Single Nucleotide Polymorphism Genotyping Analysis ShowsThat Vaccination Can Limit the Number and Diversity ofRecombinant Progeny of Infectious Laryngotracheitis Virusesfrom the United States

Carlos A Loncomana Carol A Hartleya Mauricio J C Coppoa Glenn F Browninga Gabriela Beltraacutenb Sylva Ribletb

Carolina O Freitasb Maricarmen Garciacuteab Joanne M Devlina

aAsia-Pacific Centre for Animal Health Department of Veterinary Biosciences Melbourne Veterinary SchoolFaculty of Veterinary and Agricultural Sciences University of Melbourne Parkville Victoria Australia

bPoultry Diagnostic and Research Center College of Veterinary Medicine University of Georgia AthensGeorgia USA

ABSTRACT Infectious laryngotracheitis (ILTV Gallid alphaherpesvirus 1) causesmild to severe respiratory disease in poultry worldwide Recombination in this vi-rus under natural (field) conditions was first described in 2012 and more recentlyhas been studied under laboratory conditions Previous studies have revealedthat natural recombination is widespread in ILTV and have also demonstratedthat recombination between two attenuated ILTV vaccine strains generatedhighly virulent viruses that produced widespread disease within poultry flocks inAustralia In the United States natural ILTV recombination has also been de-tected but not as frequently as in Australia To better understand recombinationin ILTV strains originating from the United States we developed a TaqMan singlenucleotide polymorphism (SNP) genotyping assay to detect recombination be-tween two virulent US field strains of ILTV (63140 and 1874c5) under experi-mental in vivo conditions We also tested the capacity of the Innovax-ILT vaccine(a recombinant vaccine using herpesvirus of turkeys as a vector) and the Tra-chivax vaccine (a conventionally attenuated chicken embryo origin vaccine) toreduce recombination The Trachivax vaccine prevented ILTV replication andtherefore recombination in the trachea after challenge The Innovax-ILT vaccineallowed the challenge viruses to replicate and to recombine but at a signifi-cantly lower rate than in an unvaccinated group of birds Our results demon-strate that the TaqMan SNP genotyping assay is a useful tool to study recombi-nation between these ILTV strains and also show that vaccination can limit thenumber and diversity of recombinant progeny viruses

IMPORTANCE Recombination allows alphaherpesviruses to evolve over time and be-come more virulent Historically characterization of viral vaccines in poultry havemainly focused on limiting clinical disease rather than limiting virus replication butsuch approaches can allow field viruses to persist and evolve in vaccinated popula-tions In this study we vaccinated chickens with Gallid alphaherpesvirus 1 vaccinesthat are commercially available in the United States and then performed coinocula-tions with two field strains of virus to measure the ability of the vaccines to preventfield strains from replicating and recombining We found that vaccination reducedviral replication recombination and diversity compared to those in unvaccinatedchickens although the extent to which this occurred differed between vaccines Wesuggest that characterization of vaccines could include studies to examine the abilityof vaccines to reduce viral recombination in order to limit the rise of new virulent

Received 25 July 2018 Accepted 12September 2018

Accepted manuscript posted online 21September 2018

Citation Loncoman CA Hartley CA CoppoMJC Browning GF Beltraacuten G Riblet S FreitasCO Garciacutea M Devlin JM 2018 Singlenucleotide polymorphism genotyping analysisshows that vaccination can limit the numberand diversity of recombinant progeny ofinfectious laryngotracheitis viruses from theUnited States Appl Environ Microbiol 84e01822-18 httpsdoiorg101128AEM01822-18

Editor Donald W Schaffner Rutgers The StateUniversity of New Jersey

Copyright copy 2018 American Society forMicrobiology All Rights Reserved

Address correspondence to Carlos A Loncomancloncomanstudentunimelbeduau

MG and JMD contributed equally to thisarticle

METHODS

crossm

December 2018 Volume 84 Issue 23 e01822-18 aemasmorg 1Applied and Environmental Microbiology

on Decem

ber 15 2020 by guesthttpaem

asmorg

Dow

nloaded from

field strains due to recombination especially for those vaccines that are known notto prevent viral replication following challenge

KEYWORDS herpesvirus recombination replication diversity SNP genotyping assayvaccine infectious laryngotracheitis virus ILTV

Infectious laryngotracheitis virus (ILTV Gallid alphaherpesvirus 1) causes mild to severerespiratory tract disease in chickens that results in major economic losses in poultry

industries throughout the world as a consequence of increased mortality decreasedweight gain and decreased egg production (1) Live attenuated vaccines are widelyused to help control disease caused by infection with ILTV in Asia (2ndash4) Australia (5ndash9)Europe (10) and the United States (11ndash14) These vaccines are generally effective incontrolling clinical disease and although some of these vaccines may not entirelyprevent ILTV replication as measured by viral tires after challenge (15) they have beenused successfully to curtail outbreaks of the disease in the United States (1) Howevergenome analysis of US isolates suggests that vaccine-derived virulent subpopulationsallowed to persist in the field will give rise to vaccine revertants which can causeoutbreaks of the disease examples are genotype groups III (81658) and V (63140) (1)Attenuated vaccines also have other limitations (16) including the capacity to undergorecombination to generate new highly virulent viruses (9) This was first observed inAustralian poultry when natural recombination between two attenuated vaccine strainsof ILTV generated virulent recombinant field viruses that spread to cause outbreaks ofsevere disease in commercial poultry flocks (9) Recombination has now been widelydetected among ILTV field strains worldwide (5 8 9 17)

Viruses can acquire genetic changes through several mechanisms includingpoint mutation and recombination with the latter particularly important in manyalphaherpesviruses (18ndash21) Viruses that belong to the order Herpesvirales havedouble-stranded linear DNA genomes and have complex viral DNA replicationmachinery comprising a DNA polymerase with a highly efficient proofreadingcapacity resulting in very low spontaneous mutation rates (22ndash24) Thereforerecombination is considered crucial for the evolution of some species of alphaher-pesviruses (9 25 26) Specifically intraspecific recombination has been extensivelystudied for a number of different alphaherpesviruses under in vitro conditionsincluding Human alphaherpesvirus 1 (27) Bovine alphaherpesvirus (28) Humanalphaherpesvirus 3 (29) Felid alphaherpesvirus 1 (30) and Suid alphaherpesvirus 1(31) Next-generation sequencing and analysis of the resultant sequences arepowerful approaches to detecting and characterizing alphaherpesvirus recombina-tion events and also allow recombination breakpoints to be identified Howeverother approaches to detecting recombination in alphaherpesviruses such as theuse of single nucleotide polymorphism (SNP) genotyping assays may be moreappropriate for use in recombination experiments particularly as a screening toolSuch assays can be more efficient and cost-effective than next-generation sequenc-ing methods and more suitable for testing large numbers of viruses (28 32)

Recombination between strains of ILTV has been recognized as a problem forpoultry in Australia and has been detected in both natural (field) settings (5 8 917) and laboratory settings (17 32) Natural ILTV recombination has also beendetected in United States although fewer recombination events were detected inUS field strains than in Australian field strains (17) Recently using full-genomesequence analysis of ILTV field strains from the United States a natural recombi-nation event was detected (1874c5 and J2 strains as parental strains) (17) In thestudy described here we aimed to examine the potential for recombination in vivounder experimental conditions between two prevalent virulent field strains fromthe United States Specifically we developed a TaqMan SNP genotyping assay todetect ILTV recombinants arising after coinoculation with the two parental virulentfield strains and then examined the recombinants that arose in unvaccinated and

Loncoman et al Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e01822-18 aemasmorg 2

on Decem

ber 15 2020 by guesthttpaem

asmorg

Dow

nloaded from

vaccinated birds in order to determine whether vaccination could be used as a toolto limit recombination in ILTV

RESULTSGrowth and entry kinetics Growth and entry kinetics experiments were performed

to determine in vitro characteristics of the 63140 and 1874c5 parental strains in LMHcells These experiments were also performed to determine the suitability of LMH cellsfor the isolation and detection of viral progeny from the swabs collected from infectedchickens Significant differences were detected between the entry kinetics of the 63140and 1874c5 viruses at 25 75 and 30 min after inoculation (Fig 1A) The multistepgrowth curves of the viruses were also significantly different at every time pointpostinfection (Fig 1B) Statistics for each time point for both entry and growth kineticsare in Tables S3 and S4 in the supplemental material

Bird survival virus genome quantification and virus isolation The survival ratesin groups of birds that were mock vaccinated and then inoculated only with either63140 or 1874c5 were 50 (510) in both groups (Fig 2) The mock-vaccinatedcoinoculated group had survival rates of 458 and 333 (1124 and 824) at days 7and 9 respectively (Fig 2) All birds in the vaccinated groups survived throughout theexperiment (Fig 2) Although most mortalities occurred in the directly challenged birdstwo mortalities were recorded for in-contact unvaccinated birds one in the mock-vaccinated group coinoculated with both parental viruses and one in the second in themock-vaccinated group challenged with 1874c5

In the groups of birds that were coinoculated with both viruses higher concentra-tions of virus were detected by quantitative PCR (qPCR) in the tracheal swabs collectedfrom birds in the mock-vaccinated group than in the swabs from birds in the groupsvaccinated with the CEO and HVT vaccines at days 3 5 and 7 after challenge (Fig 3AB and C respectively) No significant differences were detected between these groupsat day 9 (Fig 3D) In these groups peak virus concentrations were detected earlier inthe directly inoculated birds (day 3) than in the in-contact birds (day 5) (Fig 3) At days3 5 and 7 after challenge no significant differences in viral concentrations weredetected between the mock-vaccinated coinoculated group and the groups that weremock vaccinated and then challenged with either 63140 or 1874c5 (Fig 3A B and Crespectively) Significantly lower viral concentrations were detected at day 9 between

FIG 1 Growth and entry kinetics of the 63140 and 1874c5 ILTV parental viruses (A) Entry kinetics of the63140 and 1874c5 strains LMH cells were infected with virus after which they were overlaid withmethylcellulose medium and incubated at 37degC Entry at different time points was calculated bycomparing the number of plaques formed after inoculation at a specific time point to the number formedafter an inoculation period of 60 min This experiment was repeated 3 times each in triplicate Meanresults are shown Error bars represent SDs (B) Growth kinetics of the 63140 and 1874c5 strains LMH cellswere inoculated in triplicate at a multiplicity of infection (MOI) of 0002 At 24-h intervals the virusgenome concentration in the cell-free supernatant was determined by qPCR Error bars indicate SDs andasterisks indicate values that were significantly different (P 005 Studentrsquos t test)

Recombination between US Field Strains of ILTV Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e01822-18 aemasmorg 3

on Decem

ber 15 2020 by guesthttpaem

asmorg

Dow

nloaded from

the mock-vaccinated coinoculated group and the mock-vaccinated groups that werechallenged with only 63140 or 1874c5 (Fig 3D)

The results from virus isolation were consistent with those obtained by qPCRanalysis Viruses could be isolated and plaque purified from the mock-vaccinatedcoinoculated group (individual birds A to R) and all in-contact birds (individual birds Sto X) Viruses could be isolated and plaque purified from only 3 out of 18 directlycoinoculated birds in the group vaccinated with herpesvirus of turkey (HVT) (individualbirds Y Z and A1) and could not be isolated from any of the in-contact chickens Viruscould not be isolated from swabs collected from birds in the groups vaccinated withchicken embryo origin vaccine (CEO) Thus all subsequent investigations to character-ize progeny viruses and examine viral diversity were restricted to the mock-vaccinatedcoinoculated and HVT-vaccinated coinoculated groups

Characterization of progeny viruses using the SNP genotyping assay Up to 20progeny viruses were isolated and plaque purified from each tracheal swab sampleyielding a total of 707 plaque-purified progeny viruses along the experiment fromwhich DNA was extracted for characterization Six SNPs across the length of each of thegenomes of the progeny viruses were identified as originating from either the 63140 or1874c5 genome using the SNP genotyping assay interface within the StratageneMx3000P qPCR software system as previously described (Fig 1) The genotyping assayidentified 78 plaque-purified viruses as potentially mixtures so these were discardedfrom further investigation The remaining 629 plaque-purified viruses were identified aseither recombinant or parental viruses Recombinant viruses were detected in mock-vaccinated (see Fig S1 in the supplemental material) and HVT-vaccinated (see Fig S2)groups In total across all birds (directly inoculated and in-contact birds) the proportionof progeny viruses that were recombinants was significantly higher among viruses fromthe mock-vaccinated coinoculated group (36 [207576]) (Tables 1 and 2) than amongviruses from the HVT-vaccinated coinoculated group (20 [1153]) (Table 3) (P 0034Fisherrsquos exact test) There was no significant difference between the proportion ofprogeny viruses that were recombinants in the directly coinoculated birds in themock-vaccinated group (43 [128428]) (Tables 1 and 2) and among the viruses fromHVT-vaccinated group (20 [1153]) (Table 3) (P 0199 Fisherrsquos exact test) In themock-vaccinated coinoculated group 38 (59) of the 64 possible genotype patternswere detected among the viral progeny (Tables 1 and 2) In the HVT-vaccinatedcoinoculated group 8 (125) of the 64 possible genotype patterns were detectedamong the viral progeny (Table 3) Some genotype patterns were detected morefrequently than others at days 3 5 and 7 Genotype pattern codes 6 17 18 and 26were detected in the mock-vaccinated coinoculated group on all days (Tables 1 and 2)

FIG 2 Survival rates in the different experimental groups as described in Table 4 Mortalities wereobserved only in the mock-vaccinated groups that were challenged with 63140 or 1874c5 either aloneor in combination (coinoculated) All other groups had a 100 survival rate from day 3 to day 9 Theresults from the group vaccinated with HVT and then coinfected with 63140 and 1874c5 is shown as anexample of a 100 survival curve The results from the other groups with 100 survival are not shownMock-VxCo-inoculation-Ch mock-vaccinated coinoculated group HVT-VxCo-inoculation-Ch HVT-vaccinated coinoculated group

Loncoman et al Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e01822-18 aemasmorg 4

on Decem

ber 15 2020 by guesthttpaem

asmorg

Dow

nloaded from

whereas in the HVT-vaccinated coinoculated group viruses were detected only at day3 At this time the most abundant recombinant genotype was genotype patterncode 3 (57 of total progeny viruses) but the 63140 parental strain dominated(792 of total progeny viruses) The 1874c5 parent strain was not detected in thisgroup (Table 3)

Viral-diversity analysis In the mock-vaccinated coinoculated group there were nosignificant differences in the level of viral diversity as assessed by the Renyi diversityprofiles between days 3 5 and 7 (Fig 4A) Separate analysis of the directly inoculatedbirds and in-contact birds in this group revealed a higher level of diversity at day 3 thanat day 5 in the directly inoculated birds (Fig 4B) but not in the in-contact birds (Fig 4C)

FIG 3 Replication of ILTV in different groups of birds after challenge based on genome copy numbers in tracheal swabs as measured by qPCR on tracheal swabs(A) Day 3 after challenge (B) day 5 after challenge (C) day 7 after challenge (D) day 9 after challenge Asterisks represent significant differences (P 005student t test) compared to the mock-vaccinated coinoculated group

Recombination between US Field Strains of ILTV Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e01822-18 aemasmorg 5

on Decem

ber 15 2020 by guesthttpaem

asmorg

Dow

nloaded from

TABLE 1 Viruses detected in the mock-vaccinated cochallenged group including directly inoculated birds and in-contact birdsa

Collection time point Genotype pattern code Chicken(s) from which virus was isolated (no of isolates) Total no of isolates ()

Day 3 1 A (1) C (1) H (1) K (1) L (2) N (3) 9 (36)2 A (1) C (1) D (2) G (3) I (1) L (2) N (1) 11 (45)3 B (1) C (1) F (3) G (1) H (1) M (1) O (1) 9 (36)4 B (1) C (1) 2 (08)5 B (1) 1 (04)6 C (2) F (1) J (1) 4 (16)7 C (1) 1 (04)8 C (1) 1 (04)9 C (1) 1 (04)10 C (1) O (1) 2 (08)11 D (1) 1 (04)12 E (1) L (1) 2 (08)13 E (1) G (2) N (1) 4 (16)14 F (1) J (1) L (1) N (1) 4 (16)15 G (1) 1 (04)16 G (1) 1 (04)17 G (1) O (1) 2 (08)18 G (1) J (1) 2 (08)19 G (1) O (3) 4 (16)20 I (1) O (1) 2 (08)21 J (1) L (1) 2 (08)22 K (2) 2 (08)23 K (1) 1 (04)24 N (1) 1 (04)25 N (1) 1 (04)26 N (1) O (1) 2 (08)27 O (1) 1 (04)63140 A (15) B (8) C (6) D (14) E (13) F (7) G (5) H (15) I (16)

J (9) K (14) L (11) M (14) N (6) O (3)156 (63)

1874c5 B (5) D (1) F (1) J (1) N (2) O (7) 17 (69)Day 5 2 A (1) C (3) K (3) R (1) 8 (29)

3 C (2) G (6) H (1) R (2) S (2) T (8) 21 (76)4 S (1) 1 (04)5 T (1) 1 (04)6 C (1) P (1) H (1) K (1) U (1) 5 (18)7 P (1) V (1) 2 (07)9 A (1) P (1) H (3) 5 (18)13 A (1) G (3) S (2) 6 (22)17 K (1) 1 (04)18 R (1) S (1) 2 (07)19 P (2) H (1) U (1) W (2) 6 (22)20 H (1) W (1) 2 (07)24 W (1) 1 (04)26 H (2) K (1) 3 (11)27 W (6) 6 (22)28 P (1) 1 (04)29 P (1) 1 (04)30 P (1) H (1) 2 (07)31 P (1) H (1) 2 (07)32 H (2) 2 (07)33 K (2) 2 (07)34 R (1) 1 (04)35 R (1) 1 (04)36 S (1) 1 (04)37 W (2) 2 (07)38 W (1) 1 (04)63140 A (15) C (14) D (17) P (7) G (10) H (7) Q (20) K (10)

R (13) M (5) S (7) T (10) U (18) V (19) W (2)174 (63)

1874c5 P (4) K (2) R (1) M (2) S (2) T (1) W (5) 17 (61)Day 7 6 T (1) X (14) 15 (29)

17 V (5) 5 (96)18 T (11) 11 (21)26 T (1) 1 (19)36 V (15) 15 (29)63140 T (2) X (2) 4 (77)1874c5 T (1) 1 (19)

aDirectly inoculated birds included individual birds A to R and in-contact birds included individual birds S to X Virus isolation from in-contact birds is bold and underlined

Loncoman et al Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e01822-18 aemasmorg 6

on Decem

ber 15 2020 by guesthttpaem

asmorg

Dow

nloaded from

Overall the level of viral diversity was higher in the mock-vaccinated coinoculatedgroup than in the HVT-vaccinated coinoculated group (Fig 4D)

DISCUSSION

We developed a specific SNP genotyping assay to study recombination betweenvirulent US ILTV field strains 63140 and 1874c5 These field strains share 976 sequenceidentity Six of the 93 SNPs detected between these strains were selected as suitable fordesign of primers and fluorogenic (TaqMan) probes to differentiate viral recombinantswithin the viral progeny Four of these SNPs were located in the unique long (UL) region (inthe UL54 ORFE UL36 and UL6 genes) and two within the unique short (US) region (in ORF1and US9) Previous studies have shown that natural recombination occurs throughout theILTV genome including within the UL internal repeat (IR) and US regions (5 8) Recom-bination hot spots have been detected within the ICP4 gene in the IR region (17) howevernone of the SNPs between the two parental viruses 1874c5 and 63140 within the ICP4gene were suitable for design of primers and probes Therefore recombination events inthis region of the genome were not directly assessed in the present study

Recombination events have been detected frequently in Australian ILTV field stainsbut have been less frequently detected in US field strains (5 17) The field strain1874c5 used as one of the parent strains in the study described here was recentlyrecognized as a likely natural recombinant (17) so this parental strain was of particularinterest in this study

TABLE 2 Summary of collection days and total number and type of isolates in the mock-vaccinated cochallenged group including directly inoculated birds and in-contact birds

Collection time point and typeof isolate

No of isolates ()a

Whole group Directly inoculated In-contact

Day 3Parental 173 (70) 173 (70) 0 (0)Recombinant 74 (70) 74 (70) 0 (0)Total 247 (100) 247 (100) 0 (0)

Day 5Parental 191 (69) 127 (70) 64 (67)Recombinant 86 (31) 54 (30) 32 (33)Total 277 (100) 181 (653) 96 (35)

Day 7Parental 5 (96) 0 (0) 5 (96)Recombinant 47 (903) 0 (0) 47 (03)Total 52 (100) 0 (0) 52 (100)

aDirectly inoculated birds included individual birds A to R and in-contact birds included individual birdsS to X

TABLE 3 Viruses detected in the HVT-vaccinated coinoculated group from directlyinoculated birds (individual birds Y Z and A1) on day 3a

Genotype pattern code Chicken (no of isolates)Total no of isolates( of whole group)

2 A1 (1) 1 (19)3 Z (1) A1 (2) 3 (57)12 A1 1 (19)26 A1 1 (19)36 Z (1) A1 (1) 2 (38)37 Z (1) 1 (19)39 Z (1) 1 (19)40 A1 1 (19)63140 Y (18) Z (14) A1 (10) 42 (792)1874c5 None 0 (0)aFor the parental viruses 42 (79) isolates were detected in the whole group and 42 (79) were directlyinoculated For the recombinant viruses 11 (21) were detected in the whole group and 11 (21) weredirectly inoculated The total number of isolates was 53 Viruses could not be isolated from in-contact birds

Recombination between US Field Strains of ILTV Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e01822-18 aemasmorg 7

on Decem

ber 15 2020 by guesthttpaem

asmorg

Dow

nloaded from

The in vitro characteristics of the 63140 and 1874c5 parental viruses were assessedin LMH cells in order to compare their rates of replication and entry kinetics Synchro-nized entry and growth kinetics are important factors facilitating recombination inalphaherpesviruses (26) Results from this study suggest that differences in entry andgrowth kinetics may affect the generation of recombinants in vivo as a lower propor-tion of progeny were found to be recombinants (29) in unvaccinated directlycoinoculated birds Previous in vivo coinoculation experiments with unvaccinateddirectly coinoculated chickens with Australian ILTV field strains with very similar entryand growth kinetics showed that a high proportion of the viral progeny were recom-binants (65) However it must also be considered that the entry and growth kineticsviruses were examined in vitro using LMH cell culture entry and growth kinetics maydiffer when the viruses are grown in vivo which could impact recombination

Previous studies have shown that the levels of recombinant diversity after coinocu-lation of ILTV strains are highest at the peak of viral replication (17) In the presentstudy the highest level of viral diversity was detected in unvaccinated directly coin-oculated birds at day 3 Over the whole group (directly coinoculated birds andin-contact birds) a higher level of viral diversity was detected at day 5 coinciding withtime point at which the highest tracheal concentrations of viruses were detected withinthe directly coinoculated birds and in-contact birds

FIG 4 Detailed Renyi diversity profiles for progeny viruses isolated from the mock-vaccinated coinocu-lated group and the HVT-vaccinated coinoculated group Levels of diversity are shown on the y axis anddiversity measures on the x axis Renyi profiles contain 11 diversity measurements including richness (xaxis value 0) Hill values (x axis values 025 05 4 8 16 32 64) Shannon-Weaver (x axis value 1)1Simpson (x axis value 2) and 1Berger Parker (x axis value infinite [INF]) One community can beregarded as more diverse than another if all its Renyi diversity measurements are higher (48) (A) Diversityof viral progeny in all birds (directly inoculated birds and in-contact birds) in the mock-vaccinatedcoinoculated group (B) separate analysis of the directly inoculated birds in the mock-vaccinatedcoinoculated group (C) separate analysis of the in-contact birds in the mock-vaccinated coinoculatedgroup (D) diversity of viral progeny in all birds (directly inoculated birds and in-contact birds) in theHVT-vaccinated coinoculated birds and in the mock-vaccinated coinoculated birds

Loncoman et al Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e01822-18 aemasmorg 8

on Decem

ber 15 2020 by guesthttpaem

asmorg

Dow

nloaded from

As the highest levels of viral diversity the highest prevalence of recombinantprogeny and the peak levels of viral replication coincided in directly coinoculated birdsin the mock-vaccinated group it can be hypothesized that a reduced level of viralreplication mediated by vaccination would affect not only the severity of clinicaldisease (15) but also the level of recombination and viral diversity In the United Statesclinical disease caused by ILTV is mainly controlled by vaccination with either conven-tional attenuated or recombinant virally vectored vaccines (1) In this study we testedthe attenuated CEO vaccine Trachivax and the recombinant HVT-LT Innovax The CEOvaccine protected challenged birds as measured by survival rates (Fig 2) and pre-vented virus replication as detected by qPCR (Fig 3) There was insufficient viralreplication in this group of birds to enable virus isolation and purification These resultswere not unexpected as this vaccine is known to induce good protection againstdisease and to prevent challenge virus replication and transmission (33 34)

We also tested the HVT-vectored vaccine Innovax-ILT which expresses two ILTVgenes those for US6 (glycoprotein D) and US7 (glycoprotein I) (35) The HVT vaccineprotected birds against challenge as measured by survival rates and partially protectedbirds against viral replication following challenge as determined by qPCR and virusisolation The qPCR results from this study are consistent with previous studies showingthat after challenge viral replication in the tracheas of HVT-vaccinated birds is higherthan in CEO-vaccinated chickens but lower than in unvaccinated birds (36) Virusisolation purification and characterization were possible for 3 of 18 directly inoculatedbirds Of the viral progeny 21 were recombinants but none of the recombinantsdominated as much as the parental strain 63140

Our results show that both vaccines tested in this study could be used as tools to helpcontrol ILTV recombination but that any variation in the dose or delivery method thatreduces vaccine efficacy eg delivery by drinking water or in ovo (37) may increase thediversity of the progeny and the potential of generating recombinant viruses after coin-oculation In this study it is notable that despite the detection of viral replication the lowlevel of recombinant progeny detected in the recombinant HVT-vaccinated and-coinoculated group of birds may be a reflection of the administration of double full dose(approximately 12000 PFU) which emphasizes that at least a full dose of recombinantvaccines is necessary to reduce the potential of generating recombinant viruses aftercoinoculation In order to achieve optimal control of ILTV under field conditions it isimportant that other advantages and disadvantages of vaccines be considered in additionto their potential impact on ILTV recombination It is possible that ILTV recombinationoccurs less frequently in the United States than in Australia where recombination has givenrise to new virulent ILTV strains that have caused severe disease (9) However it should benoted that the level of recombination observed between the 63140 and 1874c5 field strainswas still substantial and that other US field strains may yield higher levels of recombina-tion Further studies to examine ILTV recombination in strains from different geographicalregions are indicated along with further studies to investigate the ability of differentvaccines to control recombination

MATERIALS AND METHODSViruses The virulent 1874c5 and 63140 field strains of ILTV were used as the parental viruses for

in vivo coinoculation These strains belong to genotypes VI and V following the ILTV classification systemused in the United States (38) and were first isolated from broiler flocks (11) Both parental viruses werepropagated at the Poultry Diagnostic and Research Center (PDRC) University of Georgia GA For thisstudy the parental viruses were propagated and titrated in chicken hepatocellular carcinoma (LMH) cells(39) using a plaque assay as previously described (40) The vaccines used in the present study were theherpesvirus of turkey (HVT)-vectored vaccine Innovax-ILT (Merck Animal Health Madison NJ) and thechicken embryo origin (CEO) vaccine Trachivax (Merck Animal Health Madison NJ)

Cell culture and in vitro characterization of viruses Virus isolation and purification from clinicalmaterial collected during the in vivo experiment as well as in vitro characterization of the parental strainswere performed in LMH cell monolayers The cells were cultured in growth medium (GM) consisting ofDulbeccorsquos minimal essential medium (DMEM Gibco-Thermo Fisher) supplemented with antibiotic-antimycotic (100 Gibco-Thermo Fisher) as recommended by the manufacturer and 10 (volvol) fetalbovine serum (FBS Sigma-Aldrich) Virus titrations were performed using the plaque assay described

Recombination between US Field Strains of ILTV Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e01822-18 aemasmorg 9

on Decem

ber 15 2020 by guesthttpaem

asmorg

Dow

nloaded from

previously (41) In vitro multistep virus growth kinetics and entry kinetics studies were performed asdescribed by Devlin et al (41) and Lee et al (42) respectively

In vivo coinoculation experiment This experiment was undertaken with approval from the AnimalEthics Committee (AEC) of the University of Georgia (A2016 10-010-Y1-A0) Two hundred specific-pathogen-free (SPF) eggs were obtained from Valo BioMedia North America Inc (Adel IA) and incubatedin a small-scale hatcher (Natureform Inc Jacksonville FL) at the PDRC facilities After hatch chickenswere provided with water and feed ad libitum At 1 day of age 33 chicks were vaccinated subcutaneouslyin the neck with HVT-LT Innovax at a dose of approximately 120000 PFU per bird (twice the full dose)administered in 100 l At 2 weeks of age a total of 33 chickens were vaccinated with the Trachivax CEOvaccine at dose of approximately 367 50 tissue culture infective doses (TCID50) per bird (one dose asdescribed on the vaccine label) administered in 33 l via eye drop Also at 2 weeks of age 40 chickenswere mock vaccinated via eye drop with vaccine diluent

At 5 weeks of age three groups of 18 chickens each vaccinated with either CEO Trachivax or HVT-LTInnovax or mock vaccinated were housed in separate isolators and challenged by coinoculation with 300l of a 11 mixture of the 1874c5 and 63140 strains of ILTV containing 103 PFU of each strain by theintratracheal route Immediately after the coinoculation challenge six naive (unvaccinated and uninocu-lated) chickens of the same age (5 weeks) were introduced into each group as in-contact animals Nineadditional groups of five to eight chickens each that had been previously vaccinated with either CEOTrachivax or HVT-LT Innovax or mock vaccinated were housed in separate isolators and challenged at 5weeks of age with 103 PFU of either 63140 or 1874c5 or mock challenged with GM Three naive chickenswere added to each group as in-contact birds immediately after inoculation In total 148 chicks wereused in this study The different experimental groups are summarized in Table 4

The birds were monitored for 9 days At 3 5 7 and 9 days after challenge tracheal swabs werecollected using standard techniques placed into 1 ml of viral transport medium (DMEM 3 [volvol] FBSand 100 g of ampicillinml) transported on ice and then stored at 80degC until they were processed forvirus isolation and purification Prior to storage at 80degC 200-l aliquots of tracheal swab suspensionwere collected and stored separately at 20degC for DNA extraction using the MegaZorb DNA Mini-Prepkit (Promega) following the manufacturerrsquos instructions DNA extracts were used as the template formeasurement of the ILTV genome concentration using a TaqMan qPCR that amplified a 103-bp productfrom glycoprotein C as described previously (43)

Virus isolation and purification Progeny viruses were isolated and purified as previously described(32) Material from each tracheal swab was serially diluted (10-fold) in GM in order to identify theappropriate dilution for plaque purification Dilutions were used to inoculate LMH cell monolayers in6-well plates After 1 h of incubation at 37degC the cell monolayer was covered with semisolid (2 [wtvol])methylcellulose overlay medium containing 10 (volvol) FBS and incubated at 37degC in a humidifiedatmosphere of 5 (volvol) CO2 in air After incubation for 24 to 48 h up to 20 plaques were picked fromeach sample from the chickens coinoculated with 1874c5 and 63140 ILTV and up to 10 were picked fromsamples collected from birds that received only one challenge virus (either 1874c5 or 63140) for each ofthe time points at which samples were collected (day 3 5 7 and 9 after challenge) Plaques were pickedwith a micropipette and then each plaque was propagated individually by the inoculation of LMH cellmonolayers in 12-well plates Three rounds of plaque purification were performed with one freeze-thawcycle between each round A final virus amplification step was then performed in 1 well of a 12-well plateper isolate to increase the amount of each ILTV isolate for downstream analysis

SNP genotyping assay To detect recombination a TaqMan SNP genotyping assay was developedthat targeted six unique SNPs distributed along the two ILTV genomes The SNPs were separated by amaximum of 30 kbp and a minimum of 2 kbp and were selected following alignment of the whole-

TABLE 4 Experimental groups

Group namea

No of chickens inoculatedin the group

No of in-contact birds addedat the time of challenge

Mock-VxMock-Ch 8 0Mock-Vx63140-Ch 7 3Mock-Vx1874c5-Ch 7 3Mock-Vxcoinoculation-Ch 18 6

CEO-VxdaggerMock-Ch 5 3CEO-Vxdagger63140-Ch 5 3CEO-Vxdagger1874c5-Ch 5 3CEO-Vxdaggercoinoculation-Ch 18 6

HVT-VxsectMock-Ch 5 3HVT-Vxsect63140-Ch 5 3HVT-Vxsect1874c5-Ch 5 3HVT-Vxsectcoinoculation-Ch 18 6aVx vaccinated Ch challenged dagger CEO vaccine (Trachivax Merck Animal Health Madison NJ) delivered byeye drop at 2 weeks of age sect HVT vaccine (Innovax-ILT Merck Animal Health Madison NJ) deliveredintradermally at 1 day of age coinoculation (strains 63140 and 1874c5 all challenge inocula weredelivered intratracheally at 5 weeks of age)

Loncoman et al Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e01822-18 aemasmorg 10

on Decem

ber 15 2020 by guesthttpaem

asmorg

Dow

nloaded from

genome sequences of 63140 and 1874c5 (GenBank accession numbers JN542536 and JN542533respectively) using the Mauve algorithm in Genious 80 (44) (Fig 5A) All targeted SNPs were transitionchanges resulting in either nonsynonymous or synonymous changes (Table 5) Each of the six SNPsidentified in the full-genome sequences of the parental strains was reconfirmed by PCR (primers are

FIG 5 Single nucleotide polymorphism (SNP) genotyping assay (A) Schematic representation of the distri-bution of the TaqMan probes along the unique long (UL) unique short (US) and internal and terminal repeat(IR and TR) regions of the genomes of ILTV strains 63140 (gray) and 1874c5 (black) The SNPs targeted areindicated with arrows and were located in the UL54 ORFE UL36 UL6 ORF1 ORF1 and US9 genes (B) Scatterplot of results from SNP genotyping assays when applied to 3 10-fold dilutions of positive-control samplesstarting from 1 105 genome copies per reaction of pure 63140 DNA or 1874c5 DNA negative-controlsamples (no-template and DNA negative extraction controls) and mixed control samples (63140 and 1874c5ILTV DNA in ratios of 101 11 and 110) SNP genotyping assay results were analyzed using StratageneMx3000P QPCR 41v software Orange 560 dye was used for the detection of SNPs originating from strain1874c5 (x axis) and FAM was used for the detection of SNPs originating from strain 63140 (y axis)

Recombination between US Field Strains of ILTV Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e01822-18 aemasmorg 11

on Decem

ber 15 2020 by guesthttpaem

asmorg

Dow

nloaded from

listed in Table S1 in the supplemental material) and amplicon sequencing (BigDye Terminator v31 LifeTechnologies) Samples were processed by the Georgia Genomics and Bioinformatics Core University ofGeorgia followed by sequence analysis using Geneious version 80 (44) After the presence of each SNPwas confirmed the target sequences for each SNP were analyzed using RealTimeDesign (BiosearchTechnologies httpswwwbiosearchtechcomrealtimedesign) (see Table S2) to design appropriateprimers and TaqMan probes The dye 6-carboxyfluorescein (FAM) was used for all the 63140 SNP probesand 560 CAL Fluor orange (CAL) was used for all 1874c5 SNP probes (Table 6) In silico evaluation of theprobes and primers was performed using the oligonucleotide evaluator feature within RealTimeDesign(httpswwwbiosearchtechcomProbeITydesignOligoEvaluatoraspx) For the TaqMan PCR assaysDNAs extracted from plaque-purified laboratory stocks of 63140 and 1874c5 were used as controlsamples These extracted DNAs were also used to create control samples that contained a mixture ofboth virus genomes at ratios of 101 11 and 110 The genome concentrations were determined usinga qPCR targeting the UL15 gene described elsewhere (43) These pure and mixture controls were thenused as the templates in control reactions along with negative (no template)-control reaction mixturesthat included distilled water rather than template DNA Each PCR mixture contained 2 l of DNAtemplate a 500 nM concentration of each of the specific primers and a 500 nM concentration of thespecific probe (Table 6) in addition to 8 l of the TaqMan GTXpress master mix (Applied Biosystems)Reaction mixtures were incubated in an Mx3000 real-time thermocycler (Stratagene) through 1 cycle of95degC for 2 min and 40 cycles of 30 s at 95degC and 60degC for 1 min The fluorescence from FAM (63140 SNPs)and CAL Fluor orange 560 (1874c5 SNPs) generated during the PCR amplification was read and themeasurements plotted using Stratagene Mx3000P QPCR 41v The results were used to confirm thepresence of DNA derived from the genome of either 63140 or 1874c5 ILTV at each SNP locus (Fig 5B)Following validation of the assay using the control samples the assay was then applied to DNA extractedfrom plaque-purified viruses recovered from the in vivo study in order to detect and discriminatebetween parent and recombinant viruses Any samples that yielded a result that could not be definitivelyidentified as either ILTV genome at any of the SNP loci (ie potentially contained a mixed population ofviruses) were excluded from further analysis

Examination of viral diversity To characterize the viral progeny and identify recombinants DNAfrom each plaque-purified virus was extracted and used as the template in the TaqMan SNP genotypingassay To measure diversity we first defined each recombinant using a unique genotype pattern codeThese genotype pattern codes were then analyzed in RStudio 099902 using VeganR (45) and Biodiver-sityR (46) VeganR calculates the diversity indices used to perform ecological diversity measurements in

TABLE 5 Single nucleotide polymorphisms (SNPs) selected within the genomes of strains63140 and 1874c5 for recombination detection assays

Target geneTarget lengthsequenced (bp)

Codon and amino acid forstraina

Transitionb63140 1874c5

UL54 98 CAC Val CAT Val SORFE 102 GTT Gln GCT Arg NSUL36 105 TGC Thr TGT Thr SUL6 175 CGG Ala TGG Thr NSORF1 90 TTA Leu CTA Leu SUS9 67 ACA Thr ATA Ile NSaModified nucleotide shown in boldbS synonymous NS nonsynonymous

TABLE 6 Oligonucleotide probes and primers used to detect SNPs within the genomes of ILTV strains 63140 and 1874c5

Targetgene

SNP positionin 63140

SNP positionin 1874c5

Distinguishingnucleotide

Fluorogenic probe(5=-BHQ1plus-3=)a Primer (5=ndash3=)b63140 1874c5

UL54 11750 11865 C T FAM-AAGACCGCACGCTCA F CACGGCCTCTCATAAACTTATTTCGCAL-TATGGAAGACCGTACGCT R CGAGCCTCGTTCCCGTTAC

ORFE 30097 30209 T C FAM-AATATCGCCGCTTGTAGTAG F GGCAAGTAATTATCGGCGAAGCTATCAL-CGCCGCTCGTAGTAG R GAGACAGCCCGCATCACTC

UL36 55879 55994 C T FAM-CTGGCAACGACACGTA F CCCGGAACCAGAAGATCGAAGCAL-CCTGGCAACAACACGT R GCGGTGTCATGTTTATCTCTGTG

UL6 102923 103038 C T FAM-CATCATAGGCGCGGATT F CAGTTACCAATGGTTCCCAAACAACCAL-CCATCATAGGTGCGGATT R GCCAGAGGGTTCGAAATGCT

ORF1 130696 129283 T C FAM-TGAGAAATCTTAAGGACCCC F ACTCCGTCTGCAATAATTTCCCTTCAL-ATGAGAAATCTTAGGGACCCC R CGTTAAAGCTATTTCCAGCGACAG

US9 139387 137974 C T FAM-CCACACACCCATGC F CGCTCTACCGTTTCCAGTCAACCAL-CCCACATACCCATGC R GCACGCGCCCATACTCAG

aDistinguishing nucleotides are in bold The BHQ1plus quencher (Biosearch Technologies) was attached to the 5= endbF forward R reverse

Loncoman et al Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e01822-18 aemasmorg 12

on Decem

ber 15 2020 by guesthttpaem

asmorg

Dow

nloaded from

communities (47) BiodiversityR was used to generate Renyi profiles This package provides a graphicaluser interface via R-Commander incorporating functions used by VeganR to analyze measures ofdiversity including richness (x axis value 0) Hill values (x axis values 025 05 4 8 16 32 and 64)Shannon-Weaver (x axis value 1) 1Simpson (x axis value 2) and 1Berger Parker (x axis value infinite) (46)

SUPPLEMENTAL MATERIAL

Supplemental material for this article may be found at httpsdoiorg101128AEM01822-18

SUPPLEMENTAL FILE 1 PDF file 40 MB

ACKNOWLEDGMENTSThis work was supported by the Australian Research Council (FT140101287) Carlos

A Loncoman was supported by Becas Chile CONICYT Gobierno de ChileThe funders had no role in study design data collection and interpretation or the

decision to submit the work for publication

REFERENCES1 Garcia M Spatz S Guy JS 2013 Infectious laryngotracheitis p 161ndash180

In Swayne D Glisson J McDougald L Nolan L Suarez D Nair V (ed)Diseases of poultry 13th ed Wiley-Blackwell Hoboken NJ

2 Zhao Y Kong C Wang Y 2015 Multiple comparison analysis of two newgenomic sequences of ILTV strains from China with other strains fromdifferent geographic regions PLoS One 10e0132747 httpsdoiorg101371journalpone0132747

3 Kong C Zhao Y Cui X Zhang X Cui H Xue M Wang Y 2013 Completegenome sequence of the first Chinese virulent infectious laryngotracheitisvirus PLoS One 8e70154 httpsdoiorg101371journalpone0070154

4 Zhao Y Kong C Cui X Cui H Shi X Zhang X Hu S Hao L Wang Y 2013Detection of infectious laryngotracheitis virus by real-time PCR in natu-rally and experimentally infected chickens PLoS One 8e67598 httpsdoiorg101371journalpone0067598

5 Lee S-W Devlin JM Markham JF Noormohammadi AH Browning GFFicorilli NP Hartley CA Markham PF 2013 Phylogenetic and molecularepidemiological studies reveal evidence of multiple past recombinationevents between infectious laryngotracheitis viruses PLoS One 8e55121httpsdoiorg101371journalpone0055121

6 Lee SW Markham PF Markham JF Petermann I Noormohammadi AHBrowning GF Ficorilli NP Hartley CA Devlin JM 2011 First completegenome sequence of infectious laryngotracheitis virus BMC Genomics12197 httpsdoiorg1011861471-2164-12-197

7 Lee SW Devlin JM Markham JF Noormohammadi AH Browning GFFicorilli NP Hartley CA Markham PF 2011 Comparative analysis of thecomplete genome sequences of two Australian origin live attenuatedvaccines of infectious laryngotracheitis virus Vaccine 299583ndash9587httpsdoiorg101016jvaccine201110055

8 Agnew-Crumpton R Vaz PK Devlin JM OrsquoRourke D Blacker-Smith HPKonsak-Ilievski B Hartley CA Noormohammadi AH 2016 Spread of thenewly emerging infectious laryngotracheitis viruses in Australia InfectGenet Evol 4367ndash73 httpsdoiorg101016jmeegid201605023

9 Lee SW Markham PF Coppo MJ Legione AR Markham JF Noormoham-madi AH Browning GF Ficorilli N Hartley CA Devlin JM 2012 Attenu-ated vaccines can recombine to form virulent field viruses Science337188 httpsdoiorg101126science1217134

10 Piccirillo A Lavezzo E Niero G Moreno A Massi P Franchin E Toppo SSalata C Palugrave G 2016 Full genome sequence-based comparative study ofwild-type and vaccine strains of infectious laryngotracheitis virus from ItalyPLoS One 11e0149529 httpsdoiorg101371journalpone0149529

11 Spatz SJ Volkening JD Keeler CL Kutish GF Riblet SM Boettger CMClark KF Zsak L Afonso CL Mundt ES Rock DL Garcia M 2012 Com-parative full genome analysis of four infectious laryngotracheitis virus(gallid herpesvirus-1) virulent isolates from the United States VirusGenes 44273ndash285 httpsdoiorg101007s11262-011-0696-3

12 Garciacutea M Volkening J Riblet S Spatz S 2013 Genomic sequence analysisof the United States infectious laryngotracheitis vaccine strains chickenembryo origin (CEO) and tissue culture origin (TCO) Virology 44064 ndash74httpsdoiorg101016jvirol201302007

13 Chandra YG Lee J Kong BW 2012 Genome sequence comparison of

two United States live attenuated vaccines of infectious laryngotrache-itis virus (ILTV) Virus Genes 44470 ndash 474 httpsdoiorg101007s11262-012-0728-7

14 Garcia M Spatz SJ Cheng Y Riblet SM Volkening JD Schneiders GH2016 Attenuation and protection efficacy of ORF C gene-deleted recom-binant of infectious laryngotracheitis virus J Gen Virol 972352ndash2362httpsdoiorg101099jgv0000521

15 Coppo MJ Hartley CA Devlin JM 2013 Immune responses to infectiouslaryngotracheitis virus Dev Comp Immunol 41454 ndash 462 httpsdoiorg101016jdci201303022

16 Coppo MJ Noormohammadi AH Browning GF Devlin JM 2013 Chal-lenges and recent advancements in infectious laryngotracheitis virusvaccines Avian Pathol 42195ndash205 httpsdoiorg101080030794572013800634

17 Loncoman CA Hartley CA Coppo MJC Vaz PK Diaz-Mendez A Brown-ing GF Garcia M Spatz S Devlin JM 2017 Genetic diversity of infectiouslaryngotracheitis virus during in vivo coinfection parallels viral replica-tion and arises from recombination hot spots within the genome ApplEnviron Microbiol 83e01532-17 httpsdoiorg101128AEM01532-17

18 Jetzt AE Yu H Klarmann GJ Ron Y Preston BD Dougherty JP 2000 Highrate of recombination throughout the human immunodeficiency virustype 1 genome J Virol 741234 ndash1240 httpsdoiorg101128JVI7431234-12402000

19 Loncoman CA Vaz PK Coppo MJ Hartley CA Morera FJ Browning GFDevlin JM 2017 Natural recombination in alphaherpesviruses insightsinto viral evolution through full genome sequencing and sequenceanalysis Infect Genet Evol 49174 ndash185 httpsdoiorg101016jmeegid201612022

20 Holmes EC 2003 Error thresholds and the constraints to RNA virusevolution Trends Microbiol 11543ndash546 httpsdoiorg101016jtim200310006

21 Mahy BWJ 2010 The evolution and emergence of RNA viruses EmergInfect Dis 16899 httpsdoiorg103201eid1605100164

22 Crute JJ Lehman IR 1989 Herpes simplex-1 DNA polymerase Identifi-cation of an intrinsic 5=-3= exonuclease with ribonuclease H activity JBiol Chem 26419266 ndash19270

23 McGeoch DJ Cook S 1994 Molecular phylogeny of the alphaherpesviri-nae subfamily and a proposed evolutionary timescale J Mol Biol 2389 ndash22 httpsdoiorg101006jmbi19941264

24 Drake JW Hwang CBC 2005 On the mutation rate of herpes simplexvirus type 1 Genetics 170969 ndash970 httpsdoiorg101534genetics104040410

25 Javier RT Sedarati F Stevens JG 1986 Two avirulent herpes simplexviruses generate lethal recombinants in vivo Science 234746 ndash748httpsdoiorg101126science3022376

26 Thiry E Meurens F Muylkens B McVoy M Gogev S Thiry J Vanderplass-chen A Epstein A Keil G Schynts F 2005 Recombination in alphaher-pesviruses Rev Med Virol 1589 ndash103 httpsdoiorg101002rmv451

27 Kintner RL Allan RW Brandt CR 1995 Recombinants are isolated at highfrequency following in vivo mixed ocular infection with two avirulent

Recombination between US Field Strains of ILTV Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e01822-18 aemasmorg 13

on Decem

ber 15 2020 by guesthttpaem

asmorg

Dow

nloaded from

herpes simplex virus type 1 strains Arch Virol 140231ndash244 httpsdoiorg101007BF01309859

28 Muylkens B Farnir F Meurens F Schynts F Vanderplasschen A GeorgesM Thiry E 2009 Coinfection with two closely related alphaherpesvirusesresults in a highly diversified recombination mosaic displaying negativegenetic interference J Virol 833127ndash3137 httpsdoiorg101128JVI02474-08

29 Dohner DE Adams SG Gelb LD 1988 Recombination in tissue culturebetween varicella-zoster virus strains J Med Virol 24329 ndash341 httpsdoiorg101002jmv1890240310

30 Fujita K Maeda K Yokoyama N Miyazawa T Kai C Mikami T 1998 Invitro recombination of feline herpesvirus type 1 Arch Virol 14325ndash34httpsdoiorg101007s007050050265

31 Henderson LM Katz JB Erickson GA Mayfield JE 1990 In vivo and invitro genetic recombination between conventional and gene-deletedvaccine strains of pseudorabies virus Am J Vet Res 511656 ndash1662

32 Loncoman CA Hartley CA Coppo MJC Vaz PK Diaz-Meacutendez A Brown-ing GF Lee S-W Devlin JM 2017 Development and application of aTaqMan single nucleotide polymorphism genotyping assay to studyinfectious laryngotracheitis virus recombination in the natural host PLoSOne 12e0174590 httpsdoiorg101371journalpone0174590

33 Rodriacuteguez-Avila A Oldoni I Riblet S Garciacutea M 2008 Evaluation of theprotection elicited by direct and indirect exposure to live attenuatedinfectious laryngotracheitis virus vaccines against a recent challengestrain from the United States Avian Pathol 37287ndash292 httpsdoiorg10108003079450802043742

34 Han MG Kim SJ 2003 Efficacy of live virus vaccines against infectiouslaryngotracheitis assessed by polymerase chain reaction-restriction frag-ment length polymorphism Avian Dis 47261ndash271 httpsdoiorg1016370005-2086(2003)047[0261EOLVVA]20CO2

35 Hein R Slacum G Lynch P Honegger K 2008 Recombinant HVTLTvaccine (INNOVAX-ILT) field application issues p 73ndash74 Proceedings ofthe 43rd National Meeting on Poultry Health and Processing OceanCity MD

36 Vagnozzi A Zavala G Riblet SM Mundt A Garcia M 2012 Protectioninduced by commercially available live-attenuated and recombinantviral vector vaccines against infectious laryngotracheitis virus in broilerchickens Avian Pathol 4121ndash31 httpsdoiorg101080030794572011631983

37 Fulton RM Schrader DL Will M 2000 Effect of route of vaccination onthe prevention of infectious laryngotracheitis in commercial egg-layingchickens Avian Dis 448 ndash16 httpsdoiorg1023071592502

38 Oldoni I Garcia M 2007 Characterization of infectious laryngotracheitisvirus isolates from the US by polymerase chain reaction and restrictionfragment length polymorphism of multiple genome regions AvianPathol 36167ndash176 httpsdoiorg10108003079450701216654

39 Kawaguchi T Nomura K Hirayama Y Kitagawa T 1987 Establishmentand characterization of a chicken hepatocellular carcinoma cell lineLMH Cancer Res 474460 ndash 4464

40 Devlin JM Browning GF Gilkerson JR 2006 A glycoprotein I- andglycoprotein E-deficient mutant of infectious laryngotracheitis virus ex-hibits impaired cell-to-cell spread in cultured cells Arch Virol 1511281ndash1289 httpsdoiorg101007s00705-005-0721-8

41 Devlin JM Browning GF Hartley CA Kirkpatrick NC Mahmoudian ANoormohammadi AH Gilkerson JR 2006 Glycoprotein G is a virulencefactor in infectious laryngotracheitis virus J Gen Virol 872839 ndash2847httpsdoiorg101099vir082194-0

42 Lee SW Hartley CA Coppo MJ Vaz PK Legione AR Quinteros JANoormohammadi AH Markham PF Browning GF Devlin JM 2015Growth kinetics and transmission potential of existing and emergingfield strains of infectious laryngotracheitis virus PLoS One 10e0120282httpsdoiorg101371journalpone0120282

43 Callison SA Riblet SM Oldoni I Sun S Zavala G Williams S ResurreccionRS Spackman E Garcia M 2007 Development and validation of areal-time Taqman PCR assay for the detection and quantitation ofinfectious laryngotracheitis virus in poultry J Virol Methods 13931ndash38httpsdoiorg101016jjviromet200609001

44 Kearse M Moir R Wilson A Stones-Havas S Cheung M Sturrock S BuxtonS Cooper A Markowitz S Duran C Thierer T Ashton B Meintjes P Drum-mond A 2012 Geneious Basic an integrated and extendable desktopsoftware platform for the organization and analysis of sequence dataBioinformatics 281647ndash1649 httpsdoiorg101093bioinformaticsbts199

45 Oksanen J 2015 Multivariate Analysis of Ecological Communities in Rvegan tutorial The R Foundation Vienna Austria httpveganr-forger-projectorg

46 Kindt R Coe R 2005 Tree diversity analysis a manual and software forcommon statistical methods for ecological and biodiversity studies WorldAgroforestry Centre Nairobi Kenya httpwwwworldagroforestryorgresourcesdatabasestree-diversity-analysis

47 Hill MO 1973 Diversity and evenness a unifying notation and itsconsequences Ecology 54427ndash 432 httpsdoiorg1023071934352

48 Toacutethmeacutereacutesz B 1995 Comparison of different methods for diversityordering J Veg Sci 6283ndash290 httpsdoiorg1023073236223

Loncoman et al Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e01822-18 aemasmorg 14

on Decem

ber 15 2020 by guesthttpaem

asmorg

Dow

nloaded from