simba thesis 06feb2012 - ugent · 2019-07-04 · my education. may this thesis be a reward for all...
TRANSCRIPT
1
Domestication of the trypanosome transmission cycle and its
effect on the level of drug resistance, transmissibility and
virulence of Trypanosoma congolense.
Simbarashe Chitanga
Dissertation submitted in fulfilment of the requirements for the degree of Doctor of
Philosophy (PhD) in Veterinary Parasitology
2012
Promoters:
Prof. Dr. Jan Van Den Abbeele
Prof. Dr. Pierre Dorny
Co-Promoters:
Dr. Vincent Delespaux
Dr. Boniface Namangala
Laboratory of Parasitology
Department of Virology, Parasitology and Immunology
Faculty of Veterinary Medicine, Ghent University
Salisburylaan 133, B-9820 Merelbeke
2
I dedicate this thesis to the memory of Prof. Dr. Peter Van den Bossche (May his soul rest
in eternal peace), for his contribution to my academic career but mostly to the study and
control of tsetse and trypanosomosis.
3
Acknowledgements
Firstly I would like to express my sincere gratitude to my various promoters for their input in
the initiation, implementation and successful completion of this work; Dr. Vincent
Delespaux, the late Prof. Peter Van den Bossche, Prof. Jan Van Den Abbeele, Dr. Boniface
Namangala, and Dr. Davies Mubika Pfukenyi.
I would also like to express my profound gratitude to Prof. Pierre Dorny for accepting me as
his student at Ghent University.
My sincere gratitude to the Belgian government who, through the Directorate General of
Development Cooperation and the Institute of Tropical Medicine, provided the financial
support for this thesis.
Special thanks go to Dr. Tanguy Marcotty for his tireless efforts and patience in helping me
with the statistical analysis of my experimental data.
I would like to say ‘thank you very much’ to the technical staff at ITM namely Ko, Lieve,
Famke, Niels, Anke, Karin and Jos Van Hees for all the assistance they rendered to me
during the course of all these studies. The same thanks go to Mercy and Mr. Chota at UNZA.
I also acknowledge the staff of Rukomichi and Kakumbi research stations as well as
veterinary staff of Siavonga and Mambwe districts.
4
A big thank you to my wife, Katendi, and daughter, Sihle Thandie, who had to endure long
periods of separation as I pursued this dream. I love you both so much. You bring meaning
and purpose to my life.
Thanks are due to my parents who sacrificed a lot to give me very good education which
served as the foundation for me to reach this level of education. I thank them, together with
my siblings, for putting aside their needs in order to allow me to use the resources to advance
my education. May this thesis be a reward for all your sacrifices.
Thank you to the staff of ITM, especially the ones from the former Animal Health
Department who made their best to make me feel at home, away from home. To Ko, those
weekly drinks meant a lot.
To my fellow PhD students, with whom together we suffer the struggle to attain this degree, I
say ‘Aluta continua’.
Last but not least, I say thank you to the almighty Lord for granting me the strength and
knowledge to pull through this opportunity you gave me from the goodness of your heart.
May this thesis be to your glory.
5
List of abbreviations
µl: Microliter
AAT: African Animal Trypanosomosis
CI: Confidence Interval
DA: Diminazene Aceturate
DNA: Deoxyribonucleic Acid
dNTP: Deoxynucleotide Triphosphates
EDTA: Ethylenediamine Tetra acetic Acid
IP: Intraperitoneally
ISM: Isometamidium
NaCl: Sodium Chloride
OF1: Outbred First generation
PCR: Polymerase Chain Reaction
PSG: Phosphate Buffered Saline Glucose
Taq: Thermus aqueous
TcoAT1: Trypanosoma congolense Adenosine Transporter 1
6
List of Figures
FIGURE 1 - 1. EFFECT OF ENVIRONMENTAL CHANGES ON THE VECTOR-PARASITE-HOST
INTERACTION/RELATIONSHIP IN TSETSE TRANSMITTED TRYPANOSOMOSIS AND THEIR
REPERCUSSIONS FOR THE EPIDEMIOLOGY OF THE DISEASE. VAN DEN BOSSCHE ET AL.
(2010). ................................................................................................................................ 6
FIGURE 2 - 1. MEDIAN SURVIVAL TIME (WITH 95% C.I.) OF MICE INFECTED WITH ONE OF THE T.
CONGOLENSE (SAVANNAH SUBGROUP) STRAINS ISOLATED IN ZAMBIA AND SOUTH AFRICA.
.......................................................................................................................................... 35
FIGURE 2 - 2. SURVIVAL ANALYSIS OF MICE INFECTED WITH STRAINS ISOLATED FROM THE TWO
TRANSMISSION CYCLES. .................................................................................................... 36
FIGURE 4 - 1. RELATION BETWEEN THE PARASITE LOAD OF THE BLOOD MEAL AND THE MIDGUT
INFECTION RATE. RESULTS WERE OBTAINED FOR THREE DIFFERENT T. CONGOLENSE
ISOLATES (IL 1180, MF1 CL1 AND KAPEYA 357 C1). THE INFECTED FLIES WERE
DISSECTED 10 DAYS AFTER TAKING THE INFECTIVE BLOOD MEAL. .................................... 67
7
List of Tables
TABLE 2 - 1. NUMBER OF T. CONGOLENSE STRAINS (SAVANNAH SUBGROUP), ISOLATED IN THE
DOMESTIC OR SYLVATIC TRANSMISSION CYCLE, BELONGING TO THE LOW, MEDIUM AND
HIGH VIRULENCE CATEGORY ............................................................................................. 37
TABLE 3 - 1. RFLP-PROFILES OF THE DIFFERENT WILD T. CONGOLENSE STRAINS AND THEIR
DRUG SENSITIVITY PROFILE IN INFECTED MICE TREATED WITH 20 AND 10 MG/KG
DIMINAZENE (DA). THIS DRUG SENSITIVITY PROFILE WAS SCORED FOR EACH INDIVIDUAL
MOUSE BY MICROSCOPY AND PCR ANALYSIS, 60 DAYS AFTER THE INITIAL TREATMENT. . 52
TABLE 3 - 2. WEEKLY EVOLUTION OF PARASITAEMIA AS DETERMINED BY PCR-RFLP POST-
TREATMENT WITH 20MG/KG .............................................................................................. 52
TABLE 4 - 1. ISOLATES USED IN THE STUDY SHOWING THEIR ORIGIN, VIRULENCE CATEGORY,
NUMBER OF FLIES DISSECTED AND PROPORTION INFECTED (%) WITHIN THE MIDGUT
(PROCYCLIC) AND MOUTHPARTS (METACYCLIC) .............................................................. 69
TABLE 4 - 2. COMPARISON OF THE TRANSMISSIBILITY BETWEEN ISOLATES FROM DIFFERENT
CYCLES AND VIRULENCE CATEGORIES .............................................................................. 70
8
Table of Contents
Acknowledgements .................................................................................................................. 3
List of abbreviations ................................................................................................................ 5
List of Figures ........................................................................................................................... 6
List of Tables ............................................................................................................................ 7
General introduction ............................................................................................................... 1
References ................................................................................................................................. 4
Chapter 1 .................................................................................................................................. 6
Evolution of trypanosomosis from game to livestock reservoir: dynamics of host-vector-
parasite interactions. A literature review. ............................................................................ 6
1.1. Introduction ....................................................................................................................... 7
1.2. Vector-Parasite interactions ............................................................................................ 7
1.2.1. Transmission ................................................................................................................ 7
1.2.2. Evolution of transmission .......................................................................................... 10
1.3. Host-Parasite interactions .............................................................................................. 10
1.3.1. Evolution of virulence................................................................................................ 12
1.3.2. Control of trypanosomosis ......................................................................................... 13
1.3.2.1. Drug resistance in trypanosomosis control ......................................................... 13
1.3.2.2. Evolution of drug resistance ............................................................................... 14
1.3.2.3. Spread of resistance ............................................................................................ 16
1.3.2.4. Challenges of drug resistance ............................................................................. 16
1.4. Conclusion ....................................................................................................................... 18
1.5. References ........................................................................................................................ 19
Objectives of the thesis .......................................................................................................... 26
Chapter 2 ................................................................................................................................ 28
Virulence in Trypanosoma congolense Savannah subgroup: A comparison between
strains and transmission cycles ............................................................................................. 28
Abstract ................................................................................................................................... 29
2.1. Introduction ..................................................................................................................... 30
2.2. Materials and Methods ................................................................................................... 31
2.2.1. Isolation of trypanosomes belonging to the domestic transmission cycle ................. 31
2.2.2. Isolation of trypanosomes belonging to the sylvatic transmission cycle ................... 32
2.2.3. Virulence testing ........................................................................................................ 32
2.2.4. Statistical analysis ...................................................................................................... 33
2.3. Results .............................................................................................................................. 34
2.4. Discussion and conclusion .............................................................................................. 37
9
2.5. References ........................................................................................................................ 40
Chapter 3 ................................................................................................................................ 44
High prevalence of drug Resistance in Animal Trypanosomes without a history of drug
exposure. ................................................................................................................................. 44
Abstract ................................................................................................................................... 45
3.1. Introduction ..................................................................................................................... 46
3.2. Materials and Methods ................................................................................................... 48
3.2.1. Study areas and isolation of trypanosomes ................................................................ 48
3.2.2. DA resistance genetic profiling by DpnII-PCR-RFLP .............................................. 49
3.2.3. In vivo drug sensitivity testing (multi doses test in mice) ......................................... 50
3.2.4. Monitoring trypanosome presence by PCR ............................................................... 50
3.2.5. Degradation of trypanosomal DNA in vivo ............................................................... 50
3.3. Results .............................................................................................................................. 51
3.4. Discussion......................................................................................................................... 53
3.5. References ........................................................................................................................ 56
Chapter 4 ................................................................................................................................ 59
Parasite-related factors that could affect the tsetse fly transmissibility of T. congolense
isolates: parasite load and the parasite transmission cycle. ............................................. 59
Abstract ................................................................................................................................... 60
4.1. Introduction. .................................................................................................................... 61
4.2. Materials and methods ................................................................................................... 63
4.2.1. Tsetse flies ................................................................................................................. 63
4.2.2. Trypanosome isolates from domestic and sylvatic cycles ......................................... 63
4.2.3. Mice and rabbits ......................................................................................................... 64
4.2.4. Experimental designs ................................................................................................. 64
4.2.4.1 Effect of the parasite load of a blood meal on parasite establishment in the tsetse
fly midgut ......................................................................................................................... 64
4.2.4.2. Comparison of the transmissibility in the sylvatic and domestic cycles ............ 65
4.2.5. Statistical analysis ...................................................................................................... 65
4.3. Results .............................................................................................................................. 66
4.3.1. Parasite load and transmissibility............................................................................... 66
4.3.2. Comparison of the transmissibility between cycles and virulence ............................ 67
4.4. Discussion and conclusion .............................................................................................. 70
4.5. References ........................................................................................................................ 73
Chapter 5. ............................................................................................................................... 76
General discussion ................................................................................................................. 76
5.1. Introduction ..................................................................................................................... 77
5.2. Host-Parasite Interactions: has transmission cycle altered this relationship?.......... 77
10
5.2.1. Evolution of virulence ................................................................................................ 77
5.2.2. Evolution of the prevalence of drug resistance inducing mutations .......................... 79
5.3. Vector-Parasite Interactions: what is the effect of parasite density and host
change/transmission cycle? ................................................................................................... 81
5.4. Drug sensitivity, virulence and transmissibility interaction in domestication of the
trypanosome transmission cycle ........................................................................................... 82
5.5. Implications of our findings in trypanosomosis control in livestock .......................... 82
5.6. References:....................................................................................................................... 85
Summary ................................................................................................................................. 88
Samenvatting .......................................................................................................................... 92
Curriculum Vitae ................................................................................................................... 96
1
General introduction
2
African animal trypanosomosis (AAT) is one of the economically most important
livestock diseases in sub-Saharan Africa due to its extensive economic losses, reduction in
livestock productivity and rural development. The direct and indirect losses attributed to the
disease run into billions of dollars, annually (Mattioli et al., 2004). The disease is caused by
trypanosomes, which are flagellated protozoan parasites belonging to the order
Kinetoplastida, family Trypanosomatidae, genus Trypanosoma (Hoare, 1972). Tsetse-
transmitted trypanosomes belong to the Salivaria section which is subdivided based on
several criteria, including morphology and site of development in the fly into four subgenera
including various species. Trypanosoma congolense (T. congolense) is considered the most
pathogenic of cattle trypanosomes.
In sub-Saharan Africa, trypanosomes are biologically transmitted by tsetse flies (order
Diptera, family Glossinidae, genus Glossina). The genus is further subdivided into three
groups/subgenera, namely the fusca group, the morsitans group and the palpalis group with
each group further subdivided into species and subspecies (Buxton, 1955). However, other
biting insects may mechanically transmit trypanosomes (Desquesnes and Dia, 2003). In the
tsetse fly, trypanosomes undergo a developmental cycle which depends on the trypanosome
species. Trypanosoma vivax (T. vivax) normally develops in the proboscis alone (Gardiner,
1989). T. congolense and Trypanosoma brucei (T. brucei) establish as procyclic forms in the
tsetse midgut before migration and maturation into metacyclic forms in the fly proboscis and
salivary glands, respectively.
The impact of the disease on animal health depends on a number of factors, among
which are the susceptibility of the host, the trypanosome species and the
pathogenicity/virulence of the trypanosome population involved. Wild animals, which are the
natural host of the infection, do not normally exhibit clinical signs of infection, whilst in
domestic livestock the infection exhibits as either an acute or chronic infection. The infection
3
in livestock is often fatal with its herd level impact ranging widely, but affecting various
aspects of productivity (Connor, 1994).
Disease control measures are mainly targeted towards elimination of the parasite from
host blood and prevention of tsetse bites through vector control. Parasite elimination is
mainly achieved through use of trypanocides which can be either curative or prophylactic; of
which diminazene aceturate (DA) and isometamidium (ISM) are commonly used to achieve
the respective goals. However, this control arsenal is now hampered by increasing reports of
drug resistance (Delespaux et al., 2008). Vector control is based on tsetse fly elimination and
various control methods have been used to achieve this goal. (Vale et al., 1988; Bauer et al.,
1995; Hargrove et al., 1995; Hargrove et al., 2000; Vreysen et al., 2000). Prevention of
successful establishment and/or maturation of trypanosomes within the tsetse fly have been
proposed as possible future control method (Hao et al., 2001; Aksoy et al., 2003). Use of
trypanotolerant animals is another alternative in areas affected by the disease since these
animals do not succumb to the infection.
Many studies have been conducted on the epidemiology of trypanosomosis but this
has focussed mostly on the domestic transmission cycle. The various trypanosome
characteristics that impact the epidemiology of the parasite infection in its natural
transmission cycle will be detailed in the next chapter. Some emphasis will be put on how the
change in trypanosome transmission cycle could potentially influence the evolution of some
of these trypanosome characteristics.
4
References
Aksoy, S., Gibson, W.C., Lehane, M.J., 2003. Interactions between tsetse and trypanosomes
with implications for the control of trypanosomiasis. Adv. Parasitol. 53, 1-83.
Bauer, B., Amsler-Delafosse, S., Clausen, P.H., Kabore, I., Petrich-Bauer, J., 1995.
Successful application of deltamethrin pour on to cattle in a campaign against tsetse
flies (Glossina spp.) in the pastoral zone of Samorogouan, Burkina Faso. Trop. Med.
Parasitol 46, 183-189.
Buxton, P.A., 1955. The natural history of tsetse flies. An account of the biology of the genus
Glossina (Diptera). Lewis H.K. & Co Ltd., London.
Connor, R.J., 1994. The impact of nagana. Onderstepoort J. Vet. Res. 61, 379-383.
Delespaux, V., Geysen, D., Van den Bossche, P., Geerts, S., 2008. Molecular tools for the
rapid detection of drug resistance in animal trypanosomes. Trends Parasitol 24, 236-
242.
Desquesnes, M., Dia, M.L., 2003. Mechanical transmission of Trypanosoma congolense in
cattle by the African tabanid Atylotus agrestis. Exp. Parasitol. 105, 226-231.
Gardiner, P.R., 1989. Recent studies of the biology of Trypanosoma vivax. Adv. Parasitol 28,
229-317.
Hao, Z., Kasumba, I., Lehane, M.J., Gibson, W.C., Kwon, J., Aksoy, S., 2001. Tsetse
immune responses and trypanosome transmission: implications for the development
of tsetse-based strategies to reduce trypanosomiasis. Proc. Natl. Acad. Sci. U. S. A 98,
12648-12653.
Hargrove, J.W., Holloway, M.T.P., Vale, G.A., Gough, A.J.E., Hall, D.R., 1995. Catches of
tsetse (Glossina spp.) (Diptera Glossinidae) from traps and targets baited with large
doses of natural and synthetic host odour. In: pp. 215-227.
Hargrove, J.W., Silas, O., Msaliswa, J.S.I., Fox, B., 2000. Insecticide-treated cattle for tsetse
control: The power and the problems. In: pp. 123-130.
Hoare, C.A., 1972. The trypanosomes of mammals. A Zoological Monograph. Blackwell,
Oxford.
Mattioli, R.C., Feldmann, G., Hendrickx, W., Wint, J., Jannin, J., Slingenbergh, J., 2004.
Tsetse and trypanosomiasis intervention policies supporting sustainable animal-
agricultural development. Food, Agr. Environ. Food Agr Environ, 310-314.
Vale, G.A., Lovemor, D.F., Flint, S., Cockbill, G.F., 1988. Odour-baited targets to control
tsetse flies, Glossina spp. (Diptera: Glossinidae), in Zimbabwe. In: pp. 31-49.
Vreysen, M.J., Saleh, K.M., Ali, M.Y., Abdulla, A.M., Zhu, Z.R., Juma, K.G., Dyck, V.A.,
Msangi, A.R., Mkonyi, P.A., Feldmann, H.U., 2000. Glossina austeni (Diptera:
5
Glossinidae) eradicated on the island of Unguja, Zanzibar, using the sterile insect
technique. J. Econ. Entomol. 93, 123-135.
6
Chapter 1
Evolution of trypanosomosis from game to livestock reservoir:
dynamics of host-vector-parasite interactions. A literature
review.
Figure 1 - 1. Effect of environmental changes on the vector-parasite-host
interaction/relationship in tsetse transmitted trypanosomosis and their repercussions for
the epidemiology of the disease. Van den Bossche et al. (2010).
7
1.1. Introduction
Tsetse transmitted trypanosomosis is an important tropical disease affecting livestock
(nagana) and humans (sleeping sickness). Tsetse flies (Diptera: Glossinidae) cyclically
transmit several trypanosome species i.e. Trypanosoma vivax (T. vivax), Trypanosoma
congolense (T. congolense), Trypanosoma simiae (T. simiae) and Trypanosoma brucei (T.
brucei) (Aksoy et al., 2003) with T. congolense being the most pathogenic for cattle
(Swallow, 2000). Trypanosomosis is naturally an infection of wildlife but has crossed over to
domestic animals due to encroachment of people into areas normally inhabited by game
animals, resulting in different epidemiological settings representing specific host-parasite
interactions (Van den Bossche, 2008). Much work has been done on the epidemiology of
trypanosomosis but there has been no attempt to determine how the evolution of the parasite
from a wildlife cycle to a domestic cycle may have impacted some trypanosome
characteristics which are of importance in the epidemiology of the disease.
The objective of this review was to summarize our current knowledge on three
important determinants of African animal trypanosomosis (AAT) epidemiology (with focus
on T. congolense) namely; transmissibility (vector-parasite interactions), drug sensitivity and
pathogenicity/virulence (host-parasite interactions), and how they are affected by various
factors in the different epidemiological settings. Based upon this review we will expose the
gaps that still need to be explored.
1.2. Vector-Parasite interactions
1.2.1. Transmission
In order to come up with specific and effective vector based control strategies, it is
important to understand the interactions between the parasite and the vector. For successful
transmission of T. congolense parasites through the tsetse fly, the parasite has to establish in
the fly midgut and then differentiate and migrate to the mouthparts. The number of flies that
8
develop a mature infection and the length of time required for an infection to establish and
mature into a transmissible form can vary depending on several factors which include fly
species, fly sex and parasite strain (Walshe et al., 2009). Tsetse flies have been shown to
exhibit some degree of refractoriness to trypanosome infection, with only a proportion of flies
taking an infective blood-meal establishing midgut infection and this proportion decreasing
with age of the fly (Distelmans et al., 1982; Welburn and Maudlin, 1992; Kubi et al., 2006;
Walshe et al., 2011). Also it has been shown that the majority of trypanosomes which
establish within the midgut will not develop into mature infections (Van den Abbeele et al.,
1999; Gibson and Bailey, 2003; Peacock et al., 2006). The refractoriness and limitation to
successful maturation of trypanosomes by tsetse flies is thought to be due to, among other
factors, the fly’s immune response to infection (Hao et al., 2001). Other factors thought to
play an important role in the refractoriness of flies include tsetse antimicrobial peptides
(Boulanger et al., 2002), starvation (Kubi et al., 2006), reactive oxygen species (Macleod et
al., 2007b), endosymbionts (Geiger et al., 2005; Geiger et al., 2007), temperature (Leak,
1998; Macleod et al., 2007a), and host blood (Mihok et al., 1993; Mihok et al., 1995; Zongo
et al., 2004). Apart from these fly related factors; parasite factors also play a significant role
in the development process. To adapt from a glucose rich environment in the animal to being
able to survive within the tsetse fly, the parasite undergoes metabolic changes which include
adaptation to use of proline as energy source, which will ultimately determine its success in
establishing within the fly (Matthews, 2005). In T. brucei, these metabolic changes are also
accompanied by morphological changes with the stumpy forms of the parasite being able to
differentiate into the midgut procyclic forms (Matthews, 1999) and its transmissibility has
been shown to be correlated to the proportion of these stumpy forms in the circulation
(Balber, 1972; Van den Bossche et al., 2005). These morphological changes are not the norm
9
in T. congolense though they have been reported in certain strains and been linked to
transmissibility (Godfrey, 1960; Nantulya et al., 1978a; Nantulya et al., 1978b).
In trypanosomosis, whilst a single trypanosome has been shown to be capable of
infecting a tsetse fly (Maudlin and Welburn, 1989), there have been conflicting reports on the
relationship between parasite density in blood meal and infection rates in tsetse fly (Nantulya
et al., 1978a; Akoda et al., 2008). In their study, Akoda et al (2008), found that stage of
development and not parasite density was the main determinant of transmissibility and
subscribed this to possibility of effect of host immune response affecting parasite viability,
hence its ability to infect tsetse fly. Transmission of another vertebrate protozoon,
Plasmodium, has been shown to be via ingestion of sexual, and not asexual, parasite forms by
the vector, with the gametocyte quality/viability and not its quantity being the main
determinant to this relationship (Drakeley et al., 2006). There have been conflicting reports
on the relationship between parasite density and mosquito infection (Draper, 1953; Muirhead-
Thomson, 1954; Jeffery and Eyles, 1955; Muirhead-Thomson, 1957; Rutledge et al., 1969;
Boudin et al., 1993; Tchuinkam et al., 1993) whilst some studies have failed to show an
association at all (Haji et al., 1996; Lensen et al., 1998). There however exists a minimum
threshold of gametocyte density beyond which mosquito infection rates increase (Drakeley et
al., 2006). This relationship is however not exponential but rather adopts a sigmoid curve due
to various immunological, haematological and mosquito factors which cause gametocyte
aggregation thus putting an upper threshold on mosquito infection (Paul et al., 2007). In their
study on T. brucei and T. congolense, Walshe et al. (2011) observed that parasite density
influenced fly infection rates between threshold of 5 000/ml and 50 000/ml, thus suggesting
host parasitaemia could influence infection prevalence.
10
1.2.2. Evolution of transmission
Evolutionary processes have resulted in considerable changes in transmissibility of
trypanosome species, most notably in T. vivax and T. brucei subgroup (Masumu et al., 2010).
Complete or partial loss of kDNA in T. brucei into its mutants, petite T. equiperdum and T.
evansi, locks the parasite in the bloodstream form making them only transmissible
mechanically, hence allowing them to adapt in tsetse free environments (Lai et al., 2008).
Also in the T. brucei subgroup, evolutionary processes have resulted in that the human
infective T. b. rhodesiense and T. b. gambiense have lower transmissibility in comparison to
the non-human infective T. b. brucei (Welburn et al., 1995). Whilst the reduced
transmissibility reduces the parasite’s basic reproductive number through reduced longevity,
the evolutionary cost of the reduced transmissibility of the human infective strains is
probably offset by their increased virulence and infectivity to other tsetse hosts (Welburn et
al., 1995). In T. congolense, variation has been observed where it has been shown that the
Savannah subgroup is more transmissible than the Riverine and Forest subgroups (Reifenberg
et al., 1997). Also within the Savannah subgroup, variation has been reported in strains
isolated from one geographical area and this was associated with the level of virulence of the
individual strains (Masumu et al., 2006b). Evolutionary adaptation of the T. congolense
Savannah subgroup to presence of drug pressure, by development of drug resistance has also
been shown to increase transmissibility of the strain (Van den Bossche et al., 2006a).
1.3. Host-Parasite interactions
Three epidemiological settings of AAT representing the various host-parasite
interactions have been identified; (i) settings in which livestock are absent or have been
introduced into game areas where wildlife is still very abundant and constitutes the major
source of food for tsetse, (ii) settings in which, often because of human interference and
habitat change, the density of game is low and livestock constitute the main source of food
11
for tsetse and (iii) settings in which tsetse have disappeared because of habitat change and
where livestock are challenged by tsetse flies at the edge of tsetse-infested protected wildlife
zones (game-livestock interface) (Van den Bossche et al., 2010).
The first epidemiological setting involves both game and livestock with a
predomination of the former (Van den Bossche et al., 2010). Game animals, being the natural
host, do not suffer from the disease as they have evolved tolerance over millions of years of
co-evolving with the parasite (Mulla and Rickman, 1988; Mattioli and Wilson, 1996). Due to
their inherent trypanotolerance, game animals are capable of acting as an important selective
pressure on trypanosomes by selecting for highly replicating parasites thereby increasing the
virulence of such strains when they infect susceptible hosts (Miller et al., 2006). The
livestock introduced into such game areas thus suffer devastating losses in productivity due to
the disease (Doran, 2000). The impact of the disease in this epidemiological setting has been
reported in the Ethiopian highlands (Slingenbergh, 1992) and during the livestock restocking
exercise of Mozambique after their civil war (Sigauque et al., 2000).
A second epidemiological setting of AAT where livestock constitute the main food
source is characterized by low disease impact on the livestock (Doran, 2000; Mattioli et al.,
2000; Van den Bossche et al., 2010). The reduced impact of the disease in this setting has
been suggested to be due to the predominance of lowly virulent strains in this transmission
cycle (Masumu et al., 2006a) and the suggested protection they offer against the devastating
effect of the highly virulent strains (Masumu et al., 2009). However, the development of
trypanotolerance in this setting cannot be discounted (Van den Bossche, 2008). The eastern
plateau of Zambia typifies such an epidemiological setting (Doran, 2000).
In the third epidemiological setting, disease impact on livestock is only found along
the game-livestock interface where the livestock succumb to the disease. In some respect the
impact of the disease along this interface is the same as that suffered when animals are
12
introduced into game areas. An example of this epidemiological setting is the one reported
along the Hluhluwe-Umfolozi game reserve in KwaZulu-Natal (Van den Bossche et al.,
2006b).
1.3.1. Evolution of virulence
The low impact of the disease in wildlife has been ascribed to the immunity of game
animals which allows them to suppress the pathogenic effects of the infection (Mulla and
Rickman, 1988) thus allowing them to select for isolates of high virulence (Miller et al.,
2006). Domestic livestock due to their susceptibility are expected to hardly survive with
considerable production losses or to succumb to infection. This has been observed when
cattle are introduced into areas with game animals or in areas bordering protected game areas
(Slingenbergh, 1992; Sigauque et al., 2000; Van den Bossche et al., 2006b). Such huge
impacts of infections in new host populations has been observed in emerging diseases
manifesting as epidemics but eventually followed by attenuation of virulence levels in the
absence of host evolution (Fenner and Ratcliffe, 1965). This attenuation of virulence could
possibly lead to reduced impact of disease through an attainment of a selection driven
optimum virulence, determined by various dynamics (Frank, 1992; Frank, 1996; van Baalen
M., 1998; Gandon et al., 2001). This evolutionary reduction in virulence could be the cause
of the reduced impact of the disease in areas where livestock constitutes the main reservoir
(Doran, 2000). It was observed that in Eastern Zambia, an area where livestock constitutes
the main reservoir, a higher proportion of low virulent strains were circulating (Masumu et
al., 2006a) explaining the apparent low impact of the disease in such epidemiological
settings. A suggested protective effect of these lowly virulent strains against pathogenic
effects of highly virulent strains (Masumu et al., 2009) as well as the possibility of
development of trypanotolerance (Van den Bossche, 2008) in livestock could also explain the
reduced impact of the disease. However, some fundamental questions still remain to be
13
answered: (i) what proportion of highly virulent strains are in circulation in the game animals;
(ii) is the increased impact of the disease at the interface due to naivety of livestock or due to
high virulence of parasites in this cycle and (iii) is the reduced impact of disease in domestic
cycle due to development of immunity in livestock or a predominance of lowly virulent
strains. More insight into these questions would help in understanding of parasite evolution as
it jumps host (wildlife versus domesticated animals) and how this impacts its virulence.
1.3.2. Control of trypanosomosis
Several strategies aimed at controlling the parasite within the animal as well as
controlling the vector are available (Cuisance et al, 1994). Vector control methods involve
the use of insecticides through spraying, insecticide-treated targets or insecticide-treated
animals (Vale et al., 1988; Bauer et al., 1995; Hargrove et al., 1995). Alternative methods
include use of traps and screens impregnated with synthetic pyrethroid insecticides (Hargrove
et al., 1995) and the sterile insect technique which has registered successful eradication in
Zanzibar (Vreysen et al., 2000). In rural communities, which are affected the most, control is
mainly reliant on trypanocides (Delespaux et al., 2008a). The main drugs used are
isometamidium (ISM), which offers both prophylactic and curative effects, and diminazene
aceturate (DA), which is only curative. Across Africa, there is a high annual usage of these
trypanocides which has been estimated to be around 35 million doses with ISM and DA each
representing 40% and 33% respectively (Geerts and Holmes, 1998).
1.3.2.1. Drug resistance in trypanosomosis control
ISM and DA have been on the market for over 50 years now and inevitably resistance
against them has emerged with the first reports dating as far back as the 1960s (Jones-Davies,
1967; Na'Isa, 1967). To date there are 18 countries in which resistance to these drugs has
been reported (Delespaux et al., 2008b) and more recently in Benin, Ghana and Togo
14
(Réseau d'épidémiosurveillance de la résistance aux trypanocides et aux acaricides en Afrique
de l'Ouest – RESCAO, unpublished data). Whilst it is not clear whether the recent increase in
reports of the phenomena is due to increase in the problem or increased interest by the
scientific community, the report by Delespaux et al. (2008a) of a fivefold increase in DA
resistance in one community over a seven year period highlights that the problem may
actually be on the rise.
1.3.2.2. Evolution of drug resistance
Clinically drug resistance is defined as an infection that survives treatment, relapsing
at a later time (Hastings, 2004). The drug resistant parasites can be partially resistant,
reappearing a few days post-treatment, or fully resistant, where they do not respond to the
treatment at all (Hastings et al., 2002; Prudhomme O'Meara et al., 2006). Parasitologically,
low parasite densities (cryptic) that can remain after treatment are also considered resistant
parasites even though the host remains healthy. This parasitological resistance is frequently
observed in the early stages of the emergence of clinical resistance (Hastings et al., 2002) and
its development is considered a crucial step in the evolution of drug resistance (Prudhomme
O'Meara et al., 2006).
Drug resistance results from, among other mechanisms, mutations in drug targets in
parasite genes (Hastings and D'Alessandro, 2000). Resistance to DA in T. congolense, has
been shown to be linked to a mutation in the putative P2-type purine transporter, TcoAT1
(Delespaux et al., 2006) which is involved in the drug uptake by the parasite. Mutation in an
ATP binding cassette-like transporter of T. congolense has been shown to induce resistance to
ISM in some strains but is not a strategy that is conserved among all trypanosomes strains.
Indeed, presence of strains which were phenotypically resistant but without the observed
mutation would suggest that there are other as yet unidentified mechanisms by which
15
trypanosomes develop resistance to ISM (Delespaux et al., 2005). These genetic mutations
can cause moderate changes in drug susceptibility, such that the drug remains effective at the
normal dose or very large reductions in susceptibility such that drug concentrations become
completely ineffective (Hastings et al., 2002; White and Pongtavornpinyo, 2003).
Resistance evolution has been identified to involve an association between the
specific drug, the microbial agent and the ecology of interaction of the two (MacLean et al.,
2010). Mutations that confer drug resistance are thought to arise randomly, independent of
the presence of the drug, with a positive selection in parasite strains exposed to the drug
(White and Pongtavornpinyo, 2003; Prudhomme O'Meara et al., 2006). However, Babiker et
al. (2009) ascertain that mutations leading to drug resistance are adaptive changes due to drug
pressure, but with a fitness cost to the parasite that would have been eliminated in the absence
of drug pressure. In the case where these mutations are considered adaptive, the following
three changes can occur to result in resistance; (i) mutations or amplification of specific genes
directly involved in a protective pathway, (ii) mutations in genes that regulate stress-response
processes and leading to altered expression of specific proteins and (iii) transfer of resistance
inducing mutations between parasites (Hayes and Wolf, 1990). Whilst any mutation is
potentially deleterious and thus selected against by natural selection, mutant parasites persist
at low frequencies maintained by the selection-mutation balance (Hastings, 2004). In order to
fully understand the evolution of drug resistance, the following factors need to be understood;
(i) frequency of resistant alleles in the population prior to drug use as determined by the
mutation-selection balance, (ii) dynamics of the resistance conferring mutation once the drug
is introduced, (iii) level and pattern of drug use and (iv) the magnitude of the threshold
frequency (Hastings, 1997). The threshold frequency is that frequency below which any
mutations will not be able to establish within the population in the absence of a selective
force.
16
1.3.2.3. Spread of resistance
The rate of spread of these drug resistance inducing mutations is directly determined
by the relative fitness of the mutant and wild-type parasites (Mackinnon, 2005). The finding
by Delespaux et al. (2008a) of a five-fold increase in prevalence of the mutation inducing DA
resistance in an area where drug use had not changed indicated that there was spread of the
mutation within the population and that it was not due to increased drug pressure. The authors
speculated that the observed increase could have been due to genetic exchange, as has been
observed in T. brucei. However, it is also possible that this was due to the increased fitness of
the mutant as is suggested to be the case in T. brucei by the findings of Geiser et al. (2005).
Besides genetic exchange and direct selection in presence of drug pressure, another route by
which resistance inducing mutations are selected for is indirectly when linked to another
genetic site which is under positive selection for a different phenotype (Hill et al., 2009).
Whichever way that resistance inducing mutations are selected for, it is worthwhile to note
that the resistance will only evolve faster in areas in which the starting frequency of the
mutation is high and may not evolve at all should the starting frequency be below the
threshold (Hastings, 1997).
1.3.2.4. Challenges of drug resistance
Emergence, establishment and subsequent spread of drug resistant pathogens tends to
erode the benefits of antimicrobial treatment and introduces the challenge of combating the
spread and this may involve finding new treatment regimens (Debarre et al., 2009). As such it
is important to fully understand the phenomena of drug resistance; its origin, spread and
effects on disease control. At the moment, much research has been to understand the
molecular basis of resistance but however, the practical consequences in terms of how to
control its evolution is still unknown (Hastings and D'Alessandro, 2000). This is further
complicated by the realization that not all parasites assessed to be drug resistant on the basis
17
of genotyping actually exhibit the resistance phenotype in a population with some level of
immunity (Cravo et al., 2001). It has been observed in T. congolense, that some strains
carrying the mutation linked to DA resistance are susceptible to drug dosages even lower than
the recommended dose (Delespaux et al., 2006). Important progress has been made in trying
to understand the molecular mechanisms of drug resistance in trypanosomosis, but still the
processes by which these mutations arise has not been elucidated.
1.3.2.5. Control of drug resistance
Understanding how patterns of drug use and the epidemiological context of drug
deployment affect the emergence and spread of drug resistance is important in protecting the
efficacy of current and future drugs (Prudhomme O'Meara et al., 2006). One of the strategies
which can be used to combat spread of drug resistance is by reducing the drug pressure.
Reduction in drug pressure impacts drug resistance evolution in three ways; (i) delays its
appearance, (ii) reduces the likelihood of its establishment and (iii) slows its spread (Smith et
al., 2010). Reducing drug pressure works very well under the assumption that the percentage
of strains carrying resistance inducing mutations increases in a population in proportion to the
rate of drug use in the population (Smith et al., 2010). Combination therapy slows the rate of
spread of drug resistance since only those strains carrying a mutation to all drugs used will be
able to survive and this lowers the starting frequency for evolution of resistance (Hastings
and D'Alessandro, 2000). In trypanosomosis control, it is recommended to use the sanative
pair as a way of curbing the spread of resistance by alternating use of ISM and DA
(Whiteside, 1962). However, combination therapy only works when the drugs are unrelated
and if instituted early enough before significant resistance to either drug is present in the
population (Hastings et al., 2002; Smith et al., 2010).
18
1.4. Conclusion
Up to now, the impact of changing from a sylvatic to a domestic reservoir on a
trypanosome population is not known. Nevertheless, the repercussions of this change for the
trypanosome population cannot be negligible considering the fact that this change involves;
(i) a shift from a trypanotolerant (wildlife) host that does not suffer from the infection to a
trypanosusceptible (livestock) host that is likely to die from the infection and,
(ii) the exposure of the trypanosome population to trypanocidal drug pressure in the domestic
host.
Questions remain on how the trypanosome population deals with these considerable
changes. Therefore, the specific aim of the proposed research project is to study three
important characteristics of trypanosomes isolated from a sylvatic and domestic transmission
cycle; i.e. level of drug resistance, pathogenicity and transmissibility in trypanosomes
isolated from a sylvatic and domestic transmission cycle. These characteristics contribute
individually and, perhaps more important, jointly to the adaptation of the trypanosome
population to their respective host. Hereby important questions related to the development
and epidemiology of drug resistance in trypanosomes will be addressed. They include (i) are
trypanosomes “naturally” resistant to trypanocidal compounds, (ii) does drug resistance
develop either by selection of naturally existing resistant trypanosomes and/or by genetic
modification of sensitive trypanosomes induced by the domestication of the life-cycle, and
(iii) is trypanosome virulence and transmissibility modified by the change in transmission
cycle.
19
1.5. References
Akoda, K., Harouna, S., Marcotty, T., De, D.R., Van den Bossche, P., 2008. Investigations on
the transmissibility of Trypanosoma congolense by the tsetse fly Glossina morsitans
morsitans during its development in a mammalian host. Acta Trop. 107, 17-19.
Aksoy, S., Gibson, W.C., Lehane, M.J., 2003. Interactions between tsetse and trypanosomes
with implications for the control of trypanosomiasis. Adv. Parasitol. 53, 1-83.
Babiker, H.A., Hastings, I.M., Swedberg, G., 2009. Impaired fitness of drug-resistant malaria
parasites: evidence and implication on drug-deployment policies. Expert Rev Anti-
Infe 7, 581-593.
Balber, A.E., 1972. Trypanosoma brucei: fluxes of the morphological variants in intact and
X-irradiated mice. Exp. Parasitol. 31, 307-319.
Boudin, C., Olivier, M., Molez, J.F., Chiron, J.P., Ambroise-Thomas, P., 1993. High human
malarial infectivity to laboratory-bred Anopheles gambiae in a village in Burkina
Faso. Am. J. Trop. Med. Hyg. 48, 700-706.
Boulanger, N., Brun, R., Ehret-Sabatier, L., Kunz, C., Bulet, P., 2002. Immunopeptides in the
defense reactions of Glossina morsitans to bacterial and Trypanosoma brucei brucei
infections. Insect Biochem. Mol. Biol. 32, 369-375.
Cravo, P., Culleton, R., Hunt, P., Walliker, D., Mackinnon, M.J., 2001. Antimalarial drugs
clear resistant parasites from partially immune hosts. Antimicrob. Agents Chemother.
45, 2897-2901.
Debarre, F., Lenormand, T., Gandon, S., 2009. Evolutionary epidemiology of drug-resistance
in space. PLoS. Comput. Biol. 5, e1000337.
Delespaux, V., Chitanga, S., Geysen, D., Goethals, A., Van den Bossche, P., Geerts, S., 2006.
SSCP analysis of the P2 purine transporter TcoAT1 gene of Trypanosoma congolense
leads to a simple PCR-RFLP test allowing the rapid identification of diminazene
resistant stocks. Acta Trop. 100, 96-102.
Delespaux, V., Dinka, H., Masumu, J., Van den Bossche, P., Geerts, S., 2008a. Five fold
increase in the proportion of diminazene aceturate resistant Trypanosoma congolense
isolates over a seven years period in Eastern Zambia. Drug Resist Update 11, 205-
209.
Delespaux, V., Geysen, D., Majiwa, P.A.O., Geerts, S., 2005. Identification of a genetic
marker for isometamidium chloride resistance in Trypanosoma congolense. Int. J.
Parasitol. 35, 235-243.
Delespaux, V., Geysen, D., Van den Bossche, P., Geerts, S., 2008b. Molecular tools for the
rapid detection of drug resistance in animal trypanosomes. Trends Parasitol 24, 236-
242.
Distelmans, W., D'Haeseleer, F., Kaufman, L., Rousseeuw, P., 1982. The susceptibility of
Glossina palpalis palpalis at different ages to infection with Trypanosoma congolense.
Ann. Soc. Belg. Med. Trop. 62, 41-47.
20
Doran, M., 2000. Socio-economics of trypanosomosis. In: RTTCP (Ed.), Bovine
Trypanosomosis in Southern Africa, Harare, pp. 1-146.
Drakeley, C., Sutherland, C., Bousema, J.T., Sauerwein, R.W., Targett, G.A., 2006. The
epidemiology of Plasmodium falciparum gametocytes: weapons of mass dispersion.
Trends Parasitol. 22, 424-430.
Draper, C.C., 1953. Observations on the infectiousness of gametocytes in hyperendemic
malaria. Trans. R. Soc. Trop. Med. Hyg. 47, 160-165.
Fenner, F., Ratcliffe, F.N., 1965. Myxomatosis. Cambridge University Press, Cambridge,
U.K.
Frank, S.A., 1992. A kin selection model for the evolution of virulence. Proc. Biol. Sci. 250,
195-197.
Frank, S.A., 1996. Models of parasite virulence. Q. Rev. Biol. 71, 37-78.
Gandon, S., Mackinnon, M.J., Nee, S., Read, A.F., 2001. Imperfect vaccines and the
evolution of pathogen virulence. Nature 414, 751-756.
Geerts, S., Holmes, P.H., 1998. Drug management and parasite resistance in bovine
trypanosomiasis in Africa. PAAT Technical Scientific Series 1.
Geiger, A., Ravel, S., Frutos, R., Cuny, G., 2005. Sodalis glossinidius (Enterobacteriaceae)
and vectorial competence of Glossina palpalis gambiensis and Glossina morsitans
morsitans for Trypanosoma congolense savannah type. Curr. Microbiol. 51, 35-40.
Geiger, A., Ravel, S., Mateille, T., Janelle, J., Patrel, D., Cuny, G., Frutos, R., 2007. Vector
competence of Glossina palpalis gambiensis for Trypanosoma brucei s.l. and genetic
diversity of the symbiont Sodalis glossinidius. Mol. Biol. Evol. 24, 102-109.
Geiser, F., Luscher, A., de Koning, H.P., Seebeck, T., Maser, P., 2005. Molecular
pharmacology of adenosine transport in Trypanosoma brucei: P1/P2 revisited. Mol.
Pharmacol. 68, 589-595.
Gibson, W., Bailey, M., 2003. The development of Trypanosoma brucei within the tsetse fly
midgut observed using green fluorescent trypanosomes. Kinetoplastid Biology and
Disease 2.
Godfrey, D.G., 1960. Types of Trypanosoma congolense. I. Morphological differences. Ann.
Trop. Med. Parasitol. 54, 428-438.
Haji, H., Smith, T., Charlwood, J.D., Meuwissen, J.H., 1996. Absence of relationships
between selected human factors and natural infectivity of Plasmodium falciparum to
mosquitoes in an area of high transmission. Parasitology 113 ( Pt 5), 425-431.
Hao, Z., Kasumba, I., Lehane, M.J., Gibson, W.C., Kwon, J., Aksoy, S., 2001. Tsetse
immune responses and trypanosome transmission: implications for the development
of tsetse-based strategies to reduce trypanosomiasis. Proc. Natl. Acad. Sci. U. S. A 98,
12648-12653.
21
Hastings, I.M., 1997. A model for the origins and spread of drug-resistant malaria.
Parasitology 115 ( Pt 2), 133-141.
Hastings, I.M., 2004. The origins of antimalarial drug resistance. Trends Parasitol. 20, 512-
518.
Hastings, I.M., D'Alessandro, U., 2000. Modelling a predictable disaster: the rise and spread
of drug-resistantmalaria. Parasitol. Today 16, 340-347.
Hastings, I.M., Watkins, W.M., White, N.J., 2002. The evolution of drug-resistant malaria:
the role of drug elimination half-life. Philos. Trans. R. Soc. Lond B Biol. Sci. 357,
505-519.
Hayes, J.D., Wolf, C.R., 1990. Molecular mechanisms of drug resistance. Biochem. J. 272,
281-295.
Hill, A.W., Guralnick, R.P., Wilson, M.J., Habib, F., Janies, D., 2009. Evolution of drug
resistance in multiple distinct lineages of H5N1 avian influenza. Infect. Genet. Evol.
9, 169-178.
Jeffery, G.M., Eyles, D.E., 1955. Infectivity to mosquitoes of Plasmodium falciparum as
related to gametocyte density and duration of infection. Am. J. Trop. Med. Hyg. 4,
781-789.
Jones-Davies, W.J., 1967. A Berenil resistant strain of Trypanosoma vivax in cattle. Vet. Rec.
81, 567-568.
Kubi, C., Van Den Abbeele, J., De, D.R., Marcotty, T., Dorny, P., Van den Bossche, P.,
2006. The effect of starvation on the susceptibility of teneral and non-teneral tsetse
flies to trypanosome infection. Med. Vet. Entomol. 20, 388-392.
Lai, D.H., Hashimi, H., Lun, Z.R., Ayala, F.J., Lukes, J., 2008. Adaptations of Trypanosoma
brucei to gradual loss of kinetoplast DNA: Trypanosoma equiperdum and
Trypanosoma evansi are petite mutants of T. brucei. Proc. Natl. Acad. Sci. U. S. A
105, 1999-2004.
Leak, S.G.A., 1998. Tsetse biology and ecology. Their role in the epidemiology and control
of trypanosomosis. CABI publishing, UK.
Lensen, A., Mulder, L., Tchuinkam, T., Willemsen, L., Eling, W., Sauerwein, R., 1998.
Mechanisms that reduce transmission of Plasmodium falciparum malaria in
semiimmune and nonimmune persons. J. Infect. Dis. 177, 1358-1363.
Mackinnon, M.J., 2005. Drug resistance models for malaria. Acta Trop. 94, 207-217.
MacLean, R.C., Hall, A.R., Perron, G.G., Buckling, A., 2010. The population genetics of
antibiotic resistance: integrating molecular mechanisms and treatment contexts. Nat.
Rev. Genet. 11, 405-414.
Macleod, E.T., Darby, A.C., Maudlin, I., Welburn, S.C., 2007a. Factors affecting
trypanosome maturation in tsetse flies. PLoS. One. 2, e239.
22
Macleod, E.T., Maudlin, I., Darby, A.C., Welburn, S.C., 2007b. Antioxidants promote
establishment of trypanosome infections in tsetse. Parasitology 134, 827-831.
Masumu, J., Akoda, K., Van den Bossche, P., 2010. Transmissibility, by Glossina morsitans
morsitans, of Trypanosoma congolense strains during the acute and chronic phases of
infection. Acta Trop. 113, 195-198.
Masumu, J., Marcotty, T., Geerts, S., Vercruysse, J., Van den Bossche, P., 2009. Cross-
protection between Trypanosoma congolense strains of low and high virulence. Vet.
Parasitol. 163, 127-131.
Masumu, J., Marcotty, T., Geysen, D., Geerts, S., Vercruysse, J., Dorny, P., Van den
Bossche, P., 2006a. Comparison of the virulence of Trypanosoma congolense strains
isolated from cattle in a trypanosomiasis endemic area of eastern Zambia. Int. J.
Parasitol. 36, 497-501.
Masumu, J., Marcotty, T., Ndeledje, N., Kubi, C., Geerts, S., Vercruysse, J., Dorny, P., Van
den Bossche, P., 2006b. Comparison of the transmissibility of Trypanosoma
congolense strains, isolated in a trypanosomiasis endemic area of eastern Zambia, by
Glossina morsitans morsitans. Parasitology 133, 331-334.
Matthews, K.R., 1999. Developments in the differentiation of Trypanosoma brucei. Parasitol.
Today 15, 76-80.
Matthews, K.R., 2005. The developmental cell biology of Trypanosoma brucei. J. Cell Sci.
118, 283-290.
Mattioli, R.C., Pandey, V.S., Murray, M., Fitzpatrick, J.L., 2000. Immunogenetic influences
on tick resistance in African cattle with particular reference to trypanotolerant
N'Dama (Bos taurus) and trypanosusceptible Gobra zebu (Bos indicus) cattle. Acta
Trop. 75, 263-277.
Mattioli, R.C., Wilson, R.T., 1996. Trypanosomes, tsetse and trypanotolerance: coevolution
in tropical Africa. Parassitologia 38, 531-535.
Maudlin, I., Welburn, S.C., 1989. A single trypanosome is sufficient to infect a tsetse fly.
Ann. Trop. Med. Parasitol. 83, 431-433.
Mihok, S., Machika, C., Darji, N., Kang'ethe, E.K., Otieno, L.H., 1995. Relationships
between host blood factors and proteases in Glossina morsitans subspecies infected
with Trypanosoma congolense. Med. Vet. Entomol. 9, 155-160.
Mihok, S., Olubayo, R.O., Darji, N., Zweygarth, E., 1993. The influence of host blood on
infection rates in Glossina morsitans sspp. infected with Trypanosoma congolense, T.
brucei and T. simiae. Parasitology 107 ( Pt 1), 41-48.
Miller, M.R., White, A., Boots, M., 2006. The evolution of parasites in response to tolerance
in their hosts: the good, the bad, and apparent commensalism. Evolution 60, 945-956.
Muirhead-Thomson, R.C., 1954. Low gametocyte thresholds of infection of Anopheles with
Plasmodium falciparum; a significant factor in malaria epidemiology. Br. Med. J. 1,
68-70.
23
Muirhead-Thomson, R.C., 1957. The malarial infectivity of an African village population to
mosquitoes (Anopheles gambiae); a random xenodiagnostic survey. Am. J. Trop.
Med. Hyg. 6, 971-979.
Mulla, A.F., Rickman, L.R., 1988. How do African game animals control trypanosome
infections? Parasitol. Today 4, 352-354.
Na'Isa, B.K., 1967. Follow-up of a survey on the prevalence of homidium-resistant strains of
trypanosomes in cattle in Northern Nigeria and drug cross-resistance tests on the
strains with Samorin and Berenil. Bull. Epizoot. Dis. Afr.
Nantulya, V.M., Doyle, J.J., Jenni, L., 1978a. Studies on Trypanosoma (nannomonas)
congolense II. Observations on the cyclical transmission of three field isolates by
Glossina morsitans morsitans. Acta Trop. 35, 339-344.
Nantulya, V.M., Doyle, J.J., Jenni, L., 1978b. Studies on Trypanosoma (nannomonas)
congolense. I. On the morphological appearance of the parasite in the mouse. Acta
Trop. 35, 329-337.
Paul, R.E., Bonnet, S., Boudin, C., Tchuinkam, T., Robert, V., 2007. Aggregation in malaria
parasites places limits on mosquito infection rates. Infect. Genet. Evol. 7, 577-586.
Peacock, L., Ferris, V., Bailey, M., Gibson, W., 2006. Multiple effects of the lectin-inhibitory
sugars D-glucosamine and N-acetyl-glucosamine on tsetse-trypanosome interactions.
Parasitology 132, 651-658.
Prudhomme O'Meara, Smith, D.L., McKenzie, F.E., 2006. Potential impact of intermittent
preventive treatment (IPT) on spread of drug-resistant malaria. PLoS. Med. 3, e141.
Reifenberg, J.M., Cuisance, D., Frezil, J.L., Cuny, G., Duvallet, G., 1997. Comparison of the
susceptibility of different Glossina species to simple and mixed infections with
Trypanosoma (Nannomonas) congolense savannah and riverine forest types. Med.
Vet. Entomol. 11, 246-252.
Rutledge, L.C., Gould, D.J., Tantichareon, B., 1969. Factors affecting the infection of
anophelines with human malaria in Thailand. Trans. R. Soc. Trop. Med. Hyg. 63,
613-619.
Sigauque, I., Van den Bossche, P., Moiana, M., Jamal, S., Neves, L., 2000. The distribution
of tsetse (Diptera: Glossinidae) and bovine trypanosomosis in the Matutuine District,
Maputo Province, Mozambique. Onderstepoort J. Vet. Res. 67, 167-172.
Slingenbergh, J., 1992. Tsetse control and agricultural development on Ethiopia. World An.
Rev. 70-71, 30-36.
Smith, D.L., Klein, E.Y., McKenzie, F.E., Laxminarayan, R., 2010. Prospective strategies to
delay the evolution of anti-malarial drug resistance: weighing the uncertainty. Malar.
J. 9, 217.
Swallow, B.M., 2000. Impacts of trypanosomosis on African agriculture. PAAT Technical
Scientific Series 2. FAO, Rome, Italy.
24
Tchuinkam, T., Mulder, B., Dechering, K., Stoffels, H., Verhave, J.P., Cot, M., Carnevale, P.,
Meuwissen, J.H., Robert, V., 1993. Experimental infections of Anopheles gambiae
with Plasmodium falciparum of naturally infected gametocyte carriers in Cameroon:
factors influencing the infectivity to mosquitoes. Trop. Med. Parasitol. 44, 271-276.
van Baalen M., 1998. Coevolution of recovery ability and virulence. Proc. Biol. Sci. 265,
317-325.
Van den Abbeele, J., Claes, Y., van, B.D., Le, R.D., Coosemans, M., 1999. Trypanosoma
brucei spp. development in the tsetse fly: characterization of the post-mesocyclic
stages in the foregut and proboscis. Parasitology 118 ( Pt 5), 469-478.
Van den Bossche, P., 2008. Tsetse-transmitted Trypanosomiasis: Variations on a Theme. In:
pp. 523-536.
Van den Bossche, P., Akoda, K., Kubi, C., Marcotty, T., 2006a. The transmissibility of
Trypanosoma congolense seems to be associated with its level of resistance to
isometamidium chloride. Vet. Parasitol. 135, 365-367.
Van den Bossche, P., Esterhuizen, J., Nkuna, R., Matjila, T., Penzhorn, B., Geerts, S.,
Marcotty, T., 2006b. An update of the bovine trypanosomosis situation at the edge of
Hluhiuwe-Imfolozi Park, Kwazulu-Natal Province, South Africa. Onderstepoort J.
Vet. Res. 73, 77-79.
Van den Bossche, P., Ky-Zerbo, A., Brandt, J., Marcotty, T., Geerts, S., De, D.R., 2005.
Transmissibility of Trypanosoma brucei during its development in cattle. Trop. Med.
Int. Health 10, 833-839.
Van den Bossche, P., Rocque, S.D., Hendrickx, G., Bouyer, J., 2010. A changing
environment and the epidemiology of tsetse-transmitted livestock trypanosomiasis.
Trends Parasitol. 26, 236-243.
Walshe, D.P., Lehane, M.J., Haines, L.R., 2011. Post eclosion age predicts the prevalence of
midgut trypanosome infections in glossina. PLoS. One. 6, e26984.
Walshe, D.P., Ooi, C.P., Lehane, M., 2009. The Enemy Within: Interactions Between Tsetse,
Trypanosomes and Symbionts. In: Simpson Stephen J, Casas Jeacuterocircme (Eds.),
Advances in Insect Physiology 37. Elsevier Ltd.
Welburn, S.C., Maudlin, I., 1992. The nature of the teneral state in Glossina and its role in the
acquisition of trypanosome infection in tsetse. Ann. Trop. Med. Parasitol 86, 529-536.
Welburn, S.C., Maudlin, I., Milligan, P.J., 1995. Trypanozoon: infectivity to humans is linked
to reduced transmissibility in tsetse. I. Comparison of human serum-resistant and
human serum-sensitive field isolates. Exp. Parasitol. 81, 404-408.
White, N.J., Pongtavornpinyo, W., 2003. The de novo selection of drug-resistant malaria
parasites. Proc. Biol. Sci. 270, 545-554.
Whiteside, E.F., 1962. The control of cattle trypanosomiasis with drugs in Kenya: Methods
and costs. East Afr. Agr. J. 28.
25
Zongo, I., Mbahin, N., Van Den Abbeele, J., De, D.R., Van den Bossche, P., 2004.
Comparison of the infection rate of tsetse, Glossina morsitans morsitans, fed in vitro
or in vivo. Med. Vet. Entomol. 18, 64-66.
26
Objectives of the thesis
27
The main objective of this thesis was to understand the changes in various epidemiological
parameters (transmissibility, virulence and drug sensitivity) which the trypanosome (T.
congolense) undergoes as a result of a change in the transmission cycle from a sylvatic
transmission cycle to a domestic transmission cycle. Knowledge of the effect of this change
on the important epidemiological parameters would improve the understanding of the
domestication of the transmission cycle and contribute to a more focussed control of
livestock trypanosomosis. In order to achieve this overall objective, the study comprised of
four specific objectives:
� Determine and compare the transmissibility of trypanosomes isolated from the
sylvatic and domestic transmission cycles.
� Determine and compare the virulence of trypanosomes isolated from the sylvatic and
domestic transmission cycles.
� Determine and compare the drug sensitivity (molecular and phenotypic), to
diminazene aceturate, of the trypanosomes isolated from the sylvatic and domestic
transmission cycles.
� Link the domestication of the transmission cycle to changes in transmissibility,
virulence and drug sensitivity of the trypanosomes.
28
Chapter 2
Virulence in Trypanosoma congolense Savannah subgroup: A comparison
between strains and transmission cycles
Van den Bossche P+†
., Chitanga S+., Masumu J., Marcotty T., Delespaux V. (2011).
Virulence in Trypanosoma congolense Savannah subgroup. A comparison between strains
and transmission cycle.
Parasite Immunology 38 (8): 456-460
+ P. Van den Bossche & S. Chitanga contributed equally to this work.
† Passed away on 14 November 2010.
Virulence evolution for any organism is an outcome of host and parasite genotypic
interactions (Read & Taylor, 2001; Ebert & Bull, 2003; Lambrechts et al., 2006)
29
Abstract
Trypanosoma congolense strains have been shown to differ in their virulence both between
subgroups and within the Savannah subgroup. This review revisits these data and
complements them with analyses of T. congolense Savannah subgroup strains isolated from
cattle (domestic transmission cycle) in different geographical areas and strains isolated in
protected areas where trypanotolerant wildlife species are the reservoir of the trypanosomes
(sylvatic transmission cycle). The virulence of a total of 62 T. congolense Savannah subgroup
strains (50 domestic and 12 sylvatic) was determined using a standard protocol in mice.
Virulence varied substantially between strains with, depending on the strain, the median
survival time of infected mice varying from 5 to more than sixty days. The proportion of
highly virulent strains (median survival time < 10 days) was significantly (P=0.005) higher in
strains from the sylvatic transmission cycle. The analysis highlights repercussions of the
domestication of trypanosomosis transmission cycle that may have to be taken in
consideration in the development of trypanosomosis control strategies.
30
2.1. Introduction
Human and animal tsetse-transmitted trypanosomosis are important diseases affecting
people and livestock in extensive areas of sub-Saharan Africa. Human African
trypanosomosis is caused by infections with Trypanosoma brucei gambiense or T. b.
rhodesiense. Infections with T. b. gambiense usually give rise to a chronic form of human
sleeping sickness in West and Central Africa that may persist for several years, whereas T. b.
rhodesiense usually causes an acute infection in East Africa (Garcia et al., 2006).
Nevertheless, a diversity of clinical evolutions from asymptomatic to acute forms has been
described in T. b. gambiense infections. Similarly in T. b. rhodesiense, the disease has a
rather chronic character in southern countries such as Malawi and Uganda (Maclean et al.,
2004). Trypanosoma vivax is a pathogen of livestock in Africa and in South America. It is
transmitted cyclically by tsetse flies and mechanically by biting flies. Differences in virulence
are recognized between East and West African T. vivax strains, with the West African strains
being generally regarded as more pathogenic to cattle (Stephen, 1986). Nevertheless, there
are also reports of a severe haemorrhagic diseases caused by T. vivax in East Africa (Gardiner
et al., 1989). In South America, most T. vivax infections are chronic and asymptomatic, with
rare outbreaks of severe disease (Osorio et al., 2008). The salivarian trypanosomes belonging
to the subgenus Nannomonas (T. congolense and T. simiae) are major pathogens of livestock
in sub-Saharan Africa. Contrary to the T. brucei group, T. congolense has been much less
studied. Currently two major clades are distinguished within the Nannomonas subgenus with
one containing the T. congolense: Savannah, Forest and Kilifi subgroups and the other
containing T. simiae, T. godfreyi and T. simiae Tsavo (Gibson, 2003). Limited experiments,
comparing the virulence of one strain of each subgroup in mice and cattle, have shown
differences between the subgroups with the T. congolense strain of Savannah subgroup being
the most virulent (Bengaly et al., 2002a; Bengaly et al., 2002b). However, experiments
31
conducted by Masumu et al (2006) have shown substantial variation in the virulence of T.
congolense strains belonging to the Savannah subgroup. These findings were based on T.
congolense strains isolated from susceptible livestock species (i.e. the domestic transmission
cycle) and may not represent the natural trypanosome population as it is present in
trypanotolerant wildlife (i.e. the sylvatic transmission cycle). This paper reviews the
virulence profiles of T. congolense Savannah subgroup strains isolated from livestock and
compares their virulence with that of strains circulating in wildlife.
2.2. Materials and Methods
Considering the dynamic nature of the epidemiology of tsetse-transmitted
trypanosomosis (Van den Bossche et al., 2010), trypanosome strains were isolated in a
livestock production area where susceptible cattle constitute the main reservoir of
trypanosomes (domestic transmission cycle) and in protected areas where trypanotolerant
wildlife is the reservoir of trypanosomes and tsetse flies do not have contact with livestock
(sylvatic transmission cycle).
2.2.1. Isolation of trypanosomes belonging to the domestic transmission cycle
A total of 45 T. congolense strains were isolated from communal cattle (Ngoni breed)
reared in a trypanosomosis endemic area located in the Katete and Mambwe districts of the
plateau areas of eastern Zambia (Masumu et al., 2006). The area is highly cultivated with a
cattle population of approximately 8-10 animals/km². Cattle constitute the main host of the
tsetse flies and the main reservoir of trypanosomes (Van den Bossche and Staak, 1997).
Large game animals are absent.
Another five T. congolense strains were also isolated from communal cattle (Ngoni
breed) kept in Siavonga District in Southern Province of Zambia. The area is separated from
the tsetse-infested wildlife area between Chirundu and Kariba in Zimbabwe by the Zambezi
River.
32
In both areas, cattle infected with T. congolense were identified using parasitological
diagnostic tests (Paris et al., 1982). For each infected bovine, a volume of 0.3ml of the
infected blood was injected intraperitoneally (I.P.) into each of two OF1 mice. The injected
mice were monitored for development of parasitaemia, with each trypanosome population
developing in a positive mouse considered as an isolate. Parasitaemic mice were euthanized
and the blood collected for stabilate production
2.2.2. Isolation of trypanosomes belonging to the sylvatic transmission cycle
Six T. congolense strains were isolated from tsetse flies in the South Luangwa
National Park in Zambia. The South Luangwa National Park is a protected game area where
wildlife acts as reservoirs of the trypanosomes. Tsetse flies (Glossina morsitans morsitans
and G. pallidipes) were trapped using epsilon traps (Hargrove and Langley, 1990) and live
flies were dissected to determine their infection status. The mouthparts of tsetse flies, infected
with trypanosomes in both the midgut and mouthparts, were injected I.P. into an
immunosuppressed OF1 mouse (300mg/kg Cyclophosphamide, Endoxan ®, Baxter S.A.).
The injected mice were then monitored for development of parasitaemia, with each positive
mouse considered as an isolate. Parasitaemic mice were then euthanized and the blood
collected for stabilate production.
Finally, six T. congolense strains were isolated from buffalos belonging to herds that
were selected randomly for tuberculosis testing in the Hluhluwe-iMfolozi Park located in the
KwaZulu-Natal Province of South Africa. From each of the 132 buffalo sampled, a volume of
0.3ml of jugular blood was injected into each of two mice. The injected mice were then
monitored as described above and stabilates were prepared from the blood of positive mice.
2.2.3. Virulence testing
The virulence of the T. congolense isolates, all belonging to the Savannah subgroup
(Geysen et al., 2003) was determined using a standard protocol in OF1 mice (Masumu et al.,
33
2006). All strains were at their fifth or sixth passage in mice. Before infection, each of the
strains was expanded into two OF1 mice. Wet tail-blood films of the infected mice were
examined microscopically at two day intervals to estimate the parasitaemia (Herbert and
Lumsden, 1976). When the parasitaemia reached between 107 and 10
8 trypanosomes/ml, tail-
blood was collected and diluted with Phosphate Buffered Saline Glucose (PSG) to achieve a
concentration of 105 parasites in a total volume of 0.2ml. This volume was injected I.P. in six
OF1 mice for each strain. A group of six mice injected with 0.2ml of PSG was used as
control.
For each strain the prepatent period (number of days between the inoculation and the
first appearance of parasites in the blood) and the survival time were recorded up to 60 days
post infection. Mortality in infected and control mice were recorded daily. An animal was
considered parasitologically negative when no trypanosomes were detected in at least 50
microscopic fields. Animal ethics approval for the experimental infections was obtained from
the Ethics Commission of the Institute of Tropical Medicine, Antwerp, Belgium (Ref DG001-
PD-M-TTT and DG008-PD-M-TTT).
2.2.4. Statistical analysis
The median mice survival time of the infected mice was estimated in parametric
survival models using a log-normal hazard distribution in Stata 10. The strains for which
none of the infected mice died during an observation period of >60 days were discarded from
the analysis. In a first model, the strains were used as discrete explanatory variable. In a
second model, transmission cycle type (domestic or sylvatic) was used as explanatory
variable. Data clustering in relation to the different isolates was taken into account using the
frailty option (shared for strains).
Strains were subsequently allocated to 3 virulence classes according to their estimated
median survival time (< 10 days, 10-50 days and >50 days). Strains for which none of the
34
infected mice died during an observation period of more than 60 days were allocated to the
last class. An ordered multinomial regression was applied on the data using the cycle type as
explanatory variable.
2.3. Results
The virulence of a total of 62 T. congolense strains was tested and compared. Median
survival time of infected mice differed substantially between strains with mice infected with
the most virulent strains having a median survival time of less than 10 days and mice infected
with the least virulent strains surviving for more than 50 days. An overview of the median
survival time (95% C.I.) of mice infected with 60 of the 62 strains (survival time could not be
calculated for 2 strains since survival was more than 60 days) is presented in Figure 2.1. The
survival analysis of mice infected with strains from the two transmission cycle is presented as
a Kaplan-Meier survival curve in Figure 2.2.
Strains were grouped into a high virulence (median survival time < 10 days), a
medium virulence (median survival time between 10-50 days) and a low virulence (median
survival time > 50 days) category. Of the strains isolated in the sylvatic transmission cycle,
50% were extremely virulent compared to 16% for strains isolated in the domestic
transmission cycle (Table 2.1). The difference was statistically significant (P = 0.005). The
median survival time of mice infected with strains isolated in the sylvatic transmission cycle
was 7.9 (C.I. 6.9-9.0) compared to 11.1 (C.I. 9.9-12.4) for those from the domestic
transmission cycle (P < 0.001).
35
Figure 2 - 1. Median survival time (with 95% C.I.) of mice infected with one of the T.
congolense (Savannah subgroup) strains isolated in Zambia and South Africa.
0
20
40
60
80
100
120
140
160
Su
rviv
al
tim
e (d
ays)
T. congolense strain
36
Figure 2 - 2. Survival analysis of mice infected with strains isolated from the two
transmission cycles.
0
0.2
0.4
0.6
0.8
1
1.2
1.1
6.0
01
11
.00
1
16
.00
1
21
.00
1
26
.00
1
31
.00
1
36
.00
1
41
.00
1
46
.00
1
51
.00
1
56
.00
1
61
.00
1
66
.00
1
71
.00
1
76
.00
1
81
.00
1
86
.00
1
Pro
po
rtio
n o
f li
ve
mic
e
Analysis time (days post infection)
Kaplan-Meier Survival curve
Domestic
Sylvatic
37
Table 2 - 1. Number of T. congolense strains (Savannah subgroup), isolated in the
domestic or sylvatic transmission cycle, belonging to the low, medium and high
virulence category
Transmission cycle Number of strains per virulence category
Low Medium High
Domestic 22 20 8
Sylvatic 1 5 6
2.4. Discussion and conclusion
The comparison of the virulence of the 62 T. congolense strains belonging to the
Savannah subgroup confirms the observation made by Masumu et al. (2006) that virulence
differs greatly from strain to strain. Since experiments performed by Bengaly et al. (, 2002a;
2002b) have shown concordance between virulence tests in mice and results of the same tests
in cattle, our findings can be extrapolated to a field situation. Moreover, based on the limited
number of strains from four geographical areas, the outcome of the analysis shows that
virulent strains are not evenly distributed over the transmission cycles but that the proportion
of highly virulent strains is significantly higher in the sylvatic transmission cycle. This may
indicate that the evolution of trypanotolerance in wildlife has acted as an important selective
pressure on trypanosomes by selecting for higher parasite replication rates to maximize the
production of bloodstream forms for transmission to tsetse flies and, at the same time,
increasing the virulence of the strains in a susceptible host (Miller et al., 2006). The
38
persistence of a relatively small proportion of strains with low virulence in the sylvatic cycle
could be explained by variation in the susceptibility to trypanosome infections in game
animals with some species being more susceptible than others (Ashcroft et al., 1959). The
predominance of virulent trypanosome strains in wildlife may be the reason why livestock
trypanosomosis epidemics, with high morbidity and high mortality, are usually encountered
when livestock is introduced in wildlife areas or when livestock are kept at a game/livestock
interface and are thus exposed to tsetse flies transmitting highly virulent strains picked from
wild animals. For example, the restocking of cattle into tsetse-infested areas of northern,
central and southern Mozambique after the civil war resulted in serious problems with
livestock trypanosomosis (Sigauque et al., 2000). Similarly, the introduction of livestock in
the tsetse-infested zones of the Rift Valley in Ethiopia has resulted in important
trypanosomosis outbreaks with high mortality in the livestock population (Slingenbergh,
1992). Finally, the bovine trypanosomosis epidemics in South Africa are all closely linked to
the game/livestock interface of the Hluhluwe-iMfolozi Game Park (Kappmeier et al., 1998;
Van den Bossche et al., 2006). Although the proportion of wildlife areas has reduced
substantially over the past century, the current drive for reforestation, and the development
and establishment of large trans-boundary conservation areas could result in the creation of
important reservoirs of tsetse flies that can transmit trypanosomes from the wildlife to
susceptible livestock and create trypanosomosis epidemics in domestic animals at the
interface. The management of the disease at such interfaces may require special attention and
may be one of the major future challenges in the control of livestock trypanosomosis.
Considering the threat posed by many of the trypanosome strains present in the
trypanotolerant reservoirs, domestication of the transmission cycle seems to have
considerable repercussions for the composition of the trypanosome population and
subsequent impact on livestock health.
39
For each host-parasite interaction there probably is an optimal level of host utilization
that maximizes the balance between rapid transmission and the time before the host dies or is
treated (Anderson and May, 1982). This trade-off between virulence and replication is an
example of how parasite fitness is influenced by the costs and benefits of host exploitation
(Frank, 1996). A higher replication rate of a particular strain will allow for a more rapid
dissemination of the alleles of this genotype compared to strains replicating slower. The
relative fitness of those highly replicating strains will thus be higher as they will leave more
alleles in the next generation of parasites relative to its competitors(s) (Mackinnon, 2005).
Inversely, a highly pathogenic strains may, by killing the host, decrease its spreading
compared to its less pathogenic competitor(s), resulting thus in a lower relative fitness. Since
susceptible hosts infected with virulent trypanosome strains will either be treated because of
acute illness (Van den Bossche et al., 2000) or die, virulent trypanosome strains are expected
to have a low fitness in the domestic transmission cycle. These curative treatments or death
will favour a selection against virulent strains and may result in a fast decrease in the
proportion of virulent strains circulating in the livestock population. This explains the
observed lower proportion of virulent strains in the domestic transmission cycle. Since
infection with a low virulent strain protects animals against the adverse effects of a
subsequent infection with a virulent strain, a number of virulent strains can persist in the
susceptible livestock population (Masumu et al., 2009).
In conclusion, it thus seems that the observed variations in virulence in T. congolense
strains belonging to the Savannah subgroup is the repercussion of the differences in the
susceptibility of hosts and the domestication of the transmission cycle. Further research is
required to investigate how these variations can be exploited in the development of
trypanosomosis control strategies
40
2.5. References
Anderson, R.M., May, R.M., 1982. Coevolution of hosts and parasites. Parasitology 85 (Pt
2), 411-426.
Ashcroft, M.T., Burtt, E., Fairbairn, H., 1959. The experimental infection of some African
wild animals with Trypanosoma rhodesiense, T. brucei and T. congolense. Ann. Trop.
Med. Parasitol. 53, 147-161.
Bengaly, Z., Sidibe, I., Boly, H., Sawadogo, L., Desquesnes, M., 2002a. Comparative
pathogenicity of three genetically distinct Trypanosoma congolense-types in inbred
Balb/c mice. Vet. Parasitol. 105, 111-118.
Bengaly, Z., Sidibe, I., Ganaba, R., Desquesnes, M., Holby, H., Sawadogo, L., 2002b.
Comparative pathogenicity of three genetically distinct types of Trypanosoma
congolense in cattle: clinical observations and haematological changes. Vet. Parasitol.
108, 1-19.
Frank, S.A., 1996. Models of parasite virulence. Q. Rev. Biol. 71, 37-78.
Garcia, A., Courtin, D., Solano, P., Koffi, M., Jamonneau, V., 2006. Human African
trypanosomiasis: connecting parasite and host genetics. Trends Parasitol 22, 405-409.
Gardiner, P.R., Assoku, R.K., Whitelaw, D.D., Murray, M., 1989. Haemorrhagic lesions
resulting from Trypanosoma vivax infection in Ayrshire cattle. Vet. Parasitol. 31,
187-197.
Geysen, D., Delespaux, V., Geerts, S., 2003. PCR-RFLP using Ssu-rDNA amplification as an
easy method for species-specific diagnosis of Trypanosoma species in cattle. Vet.
Parasitol. 110, 171-180.
41
Gibson, W., 2003. Species concepts for trypanosomes: from morphological to molecular
definitions? Kinetoplastid Biol. Dis. 2, 10.
Hargrove, J.W., Langley, P.A., 1990. Sterilizing Tsetse (Diptera, Glossinidae) in the Field-A
Successful Trial. Bull. Entomol. Res. 80, 1468-1473.
Herbert, W.J., Lumsden, W.H.R., 1976. Trypanosoma brucei: A rapid "matching" method for
estimating the host's parasitaemia. Exp. Parasitol. 40, 427-431.
Kappmeier, K., Nevill, E.M., Bagnall, R.J., 1998. Review of tsetse flies and trypanosomosis
in South Africa. Onderstepoort J. Vet. Res. 65, 195-203.
Mackinnon, M.J., 2005. Drug resistance models for malaria. Acta Trop. 94, 207-217.
Maclean, L., Chisi, J.E., Odiit, M., Gibson, W.C., Ferris, V., Picozzi, K., Sternberg, J.M.,
2004. Severity of human african trypanosomiasis in East Africa is associated with
geographic location, parasite genotype, and host inflammatory cytokine response
profile. Infect. Immun. 72, 7040-7044.
Masumu, J., Marcotty, T., Geerts, S., Vercruysse, J., Van den Bossche, P., 2009. Cross-
protection between Trypanosoma congolense strains of low and high virulence. Vet.
Parasitol. 163, 127-131.
Masumu, J., Marcotty, T., Geysen, D., Geerts, S., Vercruysse, J., Dorny, P., Van den
Bossche, P., 2006. Comparison of the virulence of Trypanosoma congolense strains
isolated from cattle in a trypanosomiasis endemic area of eastern Zambia. Int. J.
Parasitol. 36, 497-501.
Miller, M.R., White, A., Boots, M., 2006. The evolution of parasites in response to tolerance
in their hosts: the good, the bad, and apparent commensalism. Evolution 60, 945-956.
42
Osorio, A.L., Madruga, C.R., Desquesnes, M., Soares, C.O., Ribeiro, L.R., Costa, S.C., 2008.
Trypanosoma (Duttonella) vivax: its biology, epidemiology, pathogenesis, and
introduction in the New World--a review. Mem. Inst. Oswaldo Cruz 103, 1-13.
Paris, J., Murray, M., McOdimba, F., 1982. A comparative evaluation of the parasitological
techniques currently available for the diagnosis of African trypanosomiasis in cattle.
Acta Trop. 39, 307-316.
Sigauque, I., Van den Bossche, P., Moiana, M., Jamal, S., Neves, L., 2000. The distribution
of tsetse (Diptera: Glossinidae) and bovine trypanosomosis in the Matutuine District,
Maputo Province, Mozambique. Onderstepoort J. Vet. Res. 67, 167-172.
Slingenbergh, J., 1992. Tsetse control and agricultural development on Ethiopia. World An.
Rev. 70-71, 30-36.
Stephen, L.E., 1986. Trypanosomiasis. A veterinary perspective. Oxford. Pergamon Press.
Van den Bossche, P., Doran, M., Connor, R.J., 2000. An analysis of trypanocidal drug use in
the Eastern Province of Zambia. Acta Trop. 75, 247-258.
Van den Bossche, P., Esterhuizen, J., Nkuna, R., Matjila, T., Penzhorn, B., Geerts, S.,
Marcotty, T., 2006. An update of the bovine trypanosomosis situation at the edge of
Hluhiuwe-Imfolozi Park, Kwazulu-Natal Province, South Africa. Onderstepoort J.
Vet. Res. 73, 77-79.
Van den Bossche, P., Rocque, S.D., Hendrickx, G., Bouyer, J., 2010. A changing
environment and the epidemiology of tsetse-transmitted livestock trypanosomiasis.
Trends Parasitol. 26, 236-243.
43
Van den Bossche, P., Staak, C., 1997. The importance of cattle as a food source for Glossina
morsitans morsitans in Katete district, Eastern Province, Zambia. Acta Trop. 65, 105-
109.
44
Chapter 3
High prevalence of drug Resistance in Animal Trypanosomes without a
history of drug exposure.
Chitanga S., Marcotty T., Namangala B., Van den Bossche P†., Van Den Abbeele J. and
Delespaux V. (2011). High Prevalence of Drug Resistance in Animal Trypanosomes without
a history of Drug Exposure.
PloS Negl. Trop. Dis. 5 (12): e154.doi:10.1371/journal.pntd.0001454
†Passed away on 14 November 2010.
Understanding how patterns of drug use and the epidemiological context of drug deployment
affect the emergence and spread of drug resistance is important in protecting the efficacy of
current and future drugs (Prudhomme O’Meara et al., 2006)
45
Abstract
Background. Trypanosomosis caused by Trypanosoma congolense (T. congolense) is a
major constraint to animal health in sub-Saharan Africa. Unfortunately, the treatment of the
disease is impaired by the spread of drug resistance. Resistance to diminazene aceturate (DA)
in T. congolense is linked to a mutation modifying the functioning of a P2-type purine-
transporter responsible for the uptake of the drug. Our objective was to verify if the mutation
was linked or not to drug pressure.
Methodology / principal findings. Thirty-four T. congolense isolates sampled from tsetse or
wildlife in game reserves were screened for the DA-resistance linked mutation using DpnII-
PCR-RFLP. The results showed 1 sensitive, 12 resistant and 21 mixed DpnII-PCR-RFLP
profiles. This suggests that the mutation is present on at least one allele of each of the 33
isolates.
For twelve of them, a standard screening method in mice was used by (i) microscopic
examination, (ii) trypanosome specific 18S-PCR after 2 months of observation and (iii)
weekly 18S-PCR for 8 weeks. The results showed that all mice remained microscopically
trypanosome-positive after treatment with 5 mg/kg DA. With 10 and 20 mg/kg, 0.08%
(n=72) and 0% (n=72) of the mice became parasitologically positive after treatment.
However, in these latter groups the trypanosome-specific 18S-PCR indicated a higher degree
of trypanosome-positivity i.e. with a unique test, 51.4 % (n=72) and 38.9 % (n=72) and with
the weekly tests 79.2% (n=24) and 66.7% (n=24) for 10 and 20 mg/kg respectively.
Conclusion / significance. The widespread presence of the DA-resistance linked mutation in
T. congolense isolated from wildlife suggests that this mutation is favourable to the parasite
life and/or dissemination in the host population independently from the presence of drug.
After treatment with DA, those T. congolense isolates cause persisting low parasitaemia even
after complete elimination of the drug and with little impact on the health of the host.
46
3.1. Introduction
Animal trypanosomosis is one of the major constraints to animal health and
production in sub-Saharan Africa and has a major impact on people’s livelihoods. The
annual, estimated direct and indirect losses due to the disease run into billions of dollars
(Mattioli et al., 2004). The fight against the disease is either managed by the control of the
vector or of the parasite or a combination of both. However, in poor rural communities,
which are mostly affected by the disease, control is mainly relying on the use of trypanocidal
drugs (Delespaux et al., 2008b). The main drugs used by livestock keepers are
isometamidium chloride (ISM) which has both curative and prophylactic effects and DA
which has only curative properties. These drugs are in use for more than half a century now.
Geerts & Holmes (1998) estimated that ~35 million doses of trypanocides are administered
every year in sub-Saharan Africa, with ISM, ethidium bromide and DA representing 40%,
26% and 33% respectively. Despite the high usage of these veterinary trypanocides, the
interest of pharmaceutical industries to invest in research for developing new products
remains low, leaving farmers to rely on the existing drugs. Due to the privatization of
veterinary services in most parts of Africa, farmers have easy access to these trypanocides
and this has resulted in rampant misuse and under-dosage of the medications, actions which
have been blamed for the emergence of trypanocidal drug resistance (Van den Bossche et al.,
2000; Delespaux et al., 2002). To date, there are 18 countries in which trypanocidal drug
resistance has been reported (Delespaux et al., 2008b) and more recently in Benin, Ghana and
Togo (Réseau d'épidémiosurveillance de la résistance aux trypanocides et aux acaricides en
Afrique de l'Ouest – RESCAO, unpublished data). However, most of these reports seem to be
confined to areas where the disease is endemic (Delespaux and de Koning, 2007). Whilst
reports of the occurrence of trypanocidal drug resistance are increasing, it is not really clear
whether this is due to a real increase of the trypanocide resistance problem or just an
47
increased interest by scientists (Delespaux et al., 2008b). However, a report by Delespaux et
al. (2008a) of a five-fold increase in the prevalence of DA resistance over a seven year period
in the Eastern Province of Zambia, suggests that there is indeed an aggravation of the
phenomenon. Even more worrying are the recent reports of multiple drug resistance (to ISM
and DA) (Mamoudou et al., 2008) because this is threatening the last parade to overcome
drug resistance through the use of the sanative pair. Here, the concept of the sanative pair
recommends the use of two trypanocides (e.g. DA and ISM) unlikely to induce cross-
resistance. The first drug is used until resistant strains of trypanosomes appear and then the
second is substituted and used until the resistant strains have disappeared from cattle and
tsetse (Whiteside, 1962).
DA uptake is predominantly driven by a P2-type purine transporter (TbAT1) in T.
brucei and a set of six point mutations in this gene has been shown to be linked with
resistance to the veterinary drug, DA (Mäser et al., 1999). However, Delespaux et al. (2006)
found that in T. congolense a single point gene mutation in an orthologue of the T.brucei P2-
type purine transporter (TcoAT1) was correlated to resistance to DA in that species. Such
genetic mutations conferring drug resistance in parasites are thought to arise randomly and to
spread out when the parasite population is exposed to the drug because the mutation(s) is/are
conferring a selective advantage compared to the wild type population in the case of drug
pressure (Prudhomme O'Meara et al., 2006). Hastings (2001) identified the following as
some of the important factors determining the rate of evolution of the drug resistance in a
parasite population: (i) the mutation rate from wild type to resistant genotype, (ii) the level
and pattern of drug use and (iii) the parasitaemia within the host i.e. the number of parasites
exposed to the drug after the treatment of the host. Genetic mutations can impair the fitness
of parasites allowing for higher survival in presence of drugs but a progressive elimination in
absence of drug pressure (Babiker et al., 2009). However, these mutations will still persist in
48
a parasite population at low frequencies governed by the mutation-selection balance
(Hastings, 2004) with their proportion determined by the relative fitness of the mutant versus
the wild type parasites (Mackinnon, 2005). Innate phenotypes resistant to DA and to
homidium were already reported in T. vivax and T. congolense respectively (Jones-Davies,
1967; Jones-Davies, 1968).
The objective of this study was thus to examine the prevalence of the mutation linked
to DA resistance in natural T. congolense populations that were never exposed to the pressure
of the drug, this prevalence being the result of the balance between the mutation rate and the
ecological fitness of the mutated trypanosome.
3.2. Materials and Methods
3.2.1. Study areas and isolation of trypanosomes
All the trypanosomes used in this study were isolated in protected areas where game
animals served as exclusive hosts for the trypanosomes. The study areas were the South
Luangwa National Park in Zambia, Mana Pools National Park in Zimbabwe and the
Hluhluwe-Umfolozi Game Reserve in the South African KwaZulu-Natal. In the South
Luangwa National Park, tsetse flies (Glossina morsitans morsitans and G. pallidipes) were
trapped using epsilon traps (Hargrove and Langley, 1990) and flies were dissected to
determine their infection status. The mouthparts of tsetse flies, infected with trypanosomes in
both the midgut and mouthparts, were injected intraperitoneally (I.P.) in an
immunosuppressed mouse (300mg/kg Cyclophosphamide, Endoxan®, Baxter S.A.). The
inoculated mice were then monitored for development of a trypanosome infection, with the
parasitaemic blood collected from each positive mouse considered as an isolate. In the
Hluhluwe-Umfolozi Game Reserve, isolation of the trypanosomes was completed from
buffaloes belonging to herds that were selected randomly for tuberculosis testing. From each
of the 132 buffaloes sampled, a volume of 0.3ml of jugular blood was injected I.P. into two
49
mice. The injected mice were then monitored for development of a trypanosome infection,
with the parasitaemic blood collected from each positive mouse considered as an isolate.
In the Mana Pools National Park, tsetse flies (Glossina morsitans morsitans and G.
pallidipes) were trapped using epsilon traps (Hargrove and Langley, 1990) and flies were
dissected to determine their infection status (Lloyd and Johnson, 1924). The mouthparts of
those flies infected in both the midgut and mouthparts, were collected and preserved in a
buffer of 0.5M guanidine chloride, pH 8.
All 34 isolates that were collected belonged to the T.congolense Savannah sub-group
as determined by 18S-PCR-RFLP (Geysen et al., 2003). The median survival times of mice
inoculated with the isolates from Hluhluwe-Umfolozi Game Reserve and from the South
Luangwa National Park, without treatment, are described by Van den Bossche et al. (2011).
3.2.2. DA resistance genetic profiling by DpnII-PCR-RFLP
DNA extraction was conducted for all the 34 strains collected. For the isolates that
were grown in mice, blood from one parasitaemic mouse was collected and trypanosome
DNA extracted using the Gentra®
extraction kit as according to manufacturer’s
recommendations. For those strains which were preserved in guanidine storage buffer, the
trypanosome DNA was also extracted. Briefly, the mouthparts were removed from the buffer
into 100µl of grinding buffer (80 mM NaCl, 160 mM sucrose, 100 mM Tris-HCl pH 8.6, 60
mM EDTA and 0.5% SDS) and incubated at 65°C for an hour, with shaking. The dried pellet
was then suspended in 40µl of TE buffer and this was used for DNA analysis.
The DpnII-PCR-RFLP was performed on the 34 isolates to check for the presence of
the mutation in the P2-type purine transporter gene that is associated with resistance to DA
(Delespaux et al., 2006). In brief, a standard PCR was conducted on DNA samples using the
following primers (Ade2F ATAATCAAAGCTGCCATGGATGAAG and Ade2R
50
GATGACTAACAATATGCGGGCAAAG) and a Sigma thermocycler®. Analysis of the
PCR product was done using method described by Vitouley et al (2011).
3.2.3. In vivo drug sensitivity testing (multi doses test in mice)
The method described by Eisler et al. (2001) was used for evaluating the sensitivity of
the isolates to DA. The method was slightly modified as follows: the 12 field isolates were
tested at doses of 20 and 10 mg/kg DA administered I.P. Inoculation of the trypanosomes,
monitoring of the infected mice and interpretation of the results was done as described by
Eisler et al. (2001). For each isolate, groups of six mice were used for each dose and as
control. An isolate was considered resistant to a particular dose if at least two of the six mice
in that treatment group relapsed (assessed by microscopical examination). At the end of the
60 days experimental period, tail blood from all mice was spotted onto a Whatman®
Nr 4
filter paper and examined using the 18S-PCR (Geysen et al., 2003) to detect presence of
trypanosomes that could not be detected by the microscopical examination.
3.2.4. Monitoring trypanosome presence by PCR
To determine the presence of trypanosomes in mice treated with DA at a dose of 10 or
20 mg/kg, blood samples of the mice infected with the 4 different isolates (MF2, MF3, MF4
and MF5) were weekly spotted on a Whatman®
Nr 4 filter paper for 8 weeks and examined
by the 18S-PCR to detect the presence of trypanosomes.
3.2.5. Degradation of trypanosome DNA in vivo
Blood (1.4 ml) was collected from a highly parasitaemic mouse (108 trypanosomes/ml
blood) and DNA extraction was done using a Gentra®
extraction kit for a final volume of 200
µl of DNA solution. 100µl of this solution was intravenously injected into each of two mice.
Tail blood was then collected on filter paper 30 min. and 1, 3, 6, 7, 13, 15, 16, 21 & 28 days
after the injection and examined by the 18S-PCR to detect the presence of trypanosome
DNA.
51
3.3. Results
Six isolates were collected in the South Luangwa National Park, 6 in the Hluhluwe-
Umfolozi Game Reserve and 22 from Mana Pools National Park. One strain showed a
sensitive PCR-RFLP profile, 12 showed a resistant profile whilst the remaining 21 showed a
mixed profile. When a mixed profile is observed, a heterozygous trypanosome population
cannot be differentiated from a mixture of homozygous sensitive and resistant trypanosomes
as the experimental material are isolates and not cloned trypanosomes.
The results of the drug sensitivity tests in mice are summarized in table 3.1. This was
done only for the 12 isolates isolated from South Luangwa National Park and Hluhluwe-
imfolozi game reserve since only those had been successfully grown in mice. Using the
methodology and criteria described by Eisler et al. (2001) only one resistant isolate was
identified in the group treated with 10 mg/kg and none in the group treated with 20 mg/kg.
However, using the more sensitive trypanosome-specific 18S-PCR once at the end of the
observation period, more trypanosome-positive mice were observed in these groups, with
51.4 % (n=72) and 38.9 % (n=72) positive PCR results respectively. At a dose of 5 mg/kg, all
mice relapsed based upon microscopic examination as well as PCR.
When considering the weekly follow up, the parasitaemia of the groups inoculated
with the 4 isolates (MF2, MF3, MF4 & MF5) were intermittent throughout the period of
observation and the cumulative amount of relapses was impressive with 79.2 % (n=24) and
66.7 % (n=24) in the groups treated with 10 and 20 mg/kg respectively. As an example, the
results for the 20 mg/kg groups are shown in table 3.2.
Finally, the DNA, when injected intravenously, persisted in mouse blood for 14 days
beyond which it was no longer found.
52
Table 3 - 1. RFLP-profiles of the different wild T. congolense strains and their drug
sensitivity profile in infected mice treated with 20 and 10 mg/kg diminazene (DA). This
drug sensitivity profile was scored for each individual mouse by microscopy and PCR
analysis, 60 days after the initial treatment.
Strain Profile Mic. + PCR + Mic. + PCR +
MF 1 R 0/6 5/6 0/6 1/6
MF 2 R 0/6 1/6 0/6 3/6
MF 3 R 5/6 6/6 0/6 1/6
MF 4 M 1/6 5/6 0/6 5/6
MF 5 R 0/6 1/6 0/6 2/6
MF 6 R 0/6 2/6 0/6 2/6
BT0106 M 0/6 4/6 0/6 5/6
BT0206 M 0/6 3/6 0/6 5/6
BT0306 M 0/6 3/6 0/6 3/6
BT0306 ISM R 0/6 4/6 0/6 3/6
BT0406 M 0/6 3/6 0/6 1/6
BT0506 R 0/6 0/6 0/6 1/6
TRT8 sensitive control S 0/6 0/6 0/6 0/6
CRS 0.08% 51.38% 0% 38.88%
10mg/kg DA 20mg/kg DA
With: Mic. as microscopic examination, S as sensitive, R as resistant, and M as mixed
sensitivity profile
Table 3 - 2. Weekly evolution of parasitaemia as determined by PCR-RFLP post-treatment
with 20mg/kg
Strain Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 Week 7 Week 8 CR
MF 2 2/6 3/6 2/6 2/6 2/6 0/6 2/6 2/6 5/6
(1,5) (1,5,6) (3,5) (1,6) (1,2) (-) (2,6) (2,5)
MF 3 0/6 1/6 1/6 0/6 1/6 1/6 1/6 2/6 2/6
(-) (1) (1) (-) (3) (1) (1) (1,3)
MF 4 0/6 2/6 2/6 0/6 1/6 1/6 0/6 1/6 3/6
(-) (1,3) (2,3) (-) (3) (1) (-) (2)
MF5 0/6 3/6 5/6 0/6 3/6 2/6 3/6 5/6 6/6
(-) (1,5,6) (1,2,3,5,6) (-) (2,5,6) (2,4) (2,4,5) (1,3,4,5,6)
TRT8 SC 0/6 0/6 0/6 0/6 0/6 0/6 0/6 0/6 0/6
(-) (-) (-) (-) (-) (-) (-) (-)
Total CR 66,66%
53
With CR as cumulative relapses, * as number of mice becoming positive by PCR-RFLP and
** as identity of the positive mice
3.4. Discussion
The high prevalence of the mutation in the gene coding for P2-type purine
transporters in T. congolense populations that were never exposed to any drug pressure is
thought challenging. The correlation of this mutation with phenotypic resistance to DA is
largely demonstrated by the multi-dose sensitivity testing in mice (Delespaux et al., 2006).
This high prevalence of the mutation conferring resistance to DA was not expected in regions
where the circulating trypanosome populations were never exposed to any trypanocidal drug
pressure. Indeed, mutations conferring drug resistance are often related to a fitness cost for
the parasite and are supposed to be selected out in the absence of drug as it is described for
example in malaria parasites (Hastings, 2004; Babiker et al., 2009). A complete cease of the
use of DA would not allow for a return to a DA-sensitive population of trypanosomes. The
same situation was observed for ISM resistance in Eastern Province of Zambia were a high
prevalence of ISM resistance was observed 20 years after massive block treatments
administered systematically by the government (Sinyangwe et al., 2004). Drug resistance in
animal trypanosomes present thus a pattern very different from what is observed with
Plasmodium sp. (causative agent of malaria) where a complete stop in the use of the
chloroquine allows for a return to sensitivity of the circulating strains.
The observed high prevalence of the DA-resistance linked mutation in the wild T.
congolense populations suggests that it confers a selective advantage over the non-mutated
strains and that it is part of the normal genotypic diversity of a wild trypanosome population.
In support of this, Geiser et al. (2005) observed an increased fitness in T. brucei with a
similar mutation, with the P2 mutant T. brucei growing faster than the wild type strains when
grown in vitro.
54
Albeit the microscopical examination failed to detect nearly all relapses except after
treatment at 5 mg/kg DA, the results of the 18S-PCR confirms unequivocally the numerous
relapses after treatment at 10 and 20 mg/kg. This PCR-positivity is not due to persistent
circulating trypanosome DNA as we demonstrated that injected DNA is no longer PCR-
detectable in the mouse blood circulation 14 days after the initial injection. This strongly
suggests that the positive PCR results observed in the microscopically negative mice
indicates the presence of living trypanosomes circulating at low abundance. With a single
examination at the end of the observation period, more than one half and one third of the
isolates relapsed at 10 and 20 mg/kg respectively. Furthermore, the weekly follow up of the
parasitaemia shows clearly that the increased frequency of observation after treatment (8
rather than 1 at the end of the observation period) raises the observed relapses rate to 79.2 %
and 66.7 % for 10 and 20 mg/kg respectively. Remarkably, the positive outcome of the 18S-
PCR tests done two months after treatment compared to the negative microscopical
examinations suggests that the relapsed trypanosome populations remain at very low
densities. This is surprising since it can be assumed that no active DA is circulating in the
blood two month after the treatment. Indeed, the recommended withdrawal time prior
slaughtering for livestock is 21-35 days and the elimination rate of DA is not expected to be
longer in rodents as it is a smaller species with a higher metabolism (Peregrine and
Mamman, 1993; Kaur et al., 2000). This observation seems to suggest that the DA treatment
has reduced the impact of the relapsed trypanosome infection on its host. This becomes
evident when observing the median survival time of the mice that are infected with the same
isolates before DA treatment (Van den Bossche et al., 2011). Without treatment, 50% and
67% of the mice die within 10 and 20 days respectively. The predicted median survival time
for the two less virulent isolates is 24 and 51 days. None of the mice is expected to survive for
60 days as they manage in good shape in our drug resistance test. The development of such
55
cryptic infections could be due to the effect of the drug reducing the parasitaemia to a level
low enough for host immunity to maintain the parasites at a very low density. If this
observation can be confirmed in livestock, it would drastically change the rationale of
treatment guidelines in case of DA resistance.
Those very low parasitaemia with very limited impact on the host induced by the DA
treatment are interesting. Similar results were obtained in cattle when experimentally
infected with ISM resistant strains and treated with ISM at the first peak of parasitaemia. The
impact of the infection on the PCV was not very pronounced (average PCV reduction 8 to 14
weeks after treatment: 5.9%; 95% CI: 4.5–7.3) (Delespaux et al., 2010).
Our findings have important repercussions for the understanding of the epidemiology
of trypanocidal drug resistance in livestock trypanosomosis and its control: (i) considering the
high prevalence of the resistant genotype in the natural T. congolense isolates from Zambia,
Zimbabwe and South Africa, development of resistance to DA once these strains are
circulating in livestock seems to be unavoidable and quick, (ii) regular under-dosing will
support the spread of the resistant wild genotypes in the livestock population (Delespaux et
al., 2002; Sinyangwe et al., 2004) and finally (iii) if our results are further confirmed in
livestock, the advice could be to continue treating cattle even in the presence of drug
resistance as the treatment would allow the host to control the parasite and the corresponding
disease at an acceptable level.
56
3.5. References
Babiker, H.A., Hastings, I.M., Swedberg, G., 2009. Impaired fitness of drug-resistant malaria
parasites: evidence and implication on drug-deployment policies. Expert Rev Anti-
Infe 7, 581-593.
Delespaux, V., Chitanga, S., Geysen, D., Goethals, A., Van den Bossche, P., Geerts, S., 2006.
SSCP analysis of the P2 purine transporter TcoAT1 gene of Trypanosoma congolense
leads to a simple PCR-RFLP test allowing the rapid identification of diminazene
resistant stocks. Acta Trop. 100, 96-102.
Delespaux, V., de Koning, H.P., 2007. Drugs and drug resistance in African trypanosomiasis.
Drug Resist Update 10, 30-50.
Delespaux, V., Dinka, H., Masumu, J., Van den Bossche, P., Geerts, S., 2008a. Five fold
increase in the proportion of diminazene aceturate resistant Trypanosoma congolense
isolates over a seven years period in Eastern Zambia. Drug Resist Update 11, 205-
209.
Delespaux, V., Geerts, S., Brandt, J., Elyn, R., Eisler, M.C., 2002. Monitoring the correct use
of isometamidium by farmers and veterinary assistants in Eastern Province of Zambia
using the isometamidium-ELISA. Vet. Parasitol. 110, 117-122.
Delespaux, V., Geysen, D., Van den Bossche, P., Geerts, S., 2008b. Molecular tools for the
rapid detection of drug resistance in animal trypanosomes. Trends Parasitol 24, 236-
242.
Delespaux, V., Vitouley, S.H., Marcotty, T., Speybroeck, N., Berkvens, D., Roy, K., Geerts,
S., Van den Bossche, P., 2010. Chemosensitization of Trypanosoma congolense
strains resistant to isometamidium chloride by tetracycline and fluoroquinolone. PLoS
Neglect Trop D 4, e828. doi:10.1371/journal.pntd.0000828.
Eisler, M.C., Brandt, J., Bauer, B., Clausen, P.H., Delespaux, V., Holmes, P.H., Ilemobade,
A., Machila, N., Mbwambo, H., McDermott, J., Mehlitz, D., Murilla, G., Ndung'u,
J.M., Peregrine, A.S., Sidibe, I., Sinyangwe, L., Geerts, S., 2001. Standardised tests in
mice and cattle for the detection of drug resistance in tsetse-transmitted trypanosomes
of African domestic cattle. Vet. Parasitol. 97, 171-182.
Geerts, S., Holmes, P.H., 1998. Drug management and parasite resistance in bovine
trypanosomiasis in Africa. PAAT Technical Scientific Series 1.
Geiser, F., Luscher, A., de Koning, H.P., Seebeck, T., Maser, P., 2005. Molecular
pharmacology of adenosine transport in Trypanosoma brucei: P1/P2 revisited. Mol.
Pharmacol. 68, 589-595.
Geysen, D., Delespaux, V., Geerts, S., 2003. PCR-RFLP using Ssu-rDNA amplification as an
easy method for species-specific diagnosis of Trypanosoma species in cattle. Vet.
Parasitol. 110, 171-180.
Hargrove, J.W., Langley, P.A., 1990. Sterilizing Tsetse (Diptera, Glossinidae) in the Field-A
Successful Trial. Bull. Entomol. Res. 80, 1468-1473.
57
Hastings, I.M., 2001. Modelling parasite drug resistance: lessons for management and control
strategies. Trop. Med. Int. Health 6, 883-890.
Hastings, I.M., 2004. The origins of antimalarial drug resistance. Trends Parasitol. 20, 512-
518.
Jones-Davies, W.J., 1967. A Berenil resistant strain of Trypanosoma vivax in cattle. Vet. Rec.
81, 567-568.
Jones-Davies, W.J., 1968. The prevalence of homidium resistant strains of trypanosomes in
cattle in Northern Nigeria. Bull. Epizoot. Dis. Afr., 65-72.
Kaur, G., Chaudhary, R.K., Srivastava, A.K., 2000. Pharmacokinetics, urinary excretion and
dosage regimen of diminazene in crossbred calves. Acta Vet. Hung. 48, 187-192.
Lloyd, L.L., Johnson, W.B., 1924. The trypanosome infections of tsetse flies in Northern
Nigeria and a method of estimation. Bull. Entomol. Res., 225-227.
Mackinnon, M.J., 2005. Drug resistance models for malaria. Acta Trop. 94, 207-217.
Mamoudou, A., Delespaux, V., Chepnda, V., Hachimou, Z., Andrikaye, J.P., Zoli, A., Geerts,
S., 2008. Assessment of the occurrence of trypanocidal drug resistance in
trypanosomes of naturally infected cattle in the Adamaoua region of Cameroon using
the standard mouse test and molecular tools. Acta Trop. 106, 115-118.
Mäser, P., Sutterlin, C., Kralli, A., Kaminsky, R., 1999. A nucleoside transporter from
Trypanosoma brucei involved in drug resistance. Science 285, 242-244.
Mattioli, R.C., Feldmann, G., Hendrickx, W., Wint, J., Jannin, J., Slingenbergh, J., 2004.
Tsetse and trypanosomiasis intervention policies supporting sustainable animal-
agricultural development. Food, Agr. Environ. Food Agr Environ, 310-314.
Peregrine, A.S., Mamman, M., 1993. Pharmacology of diminazene: a review. Acta Trop. 54,
185-203.
Prudhomme O'Meara, Smith, D.L., McKenzie, F.E., 2006. Potential impact of intermittent
preventive treatment (IPT) on spread of drug-resistant malaria. PLoS. Med. 3, e141.
Sinyangwe, L., Delespaux, V., Brandt, J., Geerts, S., Mubanga, J., Machila, N., Holmes, P.H.,
Eisler, M.C., 2004. Trypanocidal drug resistance in Eastern province of Zambia. Vet.
Parasitol. 119, 125-135.
Van den Bossche, P., Chitanga, S., Masumu, J., Marcotty, T., Delespaux, V., 2011. Virulence
in Trypanosoma congolense Savannah subgroup. A comparison between strains and
transmission cycles. Parasite Immunol. 33, 456-460.
Van den Bossche, P., Doran, M., Connor, R.J., 2000. An analysis of trypanocidal drug use in
the Eastern Province of Zambia. Acta Trop. 75, 247-258.
Vitouley, H.S., Mungube, E.O., Allegye-Cudjoe, E., Diall, O., Bocoum, Z., Diarra, B.,
Randolph, T.F., Bauer, B., Clausen, P.H., Geysen, D., Sidibe, I., Bengaly, Z., Van den
Bossche, P., Delespaux, V., 2011. Improved PCR-RFLP for the Detection of
58
Diminazene Resistance in Trypanosoma congolense under Field Conditions Using
Filter Papers for Sample Storage. PLoS. Negl. Trop. Dis. 5, e1223.
Whiteside, E.F., 1962. The control of cattle trypanosomiasis with drugs in Kenya: Methods
and costs. East Afr. Agr. J., 6773.
59
Chapter 4
Parasite-related factors that could affect the tsetse fly transmissibility of T.
congolense isolates: parasite load and the parasite transmission cycle.
60
Abstract
The epidemiology and impact of animal African trypanosomosis (AAT) is influenced
by the transmissibility and virulence of the circulating trypanosome strains in a particular
biotope. In this study, we evaluated the influence of the trypanosome load of a blood meal on
the transmissibility of the parasite by the tsetse fly and also compared the transmissibility of
strains circulating exclusively either in wild animals or in domestic livestock. To determine
the influence of the parasite concentration of the blood meal on the infection rate, flies were
fed with parasite loads ranging from 1 to 1 000 trypanosomes/blood meal (3 strains of
Trypanosoma congolense). A total of 841 flies were dissected. Our results show that blood
meals with an average of 1 trypanosome are sufficient to infect a tsetse fly with a linear
relationship between parasite load and transmissibility observed up to an average of 250
trypanosomes (95% CI: 81 – 765) trypanosomes per blood meal (i.e. +/- 5 000
trypanosomes/ml blood). This latter concentration constitutes a plateau beyond which any
increase in parasite load is not accompanied by an increase in fly infection rates. For the
comparison of the domestic and sylvatic cycles, a total of 1295 flies from 22 batches of flies
were dissected after being infected with one of 10 domestic and 12 sylvatic Trypanosoma
congolense strains of different virulence levels (high or low as evaluated in mice). The cycle
and virulence category used as explanatory variables. When taken singularly, both cycle and
virulence categories were not significantly correlated with transmissibility. When taken
simultaneously in a multivariate model, both were significant: a higher virulence was
correlated with a higher transmissibility in both cycles (odds ratio = 0.34; 95% CI: 0.17 –
0.69; p = 0.003), whereas belonging to the domestic group increased the transmissibility for
the two virulence categories (odds ratio = 0.43; 95% CI: 0.22 – 0.84; p = 0.014). The
interaction between virulence and cycle categories was not significant (odds ratio = 1.3; 95%
61
CI: 0.36 – 4.9; p = 0.67). These results are discussed in relation to the biology of
trypanosomosis.
4.1. Introduction.
Tsetse flies acquire an infection upon taking an infective blood meal but are often
refractory, showing a main barrier to parasite establishment at midgut level. Even in those
flies that are susceptible to infection, a massive amount (>90%) of ingested blood stream
trypanosomes are eliminated during the first few days (Van Den Abbeele et al., 1999; Gibson
and Bailey, 2003), with the small surviving population starting an exponential procyclic
colonization of tsetse midgut. The factors which govern this relationship can either be
parasite or tsetse related.
Whilst a single trypanosome has been shown to be capable of infecting a tsetse fly
(Maudlin and Welburn, 1989), there have been conflicting reports on the relationship
between parasite density in the infective blood meal and the resulting infection rates in tsetse
flies. Nantulya et al. (1978) found that flies fed at peak host parasitaemia established more
midgut infections compared to those flies fed just before and after peak parasitaemia,
suggesting a relationship existed between parasite density in the blood meal and the
subsequent infection rate in flies. In a more recent study, Walshe et al. (2011) also showed
there was a relationship between parasite density in the blood meal and infection rates in flies
based on the observation that there was a drop in infection rates when parasite density in
blood meal decreased from 5 x 104 to 5 x 10
3 trypanosomes/ml. Other published data suggest
that some evolutionary processes have resulted in considerable changes to the tsetse fly
transmissibility of trypanosomes. In T. brucei subgroup, complete or partial loss of kDNA
that is observed in T. equiperdum and T. evansi respectively, has locked these parasites in the
blood stream form thus making them non-transmissible by tsetse flies (Lai et al., 2008). This
62
loss of kDNA has allowed these parasite strains to spread beyond the tsetse belt (Lun et al.,
2010). Also adaptation of T. brucei parasites for survival in the presence of human serum,
which is the case for the human-pathogenic T. b. rhodesiense and T. b. gambiense, has
resulted in reduced tsetse fly transmissibility when compared with the human serum sensitive
T. b. brucei (Welburn et al., 1995). In T. congolense, ISM resistant strains have been shown
to be more transmissible than the ISM sensitive strains (Van den Bossche et al., 2006). This
suggested that the adaptation to survive in presence of drug has also caused an increase in
transmissibility.
Host-parasite systems have been shown to coevolve with the outcome having an effect
on both parasite and host characteristics. Trypanosomosis is a natural infection of wildlife
which now circulates in livestock due to human and livestock encroachment into areas
normally inhabited by game animals. This change in host means that trypanosomes change
from circulating in immune to naïve hosts (Mulla and Rickman, 1988). Host immunity has
been shown to have a negative effect on parasite characteristics such as virulence,
transmissibility, infection length and in-host growth rate, as has been shown for e.g.
Plasmodium chabaudi infections (Mackinnon and Read, 2003). In another study using the T.
congolense parasite in an experimental mouse model (Van den Bossche et al., 2011), we
showed that the change in field transmission cycle (host change) was associated with changes
in virulence of isolates circulating within each transmission cycle, with most of strains from
the sylvatic cycle being more virulent than those from the domestic cycle. Moreover,
Masumu et al. (2006b) showed that this trypanosome characteristic (virulence) was linked
to the tsetse fly transmissibility, i.e. its potential to be transmitted by the vector. It is thus
important to find out if the change in transmission cycle had also affected transmissibility of
the trypanosome isolates circulating in these settings. A study by de Roode et al. (2010)
showed in another host-parasite model that the parasite transmission potential could be
63
affected by host genotypes as well as specific host-parasite interactions. It is thus of interest
to find out if the change in host-parasite interactions and host genotypes had caused a change
in parasite transmissibility.
The aims of this study are thus (i) to verify the effect of the parasite load of a blood
meal on the transmissibility of T. congolense trypanosomes by the tsetse fly, (ii) to compare
the transmissibility of T. congolense isolates hosted exclusively by wildlife (sylvatic cycle)
with isolates hosted exclusively by domestic cattle (domestic cycle).
4.2. Materials and methods
4.2.1. Tsetse flies
A total of 2200 freshly emerged male Glossina morsitans morsitans Westwood (aged
between 15 and 28 hours post eclosion) were used. These flies originated from the rearing
colony of the Institute of Tropical Medicine, Antwerp, Belgium. This colony originated from
pupae collected in Kariba (Zimbabwe) and Handeni (Tanzania). The rearing and maintenance
of this colony is described by Elsen et al. (1993).
4.2.2. Trypanosome isolates from domestic and sylvatic cycles
Twenty-two trypanosome isolates were used in this study. Twelve were isolated from
a sylvatic cycle (6 from Hluhluwe-iMfolozi game reserve, South Africa and 6 from South
Luangwa National park, Zambia) whilst the other 10 were from a domestic cycle (7 from
Eastern Province, Zambia and 3 from Southern Province, Zambia). The isolation of the
sylvatic isolates is described by Van den Bossche et al (2011) whilst that of the domestic
cycle is described by Masumu et al. (2006a). The virulence is categorized in highly virulent
(median survival time of mice infected with those isolates being <10 days) and lowly virulent
64
isolates (median survival time of mice infected with those isolates being > 30 days) (Masumu
et al., 2006a).
4.2.3. Mice and rabbits
Outbred Mice strain OF1 (Oncins France 1) and Hycole breed of rabbits were used in
the experiment and maintained on water and feed pellets ad-lib. Animal ethics approval for
experimental infections was obtained from the Ethics Committee of the Institute of Tropical
Medicine, Antwerp (PAR-012 & DG 008).
4.2.4. Experimental designs
4.2.4.1 Effect of the parasite load of a blood meal on parasite establishment in the tsetse
fly midgut
The establishment of trypanosomes in G. m. morsitans was determined for three (3) T.
congolense isolates i.e. IL 1180, Kapeya 357 C1 and MF1 CL1. At day seven (7) post
infection, the parasitaemia of the mice were estimated using an Uriglass® counting chamber.
Briefly, parasitaemic mouse blood was diluted 1:200 in phosphate buffered saline (PBS) and
7µl of this was pipetted into three (3) Uriglass® counting chambers. Counts were done, under
microscope (X25), in all 160 wells. The average count of the three (3) chambers was then
determined and used to estimate the total parasite count in 1 ml of blood. Here, different
dilutions of this parasitized mouse blood were then made using defibrinated horse blood
(final volume: 10 ml) to a final parasite load that corresponds to respectively 1, 5, 10, 20, 50,
100, 500 & 1 000 trypanosomes ingested by the tsetse flies (estimated blood meal
volume/fly: 20 µl). Feeding of the experimental flies (8 batches of 50 flies) with the
parasite/defibrinated horse blood mixtures was achieved through in vitro membrane feeding.
After 10 minutes of feeding, the flies were anaesthetized using Nitrogen gas and only the
engorged flies were retained for the experiment. The flies were then maintained through
feeding on an uninfected rabbit, three times a week. After 10 days, the flies were dissected
65
and their midgut microscopically checked for the presence of trypanosomes. For statistical
analysis, a quadratic logistic regression was applied on the data to determine the dose at
which the maximum establishment is reached, i.e. the ln(conc) at which the derivate equalled
zero (0).
4.2.4.2. Comparison of the transmissibility in the sylvatic and domestic cycles
For each isolate, two (2) OF1 mice were used to revive and multiply trypanosomes
from stabilates. The parasitaemia of the mice were monitored by checking tail blood
microscopically using the Uriglass® method as outlined above. The infections were
standardised so that all the flies were given a blood meal containing 50 000 trypanosomes/ml
in defibrinated horse blood, with the trypanosomes collected 4 days after the inoculation of
the mice (Akoda et al., 2008; Masumu et al., 2010). The flies were then allowed to feed for a
minimum of 10 minutes after which the unfed flies were discarded from the experiment. The
fully engorged flies were maintained on uninfected rabbits for the first week, after which they
were maintained by feeding on defibrinated horse blood via in vitro membrane feeding. All
the surviving flies were then dissected at the end of the experimental period of 21 days. The
infection status of each dissected fly, in both midgut and mouthparts, was examined
microscopically. The percentage of procyclic (immature) infections was calculated as the
proportion of flies that had a midgut infection whilst the percentage of metacyclic (mature)
infections (= transmissibility) was calculated as the proportion of dissected flies that had
infections in both the midgut and mouth parts. Maturation rate was defined as the percentage
of flies with a midgut infection that developed an infection in the mouth parts.
4.2.5. Statistical analysis
To evaluate the effect of parasite load of blood meal on transmissibility, multivariate
quadratic logistic regressions were applied on midgut binary infection data. Trypanosoma
isolates were used as categorical explanatory variables whereas the logarithm and the squared
66
logarithm of the trypanosome concentration in blood meal were used as continuous
explanatory variables. The mode of the relationship between the proportion of infected flies
and the trypanosome concentration in blood meals corresponded to the value of trypanosome
concentration for which the derivate equalled zero.
For the comparison of the trypanosome transmissibility in the sylvatic and domestic
cycles, mixed logistic models were applied on tsetse fly metacyclic infection binary data,
using individual isolates as random effects. Binary explanatory variables were the virulence
level (high or low), the cycle type (domestic or sylvatic) and the interaction between the two.
Non-significant interaction terms (p>0.05) were removed from the model for the sake of
simplification.
4.3. Results
4.3.1. Parasite load and transmissibility
A total of 841 flies were dissected. Our results show that it is possible for few and
perhaps single trypanosomes to infect a tsetse fly while a linear relationship between parasite
load and transmissibility is observed up to a value of 250 trypanosomes (95% CI: 81 – 765)
per blood meal (+/- 12 500 trypanosomes/ml blood). At higher concentration, a plateau was
observed despite the fact that less than 50% of the flies established a midgut infection (figure
1).
67
Figure 4 - 1. Relation between the parasite load of the blood meal and the midgut
infection rate. Results were obtained for three different T. congolense isolates (IL 1180,
MF1 Cl1 and Kapeya 357 C1). The infected flies were dissected 10 days after taking the
infective blood meal.
4.3.2. Comparison of the transmissibility between cycles and virulence
A total of 1295 flies were dissected. The overall maturation rate was 92.6% with 202
(16.7%) flies that established a midgut infection (procyclic infection) and 187 of them
(15.4%) that were found infected in the mouthparts (metacyclic infection). The number and
proportion of flies with a procyclic and metacyclic infection are summarized in Table 1 for
each of the 22 T. congolense isolates. The proportions of flies with a metacyclic infection
(transmissibility) for the two virulence categories in the domestic and sylvatic cycles are
shown in Table 2.
When used as single explanatory variable, the cycle had no significant effect with a
transmissibility of 13.5% (95% CI: 9.8 - 18.3%) and 15.0% (95% CI: 10.7 – 20.8%) in the
sylvatic and domestic cycles respectively (p= 0.636). Similarly, when the virulence category
0
0.1
0.2
0.3
0.4
0.5
1 10 100 1000
Pro
po
rtio
n o
f fl
ies i
nfe
cte
d
ln conc (Parasite load/blood meal)
MF1 Cl1
av
lower
pred
upper
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
1 10 100 1000
Pro
po
rtio
n o
f fl
ies i
nfe
cte
d
ln conc (Parasite load/blood meal)
Kapeya 357 C1
av
lower
pred
upper
0
0.1
0.2
0.3
0.4
0.5
0.6
1 10 100 1000
Pro
po
rtio
n o
f fl
ies i
nfe
cte
d
ln conc (Parasite load/blood meal)
IL 1180
av
lower
pred
upper
68
was used as single explanatory variable, it had no significant effect with transmissibility of
16.6% (95% CI: 12.6 - 21.4%) and 11.3% (95% CI: 7.9 – 16.0%) for high and low virulence
respectively (p= 0.09).
However, when taken simultaneously in a multivariate model, both virulence and
transmission cycle were significant: a higher virulence was correlated with a higher
transmissibility in both cycles (odds ratio = 0.34; 95% CI: 0.17 – 0.69; p = 0.003), whereas
belonging to the domestic group increased the transmissibility for the two virulence
categories (odds ratio = 0.43; 95% CI: 0.22 – 0.84; p = 0.014). The interaction between
virulence and cycle categories was not significant (odds ratio = 1.3; 95% CI: 0.36 – 4.9; p =
0.67).
69
Table 4 - 1. Isolates used in the study showing their origin, virulence category, number
of flies dissected and proportion infected (%) within the midgut (Procyclic) and
mouthparts (Metacyclic)
Isolate Transmission
cycle
Virulence
category
No. of flies
dissected
No. (%) of flies infected
Procyclic Metacyclic
MF1 CL1 SYLVATIC LOW 80 7 (8.8) 6 (7.5)
MF2 CL5 SYLVATIC HIGH 65 2 (3.1) 2 (3.1)
MF3 CL1 SYLVATIC HIGH 54 4 (7.4) 4 (7.4)
MF4 CL8 SYLVATIC HIGH 82 24 (29.3) 22 (26.8)
MF5 CL3 SYLVATIC HIGH 52 11 (21.2) 10 (19.2)
MF6 CL1 SYLVATIC HIGH 44 3 (6.8) 3 (6.8)
BT 0106 SYLVATIC HIGH 54 8 (14.8) 8 (14.8)
BT 0206 SYLVATIC HIGH 55 9 (16.4) 9 (16.4)
BT 0306 SYLVATIC HIGH 59 13 (22) 11 (18.6)
BT 0306
ISM
SYLVATIC HIGH 65 16 (24.6) 15 (23.1)
BT 0406 SYLVATIC HIGH 25 3 (12) 3 (12)
BT 0506 SYLVATIC HIGH 44 8 (18.2) 7 (15.9)
S1 CL1 DOMESTIC LOW 57 9 (15.8) 9 (15.8)
S3 CL3 DOMESTIC LOW 48 7 (14.6) 7 (14.6)
S4 CL3 DOMESTIC LOW 55 5 (9.1) 5 (9.1)
MSORO M7
C3
DOMESTIC LOW 52 10 (19.2) 9 (17.3)
MSORO
M19 C1
DOMESTIC LOW 41 6 (14.6) 6 (14.6)
CHIPOPELA
37 C3
DOMESTIC LOW 55 6 (10.9) 6 (10.9)
KAPEYA
357 C2
DOMESTIC LOW 50 3 (6.0) 3 (6.0)
ALICK 589
C1
DOMESTIC LOW 51 10 (19.6) 6 (11.8)
ALICK 339
C6
DOMESTIC HIGH 64 25 (39.1) 24 (37.5)
YOBO 2038
C2
DOMESTIC HIGH 61 13 (21.3) 13 (21.3)
70
Table 4 - 2. Comparison of the transmissibility between isolates from different cycles
and virulence categories
Transmission cycle Virulence category Transmissibility %
(95% C.I.)
SYLVATIC HIGH 14.9 (11.4-19.3)
SYLVATIC LOW 7.3 (2.7-18.5)
DOMESTIC HIGH 29.1 (18.3-42.8)
DOMESTIC LOW 12.2 (8.7-16.8)
4.4. Discussion and conclusion
Our study on effect of parasite load on transmissibility confirms the findings of
Maudlin and Welburn (1989) that a single trypanosome is capable of infecting a fly. The
relationship between parasite density and transmissibility assumes a linear relationship up to
a plateau at a parasite density of around 250 trypanosomes per blood meal (12 500/ml). Our
findings are in agreement with the recent observations of Walshe et al. (2011) that reducing
the parasite density in a blood meal from 5 x 104 to 5 x 10
3 /ml caused a significant decrease
in the infection of teneral flies, suggesting that the parasite density threshold for maximum
midgut infection rate is within this range. These data indicate that within a narrow density
range (0 – 1,3 x 104 tryps/ml), the host parasitaemia is directly influencing the success rate of
the parasite midgut establishment in the tsetse fly after ingestion through an infective blood
meal. In the field, cattle parasitaemia often fall within this narrow density range (Geysen et
al., 2003; Marcotty et al., 2008). A similar sigmoid relationship between parasite density and
vector infection rates was observed for P. falciparum and this was suggested to be due to
parasite aggregation as a result of various immunological, haematological and mosquito
factors (Paul et al., 2007).
The singular analysis showed no relationship between virulence and transmissibility.
This suggests that the parasite does not follow the simple trade-off model of virulence
71
evolution (Anderson and May, 1982). The basis of the trade-off model is that virulence and
transmissibility are parasite functions which are genetically linked and increasing functions
of parasite density (de Roode and Altizer, 2010; Froissart et al., 2010). One key assumption
of the trade-off model is that virulence is positively correlated with parasite density, without
taking into account the host factors which have been shown to influence disease outcome
(Grech et al., 2006; Lambrechts et al., 2006; Lefevre et al., 2007). Lack of correlation
between parasite density and transmissibility in trypanosomes was shown by Akoda et al.
(2008), in which they showed that stage of development was a stronger determinant of
transmissibility. The lack of correlation was suggested to be due to host immune response,
which reduced parasite viability and ability to establish in vector (Morrison et al., 1985),
indicating host effect on transmissibility which has been shown also in other parasites (de
Roode and Altizer, 2010; Mideo et al., 2011). In our analysis the different host-parasite
interaction due to different hosts were not taken into account in this singular analysis and
could have potentially blurred off the relationship.
The multivariate model took into account the effect of and interaction between
virulence and host on the transmissibility of the parasite. This showed that within a particular
transmission cycle, highly virulent isolates were more transmissible. Also it was clear that
within same virulence category, domestication tended to be associated with increased
transmissibility. Looking at relationship between virulence and transmissibility using this
model showed a positive correlation which is in agreement with findings of Masumu et al.
(2006b) which suggests the parasite follows a trade-off relationship (Anderson and May,
1982). This analysis used same parasite density indicating that the trade-off is genetically
linked and not linked by parasite density as assumed by the simple trade-off model (Anderson
and May, 1982). Also that the relationship between virulence and transmission only became
clear when comparison is between isolates circulating within same host species, and not
72
across hosts, indicates the importance of host-parasite interactions in determining the trade-
off relationship (de Roode and Altizer, 2010; Froissart et al., 2010). Indeed host effect on the
two parameters involved in the trade-off model (virulence and transmissibility) has been
shown in trypanosomes (Morrison et al., 1985; Van den Bossche et al., 2011). Host immunity
and tsetse density differences can account for the observed differences in transmissibility
between isolates from the two transmission cycles. In the sylvatic cycle, the host mounts an
immune response which controls parasitaemia thus allowing the host to survive with the
parasite (Mulla and Rickman, 1988). Also in this cycle, there is a high tsetse density which
increases the chances of trypanosomes being picked up for transmission. On the other hand,
within domestic cycle the host is naïve and succumbs to infection. Also this cycle has very
low tsetse density due to habitat fragmentation (Van den Bossche et al., 2010). The parasite
cannot attain high parasite densities without killing the host and indeed parasite densities in
the domestic cycle have been shown to be very low; often below detection limit of
microscopy (Marcotty et al., 2008). Thus in order to ensure its survival it is possible that the
parasite improves its interaction with the vector to enhance transmission. It thus seems
besides the reduced virulence in isolates in domestic cycle (Van den Bossche et al., 2011);
the parasites may have increased their transmissibility to ensure survival in the new host.
Levels of virulence and transmission as well as the virulence-transmission
relationships can be affected by host genotypes and host-parasite genetic interactions (de
Roode and Altizer, 2010). The two parameters have been shown to be closely tied and
influenced by processes occurring at the within host level (Bremermann and Pickering, 1983;
Frank, 1996; Mideo et al., 2011). As such it is possible that the relationship is only clear
when both parameters and host-parasite interactions are taken into account.
In conclusion, we managed to show the relationship between parasite density and
transmissibility of trypanosomes, which assumes a sigmoidal curve. We also showed that
73
domestication of the transmission cycle may be associated with increased transmissibility
which may explain how the parasite has managed to adapt and be maintained in an unnatural
environment. Our findings on evolution of transmissibility are however preliminary and
further studies will be required to test this hypothesis.
4.5. References
Akoda, K., Harouna, S., Marcotty, T., De, D.R., Van den Bossche, P., 2008. Investigations on
the transmissibility of Trypanosoma congolense by the tsetse fly Glossina morsitans
morsitans during its development in a mammalian host. Acta Trop. 107, 17-19.
Anderson, R.M., May, R.M., 1982. Coevolution of hosts and parasites. Parasitology 85 (Pt
2), 411-426.
Bremermann, H.J., Pickering, J., 1983. A game-theoretical model of parasite virulence. J.
Theor. Biol. 100, 411-426.
de Roode, J.C., Altizer, S., 2010. Host-parasite genetic interactions and virulence-
transmission relationships in natural populations of monarch butterflies. Evolution 64,
502-514.
Elsen P., Van Hees J., De Lil E., 1993. L'historique et les conditions d'élevage des lignées de
glossines (Diptera, Glossinidae) maintenues à l'Institut de Médecine tropicale Prince
Léopold d'Anvers. J Afr Zool 107, 439-449.
Frank, S.A., 1996. Models of parasite virulence. Q. Rev. Biol. 71, 37-78.
Froissart, R., Doumayrou, J., Vuillaume, F., Alizon, S., Michalakis, Y., 2010. The virulence-
transmission trade-off in vector-borne plant viruses: a review of (non-)existing
studies. Philos. Trans. R. Soc. Lond B Biol. Sci. 365, 1907-1918.
Geysen, D., Delespaux, V., Geerts, S., 2003. PCR-RFLP using Ssu-rDNA amplification as an
easy method for species-specific diagnosis of Trypanosoma species in cattle. Vet.
Parasitol. 110, 171-180.
Gibson, W., Bailey, M., 2003. The development of Trypanosoma brucei within the tsetse fly
midgut observed using green fluorescent trypanosomes. Kinetoplastid Biology and
Disease 2.
Grech, K., Watt, K., Read, A.F., 2006. Host-parasite interactions for virulence and resistance
in a malaria model system. J. Evol. Biol. 19, 1620-1630.
Lai, D.H., Hashimi, H., Lun, Z.R., Ayala, F.J., Lukes, J., 2008. Adaptations of Trypanosoma
brucei to gradual loss of kinetoplast DNA: Trypanosoma equiperdum and
74
Trypanosoma evansi are petite mutants of T. brucei. Proc. Natl. Acad. Sci. U. S. A
105, 1999-2004.
Lambrechts, L., Fellous, S., Koella, J.C., 2006. Coevolutionary interactions between host and
parasite genotypes. Trends Parasitol. 22, 12-16.
Lefevre, T., Sanchez, M., Ponton, F., Hughes, D., Thomas, F., 2007. Virulence and resistance
in malaria: who drives the outcome of the infection? Trends Parasitol. 23, 299-302.
Lun, Z.R., Lai, D.H., Li, F.J., Lukes, J., Ayala, F.J., 2010. Trypanosoma brucei: two steps to
spread out from Africa. Trends Parasitol. 26, 424-427.
Mackinnon, M.J., Read, A.F., 2003. The effects of host immunity on virulence-
transmissibility relationships in the rodent malaria parasite Plasmodium chabaudi.
Parasitology 126, 103-112.
Marcotty, T., Simukoko, H., Berkvens, D., Vercruysse, J., Praet, N., Van den Bossche, P.,
2008. Evaluating the use of packed cell volume as an indicator of trypanosomal
infections in cattle in eastern Zambia. Prev. Vet. Med. 87, 288-300.
Masumu, J., Akoda, K., Van den Bossche, P., 2010. Transmissibility, by Glossina morsitans
morsitans, of Trypanosoma congolense strains during the acute and chronic phases of
infection. Acta Trop. 113, 195-198.
Masumu, J., Marcotty, T., Geysen, D., Geerts, S., Vercruysse, J., Dorny, P., Van den
Bossche, P., 2006a. Comparison of the virulence of Trypanosoma congolense strains
isolated from cattle in a trypanosomiasis endemic area of eastern Zambia. Int. J.
Parasitol. 36, 497-501.
Masumu, J., Marcotty, T., Ndeledje, N., Kubi, C., Geerts, S., Vercruysse, J., Dorny, P., Van
den Bossche, P., 2006b. Comparison of the transmissibility of Trypanosoma
congolense strains, isolated in a trypanosomiasis endemic area of eastern Zambia, by
Glossina morsitans morsitans. Parasitology 133, 331-334.
Maudlin, I., Welburn, S.C., 1989. A single trypanosome is sufficient to infect a tsetse fly.
Ann. Trop. Med. Parasitol. 83, 431-433.
Mideo, N., Nelson, W.A., Reece, S.E., Bell, A.S., Read, A.F., Day, T., 2011. Bridging scales
in the evolution of infectious disease life histories: application. Evolution 65, 3298-
3310.
Morrison, W.I., Murray, M., Akol, G.W.O., 1985. Immune responses of cattle to African
trypanosomes. In: Tizard, I.R. (Ed.), Immunology and Pathogenesis of
Trypanosomiasis. CRC Press Inc., Florida, USA, pp. 103-131.
Mulla, A.F., Rickman, L.R., 1988. How do African game animals control trypanosome
infections? Parasitol. Today 4, 352-354.
Nantulya, V.M., Doyle, J.J., Jenni, L., 1978. Studies on Trypanosoma (nannomonas)
congolense II. Observations on the cyclical transmission of three field isolates by
Glossina morsitans morsitans. Acta Trop. 35, 339-344.
75
Paul, R.E., Bonnet, S., Boudin, C., Tchuinkam, T., Robert, V., 2007. Aggregation in malaria
parasites places limits on mosquito infection rates. Infect. Genet. Evol. 7, 577-586.
Van Den Abbeele, J., Claes, Y., van, B.D., Le, R.D., Coosemans, M., 1999. Trypanosoma
brucei spp. development in the tsetse fly: characterization of the post-mesocyclic
stages in the foregut and proboscis. Parasitology 118 ( Pt 5), 469-478.
Van den Bossche, P., Akoda, K., Kubi, C., Marcotty, T., 2006. The transmissibility of
Trypanosoma congolense seems to be associated with its level of resistance to
isometamidium chloride. Vet. Parasitol. 135, 365-367.
Van den Bossche, P., Chitanga, S., Masumu, J., Marcotty, T., Delespaux, V., 2011. Virulence
in Trypanosoma congolense Savannah subgroup. A comparison between strains and
transmission cycles. Parasite Immunol. 33, 456-460.
Van den Bossche, P., Rocque, S.D., Hendrickx, G., Bouyer, J., 2010. A changing
environment and the epidemiology of tsetse-transmitted livestock trypanosomiasis.
Trends Parasitol. 26, 236-243.
Walshe, D.P., Lehane, M.J., Haines, L.R., 2011. Post eclosion age predicts the prevalence of
midgut trypanosome infections in glossina. PLoS. One. 6, e26984.
Welburn, S.C., Maudlin, I., Milligan, P.J., 1995. Trypanozoon: infectivity to humans is linked
to reduced transmissibility in tsetse. I. Comparison of human serum-resistant and
human serum-sensitive field isolates. Exp. Parasitol. 81, 404-408.
76
Chapter 5.
General discussion
77
5.1. Introduction
A better understanding of the epidemiology of trypanosomosis is important in order to
come up with adequate control measures. Trypanosomosis is naturally an infection of game
animals which has spilled over into humans and domestic animals due to the encroachment of
people into areas normally inhabited by game animals. This human encroachment has
resulted in three epidemiological settings in which trypanosomes circulate: sylvatic, interface
and domestic. It has been observed that the disease impact in these settings is different, but it
has not been shown how these differences come about. Indeed it has been shown that even
for strains circulating within a similar epidemiological setting, certain phenotypic
characteristics of epidemiological importance may differ causing different disease impacts in
the various epidemiological settings. Therefore, our study aimed to determine and to compare
epidemiologically important phenotypic characteristics (virulence, transmissibility and drug
sensitivity) of trypanosome strains isolated in the different epidemiological settings.
5.2. Host-Parasite Interactions: has transmission cycle altered this relationship?
5.2.1. Evolution of virulence
Virulence evolution for any parasite/organism is an outcome of host and parasite
genotype interaction (Read and Taylor, 2001; Ebert and Bull, 2003; Lambrechts et al., 2006).
Host infection by a parasite provokes an immune response and this has been shown to be
either tolerance or resistance, with tolerance acting by reducing fitness cost of infection on
the host without direct effect on the parasite growth and reproduction (Restif and Koella,
2004; Miller et al., 2006). This immune response allows for the selection and establishment
of faster/highly replicating parasites which consequently increases their virulence when they
infect a new host (Andre et al., 2003). This seems to be the case with trypanosomes
circulating within the trypanotolerant game animals as shown by our study where the
78
majority of the strains circulating within the cycle are highly virulent in comparison to those
circulating in domestic livestock.
Whilst the trypanosomes strains circulating in the sylvatic cycle do not cause disease
in game animals, when they cross over to domestic livestock, as is the case at the
game/livestock interface, they cause devastating disease as has been reported by various
authors (Slingenbergh, 1992; Kappmeier et al., 1998; Sigauque et al., 2000; Van den Bossche
et al., 2006). This seemingly apparent change in virulence effects underlines the importance
of defining the virulence of a host with regard to a particular host as was suggested by
Gandon and Michalakis (2000). The host species jump by trypanosomes, from game to
livestock at the interface, qualifies trypanosomosis within this epidemiological setting as an
emerging infection as defined by Woolhouse et al (2005). The epidemic nature of the disease
on host crossover can be attributed to a lack of evolved tolerance in the new host (livestock)
(Bolker et al., 2010).
In the absence of a tolerant host, the subsequent high mortality due to infection by the
parasite would render this level of virulence maladaptive in the new host leading to drive
towards reduced virulence (Lenski and May, 1994; Frank, 1996; Day, 2001). In livestock
trypanosomosis the drive towards selection of low virulence is accomplished through either
host death or treatment, allowing for the domination of lowly virulent strains in this
epidemiological cycle where livestock is the main reservoir of infection (Van den Bossche et
al., 2010). This predomination of lowly virulent strains in the domestic transmission cycle
was previously reported by (Masumu et al., 2006) and has been confirmed in our study and
seems to be the reason why endemicity has been reached in some areas where livestock are
the main reservoirs of infection (Doran, 2000; Van den Bossche, 2001).
Our study has shown the predomination of highly virulent strains within the sylvatic
transmission cycle and a predomination by lowly virulent strains within the domestic
79
transmission cycle. Since the experiments of Bengaly et al. (2002a; 2002b), found that
findings in mice could be extrapolated to those in cattle, our findings could explain the
observed disease impacts on the game/livestock interface where livestock suffer from disease
effects as well as the observed endemicity in the domestic transmission cycle. It is thus
possible to reach endemicity in trypanosomosis control, which could constitute an additional
tool contributing to sustainable trypanosomosis management as was suggested by Van den
Bossche (2008).
5.2.2. Evolution of the prevalence of drug resistance inducing mutations
Determination of the evolution of drug resistance is important and has potential
clinical implications on the following; (i) development of therapeutic protocols to forestall
spread of resistance, (ii) development of modified drugs that target resistant proteins, (iii)
deployment of more effective drugs less likely to promote resistance and (iv) protecting the
efficacy of existing drugs (Prudhomme O'Meara et al., 2006; Lozovsky et al., 2009;
Tipsuwan et al., 2011). There are two schools of thought with regards to the emergence of
drug resistance inducing/associated mutations, with one group arguing that these mutations
arise randomly whilst another group argues that the emergence of these mutations is in direct
response to drug pressure (White and Pongtavornpinyo, 2003; Prudhomme O'Meara et al.,
2006; Babiker et al., 2009). Once the mutation has emerged it gets fixed within the
population by transmission and stochastic persistence (Smith et al., 2010), and by selective
advantage during drug use (Huijben et al., 2010; Malisa et al., 2010). In such cases where
drug pressure is the main driver for the emergence and establishment of mutation linked to
drug resistance, reduction of the drug pressure would delay development, fixation and spread
of such mutations (Wargo et al., 2007; Smith et al., 2010; Huijben et al., 2010). However, it
should also be noted that it is possible that once selected for, mutations can remain at high
prevalence even in the absence of drug pressure and this can occur due to presence of
80
additional mutations which compensate for the initial fitness loss, as well as when the initial
mutation has a fitness benefit to the parasite (Maisnier-Paitin et al., 2002; Nair et al., 2008;
Brown et al., 2010).
Our study showed a high prevalence of the genetic mutation associated with resistance
to diminazene aceturate, in a parasite population that had never been exposed to drug
pressure. It shows that this mutation is part of the normal genotypic diversity of
trypanosomes whilst further suggesting that it indeed carries another fitness advantage over
the non-mutants which allows it to become fixed and spread even in absence of drug
pressure. As such we can infer that emergence of the DA resistance associated mutation agree
with the model where mutations arise randomly, establish and perpetuate even in absence of
drug pressure. It thus seems inevitable that DA resistance will become a problem in parasite
control in livestock. The use of a sanative pair (Whiteside, 1962) to reduce the spread of DA
resistance is not a valuable option since the mutation linked to resistance is already present
within the parasite population. Combination therapy only works in curbing spread of
resistance mutation if the mutation is not already present in the population, based on the least
likelihood of it emerging by allowing gene recombination to breakdown gene mutations. Our
finding that the DA linked mutation is already fixed within the parasite populations, even in
those circulating in the wild life animals; suggest that the success of the sanative pair
(Whiteside, 1962) is under threat, indicating the urgent need for new drugs and alternative
control methods.
81
5.3. Vector-Parasite Interactions: what is the effect of parasite density and host
change/transmission cycle?
Tsetse flies cyclically transmit several trypanosome species and this relationship is
based on the ability of the trypanosome to successfully establish within the midgut of the fly
and then differentiate and migrate to the mouthparts for subsequent transmission to a host
animal. Various factors have been shown to affect this relationship, and these have been
shown to be related to both the vector and the parasite.
In our study, the relationship between parasite density in blood meal (host
parasitaemia) and transmissibility was determined. We showed that within a particular
parasite density range, the probability to be transmitted by a tsetse fly (i.e. be able of a full
development cycle in the fly) is directly related to the number of ingested parasites (i.e. the
parasite load of the animal host). Above a specific parasite load, this relationship reaches a
maximum plateau at which any parasite density increase is not accompanied by subsequent
increase in transmissibility. Of particular interest is that cattle parasitaemia observed in the
field, are low (Marcotty et al., 2008) and will often fall within the range of the parasite load –
transmissibility dependency. This clearly suggests an important impact of the parasite load in
the animal hosts on the epidemiology of the disease in a field situation. Control measures
which reduce the host parasitaemia would thus subsequently reduce the chances of the
parasite being transmitted.
We showed that domestic isolates were more transmissible than sylvatic isolates
suggesting that domestication of the trypanosome transmission cycle is associated with an
improvement of the vector-parasite interaction. Considering the low tsetse density in the
domestic transmission cycle, it seems logical that the trypanosomes would evolve to be more
transmissible to enhance the survival of the parasite within the new transmission cycle. Our
82
results show that trypanosomes evolve to enhance their transmissibility and hence ensure
their survival in a hostile environment.
5.4. Drug sensitivity, virulence and transmissibility interaction in domestication of the
trypanosome transmission cycle
Trypanosomes thus use various methods to adapt in the domestic transmission cycle.
The change in the host-parasite-vector interactions is accompanied by some changes in
parasite characteristics which ensure survival of the parasite in its new host. Our findings
suggest a strong interplay between these characteristic (drug sensitivity, virulence and
transmissibility) to ensure successful establishment of the parasite in this environment. The
lowly virulent and those isolates carrying the mutation conferring drug resistance are favored
in the new environment. Such strains do not kill their new host and can survive drug presence
thus ensuring survival and establishment of the parasite in the population. The increased
transmissibility associated with domestication helps in dissemination of the parasite in this
environment. As such it is clear that the three parasite characteristics (drug sensitivity,
virulence and transmissibility) have all worked together to ensure successful establishment of
trypanosomosis within the domestic transmission cycle.
5.5. Implications of our findings in trypanosomosis control in livestock
Trypanosomosis exists in three different epidemiological situations depending on the
predominant host species. There exists three epidemiological settings; sylvatic predominated
by wildlife, interface in which both wildlife and livestock are important hosts and the
domestic in which livestock are the main hosts. Parasite infections result in disease of
economic significance in the latter two epidemiologal settings and it is in these that parasite
control is instituted. The impact and dynamics of disease in the two settings is different hence
83
the need to prescribe control measures which are specific for a particular epidemiological
setting.
Our study shows that wildlife host parasite strains are highly virulent in susceptible
hosts. This finding has important implications in areas where livestock and game mix, as
livestock get exposed to these highly replicating and virulent strains which will cause an
epidemic nature of disease. Such situations exist when livestock are moved into areas
normally inhabited by game due to population expansion as well as during creation of game
parks in areas close to livestock grazing areas. Recent efforts of restocking game animals in
areas in close proximity to livestock grazing areas thus pose danger of potential epidemic
trypanosomosis in livestock. The danger of epidemic form of disease during such exercises
has to be taken into consideration and proper control measures instituted to reduce disease
impact. The finding of predominance of lowly virulent strains in domestic cycle indicates the
possibility of achieving endemic stability in this transmission cycle. It is thus possible to aim
for attainment of endemicity, especially in areas where high animal productivity can be
sacrificed. Systematic treatment of animals, focusing on the sick animals, is a possible way to
achieve endemicity as it systematically eliminates the highly virulent strains.
The high prevalence of the mutation linked to DA resistance – even in the wild life
host - indicates that development and spread of DA resistance is inevitable. One of the ways
to control spread of an already existing mutation is to fully understand the mechanisms by
which the parasite develops resistance and then developing modified drugs which target the
resistant strains. It should be noted that the mere presence of the mutation linked to drug
resistance (genotypic resistance) does not automatically equate to phenotypic resistance and
as such there is a time period when drugs are still effective even if the genotype for resistance
is already present in the population. Whilst there was high prevalence of the mutation in our
study, treatment using the recommended doses reduced the parasitaemia to a level below
84
detection by microscopy without compromising health of the mouse. Confirmation of this in
livestock, as has been done for ISM resistance, would rationalize continued use of the drug
since it would improve animal health.
Linking the evidence that continued drug use even in face of resistance helps improve health
of infected animals with the relationship between parasite density and transmissibility, shows
that drug use in resistant strains will not only improve animal health but will also reduce the
transmission potential of the parasite. As such continued drug use would help in reducing
parasite burden in the animals and hence improve their health whilst also reducing spread of
the infection among the livestock through reduced transmission. Strategic treatment of
clinically affected cases will also reduce the prevalence of highly virulent strains within the
parasite population hence allow a quicker attainment of endemic stability. As such it is our
recommendation to continue DA use even in the face of such high prevalence of the mutation
linked to resistance to the drug as the benefits are big both in improving animal health as well
as curbing the spread of the infection through the vector.
85
5.6. References:
Andre, J.B., Ferdy, J.B., Godelle, B., 2003. Within-host parasite dynamics, emerging trade-
off, and evolution of virulence with immune system. Evolution 57, 1489-1497.
Babiker, H.A., Hastings, I.M., Swedberg, G., 2009. Impaired fitness of drug-resistant malaria
parasites: evidence and implication on drug-deployment policies. Expert Rev Anti-
Infe 7, 581-593.
Bengaly, Z., Sidibe, I., Boly, H., Sawadogo, L., Desquesnes, M., 2002a. Comparative
pathogenicity of three genetically distinct Trypanosoma congolense-types in inbred
Balb/c mice. Vet. Parasitol. 105, 111-118.
Bengaly, Z., Sidibe, I., Ganaba, R., Desquesnes, M., Holby, H., Sawadogo, L., 2002b.
Comparative pathogenicity of three genetically distinct types of Trypanosoma
congolense in cattle: clinical observations and haematological changes. Vet. Parasitol.
108, 1-19.
Bolker, B.M., Nanda, A., Shah, D., 2010. Transient virulence of emerging pathogens. J. R.
Soc. Interface 7, 811-822.
Brown, K.M., Costanzo, M.S., Xu, W., Roy, S., Lozovsky, E.R., Hartl, D.L., 2010.
Compensatory mutations restore fitness during the evolution of dihydrofolate
reductase. Mol. Biol. Evol. 27, 2682-2690.
Day, T., 2001. Parasite transmission modes and the evolution of virulence. Evolution 55,
2389-2400.
Doran, M., 2000. Socio-economics of trypanosomosis. In: RTTCP (Ed.), Bovine
Trypanosomosis in Southern Africa, Harare, pp. 1-146.
Ebert, D., Bull, J.J., 2003. Challenging the trade-off model for the evolution of virulence: is
virulence management feasible? Trends Microbiol. 11, 15-20.
Frank, S.A., 1996. Models of parasite virulence. Q. Rev. Biol. 71, 37-78.
Gandon, S., Michalakis, Y., 2000. Evolution of parasite virulence against qualitative or
quantitative host resistance. Proc. Biol. Sci. 267, 985-990.
Huijben, S., Nelson, W.A., Wargo, A.R., Sim, D.G., Drew, D.R., Read, A.F., 2010.
Chemotherapy, within-host ecology and the fitness of drug-resistant malaria parasites.
Evolution 64, 2952-2968.
Kappmeier, K., Nevill, E.M., Bagnall, R.J., 1998. Review of tsetse flies and trypanosomosis
in South Africa. Onderstepoort J. Vet. Res. 65, 195-203.
Lambrechts, L., Fellous, S., Koella, J.C., 2006. Coevolutionary interactions between host and
parasite genotypes. Trends Parasitol. 22, 12-16.
Lenski, R.E., May, R.M., 1994. The evolution of virulence in parasites and pathogens:
reconciliation between two competing hypotheses. J. Theor. Biol. 169, 253-265.
86
Lozovsky, E.R., Chookajorn, T., Brown, K.M., Imwong, M., Shaw, P.J.,
Kamchonwongpaisan, S., Neafsey, D.E., Weinreich, D.M., Hartl, D.L., 2009.
Stepwise acquisition of pyrimethamine resistance in the malaria parasite. Proc. Natl.
Acad. Sci. U. S. A 106, 12025-12030.
Maisnier-Paitin, S., Berg, O.G., Lilijas, L., Anderson, D.I., 2002. Compensatory adaptation to
the deleterious effect of antibiotic resistance in Salmonella typhimurium. Mol.
Microbiol. 2, 355-366.
Malisa, A.L., Pearce, R.J., Abdulla, S., Mshinda, H., Kachur, P.S., Bloland, P., Roper, C.,
2010. Drug coverage in treatment of malaria and the consequences for resistance
evolution--evidence from the use of sulphadoxine/pyrimethamine. Malar. J. 9, 190.
Marcotty, T., Simukoko, H., Berkvens, D., Vercruysse, J., Praet, N., Van den Bossche, P.,
2008. Evaluating the use of packed cell volume as an indicator of trypanosomal
infections in cattle in eastern Zambia. Prev. Vet. Med. 87, 288-300.
Masumu, J., Marcotty, T., Geysen, D., Geerts, S., Vercruysse, J., Dorny, P., Van den
Bossche, P., 2006. Comparison of the virulence of Trypanosoma congolense strains
isolated from cattle in a trypanosomiasis endemic area of eastern Zambia. Int. J.
Parasitol. 36, 497-501.
Miller, M.R., White, A., Boots, M., 2006. The evolution of parasites in response to tolerance
in their hosts: the good, the bad, and apparent commensalism. Evolution 60, 945-956.
Nair, S., Miller, B., Barends, M., Jaidee, A., Patel, J., Mayxay, M., Newton, P., Nosten, F.,
Ferdig, M.T., Anderson, T.J., 2008. Adaptive copy number evolution in malaria
parasites. Plos Genet. 4e1000243.
Prudhomme O'Meara, Smith, D.L., McKenzie, F.E., 2006. Potential impact of intermittent
preventive treatment (IPT) on spread of drug-resistant malaria. PLoS. Med. 3, e141.
Read, A.F., Taylor, L.H., 2001. The ecology of genetically diverse infections. Science 292,
1099-1102.
Restif, O., Koella, J.C., 2004. Concurrent evolution of resistance and tolerance to pathogens.
Am. Nat. 164, E90-102.
Sigauque, I., Van den Bossche, P., Moiana, M., Jamal, S., Neves, L., 2000. The distribution
of tsetse (Diptera: Glossinidae) and bovine trypanosomosis in the Matutuine District,
Maputo Province, Mozambique. Onderstepoort J. Vet. Res. 67, 167-172.
Slingenbergh, J., 1992. Tsetse control and agricultural development on Ethiopia. World An.
Rev. 70-71, 30-36.
Smith, D.L., Klein, E.Y., McKenzie, F.E., Laxminarayan, R., 2010. Prospective strategies to
delay the evolution of anti-malarial drug resistance: weighing the uncertainty. Malar.
J. 9, 217.
Tipsuwan, W., Srichairatanakool, S., Kamchonwongpaisan, S., Yuthavong, Y., Uthaipibull,
C., 2011. Selection of drug resistant mutants from random library of Plasmodium
falciparum dihydrofolate reductase in Plasmodium berghei model. Malar. J. 10, 119.
87
Van den Bossche, P., 2001. Some general aspects of the distribution and epidemiology of
bovine trypanosomosis in southern Africa. Int. J. Parasitol. 31, 592-598.
Van den Bossche, P., 2008. Tsetse-transmitted Trypanosomiasis: Variations on a Theme. In:
pp. 523-536.
Van den Bossche, P., Esterhuizen, J., Nkuna, R., Matjila, T., Penzhorn, B., Geerts, S.,
Marcotty, T., 2006. An update of the bovine trypanosomosis situation at the edge of
Hluhiuwe-Imfolozi Park, Kwazulu-Natal Province, South Africa. Onderstepoort J.
Vet. Res. 73, 77-79.
Van den Bossche, P., Rocque, S.D., Hendrickx, G., Bouyer, J., 2010. A changing
environment and the epidemiology of tsetse-transmitted livestock trypanosomiasis.
Trends Parasitol. 26, 236-243.
Wargo, A.R., Huijben, S., de Roode, J.C., Shepherd, J., Read, A.F., 2007. Competitive
release and facilitation of drug-resistant parasites after therapeutic chemotherapy in a
rodent malaria model. Proc. Natl. Acad. Sci. U. S. A 104, 19914-19919.
White, N.J., Pongtavornpinyo, W., 2003. The de novo selection of drug-resistant malaria
parasites. Proc. Biol. Sci. 270, 545-554.
Whiteside, E.F., 1962. The control of cattle trypanosomiasis with drugs in Kenya: Methods
and costs. East Afr. Agr. J. 28.
Woolhouse, M.E., Haydon, D.T., Antia, R., 2005. Emerging pathogens: the epidemiology
and evolution of species jumps. Trends Ecol. Evol. 20, 238-244.
88
Summary
89
Trypanosomosis is naturally an infection of wild animals (sylvatic cycle) which now
affects livestock (domestic cycle) due to the encroachment of people into areas traditionally
inhabited by wildlife. This human encroachment has resulted in different epidemiological
settings in which the disease circulates, with differing levels of disease impact. The domestic
transmission cycle has been relatively extensively studied. However, few studies have been
conducted to understand how the change in transmission cycle, from sylvatic to domestic,
has impacted the evolution of some epidemiologically important parasite traits (drug
sensitivity, pathogenicity and transmissibility) which play a significant role in disease
epidemiology. Knowledge of how these epidemiologically important parasite traits have
evolved as a result of the change in transmission cycle would further improve the
understanding of the epidemiology of the domestic transmission cycle and contribute to a
more focused control of livestock trypanosomosis. Thus, the objective of the research which
culminated in this thesis was to understand the changes in various parasite traits such as
transmissibility, pathogenicity and drug sensitivity which T. congolense undergoes as a result
of a change in the transmission cycle from a sylvatic transmission cycle to a domestic
transmission cycle.
In the first chapter of the thesis, the current knowledge on three important T.
congolense epidemiological traits was reviewed. Through this extensive literature review,
knowledge gaps that still needed to be explored were identified.
In the second chapter, a study is described in which the pathogenicity of strains
isolated from sylvatic and domestic cycles was investigated. The results of this study
indicated that there was a wide variation in the pathogenicity of various strains and that there
was uneven distribution in the proportion of highly and lowly virulent strains across the
transmission cycles. There was a higher concentration of highly virulent strains in the sylvatic
transmission cycle as compared to the domestic transmission cycle which had predominantly
90
lowly virulent strains. The predominance of highly virulent strains in the sylvatic cycle could
possibly explain the epidemic nature of the disease at the wildlife/livestock interfaces and in
areas in which livestock is introduced into wildlife areas. On the other hand, the
predominance of lowly virulent strains in the domestic cycle could explain the endemic state
observed in some areas in which the parasite is hosted exclusively by livestock.
The third chapter describes a study in which the drug sensitivity of isolates from
isolated sylvatic transmission cycles (with no history of drug use) was investigated. The
results of this study revealed a surprisingly high prevalence of the genetic mutation linked to
diminazene aceturate (DA) resistance. These results suggest that the mutation linked to DA
resistance is part of the normal genotypic diversity of trypanosomes and is favorable to the
parasite survival and/or dissemination independent of drug pressure. We showed that whilst
treatment of these resistant parasites did not clear the parasite, it managed to reduce the
parasite levels in circulation to very low levels, below microscopic detection, without effect
on animal health. This seems to suggest that treatment of resistant parasites may have clinical
benefits to animals.
In the fourth chapter, two studies are described. The first study describes the
relationship between parasite density in a blood meal and its transmissibility. We managed to
show that the relationship between parasite density and transmissibility is sigmoidal with
existence of lower and upper thresholds of parasite density. This finding underlines the
importance of host parasite density in the epidemiology of the disease. The second study was
to determine if the change in transmission cycle had been accompanied by a change in
parasite transmissibility. The results of the study showed that domestication was associated
with increased transmissibility which probably explains how the parasite has adapted and
managed to maintain itself in a new transmission cycle.
91
In the last chapter, our findings are discussed first in relation to the current
knowledge, and then each parasite trait is analyzed for its possible implication in the
epidemiology of the disease in the various epidemiological settings. This is then related to the
evolution of the parasite as a result of change in transmission cycle. The three parasite
characteristics are then discussed as they relate to each other and how the observed changes
can be integrated in trypanosomosis control programmes.
92
Samenvatting
93
Trypanosomosis, een besmettelijke ziekte die oorspronkelijk enkel bij wilde dieren
voorkwam(de sylvatische cyclus), wordt tegenwoordig ook teruggevonden bij nutsdieren. Dit
komt doordat de mens de natuurlijke grenzen overschrijdt en binnendringt in gebieden waar
vroeger enkel wild leefde. Deze menselijke invasie leidt tot diverse epidemiologische
situaties waarbinnen de ziekte circuleert, waarbij elke situatie een ander niveau van impact
van de ziekte vertoont. De transmissie cyclus bij nutsdieren is al grondig bestudeerd, maar
slechts weinige studies zijn uitgevoerd om te begrijpen hoe de verandering van
transmissiecyclus (van wild- naar nutsdieren) de evolutie van sommige -epidemiologisch
belangrijke- parasietkenmerken (medicatiegevoeligheid, pathogeniciteit en transmissibiliteit)
heeft beïnvloed. Deze spelen immers een belangrijke rol binnen de epidemiologie van
ziekten. Kennis van de net vermelde evolutie zou leiden tot een beter inzicht van de
epidemiologie van de transmissiecyclus bij nutsdieren en zou bijdragen tot een meer gerichte
controle van trypanosomosis bij het vee. Het doel van dit onderzoek, dat resulteerde in deze
thesis, was dus om de evolutie te begrijpen binnen bepaalde kenmerken van T. congolense
(zoals medicatiegevoeligheid, pathogeniciteit en transmissibiliteit) als resultaat van een
verandering van transmissiecyclus, nl. van sylvatisch naar nutsdieren.
In het eerste hoofdstuk van de thesis werd de huidige kennis van 3 belangrijke
epidemiologische kenmerken van T. congolense herbekeken. Door deze uitgebreide
literatuurstudie kwamen bepaalde kennishiaten, die verder onderzocht moeten worden, naar
boven.
In het tweede hoofdstuk wordt een studie beschreven waarbij de pathogeniciteit van
geïsoleerde stammen van sylvatische en nutsdieren cycli wordt onderzocht. De resultaten van
deze studie toonden aan dat er een grote variatie was aan pathogeniciteit van de diverse
stammen en dat er een ongelijke verdeling was van het aandeel aan zeer virulente en minder
94
virulente stammen binnen de transmissiecycli. Binnen de sylvatische transmissiecyclus werd
een hogere concentratie aan zeer virulente stammen gevonden in vergelijking met de
transmissiecyclus bij nutsdieren, waar hoofdzakelijk minder virulente stammen werden
aangetroffen. De overheersing van de zeer virulente stammen binnen de sylvatische
transmissiecyclus kan eventueel de epidemische aard van de ziekte verklaren, daar waar de
territoria van vee en wild aan elkaar grenzen of elkaar overlappen. De overheersing van
minder virulente stammen bij de transmissiecyclus in nutsdieren kan daarentegen de
endemische toestand verklaren in sommige gebieden waar de parasiet zich uitsluitend in vee
kan nestelen.
Het derde hoofdstuk beschrijft een studie waarbij de medicatiegevoeligheid van
trypanosoomisolaten van afzonderlijke sylvatische transmissiecycli (zonder verleden van
medicatiegebruik) werd onderzocht. De studie bracht een bijzonder resultaat aan het licht:
een verrassend hoge prevalentie van de genetische mutatie gelinkt aan diminazene aceturate
(DA) - resistentie. Deze resultaten geven aan dat de mutatie gelinkt aan DA-resistentie, deel
uitmaakt van de normale genotypische diversiteit van trypanosomen en tevens bevorderlijk is
voor het overleven van de parasiet en/of disseminatie onafhankelijk van
behandelingsfrequentie. Wij toonden aan dat behandeling deze resistente parasieten niet
vernietigt, maar wel erin slaagt de parasitemie sterk te verlagen (tot een niveau niet meer
zichtbaar met de microscoop), zonder of met weinig effect op de gezondheid van het dier. Dit
doet vermoeden dat het dier klinische voordelen ondervindt door de resistente parasieten te
behandelen.
In het vierde hoofdstuk worden 2 studies behandeld. De eerste studie beschrijft het
verband tussen de hoeveelheid parasieten in het bloedmaal en de transmissibiliteit. Wij
slaagden erin om aan te tonen dat dit verband sigmoïdaal is met het voorkomen van lage en
95
hoge drempels binnen de hoeveelheid parasieten. Deze conclusie benadrukt het belang van de
hoeveelheid parasieten die de gastheer herbergt tegenover de epidemiologie van de ziekte.
Een tweede studie moest bepalen of de verandering van transmissiecyclus gepaard gaat met
een verandering van de transmissibiliteit van de parasiet. De resultaten van deze studie
toonden aan dat het tam maken gepaard gaat met een verhoogde transmissibiliteit, wat dan
weer verklaart hoe de parasiet zich heeft aangepast en erin slaagde om zich, binnen een
nieuwe transmissiecyclus, in stand te houden.
In het laatste hoofdstuk worden onze bevindingen besproken en vergeleken met de
huidige kennis. Daarna wordt onderzocht wat het mogelijk gevolg is van ieder kenmerk van
de parasiet op de epidemiologie van de ziekte, binnen verschillende epidemiologische
situaties. Dit wordt dan gekoppeld aan de evolutie van de parasiet ten gevolge van een
gewijzigde transmissiecyclus. Tot slot, worden de drie parasietkenmerken behandeld
(aangezien ze zich tot elkaar verhouden) en wordt er besproken hoe de waargenomen
veranderingen kunnen worden geïntegreerd binnen programma’s van trypanosomosis
controle.
96
Curriculum Vitae
Personal information
Name: Simbarashe Chitanga
Date of Birth: 27th
November 1980
Place of Birth: Mrewa, Zimbabwe
E-mail address: [email protected], [email protected]
Education
2005-2006: Master of Science in Tropical Animal Health, Institute of Tropical
Medicine (Antwerp, Belgium)
1999-2004: Bachelor of Veterinary Sciences, Faculty of Veterinary Sciences,
University of Zimbabwe (Zimbabwe)
Professional experience
2004-2005: Resident Pathologist, Department of Paraclinical Studies, Faculty of
Veterinary Sciences, University of Zimbabwe (Zimbabwe)
2006-2009: Lecturer, Department of Clinical Studies, Faculty of Veterinary
Sciences, University of Zimbabwe (Zimbabwe)
List of publications
1. S. Chitanga, T. Marcotty, B. Namangala, P. Van den Bossche, J. Van Den Abbeele
and V. Delespaux. 2011. High prevalence of drug resistance in animal trypanosomes
without a history of drug exposure. Plos Neglected Tropical Diseases 5 (12) e1454.
2. P. Van den Bossche+, S. Chitanga
+, J. Masumu, T. Marcotty, V. Delespaux. 2011.
Virulence in Trypanosoma congolense Savannah subgroup. A comparison between
strains and transmission cycles. Parasite Immunology, 33 (8): 456-460.
+ Joint first authors.
97
3. S. Mukaratirwa, S. Chitanga, T. Chimatira, C. Makuleke, S.T. Sayi and E. Bhebhe.
2009. Combination therapy using intratumoral bacillus Calmette-Guerin (BCG) and
vincristine in dogs with transmissible venereal tumours: Therapeutic efficacy and
histological changes. Journal of the South African Veterinary Association. 80 (2):
92-6.
4. V. Delespaux, S. Chitanga, D. Geysen, D. Goethals, P. Van Den Bossche and S.
Geerts. 2006. SSCP analysis of the P2 purine transporter TcoAT1 gene of
Trypanosoma congolense leads to a simple PCR-RFLP test allowing the rapid
identification of diminazene resistant stocks. Acta Tropica, 100: 96-102.
5. S. Mukaratirwa, T. Chiwome, S. Chitanga and E. Bhebhe. 2005. Canine
transmissible venereal tumour: Assessment of mast cell numbers indicators of growth
phase. Veterinary Research Communications, 30: 613-621.
6. S. Mukaratirwa, J. Chipunza, S. Chitanga, M. Chimonyo and E. Bhebhe. 2005.
Canine cutaneous neoplasms: Prevalence and influence of age and site distribution on
the presence and potential of malignancy of cutaneous neoplasms in dogs from
Zimbabwe. Journal of the South African Veterinary Association, 76: 59-62.
Professional membership
Council of Veterinary Surgeons of Zimbabwe
Veterinary Association of Zambia
Personal achievements
1. Recipient of the Jansen award for best presentation at the Belgian Society for
Parasitologists annual scientific meeting, held at University of Liege, Liege, Belgium
on June 10 2011.
98
2. Recipient of the World Association for the Advancement of Veterinary Parasitology
(WAAVP) African Foundation scholarship to attend the 23rd
WAAVP conference in
Buenos Aires, Argentina from 21 to 25 August 2011.
3. Recipient of the Carneige Corporation of New York busary to attend an international
scientific workshop at Sokoine University, Morogoro, Tanzania titled ‘One Health:
Understanding Human and Veterinary Diseases from molecular cell biology to
successful interventions’. August 1st to 7
th 2011.
4. Recipient of the Belgian Directorate General for Development Cooperation (DGDC)
scholarship (2008 – 2012) to undertake a sandwhich PhD at the Institute of Tropical
Medicine, Antwerp, Belgium, in collaboration with the School of Veterinary
Medicine, University of Zambia and Univeristy of Gent, Belgium.
5. Recipient of the Belgian Directorate General for Development Cooperation (DGDC)
scholarship (2005 – 2006) to undertake an MSc in Tropical Animal Health at the
Institute of Tropical Medicine, Antwerp, Belgium.