Celebrant: Fr. Lucas Guitar Group Lector: Michelle Riccobono 11:00am Celebrant: Fr. Lucas Lector: Rose Messina

This is the weekend to bring your gifts to the Riley and Sons Moving truck parked in the church parking lot. These gifts will be delivered to the shelters on Monday. We thank you for your generosity and the joy you are bringing to everyone receiving

these gifts. May you be blessed this Christmas season just as you have blessed others.

NICENE CREED

I believe in one God, the Father almighty, maker of heaven and earth, of all things visible and invisible.

I believe in one Lord Jesus Christ, the Only Begotten Son of God, born of the Father before all ages. God from God, Light from Light, true God from true God, begotten, not made, con-substantial with the Father; through him all things were made. For us men and for our salvation he came down from heaven,

(all bow) and by the Holy Spirit was incarnate of the Virgin Mary, and became man.

For our sake he was crucified under Pontius Pilate, he suf-fered death and was buried, and rose again on the third day in accordance with the Scriptures. He ascended into heaven and is seated at the right hand of the Father. He will come again in glory to judge the living and the dead and his kingdom will have no end. I believe in the Holy Spirit, the Lord, the giver of life, who pro-ceeds from the Father and the Son, who with the Father and the Son is adored and glorified, who has spoken through the prophets. I believe in one, holy, catholic and apostolic Church. I confess one Baptism for the forgiveness of sins and I look forward to the resurrection of the dead and the life of the world to come. Amen.

Please pick up a bulletin each week as you enter church. The Sunday readings will be printed in the bulletin every week. And, don’t forget to take that bulletin with you when you leave.

We would love to see everyone in person at Mass, but if you have any health issues, we strongly suggest you take advantage of the livestreaming of our Masses. We livestream the 9:30am Sunday Mass every week. For a list of the Christmas Masses, please see page 2 of this bulletin.

Emily Barr Riley Caggiano Anishka Chery Katherine Cole Rory Donnelly Keira Doris Alexandra Felice Lucas Free Alina Gallagher Amelia Goberdhan George Graf Jocelyn Higgins Brooklyn Hernandez Isabella Ismeal Sophia Jacoby Isaiah Jean Shea-Liz Jn Francois Fiona King Sophia Klepcynski Rose Klepesky Mandy Knox Francesca Marzullo Finley McHugh Melany Merida Penelope Mullin Rebecca Montvydas Madeleine Monsonego Steven Nguyen Amilio Noel Jorge Prado Ryan Prosperi Jose Rosario Attis Rudic Anthony Schiavone Grady Shipton Avery Smith Edwin Smith Joseph Toomey Maggie Vogler Anthony Voscott Emma White Juliette Zolynski

Manna Food Drive Next weekend we contin-ue the collection of non-perishable food items. Thank you for bringing canned goods, peanut butter, cereal, pasta, etc. to the vesti-bule of the church. God bless you for helping others.

Madeline Elizabeth Schiavone

God Bless

to the children who received their First Penance on Friday ~ December 4, 2020

Page 5: ST. CECILIA CHURCH · 2020. 12. 11. · Alina Gallagher Amelia Goberdhan George Graf Jocelyn Higgins Brooklyn Hernandez Isabella Ismeal Sophia Jacoby Isaiah Jean Shea-Liz Jn Francois

#179 5

Don’t miss this opportunity Watch ‘The Search’

You will be amazed how good it will make you feel.

To set up your FREE account 1. Visit FORMED.org 2. Click Sign Up 3. Select “I Belong to a Parish or Organization” 4. Type in St. Cecilia Parish Community 5. Enter your email ~ and you’re in!

Our parish has a FORMED subscription just for YOU!

Page 6: ST. CECILIA CHURCH · 2020. 12. 11. · Alina Gallagher Amelia Goberdhan George Graf Jocelyn Higgins Brooklyn Hernandez Isabella Ismeal Sophia Jacoby Isaiah Jean Shea-Liz Jn Francois

179 Church of St. Cecilia, Philadelphia, PA (3rd) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net

Stone • Brick • Concrete • Pointing • EP Henry • Stucco • Waterproofi ngZucaroZucaroCONTRACTINGCONTRACTING

Masonry ContractorsSince 1922

215.533.1934215.533.1934

20% Discounton Labor for all Mechanical Work

15% Cash Paidfor Accident Referrals

$39.00+tax

Inspection & Emissions

$19.95Oil Change

(Most Cars)

Auto Body & Repair Shop

612 Huntingdon Pike, Rockledge 215-379-3113 www.abbysautocenter.com

Lifetime Warranty on all Paint & Body Work. Satisfaction Guaranteed

In Our 4th Decade of Quality Service

French Drains • Foundation Repair • Mold Remediation

215-639-8500www.morganbasementwaterproofing.com

All Work Guaranteed

• Physical, Occupational & Speech Therapy• Short & Long Term Care• Beautiful On-Site Chapel With Daily Mass• Memory Support • Respite Stay• Adult Daycare • Woundcare• IV Therapy • Trach Care

ST. JOHN NEUMANN CENTERFOR REHAB AND HEALTHCARE

10400 Roosevelt Blvd.Philadelphia, PA

215-698-5600www.stnrehab.org

BUILD YOUR COMMUNITYBUILD YOUR COMMUNITY- Shop Local -

P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !

Rafferty Roofi ng215-281-0771

PA062531

For Quality & Honest Work at Reasonable PricesFree Estimates • Licensed & Insured

20 YEAR GUARANTEE ON HOT WHITE RUBBER ROOF

Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications

To all those essential workers keeping us safe,

yourservice is

invaluable & appreciated.

rivate & Public Healthcare - La- - - -- -- - - - nforcement, Public Safety - OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOfficeccecececececececececececece

ponders - Fooooooooooood &d & d &d & d & d & d & d &d & d &d &d &d & d & d & AAAAAAgrAAAAAAAAlture - Energy Sector rrrrrrrr rrrrr - Wa- Wa- Wa- WWW- Wa- Wa- Wa- WaWa- Wa- Wa- WWaste

Waterwaste - Transportattattattattattattatattatattattattattta ion ion ion ononononon on on onon on on on & Lo&&&&&&&& gics - Public Woooooooorks r & - & Infrfffffffffffff astastrastrtstttstaststtsttstst uctur

Communicatatatttttttatattatttioionononsionsionionionionsionionsiooniono & I&&&&&&&&& nforf matioy Workeorkekkekekekekekekekekekkekers -rs -rs -rs -rs -rs -rs -rs rs -rs -rs -rs -rs -s -s - Community

overnment WWWWWWWWWWWWWWWorkeorkeorkeorkeorkorkorkeorkeorkeorkeorkeorkorkorkeorkerrs - Critical Maacturing -g ---g --g -g ---g --g --- CheCheCheCheCheCheCheCheCheCheCheCheCheCheChemical & Hazardouateteeeeeeeeeeeeeerialrrrrrrrrrrrrrr s FiFiFiFiFiFiFiFiFiFiFiFiFiFiFinancnancnannannananaannanannancnancnancan ial Services - Defensdustristristristristristrstrtristristristritristritritrial Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Baasasasasasasase - Commercial Faciesssssessessssssss WorWorWorWorWorWorWorWorWorWorWorWorWorWorWorkkkkkkekekekerskekekkkk - Resid ti l & Sh ltervicesicesicesicescescecescesicesicesicescescescesces & Facilities - Hygiene Prod

To all thoserivate & Publicrivate & nforcement Pubnforcement Pub

ssentialFirst RespFirst Resp

workersWaterwaste Waterwaste

keepingcs - PublicuCommunCommun

s safe,chnologychnology

yzardouzardouD fD

service isvices DefensDefenmercial Facimercial Faci

invaluable &idential & Shelteidential & ShelteH i P dH i Ptha

nk yo

u

afeeeefeeeeeeeefefefefetyty --ttty --ttttty t -tt -- OffiOOOOOOOOOOOOO cers & First RespondeFFFoFFFFFF od &d &d &d &&&d &&d &&od d &&d &d &d &d &d &d &d &d &d AgrAAgrAAAAAgrAAAAAgrgrrgrrAggrrrAgrA rrgAAA rAAAgrAAgg iculicucuiculuiculiculiculcuiculiiicuicultureturetureurertureurturertureurrrurerrrurrtur - E- E- EE- E- E- E-- EEE- EEEnergy Se

ooroorror rrr - WaWa- WaWa- Wa- WW- WaWWWWWW- W- WWaa- WWaWaWaaWaasteststtstee stesssteetsteetts ess ees e & Wa& Wa& W& Wa& WaWaWW& Wa& Wa& WaW& Wa& Wa& WaWWWaa&& W& WaWa& Waterwterwterwterwteterwterwterwterwerwtterwe wteteerwerwerwrwwterwtterwwwasteastasteaasteasteaastesteteasteaassteasteaststststeeeeeee - TTT- T- TT- TT- T--- T- TT- T-- ranrarrarararrararraararaaaraarortrtrtrtrtrrrttttttatioatitiatiotitatiattiiatataatatataaaa n &&n & n &&n &nn Logistics - Public Wor

After

Now Hiring friends and family caregivers.www.Bayada.com/careathome

Quality Senior Home Care Services since 1975.

Call today to learn more!(215) 419-7868

MONDAY, December 14 6:30am – Thomas Wagner 8:30am – Ed & Rose Lieber

TUESDAY, December 15 6:30am – Mary & Edward McGuinn 8:30am – Thomas O. Maginnis, Sr.

WEDNESDAY, December 16 6:30am – Alice Vozzelli 8:30am – William McFeely

THURSDAY, December 17 6:30am – Ursula Wolff 8:30am – Charles & Margaret Heller

FRIDAY, December 18 6:30am – John & Anne Robbins 8:30am – Grace Bartleson

SATURDAY, December 19 8:30am – William E. Staudt & Patricia Staudt 5:00pm – Frank Chiccino (birthday)

Walter Hnat Ed Lieber Christopher Rodgers Patricia Moore James J. Tobin Mary Schultz Ann Marie Tobin Masgai Meghan Kovacs Joan Marie Reiley John Lawrysk Maki Turner Stephanie Morgan Kirsten Hosack-Edling James Potts Mary Benson Mary Jane Brough Esther Sharp Leo Wuestkamp Stephen Ruczynski Helen Tobin Andrew Slivjak Melissa Fischer George Burbage Patricia Greenleaf Rita Giordano Gregory Farrell Lisa Kovacs-Breuer Ed MacNew Timothy Martin John Smykal Julia McCauley Alice Davis Josephine O’Donnell Mary Matthews Jack Vogler Marguerite Zeltman Eileen Gaynor Alberta DeMasi Marian Diel Kathi Silcox Eleanor DeNoble Eugenia DiSilva Alonso Castillo Connie Merkel Catherine Needham Betty Harding Bill Scott Catherine Davis Theresa Halbherr Isabel Schmidt Robert McGrody Vincent Florian Fran McManus Helen Flood Clare Gilchrist Lou Baldwin John Carr Joseph Smyth Brendan Roth

Always in our prayers Mary Mikus

Frank Rozniakowski Edward Brown

Page 7: ST. CECILIA CHURCH · 2020. 12. 11. · Alina Gallagher Amelia Goberdhan George Graf Jocelyn Higgins Brooklyn Hernandez Isabella Ismeal Sophia Jacoby Isaiah Jean Shea-Liz Jn Francois

179 Church of St. Cecilia, Philadelphia, PA (i) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net

FOX CHASE WINDOWS & DOORSSALES - INSTALLATION

Please Call ... 215-725-4211

FREE ESTIMATES

Parish Member

ALL TYPES WIRING & REPAIRS215–329–9456 Parish Member

G.J. ROSSI & SONELECTRICIANS

Now In Our 3rd Generation

PATRICK J. FOY(215) 281-9656

Interior & Exterior PaintingWallpapering & Scraping

FREE Estimates • Reliable • Honest

309 Central Ave., Cheltenham379-0881

JOSEPH P. FARLEYPLUMBING & HEATING

Alterations-Jobbing

Reg. No. 3121P.A. 043294

Classic OpticalDR. AMY C. TAN, O.D. 215-722-2242

*Eye Exams * Contact Lenses * Eyeglasses6516 R S A . (G R S )

Sweeney’sVerree Tavern

KITCHEN OPEN FROM 11 AM TO MIDNIGHT

The all new Kim’s Crab CakesPhilly’s Largest Wings

All Soups & Chili HomemadeTAKE OUT AVAILABLE

All Major Sporting Events With 6 Colored TV’s

Finest Tavern Food Now Available in our

New Private Dining Room

7968 VERREE RD.215–725-3366

Mariann OwensOffi ce: (215) 698-2000Direct: (215) 698-2027Cell: (215) 280-7222Email: [email protected] Buyers and Sellersin Philadelphia, Bucks, and Montgomery CountiesEach Offi ce Independently Owned and Operated

2000

SENIOR CITIZEN DISCOUNTS

ReliableFull Service Plumber

PLUMBING, HEATING & DRAIN CLEANING EMERGENCY SERVICE

INSURED • FREE ESTIMATES215-722-6783215-379-8300

SERVING ENTIRE CITY & SUBURBSCITY VIOLATIONS CORRECTED

SEWER LINES REPLACED • HOT WATER HEATERSFROZEN PIPES • WATER PRESSURE INCREASED

DIGGING & EXCAVATION SPECIALISTS

Reg. Master Plumber #4287Michael Zalewski

Experience Peace of Mind:Pre-Arrange Your Burial at an

Archdiocese of Philadelphia Cemetery.

• Save today through pre-planning• Convenient terms for all of your burial needs• Traditional in ground, mausoleum & cremation options available at most cemeteries

CALL 215-352-4001 TODAY

Leslie AitaVocalist

[email protected]

Parishioner

Visit Us At Our New Location

Rockledge Plaza Huntingdon Pike

408 Huntingdon PikeRockledge, PA 19046215-379-2100

Family Ownedand Operated

Since 1948

$350Off Any New Stairlift With This Ad

• FREE in home evaluations• Family owned & operated for more than 20 years

1.888.900.8883

www.Tri-StateStairlifts.com

Traditional Funerals, Church Funerals & Memorial Services, Cremations“ONE FAMILY HELPING ANOTHER”

7450 Oxford Ave Phila, PA 19111 215-728-1050

David G RichardsonSupervisor/Owner

Cher l A Webb-RichardsonManager & LCBA Insurance Rep

Parishioner

richardsonsfuneralhome.com Councilman Brian O’Neill

Northeast offi ces near St. Cecilia ParishionersFox Chase - 432 Rhawn Street • 215-685-6431 • Rhawnhurst - 7522 Castor Ave • 215-685-0438

[email protected]

FreeNotaryPublic

Free copies

& Faxes

Karon MassadoReal Estate Salesperson

o 267.435.8015 m [email protected]

1601 Market St.- Fl. 19, Phila, PA

Wackerman Funeral Home, Inc.Wackerman Funeral Home, Inc.8060 Verree Rd. Philadelphia, PA 19111

www.wackermanfuneralhome.com 215-342-5200 Elizabeth Wackerman Bailey, Supervisor 1944 – Austin C. Wackerman - 2017 Emily Wackerman Funeral Director

Free & Confi dential Pregnancy Services24 Hour Hotline: 1-800-550-4900

www.BirthRight.org

“It is the right of every pregnant woman to give birth, and the right of every child to be born.”

~Birthright Charter7986 Oxford Avenue

Philadelphia, PA 19111215-728-0385

A Blessing from God

John DeCristofaroROOFING

Specializing in: Hot Asphalt RoofsShingle Roofs • Gutters • Spouts

215-379-2953 Member of St. Cecilia

A Tompkins Community BankFormerly Madison Bank

8000 Verree Rd., Philadelphia(215) 722-4566

www.risingsunhomecare.org

Providing The Highest Quality Care

Parishioner of St. Cecilia

215-605-9555

catering For your next event, call ahead to order

- Pickup or Delivery -WHITMAN SQUARE 215-969-3455 x1

Eric McHughParishioner

CYO Volunteer OFFERING AUTO, HOME, LIFE,

& BUSINESS INSURANCE Call for a quote

215-328-9990 x7001 or email [email protected]

210 Huntingdon Pike, Rockledge

Patronize the Adve isers who make this bulletin possible!

BUILD YOUR COMMUNITY!

Patt o i e the A

SHOP LOCAL

Local, trusted, proven, effective, supportive, referrals, relationships, affordable, repetitious, versatile, lasting.

This describes the power of...

Placing an ad in the parish bulletin supports the parish while building your business - THAT’S A WIN WIN!

Call 1.800.333.3166 TODAY!

Pranic Healing infl uences your natural life force to bring about a

healthier body.

Dan McMeans Pranic Healer

215 962 [email protected]

https://danmcmeans.wixsite.com/advancehealing

Page 8: ST. CECILIA CHURCH · 2020. 12. 11. · Alina Gallagher Amelia Goberdhan George Graf Jocelyn Higgins Brooklyn Hernandez Isabella Ismeal Sophia Jacoby Isaiah Jean Shea-Liz Jn Francois

IT'S TAX TIME!Be Confi dent In Your Accountant

For pricing & appointments at your home or my offi ce call:

215-603-4535 or 215-572-0529

179 - Church of St. Cecilia, Philadelphia, PA (b) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net

Schmidt’s Florist 700 Solly Ave., Phila., PA 19111

www.schmidtsfl orist.com 215-745-6234

LAW OFFICES

PAUL A. COGHLAN437 RHAWN STREET

PHILADELPHIA, PA 19111(215) 725-5998

FAX (215) 725-3904

Robert Wetzel, F.D.419 Huntingdon Pike, Rockledge

Erich Wetzel, Supv.Willow Grove - Bill Herchenroder, Supv. INC.

Funeral Directors Since 1881 215-663-8550 • www.wetzelandson.com

Stewart and McGowanATTORNEYS-AT-LAW

6221 RISING SUN AVE. (Opposite St. William’s Church)338-2800

S W D ’ E

WE DELIVER~ Traditional Pizza~ White Pizza~ Tomato Pies

The Original

Pizza6500 Rising Sun Ave. • 215-745-9992

Nora McCloskeyParishioner

Fine Art ClassesWorkshops & Partiesfor Children & Adults215-301-0103

www.bloomingartiststudio.comwww.bloomingartiststudio.com

PLUMBING, HEATING, DRAIN CLEANING & AIR CONDITIONING

SENIOR CITIZEN DISCOUNTFREE ESTIMATES

Ph: (215) 728-1482Fax: (215) 742-7098

8675 Torresdale Ave.Philadelphia, PA 19136

WWW.BILLFRUSCO.COM

O’Donnell PaintingInterior and Exterior

House Painting & Drywall RepairNeat Clean Work • No Job Too SmallFree Estimates 215-677-5854

JOHN F. GIVNISH(3rd Generation)

JOHN F.X. GIVNISH, III(4th Generation)

Serving the Archdioceseof Philadelphia with

grace and dignity since 1928

1-800-GIVNISH

Each Offi ce Independently Owned and Operated

Larry AitaREALTOR®

Seniors Real Estate SpecialistOutstanding Agents. Outstanding Results.

Regency Realty

Cell: (215) 478-4344Offi ce: (215) [email protected]’s Get Moving!

2018 Outstanding

Agentof the Year

s.

Parishioner

Serving Families Since 1900

Joseph J. McGoldrick Funeral Home, Inc.Joseph J. McGoldrick Funeral Home, Inc.Joseph J. McGoldrick, F.D. 1924-2013

Th omas M. McGoldrick, F.D. SupervisorJames T. Meyers, F.D. • Timothy J. Meyers, F.D.

215-884-0800 507 West Avenue, Jenkintown, PA 19046 www.mcgoldrickfh .com

Mallory’s Army FoundationUnited Together In The Fight Against Bullying...

Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com

(973) 440-8657 • [email protected] It’s easy to join our mailing list! Just send your email address by text message:

Text MALLORYSARMY to 22828 to get started.Message and data rates may apply.

What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my name?” before entering their vehicle

to make sure it is the car they are supposed to enter.

In Remembrance of Samantha Josephson

#WHATSMYNAME

Commercial Rates are at an All Time Low. Contact us today to get a free analysis to see if we can help Save you money with your monthly

payments on your commercial property. Multi-Family, Retail, Offi ce Building, Apartment and Condos. Can close in as little as 45 days! Four

season customer service is our top priority.

www.duqfunding.com1650 Market Street - Suite 3600, Philadelphia, PA 19103

JIM CASEYWallcoveringPainting • ScrapingClean Work • Since 1986215-379-0558 Member of Parish

Professionals Serving Professionals

Jay B. ComlyBuilding & Offi ce Maintenance

[email protected]

w/an A+ Rating

Commercial • AutomotiveResidential • Safes

Fully Equipped RadioDispatched Mobile Trucks

7936 Oxford Ave. 215-745-5007

Full Service Locksmith Since 1978Member of Parish

VERREEPHARMACY

7960 VERREE RD.(AT RHAWN)Free Delivery

M-F 9AM - 8PMSat. 9AM - 6PM

Sun. 9AM - 1 PM215-342-0100

Mitchell Spivack, R. PH.

HandymanElectric, PlumbingOdd jobs... Just Ask!

From McCloy’s TV 267-231-8785

Tax & AccountingFrancis J. McConnell CPA

Tax Preparation • Individual & Business(Across from St. Williams)

Call (215) 742-3428 for Appointments

Charles P. Elliott, PC 110 Central Ave

Cheltenham, PA 19012

215-663-2500We Make House Calls

Complimentary InitialConsultation

We are here for all your tax, IRS, fraud investigations,

& inheritance tax.

RENEE ROACHEREALTOR ~ PARISHIONER

FOX CHASE SPECIALISTBuying or Selling a Home?

Call Today!

Office 215-961-6000 Cell [email protected]

EASTERNEEEAEAAEAEEEEEEEEEEEEEEEEAEASTSTTTSTTTSSTTTTTTTTTEEREEEEEEEEEEEEEEAEAEAEEEEEEEEASTSTTTSTTSSTTTEEEREEEE

A Signature Hair Salon llc$10 OFF Color ServiceMen | Women | Children

7950 Bustleton Ave., Philadelphia, PA215-821-3522

Cochrane Construction LLC

ROOFINGSIDING * GUTTERS

Chimney Restorations & RepairsLicensed & Insured PA # 154589

Senior Citizen Discounts • Free Est.215-839-4317

www.cochraneconstruction.org

Friends, Family, Neighbors!

1-844-640-4200 PaulsRun.org/Living

Wedding Invitations Wedding Invitations & Holiday Cards& Holiday CardsLog onto Log onto www.jppc.netwww.jppc.netconveniently from yourconveniently from yourhome or offi ce.home or offi ce.Online CatalogOnline CatalogOnline OrderingOnline OrderingOnline ProofingOnline ProofingAll Major Credit All Major Credit Cards AcceptedCards Accepted

FREE UPS FREE UPS GROUND GROUND SHIPPINGSHIPPING!

WE CARE AND IT SHOWS

Beautiful On-Site Chapel with Daily Mass - Respite Stay Available

We Acknowledge We Appreciate

2990 Holme Ave., Phila.215-335-2100

www.imrehab.org

IMMACULATE MARYCENTER

Rehabilitation & Healthcare

Advertise Your Business Here

800-333-3166 ext. 161www.jppc.net