SSR Analysis of the USDA-ARS Cacao collection

Brian M. Irish

USDA-ARS Tropical Agriculture Research Station

Mayaguez, Puerto Rico

Management of Tropical/Subtropical Genetic Resources and Associated Information Horticulturist/Plant pathologist

Bananas, plantains, cacao, sapote, nispero, Annona spp., Garcinia spp., bamboo, mango, quenepa (Spanish lime)

Acquire, propagate (disease-free), maintain, characterize and distribute

Genetic diversity Characterize Phenotypic, Molecular

All information is incorporated in our GRIN database All accessions are propagated clonally by means of

divisions, cuttings, air-layers or grafting 2 field/1 lab technicians, 1 Information technologist, 1

gardener, 3 part time lab/field technicians, 1 graduate/1 undergraduate students

Cacao or Cocoa

Industry (billion dollar industry in the U.S.) Cosmetics, soaps Chocolate (bars, powder) Large food processors: ADM/Barry Callebaut Confectionary industry

Mars, Hershey's, Cadbury, Nestle and many others Other industries that are directly related

in chocolate making Sugar, dairy, nuts

Replicated and characterized collection with freely available germplasm

Cacao collection at TARS

Theobroma cacao 154 accessions/clones (924)

In the process of introducing ~50-100 accessions Breeding/selection programs at CATIE, EET-

Pichilingue, CRU, U. Reading, Brazil and USDA Evaluation

Number, weight, color, size of pods, number and weight of seed, chocolate quality, disease and insect resistance

Due to the nature of how the crop is propagated and the length of time it has been maintained, errors in propagation have accumulated (world)

A set of 15 microsatellite markers have been used to fingerprint cacao worldwide.

Day 1 Day 2 Day 3

Day 4 Day 5 Day 6

Day 7 Day 8 Day 9

Accession -AC T 1/1. From 9/6/07-9/14/07

1

2

5

6

3 4

April 8th, 2008

Microsatellites (SSRs)

Short repetitive sequences in Eukaryotes in non coding regions of the genome

Highly variable and inherited in Mendelian fashion

Developed at CIRAD and USDA On different chromosomes (10) and

separate linkage groups High allelic diversity in cacao genotypes mTcCIR – Microsatellite Theobroma

cacao CIRAD

Primer name

Forward and Reverse Sequences (5' - 3')

Chrom Tm Repeat MotifAllele Range

Alleles/Locus† HObs

‡ HExp‡ PIC

mTcCIR1§ F: gcagggcaggtccagtgaagcaR: tgggcaaccagaaaacgat

8 51 (ct)14 127-144 5 0.47 0.45 0.44

mTcCIR6F: ttccctctaaactaccctaaat R: taaagcaaagcaatctaacata

6 46 (tg)7(ga)13 222-247 9 0.64 0.64 0.96

mTcCIR7F: atgcgaatgacaactggtR: gctttcagtcctttgctt

7 51 (ga)11 148-163 6 0.61 0.65 0.65

mTcCIR8F: ctactttcccatttaccaR: tcctcagcattttctttc

9 46 (tc)5 tt(tc)17 ttt(ct)4 288-304 6 0.56 0.62 0.92

mTcCIR11F: tttcctcattattagcagR: gattcgatttgatgtgag

2 46 (tc)13 288-317 11 0.61 0.66 0.74

mTcCIR12F: tctgaccccaaacctgtaR: attccagttaaagcacat

4 46 (cata)4 n18 (tg)6 188-251 10 0.73 0.74 0.80

mTcCIR15F: cagccgcctcttgttagR: tatttgggattcttgatg

1 46 (tc)19 232-256 11 0.82 0.81 0.87

mTcCIR18F: gatagctaaggggattgagga R: ggtaattcaatcatttgaggata

4 51 (ga)12 331-355 9 0.66 0.67 0.72

mTcCIR22F: attctcgcaaaaacttag R: catccaaggagtgtaaatag

1 46 (tc)12 n146 (ct)10 279-290 6 0.60 0.58 0.59

mTcCIR24F: tttggggtgatttcttctgaR: tctgtctcgtcttttggtga

9 46 (ag)13 185-203 7 0.57 0.50 0.95

mTcCIR26F: gcattcatcaatacattcR: gcactcaaagttcatactac

8 46 (tc)9c(ct)4tt(ct)11 282-307 9 0.71 0.67 0.69

mTcCIR33F: tgggttgaagatttggtR: caacaatgaaaataggca

4 51 (tg)11 264-346 10 0.71 0.72 0.73

mTcCIR37F: ctgggtgctgatagataaR: aataccctccacacaaat

10 46 (gt)15 133-185 12 0.67 0.70 0.72

mTcCIR40F: aatccgacagtctttaatcR: cctaggccagagaattga

3 51 (ac)15 259-284 9 0.70 0.79 0.84

mTcCIR60F: cgctactaacaaacatcaaaR: agagcaaccatcactaatca

2 51 (ct)7(ca)20 187-223 12 0.64 0.73 0.86

Mean 8.8 0.65 0.66 0.78

Table 3. Characteristics and summary statistics for the 15 International set of microsatellite primers utilized for fingerprinting the USDA-ARS Tropical Agriculture Research Station cacao (Theobroma cacao) collection.

Clone #101-TARS 23 Heterozygous and consistent

for all 6 plants

Clone #42-EET 53 Heterozygous/homozygous and inconsistent across the 6 plants

Analysis (continued)

Mislabeling Homonymous or ‘intra-plant’ error Synonymous or ‘duplicate’ error Non-match error

Synonymous multi-locus fingerprint profiles condensed into a single profile

139 unique profiles used for subsequent analysis

Accessions grouped into four main clusters Based on geographic

and common genetic background Trinitarios/Criollos Lower A. Forasteros Upper A. Forasteros Hybrids

Mislabeling: e.g., RIM group

RIM identical (SSRs) Yellow/green

highlighted (A/B) ending

More than one genotype e.g., RIM13 [MEX]

Several clones don’t belong in this group CC10, EET 353, SGU69

CC10 B EET353[ECU] B EET381[ECU]

P10[MEX] A P22[MEX] P43[MEX]

RIM105[MEX] RIM13[MEX] A

RIM15[MEX] RIM2[MEX]

RIM34[MEX] RIM41[MEX] RIM48[MEX] RIM52[MEX]

RIM6[MEX] RIM75[MEX] RIM78[MEX] RIM10[MEX]

SGU69 ICS39

POUND7[POU] B SIC72 B

SC49[COL] GS46

UF668 ICS40

GS7 ICS29 UF601

Genetic Distance Coefficient0.00 0.34 0.68

RIM 30 [MEX]RIM 13 [MEX] B

RIM 13 [MEX] ARIM 10 [MEX]RIM 6 [MEX]RIM 2 [MEX] RIM 2 [MEX]

RIM 48 [MEX]RIM 41 [MEX]RIM 34 [MEX]RIM 15 [MEX] RIM 52 [MEX]

P 22 [MEX]P 10 [MEX]RIM 105 [MEX]RIM 75 [MEX] P 43 [MEX]

SGU 69EET 353EET 381

Set Accessions Set Accessions Set Accessions

1 CC 10 A 3 GS 46 10 CC 38 A

1 EET 353 [ECU] B 3 UF 668 10 RIM 13[MEX] B *

1 EET 381 [ECU]

1 P 10 [MEX] A 4 GS 7 11 CC 39

1 P 22 [MEX] 4 ICS 29 11 CC 49

1 P 43 [MEX] 11 EET 40 [ECU] A

1 RIM 10 [MEX] 5 EET 236 [ECU]

1 RIM 13 [MEX] A 5 TSAN 812 12 CC 10 B

1 RIM 15 [MEX] 12 CC 11

1 RIM 105 [MEX] 6 ICS 60

1 RIM 2 [MEX] 6 ICS 61 13 UF 666

1 RIM 34 [MEX] 13 UF 705

1 RIM 41 [MEX] 7 CC 57

1 RIM 48 [MEX] 7 GA 57 [MAY] 14 EET 397 [ECU]

1 RIM 52 [MEX] 14 UF 717

1 RIM 6 [MEX] 8 SIAL 98

1 RIM 75 [MEX] 8 SIC 1

1 RIM 78 [MEX] 8 SIC 2

1 SGU 69 [MEX] 8 SIC 72 B

2 ICS 39 9 POUND 7 [POU] B *

2 POUND 7 [POU] A * 9 UF652 A

2 SIC 72 A *

Table 2. Fourteen synonymous groups (including 49 accessions) within the USDA-ARS Mayaguez cacao collection identified by microsatellite DNA analysis. Accessions in the same

synonymous set shared identical multi-locus microsatellite profiles.

Clone name † Source ‡ RIV Clone name Source RIV1 AC T 1/1 [TTO] Trinidad 38 EET 397 [ECU] Ecuador 2 AC T 2/8 [TTO] Trinidad 39 EET 400 [ECU] Ecuador 3 AC T 2/11 [TTO] Trinidad 40 EET 401 [ECU] Ecuador 4 AC T 2/18 [TTO] Trinidad 41 EET 407 [ECU] Ecuador 5 AMELONADO Ghana 42 GA 57 Haiti 6 APA 4 Costa Rica 43 GC 7 [SUR] Costa Rica 7 APA 5 Colombia 44 GS 7 Grenada 8 BE 10 Brazil 1§,2¶ 45 GS 29 Grenada 9 C 87/56 Trinidad 46 GS 46 Grenada

10 CAS 1 Costa Rica 47 HY 27 1418 Puerto Rico 11 CC 10 A Costa Rica 1 48 HY 27 1419 Puerto Rico 11 CC 10 B Costa Rica 1 49 HY 27 1420 Puerto Rico 12 CC 11 Costa Rica 50 ICS 1 Trinidad 13 CC 34 Costa Rica 51 ICS 6 Trinidad 14 CC 37 A Costa Rica 1 52 ICS 16 Trinidad 14 CC 37 B Costa Rica 1 53 ICS 22 Trinidad 15 CC 38 A Costa Rica 1 54 ICS 29 Trinidad 15 CC 38 B Costa Rica 55 ICS 39 Trinidad 16 CC 39 Costa Rica 1 56 ICS 40 Guatemala 17 CC 40 Costa Rica 57 ICS 41 Trinidad 18 CC 41 Costa Rica 58 ICS 45 Trinidad 19 CC 49 Costa Rica 1 59 ICS 48 Trinidad 1,220 CC 54 Costa Rica 1 60 ICS 55 Trinidad 21 CC 57 Costa Rica 61 ICS 60 Trinidad 22 CC 60 Costa Rica 62 ICS 61 Trinidad 23 CC 71 Costa Rica 63 ICS 88 Trinidad 24 CC 80 Costa Rica 64 ICS 95 Trinidad 25 EET 40 [ECU] A Ecuador 65 ICS 129 Trinidad 25 EET 40 [ECU] B Ecuador 66 IMC 20 ---------#

26 EET 54 [ECU] Ecuador 67 IMC 47 Trinidad

Table 1. Name, source and results of identification verification (RIV) of cacao accessions maintained at the USDA-ARS Tropical Agriculture Research Station in Mayaguez, PR.

Summary

Multilocus profiles, dendrogram, assignment test and reference genotypes help sort out mistakes

Allelic diversity proportional to CATIEs and not very different for major alleles

Genetic redundancy does exist Shannon’s diversity index

Rationalization of collection is an option, but only after field characterization Agronomic traits

THANK YOU. QUESTIONS?