special lecture on information knowledge network
TRANSCRIPT
Special lecture on Information Knowledge Network-Information retrieval and pattern matching-
The 4th Approximate string matching
Takuya kidaIKN Laboratory,
Division of Computer Science and Information Technology
2018/11/22Special lecture on IKN
Todayβs contents
What is the approximation pattern matching?
Dynamic programming approach
NFA-base approachBit parallel simulation (BPR, BPD)
Filtering approachPattern division method (PEX)NFA method (ABNDM)
2
Letβs talk with an intelligent computer!
Thatβs right!Vermeer!
Both of them werefrom the Netherlands,
werenβt them?
By the way.Did you know Tera-sgees
who was in the same era?
Yes!Rembrandt! I remember!β¦And who that painter?
He drew many genre paintings in the same era.
Very popular in Japan
Erβ¦,Not Wermerβ¦
Who was that painter in the Baroque era?
He drew a famous picture called
βThe Nightwatchββ¦
Erβ¦,Certainly, was he β¦
Rembbright?
VelΓ‘zquez!γ½(`ΠΒ΄)γ #
β¦Perhaps,Vermeer?It's Rembrandt
Letβs talk with an intelligent computer!
Thatβs right!Vermeer!
Both of them werefrom the Netherlands,
werenβt them?
By the way.Did you know Tera-sgees
who was in the same era?
Yes!Rembrandt! I remember!β¦And who that painter?
He drew many genre paintings in the same era.
Very popular in Japan
Erβ¦,Not Wermerβ¦
VelΓ‘zquez!γ½(`ΠΒ΄)γ #
β¦Perhaps,Vermeer?
Letβs talk with an intelligent computer!
Thatβs right!Vermeer!
Both of them werefrom the Netherlands,
werenβt them?
By the way.Did you know Tera-sgees
who was in the same era?
VelΓ‘zquez!γ½(`ΠΒ΄)γ #
What is the approximation pattern matching?
It is the problem to find positions of substrings in a given text where its edit distance with a given pattern is less than or equal to ππ
Edit distance ed π₯π₯,π¦π¦ is defined as the minimum cost ππ for translating string π₯π₯ into string π¦π¦ with character edit operations: insertion, deletion, and substitution.
MARRIAGE
MASSAGE
CARRIAGE
ππ = 2
ππ = 1
ππ = 3
MARRIAGE
MASS AGE
deletesubstitute
OK
Bad
0 < k < m
ed(MARRIAGE, MASSAGE)=3
Edit distanceHow much do two strings look like?
similarity β edit distance between strings (dissimilarity)
Variation of edit distanceLevenshtein distance οΌThe costs of all operations are equal to 1.Hamming distance οΌOnly substitution is allowed.Weighted-cost edit distance
οΌThe cost of each operation may differ.Unrestricted-cost edit distance
οΌThe cost is different at each character pair.Damerau distance οΌThe character transposition is also permitted.Indel distance οΌSubstitution is not allowed.
insertion + deletion = indel(from Heikki HyyrΓΆ [SOFSEM2005])
Hereafter, we mainly treat with Levenshtein distance
Application examples
Calculating the similarity between DNAs
Spell checker / Searching with ambiguityOrthographic variationοΌ Carpaccio β Caravaggio
Retrieval of similar sentencesAn advanced retrieval can be realized by combining with natural language processingA sentence = a sequence of morphemes β a string
Similar music retrievalFinding a similar phrase on MIDI dataRetrieval with humming recognition
Search on OCR dataOCRed data often contains mistakes
Applications to real data miningWeb mining using approximate string matching algorithms (T. Nakato, Kyushu Univ.)
Searching with thesaurus is another related topic
Consider each morpheme as a meta character
Using Dynamic Time Warping (DTW)
Dynamic programming approach
The way of calculating edit distance based on dynamic programming (DP) has been known in the 1960βs. However, the well-known algorithm for pattern matching is shown by Sellers in 1980.
P. H. Sellers, The theory and computation of evolutionary distances: Pattern recognition. Journal of Algorithms, 1(4):359-373,1980.H. Sakoe and S. Chiba, A Dynamic Programming Algorithm Optimization for Spoken Word Recognition, IEEE Trans. on Acoust., Speech and Signal Proc., Vol. ASSP- 26, No. 1, pp. 43-49, 1978.
How to calculate ed(π₯π₯,π¦π¦):Let ππππ,ππ = ed(π₯π₯ 1: ππ ,π¦π¦ 1: ππ ). Then,
ππ0,0 β 0,ππππ,ππ β min ππππβ1,ππβ1 + πΏπΏ π₯π₯ ππ ,π¦π¦ ππ ,ππππβ1,ππ + 1,ππππ,ππβ1 + 1 .
where πΏπΏ ππ, ππ is defined as 0 if ππ = ππ, otherwise 1.Efficient recursive formulas for doing the same calculations are:
ππππ,ππ βππππ,0 β ππ, ππ0,ππ β ππππππβ1,ππβ1 (if π₯π₯ ππ = π¦π¦ ππ )1 + min ππππβ1,ππβ1,ππππβ1,ππ ,ππππ,ππβ1 (otherwise)
i.e., ππ|π₯π₯|,|π¦π¦| = ed(π₯π₯,π¦π¦)
Why can we do correct calculation?
Prove by induction. Let ππ0,0 = 0 be for two empty strings. Now we want to obtain ed π₯π₯[1: ππ],π¦π¦[1: ππ] = ππππ,ππ. Assume that we have ed π₯π₯[1: ππβ²],π¦π¦[1: ππβ²] for any ππβ² < ππ and ππβ² < ππ. Then, we consider the cost for translating π₯π₯[1: ππ] into π¦π¦[1: ππ].If π₯π₯ ππ = π¦π¦[ππ], then we can simply transform π₯π₯[1: ππ β 1] into π¦π¦[1: ππ β 1] with the minimum cost ππππβ1,ππβ1. In this case, it holds ππππ,ππ = ππππβ1,ππβ1.If π₯π₯[ππ] β π¦π¦[ππ], then we have three cases:
substituting π₯π₯[ππ] with π¦π¦[ππ], and change π₯π₯[1: ππ β 1] to π¦π¦[1: ππ β 1] with cost ππππβ1,ππβ1deleting π₯π₯[ππ], and change π₯π₯ 1: ππ β 1 to π¦π¦[1: ππ] with cost ππππβ1,ππinserting π¦π¦[ππ] at the end of π₯π₯[1: ππ], and change π₯π₯[1: ππ] to π¦π¦[1: ππ β 1] with cost ππππ,ππβ1
We choose the minimum one among the above.
deletion
π₯π₯[1: ππβ 1]
π¦π¦[1: ππβ 1] π¦π¦[ππ]
ππππβ1,ππ
π₯π₯[ππ]+1
substitution
π₯π₯[1: ππβ 1] π₯π₯[ππ]
π¦π¦[1: ππβ 1] π¦π¦[ππ]
ππππβ1,ππβ1 +1
insertion
π₯π₯[1: ππβ 1]
π¦π¦[1: ππβ 1] π¦π¦[ππ]
π₯π₯[ππ]
+1ππππ,ππβ1
ππππβ1,ππβ1
ππππ,ππβ1 ππππ,ππ
ππππβ1,ππ
+πΏπΏ(π₯π₯[ππ],π¦π¦[ππ]) +1
+1
How to detect the pattern occurrences
a n n e a l i n g0 1 2 3 4 5 6 7 8 9
a 1 0 1 2 3 4 5 6 7 8n 2 1 0 1 2 3 4 5 6 7n 3 2 1 0 1 2 3 4 5 6u 4 3 2 1 1 2 3 4 5 6a 5 4 3 2 2 1 2 3 4 5l 6 5 4 3 3 2 1 2 3 4
ππππ,ππ for ed(annual, annealing)
πππ₯π₯ , π¦π¦ = ed(annual, annealing) = 4
ππ0,0 a n n e a l i n g0 0 0 0 0 0 0 0 0 0
a 1 0 1 1 1 0 1 1 1 1n 2 1 0 1 2 1 1 2 1 2n 3 2 1 0 1 2 2 2 2 2u 4 3 2 1 1 2 3 3 3 3a 5 4 3 2 2 1 2 3 4 4l 6 5 4 3 3 2 1 2 3 4
Approximate string matching forππ =annual, ππ =annealing, ππ = 2
For any ππ = 0 β¦ππ, all that we have to do is to set ππ0,ππ = 0
This means that empty string ππ matches at anywhere in a given text with 0 error
ππ(ππππ) time and ππ(ππ) space
ππππβ1,ππβ1
ππππ,ππβ1 ππππ,ππ
ππππβ1,ππ
+πΏπΏ(π₯π₯[ππ],π¦π¦[ππ]) +1
+1
Improvement the average time complexity
The given pattern seldom occurs in the text!During calculations of each column, values become k+1 before reaching to the bottom (that is, mismatch occurs at the current position).A cell whose value is larger than k+1 does not affect to the final results.If the value of a cell is less than or equal to ππ, we call it active. The average time complexity can be reduced to O(ππππ) by calculating only active cells. (This improved algorithm is called DP)
E. Ukkonen. Finding approximate patterns in strings. Journal of Algorithms, 6(1-3):132-137, 1985.
a n n e a l i n g0 0 0 0 0 0 0 0 0 0
a 1 0 1 1 1 0 1 1 1 1n 2 1 0 1 2 1 1 2 1 2n 3 2 1 0 1 2 2 2 2 2u 4 3 2 1 1 2 3 3 3 3a 5 4 3 2 2 1 2 3 4 4l 6 5 4 3 3 2 1 2 3 4
DP calculation forππ =annual, ππ =annealing, ππ = 2
ππ(ππππ) time in the worst caseππ(ππππ) time for the average
Pseudo code of DP algorithm
DP (P=p1p2β¦pm, T=t1t2β¦tn, k)1 Preprocessing:2 For iβ0β¦m Do Ci β i3 lact β k + 1 /* last active cell */4 Searching:5 For posβ1...n Do6 pC β 0, nC β 07 For i β 1β¦lact Do8 If pi = tpos Then nC β pC9 Else10 If pC < nC Then nC β pC11 If Ci < nC Then nC β Ci12 nC β nC + 113 End of if14 pC β Ci, Ci β nC15 End of for16 While Clact > k Do lact β lact β 117 If lact = m Then report an occurrence at pos18 Else lact β lact + 119 End of for
NFA-base approach
Doing pattern matching by simulating this NFA by translating it to DFA.Originally, this is proposed by Ukkonen[1985]. And several improvements have been proposed so far.Translating to a corresponding DFA increases the number of states to (min(3ππ,ππ(2ππ|β|)ππ)).Therefore, it is not practical when ππ is large.
An NFA that accepts ππ = annual with allowing 2 errorsany a β β
a n un a l
a n un a l
β β β β β ββ β β β β β βΞ΅ Ξ΅ Ξ΅ Ξ΅ Ξ΅ Ξ΅
a n un a l
β β β β β ββ β β β β β βΞ΅ Ξ΅ Ξ΅ Ξ΅ Ξ΅ Ξ΅
no error
1 error
2 error
Active states after reading ππ = anneal
E. Ukkonen. Finding approximate patterns in strings. Journal of Algorithms, 6(1-3):132-137, 1985.
ΣΣ ΣΡ
Ξ£
L
Ξ£L
match
ins
del
sub
Row-wise bit-parallel for the NFA (BPR)
Pack states of each row to one bit-vector (1 indicates active, 0 indicates non-active) and simulate the move of the whole NFA by a bit-parallel technique.It needs ππ + 1 bit masks whose length are ππ bits.The formulas to update the ππ-th row state π π ππ into new π π β²ππ:
Rβ0 β ((R0<<1)|0m-11) & B[tj]Rβi β ((Ri<<1)&B[tj])|Ri-1|(Ri-1<<1)|(Rβi-1 << 1)|0m-11
no error
1 error
2 error
000000
100011
110111
any a β β
a n un a l
a n un a l
β β β β β ββ β β β β β βΞ΅ Ξ΅ Ξ΅ Ξ΅ Ξ΅ Ξ΅
a n un a l
β β β β β ββ β β β β β βΞ΅ Ξ΅ Ξ΅ Ξ΅ Ξ΅ Ξ΅
An NFA that accepts ππ = annual with allowing 2 errors
Active states after reading ππ = anneal
ππ(ππππ/π€π€ππ) timeππ(ππππ) time if ππ β¦ π€π€
Note that the bit order is reversed.
S. Wu and U. Manber. Fast text searching allowing errors. Communications of the ACM, 35(10): 83-91,1992.
Multiple rows can be packed into one vector!
Pseudo code of BPR
BPR (P=p1p2β¦pm, T=t1t2β¦tn, k)1 Preprocessing:2 For cββ Do B[c] β 0m3 For j β1β¦m Do B[pj ] β B[pj ] | 0m-j 10j-14 Searching:5 For i β0...k Do Ri β 0m-i 1i6 For pos β 1β¦n Do7 oldR β R08 newR β ((oldR<<1)|0m-1 1)&B[tpos]9 R0 β newR10 For i β1...k Do11 newR β ((Ri<<1)&B[tpos])|oldR|((oldR|newR)<<1)|0m-1112 oldR β Ri, Ri β newR13 End of for14 If newR & 10m-1β 0m Then report an occurrence at pos15 End of for
Diagonal-wise bit-parallel for the NFA (BPD)
Pack states diagonally by representing the depth of active states with unary(needing k+1 bits), and combine them into one bit-vector.It needs β0βs for representing the boundaries, the total length of the vector becomes (ππβ ππ)(ππ + 2) bits.The formulas to update when reading ππ-th character π‘π‘ππ:
Dβi β min(Di+1, Di+1+1, g(i-1, tj ))g(i,c) = min({k+1}βͺ{r|rβ§Di and pi+1+r=c})
β a n un a l
a n un a l
β β β β β ββ β β β β β βΞ΅ Ξ΅ Ξ΅ Ξ΅ Ξ΅ Ξ΅
a n un a l
β β β β β ββ β β β β β βΞ΅ Ξ΅ Ξ΅ Ξ΅ Ξ΅ Ξ΅
D0 D1 D2 D3 D4
no error
1 error
2 error
R. A. Baeza-Yates and G. Navarro. Faster approximate string matching. Algorithmica, 23(2):127-158, 1999.
D= 0 001 0 0 0k+1 bits k+1 bits k+1 bits k+1 bits
D1111 011 011
D2 D3 D4
Bit-masks like those of Shift-Or
The 1st item is for sub.The 2nd item is for ins.The 3rd item is for match
π·π·ππ = 3 =[111] if there is no active state
Pseudo code of BPD
BPD (P=p1p2β¦pm, T=t1t2β¦tn, k)1 Preprocessing:2 For cββ Do B[c] β 1m3 For j β1β¦m Do B[pj ] β B[pj ] & 1m-j 01j-14 For cββ Do5 BB[c] β 0 sk+1(B[c],0) 0 sk+1(B[c],1)β¦ 0 sk+1(B[c],m-k-1)6 End of for7 Searching:8 D β (01k+1)m-k9 For pos β 1β¦n Do10 x β (D >> (k+2)) | BB[tpos]11 D β ((D << 1) | (0k+11)m-k)12 & ((D << (k+3)) | (0k+11)m-k-101k+1)13 & (((x + (0k+11)m-k) β§ x) >> 1) & (01k+1)m-k14 If D & 0(m-k-1)(k+2)010k = 0(m-k)(k+2) Then15 Report an occurrence at pos16 D β D | 0(m-k-1)(k+2)01k+117 End of If18 End of for
π·π·ππ + 1π·π·ππ+1 + 1
ππ(ππ β 1, tpos)
clean up
Filtering approach: Pattern division method
Idea of filtering approach:It is easier to say βHere is not an occurrenceβ than βHere is an occurrenceββ Find the candidates rapidly, then look up in detail!This improves the average complexity.Actually, it goes well when the error rate (πΌπΌ = ππ/ππ) is small.
Pattern division method:Divide a given pattern into k+1 piecesThen, find each piece using a fast multiple pattern matching algorithmWhen finding a piece, run an ordinary approximate string matching algorithm (such as DP) over the neighborhood of the occurrence to check if the pattern matches
Text: ACCCTGTTTAGATCACGGCACTACTGTAAAC
ππ + 1 pieces: TAAAT, CACGG, CATACT
For ππ = 2Pattern: TAAATCACGGCATACT
S. Wu and U. Manber. Fast text searching allowing errors. Communications of the ACM, 35(10): 83-91,1992.
Multiple Shift-And orSet Horspool
Speeding-up by hierarchical verification (PEX)
Checking candidates hierarchically can reduce the processing time.Assume that ππ = ππ + 1 = 2ππ. Halve a given pattern with allowing ππ/2 errors for each, and repeat the division recursively till each piece allows 0 errors.Find the pieces using a multiple pattern matching algorithm, and then check the candidates hierarchically.
CreateTree (P=p1p2β¦pm, k, myParent, idx, plen)1 Create new node2 from(node) β i3 to(node) β j4 left β (k+1)/25 parent(node) β myParent6 err(node) β k7 If k = 0 Then leafidx β node8 Else9 CreateTree(piβ¦i+leftγ»plenβ1, (leftγ»k)/(k+1), node, idx, plen) 10 CreateTree(pi+leftγ»plenβ¦j,((k+1βleft)γ»k)/(k+1),node,idx+left,plen)11 End of If
G. Navarro and R. Baeza-Yates. Very fast and simple approximate string matching. Information Processing Letters, 72:65-70, 1999.
a a a b b b c c c d d da a a b b b c c c d d d
a a a b b b c c c d d d
ππ = 3 errors
ππ = 1 errors
ππ = 0 errors
Make padding when it doesnβt match with 2ππ
Pseudo code of PEX
PEX (P=p1p2β¦pm, T=t1t2β¦tn, k)1 Preprocessing:2 CreateTree(p, k,ΞΈ, 0, m/(k+1) )3 Preprocess multipattern search for4 {pfrom(node)β¦pto(node) | node = leafi , iβ{0β¦k} }5 Searching:6 For (pos, i) β output of multipattern search Do7 node β leafi8 in β from(node)9 node β parent(node)10 cand β TRUE11 While cand = TRUE and node β ΞΈ Do12 p1 β pos β (in β from(node)) β err(node)13 p2 β pos + (to(node) β in + 1) + err(node)14 Verify text area Tp1β¦p2 for pattern piece pfrom(node)β¦to(node)15 allowing err(node) errors 16 If pattern piece was not found Then cand β FALSE17 Else node β parent(node)18 End of while19 If cand = TRUE Then20 Report the positions where the whole p was found21 End of If22 End of for
Filtering approach: BNDM method (ABNDM)
Construct an NFA that accepts any factor of πππ π for a given pattern ππ with allowing ππ errors β an extension of BNDM
The NFA can tell if the input is a prefix of πππ π with ππ errors.BNDM runs faster than BM when the alphabet size is small enough.We can quickly extract candidate positions by this NFA.It can skip several text positions like BNDM.
For texts whose alphabet size is small, such as DNA sequence, ABNDM runs faster than PEX
anu nalβ β β β β β
β β β β β β βΞ΅ Ξ΅ Ξ΅ Ξ΅ Ξ΅ Ξ΅
β β β β β ββ β β β β β βΞ΅ Ξ΅ Ξ΅ Ξ΅ Ξ΅ Ξ΅
no error
1 error
2 error
ΡΡ Ρ Ρ Ρ Ρ Ρ
G. Navarro and R. Baeza-Yates. Very fast and simple approximate string matching. Information Processing Letters, 72:65-70, 1999.
anu nal
anu nal
Pseudo code of ABNDM
ABNDM (P=p1p2β¦pm, T=t1t2β¦tn, k)1 Preprocessing:2 For cββ Do B[c] β 0m3 For j β1β¦m Do B[pj ] β B[pj ] | 0m-j 10j-14 Searching:5 pos β 06 While pos β¦ n β (m β k) Do7 j β m β k β 1, last β m β k β 18 R0 β B[tpos+mβk ]9 newR β 1m10 For i β1β¦k Do Ri β newR11 While newR β 0m and j β 0 Do12 oldR β R013 newR β (oldR << 1) & B[tpos+j ]14 R0 β newR15 For i β1β¦k Do16 newR β ((Ri<<1)&B[tpos+j])|oldR|((oldR|newR)<<1)17 oldR β Ri, Ri β newR18 End of for19 j β j β 120 If newR & 10m-1 β 0m Then /* prefix recognized */21 If j > 0 Then last β j22 Else check a possible occurrence starting at pos+123 End of if24 End of while25 pos β pos + last26 End of while
SummaryWhat is the approximate string matching?
It is the problem of finding substrings which match to ππ within ππ edit distances.Dynamic programming approach:
O ππππ time and O(ππ) space β can be improved to O(ππππ) for the average (DP)
NFA approach:It constructs an NFA that accepts ππ with ππ errors β translate to a corresponding DFA and then simulate itBit-parallel simulation of the NFA:
Row-wise (BPR)οΌ O(ππ ππ/π€π€ ππ) timeDiagonal-wise (BPD)οΌ O( ππ(ππ β ππ)/π€π€ ππ) time
Filtering approach:It finds without checking the most of text in detailPattern division method (PEX), BNDM method (ABNDM)
The next theme:Regular expression matching: for a flexible and convenient keyword searching