Sigatoka Leaf Spot Disease on Banana

Laboratory Diagnostics Manual

Edited by Dr Juliane Henderson

December 2006

The PCR primers and reaction conditions for molecular diagnosis of Mycosphaerella musicola and Mycosphaerella fijiensis are pending publication and thus must be held in confidence until such time they appear in the public domain. Please also ensure these parameters do not appear in material including conference oral presentations and posters and funding body reports. © Copyright 2006

1

Sigatoka Leaf Spot Disease Diagnostic Manual

Updated December 2006

Contributors

Sharon Van Brunschot

André Drenth

Kathy Grice

Juliane Henderson

Julie Pattemore

Ron Peterson

Susan Porchun

2

Table of Contents

Introduction.............................................................................................................................. 3

The Banana Industry in Australia .......................................................................................... 3

Origin and Distribution of Black Sigatoka.............................................................................. 3

Black Sigatoka in Australia.................................................................................................... 6

Yellow Sigatoka..................................................................................................................... 9

Disease Symptoms................................................................................................................ 10

Black Sigatoka..................................................................................................................... 10

Yellow Sigatoka................................................................................................................... 13

Other Leaf spots.................................................................................................................. 17

The Pathogens ....................................................................................................................... 18

The Causal Agents.............................................................................................................. 18

Taxonomy of M.fijiensis and M. musicola ........................................................................... 18

Morphology ..................................................................................................................... 18

Hosts ............................................................................................................................... 21

Relative Distributions of M. fijiensis and M. musicola ......................................................... 21

Life Cycle............................................................................................................................. 21

Disease Development and Epidemiology ........................................................................... 23

Disease Cycle ..................................................................................................................... 23

Survival of the Inoculum...................................................................................................... 23

Spread of the Pathogen ...................................................................................................... 25

Disease Control ..................................................................................................................... 26

Cultural Control ................................................................................................................... 26

Chemical Control................................................................................................................. 26

Microscopic Diagnosis of Disease ...................................................................................... 28

The Pathogen...................................................................................................................... 28

Molecular Diagnosis of Disease........................................................................................... 29

Preliminary diagnosis and sampling.................................................................................... 29

DNA extraction .................................................................................................................... 29

PCR Amplification ............................................................................................................... 32

PCR analysis using gel electrophoresis.............................................................................. 40

Troubleshooting .................................................................................................................... 44

Troubleshooting Guide 1 - DNA Extraction ......................................................................... 44

Troubleshooting Guide 2 - Gel Electrophoresis .................................................................. 45

Troubleshooting Guide 3 – PCR Diagnostic Results .......................................................... 47

Limitations of the Technology ............................................................................................. 49

Sources of Reference Material ............................................................................................. 50

Fungal cultures and DNA .................................................................................................... 50

Contacts ................................................................................................................................. 51

Further Reading ..................................................................................................................... 52

Appendix ................................................................................................................................ 53

Reagents for DNA extraction............................................................................................... 53

Reagents for Agarose Gel Electrophoresis......................................................................... 54

References ............................................................................................................................. 56

3

Introduction

The Banana Industry in Australia

In 2005, the wholesale value of the Australian banana industry exceeded $320 million. More

than 80% of the 20.4 million, 13kg carton crop is produced in the wet tropics of North

Queensland, in the region between Tully and Cooktown. The remaining 20% are grown

predominantly in the subtropical regions of the eastern coast from Nambucca Heads, in New

South Wales to Nambour in Queensland. There are also small producing regions in the

Northern Territory and in Kununurra and Carnarvon in Western Australia.

Approximately 95% of bananas grown in Australia are of the Cavendish subgroup (including

the cultivars Grand Nain and Williams) with the remaining 5% comprising mainly the

Ladyfinger cultivar but also some Goldfinger, Ducasse, Sucrier, FHIA 18, Red Dacca and

Plantains. The Australian market for banana is mostly that of the fresh fruit product.

Currently the only other products made from banana fruit are the small-scale production of

banana puree, dried banana and banana wine. There is also a specialist manufacturer of

handbags from banana fibre.

Origin and Distribution of Black Sigatoka

Black Sigatoka, which is also known as black leaf streak in some parts of the world, is caused

by the fungal pathogen Mycosphaerella fijiensis (Leach 1964). Black Sigatoka affects many

Musa species throughout the world including those grown on the island of New Guinea, and

in the Torres Strait Islands (TSI).

M. fijiensis was first identified in the Sigatoka valley of Vita Levu in the Fiji Islands in 1963

(Leach 1964). Black leaf streak, as it was first known, quickly replaced Sigatoka, which was

endemic in the region at that time. Surveys of the Oceanic region from 1964 to 1967 revealed

that this new disease was already established in the Pacific and parts of the Pacific Rim.

From its wide dispersal, it appeared that M. fijiensis had been present in this region for some

time prior to its identification. The disease was found in the Philippines in 1970 but again it

appeared that it might have been present for 15 years or more prior to this. From the

examination of herbarium specimens it was concluded that M. fijiensis had been present on

the island of New Guinea since 1957 and that it had been present in Taiwan in 1927 (Stover

1978). From this work Stover concluded that the centre of origin for M. fijiensis was likely to

have been in PNG-Solomon Islands region.

The spread of M. fijiensis in the Latin Americas has been well documented as it appeared in

this region after its initial identification in Fiji in 1963. Although the pathogen may have been

4

introduced to Honduras as early as 1969, it was only positively identified there in 1972 (Stover

and Dickson 1976). It was here that the disease acquired its current name black Sigatoka.

The disease slowly moved throughout Latin America and by 1981 was endemic to Central

America. It has since moved south into Colombia, Ecuador, Peru and Bolivia. M. fijiensis has

only recently reached the Caribbean. It was first identified in Cuba in 1992 (Vidal 1992) and

more recently in Jamaica, the Dominican Republic, Trinidad, Grand Bahama Island and Haiti

(Carlier et al. 2000a) (Fortune et al. 2005; Jones 2002) (Mourichon et al. 1997). The direction

of the prevailing winds is believed to limit further spread by natural means of M. fijiensis within

the Carribean (Carlier et al. 2000a).

Although M. fijiensis may have been present in Africa as early as 1973, it was first identified in

Gabon in 1978 (Frossard 1980). It is believed that the pathogen was introduced into Africa

from infected banana plants imported from Asia. From its first introduction, it has since spread

to neighbouring countries and is now found in Cameroon, Cote d’Ivoire, the Democratic

Republic of Congo, Nigeria, and Ghana. A separate introduction is believed to have brought

the pathogen to the countries on the east coast of Africa (Carlier et al. 2000a). The disease

was first identified in this region in 1987 on the island of Pemba. The disease quickly spread

to the adjacent island of Zanzibar and from there to the mainland of Tanzania (Dabek and

Waller 1990). By 1988 it had reached Kenya (Kung'U et al. 1992). The introduction of the

disease to the East African countries of Rwanda, Burundi, (Sebasigari 1989), Uganda

(Tushemereirwe and Waller 1993) and Malawi (Ploetz et al. 1992) is however thought to have

been from the Democratic Republic of Congo (Carlier et al. 2000a). A map showing the

worldwide distribution of M. fijiensis is presented in Figure 1.

The distribution of M. fijiensis in Asia is still unclear (see section on Other Leaf Spots)

although there are several substantiated reports of this pathogen from this region. The

pathogen has been confirmed as being present in Southern China (Carlier et al. 2000a;

Mourichon and Fullerton 1990), Vietnam, Thailand, Taiwan and Singapore. Black Sigatoka

has also been confirmed as being present in parts of Malaysia; West Malaysia, Jahore,

Langkawi and East Malaysia and also as being present in parts of Indonesia, namely

Halmahera, Java, Kalimantan and West Sumatra.

5

Distribution of M. musicola.

xxxx Distribution of M. fijiensis.

● Distribution of M. eumusae.

Figure 1: World map showing the global distribution of Mycosphaerella fijiensis, Mycosphaerella musicola and Mycosphaerella eumusae.

6

Black Sigatoka in Australia

Currently, mainland Australia is a designated ‘black Sigatoka free’ region. However, there

have been nine previous incursions of the disease in North Queensland, the first detected in

1981 and the most recent incursion in 2001 in the Tully Valley. A Pest Free Area was

declared on the 20th December 2004.

Although M. fijiensis was only detected on bananas on the Torres Strait Islands during a plant

disease survey in 1981 its spread would indicate that it had been present in this region for a

considerable period of time prior to its detection. However, as no disease surveys had been

undertaken in the region prior to 1981, it cannot be certain how long the disease had been

present for. The pathogen had most likely been introduced on banana plants brought over

from Papua New Guinea where it is known to be endemic.

Black Sigatoka was also detected in Bamaga, on mainland Australia, during the 1981 disease

survey. Although the disease was widespread through the township, only 25% of plants were

infected due to the resistance of many of the banana cultivars grown. Many plants found in

Bamaga belonged to the ABB genotype. The ABB genotype contains subgroups with many

cultivars having higher resistance to M. fijiensis compared with other genotypes, such as the

AAA subgroup of which Cavendish is a member. Another factor that impeded the spread of

the disease was this region had a low density of banana plants and is situated in the dry

tropics of Australia. Without additional water and nutrients, banana plants do not grow well in

this region. As an initial measure to prevent the spread of black Sigatoka, the disease was

declared quarantinable under the Commonwealth Quarantine Act of 1908. The region was

then proclaimed a quarantine region enabling enforceable restrictions on the movement of

banana material out of the area.

Due to the proximity of this region to Queensland’s major commercial banana production

areas, the Queensland Department of Primary Industries and Fisheries (DPI&F) first

attempted eradication in October of 1981. The Commonwealth Government and Australia’s

banana growing States sponsored this eradication program. This original attempt at

eradication involved the destruction of all banana plants in the Bamaga region as well as all

banana plants on Thursday Island, Badu Island and Kubin Village on the western side of Moa

Island. Replanting was left for a period of 6 months in order to avoid reinfection from any

ascospores discharged from the banana trash. In 1984, M. fijiensis was again detected on

some banana plants during routine plant disease surveillance by the DPI&F. This time the

disease was restricted to the Bamaga area. It was not found on Thursday, Badu or Moa

Islands (Jones 1984) indicating that the eradication program on these islands had been

successful.

7

Failure of the initial eradication program in Bamaga was thought to be due to several factors.

Regrowth from eradicated plants may have provided a source of inoculum or some banana

plants may have been missed during eradication despite thorough surveys of the area.

Another possibility is that local residents may have hidden plants prior to the eradication

program and then returned them to Bamaga after the reintroduction of clean planting material,

and so providing a source of inoculum (Jones 1989). At that time it was decided not to

proceed any further with eradication attempts and the disease was instead managed and

contained in Bamaga. This was possible due to quarantine restrictions preventing the

movement of banana material out of the Torres Strait Islands and Bamaga to other parts of

Australia and also due to the remoteness and isolation of the region at the time. Trials were

undertaken in the region to evaluate the resistance of several banana cultivars to black

Sigatoka (Jones 1984). A program was also introduced during this time by the Queensland

Banana Industry Protection Board (BIPB) to replace all the bananas in the Bamaga area with

more resistant cultivars such as Bluggoe and Tu8 (Jones 1989).

In 1988, a second attempt at eradication was undertaken due to increased pressure from the

banana industry. A small commercial plantation of Cavendish bananas had been planted at

Bamaga and the access road had been upgraded leading to an increase in traffic to the

region. The industry feared that black Sigatoka would move south into the large commercial

growing regions devastating the industry. Eradication of the pathogen was effected through

the destruction of all banana plants in the area, replanting with resistant lines such as Tu8,

Bluggoe and Ducasse, and the favourable climate of a long, hot, dry season. Another

incursion in this region detected in 1999 has been linked to regrowth of plants from the 1988

eradication program and also to the importation of plants directly from Thursday Island (Davis

et al. 2000). Again, all susceptible plants were removed and buried. Black Sigatoka has not

been detected in the region since the 1999 eradication.

There have been six further small incursions since 1988 (Figure 2) all in isolated, banana

growing regions. On each occasion, officers from DPI&F have managed the eradication of the

disease by the removal and destruction of all banana plants in a buffer zone of up to a 50 km

around the site of the infection. The area was then allowed to remain free of banana plants for

at least 4 months before replanting with cultivars more resistant to black Sigatoka. Eradication

was also assisted by the natural climatic conditions. Many regions in Cape York experience

long, hot and dry seasons interspersed with a short, wet season. Banana plants do not

survive the dry season in this area without irrigation and M. fijiensis does not proliferate under

these conditions (Peterson 2002).

All of these incursions have been attributed to the movement of diseased plants between

sites of infection. The close proximity of the Torres Strait Islands to the mainland and the

strong cultural ties between various communities residing in this region suggest a logical

8

ingress for the pathogen. The initial movement of diseased banana plant material and

suckers from the Torres Strait Islands could have brought the pathogen to mainland Australia

and then the subsequent movement of planting material transported it between sites of

infection on the mainland.

The most recent and most serious of incursions was in Tully in 2001. This incursion differed

from the previous ones in two ways: (i) this incursion was in the largest commercial banana

production area in Australia and (ii) Tully has one of the highest rainfalls in Australia. The prior

eradication strategy of removing all banana plants in the region was revised as this now

involved 4400 ha of banana plants. An alternative strategy was developed which relied

heavily on deleafing of all banana plants to achieve a zero disease level in the region.

Constant surveillance also enabled scientists to monitor the disease. Diagnosis of diseased

leaf material was however more difficult than usual. Heavy rains in the area at the time had

washed away all of the fungal structures used to differentiate M. fijiensis from the endemic M.

musicola. Molecular diagnosis was a useful tool used to differentiate between the two

pathogens and was one of the many factors contributing to the success of the eradication

campaign.

Figure 2: Map of Queensland showing the locations of all Mycosphaerella fijiensis incursions

on mainland Australia since 1981. All incursions were eradicated by the Queensland

Department of Primary Industries and Fisheries (DPI&F).

9

Yellow Sigatoka

Yellow Sigatoka is caused by the fungal pathogen Mycosphaerella musicola Leach which is

closely related to M. fijiensis. The pathogen is considered to have a worldwide distribution. It

has not however been reported in the banana growing regions of the Canary Islands, Egypt

and Israel (Jones 2000) and its exact distribution through Asia is still unclear.

Stover (1962) hypothesised the mode of spread of M. musicola worldwide (Stover 1962).

Working from disease records, Stover proposed that M. musicola was moved from Java

where Zimmermann first described the anamorph of this pathogen, Pseudocercospora musae

in 1902, to Fiji on banana leaf material used as packing material in shipping containers. M.

musicola was first identified in Fiji in 1913 by Massee (Massee 1914). From here Stover

proposed that the pathogen moved to the east coast of Australia on the prevailing winds in

around 1924. At this time there was a disease epidemic in the Fijian banana plantations of the

Sigatoka Valley which was causing inoculum levels to be exceptionally high. Once in Australia

the disease quickly spread throughout banana plantations, many of which had been left

unmanaged due to the severe banana bunchy top disease (BBTD) epidemic. Stover

hypothesised that the combination of exceptionally high levels of inoculum during the

epidemic years of the late 1920s and early 1930s, coupled with unusual climatic conditions

and air turbulence, could have resulted in enough viable ascospores surviving the long

journey on the tradewinds to cause the disease outbreaks in Africa and South America.

This hypothesis was tested using RFLP markers to study the genetic structure of the global

population of M. musicola (Hayden et al. 2003). Hayden (2003) found that Stover’s hypothesis

was supported by the fact that many alleles found in the Indonesian population were detected

in the Australian, African and South American populations. The hypothesis however was not

supported when the Australian population was compared with the African and the South

American populations. Both of these populations possessed alleles not present in the

Australian population. Further, Hayden concluded from the genetic differentiation data that it

is likely that the African and South American M. musicola populations arose from the

Indonesian population in a separate founder event from that of the Australian population.

In Australia, M. musicola was found to have spread to the banana growing regions of New

South Wales by 1927 (Simmonds 1928). M. musicola is now endemic throughout all banana-

growing regions in Queensland and northern New South Wales. In Western Australia it was

first detected in Kununurra in 1990 although it is thought to have been present for some time

before this first report (Shivas and Kesavan 1992). It is now identified as a common pathogen

to the banana growing regions of the Kimberleys. The pathogen has also been detected in

banana growing regions in the Northern Territory.

10

Disease Symptoms

Black Sigatoka

Black Sigatoka causes large necrotic lesions on the leaves of the banana plant and early drop

(collapse) of the entire leaf (Figure 3). The resulting loss of photosynthetic capacity leads to

slower filling of fingers, reduced yields and finger size and premature ripening of fingers. Field

losses vary from 30-50% depending on the climatic conditions (Gauhl et al. 2000; Stover

1983) and are presently 5-10% in even well-managed plantations with good control strategies

(R. Romero, pers. comm.). In subsistence crops of plantain, yield loss has been estimated to

be up to 33% during the first crop cycle and up to 76% in the second (Mobambo et al. 1996).

(a) Photo by Juliane Henderson

(b)

CIRAD

(c) CIRAD(a) Photo by Juliane Henderson

(b)

CIRAD

(c) CIRAD

Figure 3(a): Black sigatoka infection in a managed banana plantation in Costa Rica (Photo by

Juliane Henderson), (b) heavily diseased leaf (Image courtesy of CIRAD) and (c) underside

of a diseased leaf (Image courtesy of CIRAD).

11

There are six recognised stages in symptom development (Fouré 1987; Meredith and

Lawrence 1969). A brief description of each stage follows:

Stage 1: Initially, tiny specks < 0.25 mm and white to yellowish in colour that quickly

turn a reddish brown, appear on the abaxial surface (underside) of the leaf laminar.

This first stage is also known as the ‘initial speck stage’ ).

Stage 2: The tiny reddish brown specks elongate and widen, becoming streaks

approximately 2mm X <1 mm. This stage is also referred to as the ‘initial streak

stage’. The streaks are more clearly visible on the abaxial surface of the leaf laminar

than the adaxial surface (upper side) of the leaf. Conidia and conidiophores may be

present (Figure 4(a)).

Stage 3: The streaks continue to expand in size and change colour to a very dark

brown, almost black, colour. This is also referred to as the ‘second streak stage’.

Where infection is heavy, the streaks overlap to give a black appearance to large

areas of the leaf. The streaks are clearly visible from the adaxial side of the leaf.

Conidia and conidiophores are present at this stage (Figure 4(b)).

Stage 4: The streaks continue to enlarge and become more elliptical in shape as it

broadens and a water-soaked border may develop around the edges. This stage is

known as the ‘first spot stage’ (Figure 4(c)).

Stage 5: This stage also known as the ‘second spot stage’ is characterised by the

central region of the spot becoming slightly depressed. The water soaked border

may develop a yellow halo around it. Where infection is heavy, large areas of leaf

tissue collapses. (Figure 4(d)).

Stage 6: The final stage, also referred to as the ‘third spot stage’, is when the centre

of each spot becomes dry and pale grey to beige in colour. Perithecia and

ascospores are present in stage 6 lesions. Surrounding each of the spots is a

distinctive black border. Where infection is heavy the large areas of the leaf become

necrotic. The spots remain visible even after the death and desiccation of the leaf

due to the dark border encircling each of the individual spots (Figure 4(e)).

(a)

(b)

(a)

12

Figure 4(a): Stage 2 symptoms or ‘First Streak Stage’.

Conidia and conidiophores may be present at this stage.

Note that Stage 1 symtpoms (initial speck stage) are barely

visible at <0.25mm.

Figure 4(b): Stage 3 symptoms or ‘Second Streak Stage’.

Streaks are now almost black. Conidia and conidiophores

are present.

Figure 4(c): Stage 4 symptoms or ‘First Spot Stage’. The

streaks are becoming more elliptical and have a water-

soaked border.

Figure 4(d): Stage 5 symptoms or ‘Second Spot Stage’.

Note the blackening in the centre of the spots. The water-

soaked border begins to develop a yellow halo.

Figure 4(e): Stage 5 & 6 ‘Third Mature Spot’ symptoms.

Multiple lesion stages are present. Note the pale grey

centres of the Stage 6 lesions.

Figure 4(a): Stage 2 symptoms or ‘First Streak Stage’.

Conidia and conidiophores may be present at this stage.

Note that Stage 1 symtpoms (initial speck stage) are barely

visible at <0.25mm.

Figure 4(b): Stage 3 symptoms or ‘Second Streak Stage’.

Streaks are now almost black. Conidia and conidiophores

are present.

Figure 4(c): Stage 4 symptoms or ‘First Spot Stage’. The

streaks are becoming more elliptical and have a water-

soaked border.

Figure 4(d): Stage 5 symptoms or ‘Second Spot Stage’.

Note the blackening in the centre of the spots. The water-

soaked border begins to develop a yellow halo.

Figure 4(e): Stage 5 & 6 ‘Third Mature Spot’ symptoms.

Multiple lesion stages are present. Note the pale grey

centres of the Stage 6 lesions.

Figure 4: Images of five of the six diagnostic stages of development for black Sigatoka

disease (Images reproduced with permission, Department of Primary Industries and

Fisheries, Queensland).

13

Yellow Sigatoka

Yellow Sigatoka disease is similar to black Sigatoka (Figure 5). There are, however, some

distinguishing diagnostic features for yellow Sigatoka. The disease ultimately has the same

effect on yields as black Sigatoka, although yellow Sigatoka disease development is slower,

enabling it to be controlled through deleafing and the use of fungicides.

(a)

(b)

(c)

CIRAD

(a)

(b)

(c)

CIRAD

Figure 5: (a) Banana plant infected with Mycosphaerella musicola. Note later stage lesions

are always present in the lower leaves which are older while the newer leaves show the

earlier stage symptoms. Symptom development can be used in conjunction with other tools to

assist with diagnosis. The photographs in (b) and (c) show advanced lesions on leaves.

(Images (a) & (c) reproduced with permission, Department of Primary Industries & Fisheries,

Queensland (b) courtesy of CIRAD & INIBAP)

14

Yellow Sigatoka can be differentiated from black Sigatoka at the early stages of lesion

development (Stages 1 and 2) on visual symptoms. At later stages, examination of the

conidiophores and conidia requires compound microscopy. There have been several

descriptions of the development of individual lesions of Sigatoka disease over the years which

are well summarised in Meredith (1970) (Meredith 1970). Brun’s description (Brun 1958) is

similar to that of Leach (Leach 1946) except that Brun excludes Leach’s 5th stage (second

spot stage). A brief description of each stage as per Brun follows:

Stage 1: This stage is characterised by the appearance of very small light green dots

or dashes of approximately 1 mm in length. (Figure 6(a))

Stage 2: The small dot or dash of Stage 1 elongates into a light green streak several

millimetres long. (Figure 6(b)&(c))

Stage 3: At this stage there is a change in the colour of the streak to a rusty brown.

The streak becomes elongated and widens slightly. The border of the streak is ill

defined. (Figure 6(d))

Stage 4: The streak becomes more elliptical and is a definite spot with a sunken dark

brown centre. It is often surrounded by a yellow halo. At this stage the conidia and

conidiophores are produced. (Figure 6(e))

Stage 5: The final stage has a grey dried out centre and an obvious black margin. This

black margin can still be seen even after the leaf has dried out. (Figure 6(f))

The stages of both yellow and black Sigatoka are summarised in Table 1.

15

Figure 6(a): Stage 1 lesions of yellow Sigatoka

characterised by the light green dots and dashes which are

about 1 mm in length.

Figure 6(b): Lesions associated with Stage 2a (early) of

yellow Sigatoka. Note light green streaks which are the

characteristic lesions at this stage.

Figure 6(c): Lesions associated with Stage 2b (late) of

yellow Sigatoka. Note the change in colour of the streaks

from light green to rusty brown.

Figure 6(d): Stage 3 symptoms associated with yellow

Sigatoka. Note that the streaks from stage 2 have now

elongated and widened.

Figure 6(e): Stage 4 symptoms associated with yellow

Sigatoka. Note that the Stage 3 streaks have now become

spots. Conidia and conidiophores may be present from this

stage

Figure 6(f): Stage 5 symptoms of yellow Sigatoka. Note

the dried out grey centre with the black ring outside.

Figure 6(a): Stage 1 lesions of yellow Sigatoka

characterised by the light green dots and dashes which are

about 1 mm in length.

Figure 6(b): Lesions associated with Stage 2a (early) of

yellow Sigatoka. Note light green streaks which are the

characteristic lesions at this stage.

Figure 6(c): Lesions associated with Stage 2b (late) of

yellow Sigatoka. Note the change in colour of the streaks

from light green to rusty brown.

Figure 6(d): Stage 3 symptoms associated with yellow

Sigatoka. Note that the streaks from stage 2 have now

elongated and widened.

Figure 6(e): Stage 4 symptoms associated with yellow

Sigatoka. Note that the Stage 3 streaks have now become

spots. Conidia and conidiophores may be present from this

stage

Figure 6(f): Stage 5 symptoms of yellow Sigatoka. Note

the dried out grey centre with the black ring outside.

Figure 6(a)-(f): Images of the five stages of lesion development in yellow Sigatoka.

(Images reproduced with permission, Department of Primary Industries and Fisheries,

Queensland).

16

Lesion Stage

Yellow Sigatoka

Black Sigatoka

Stage 1 Very small light green dot or dash up to 1 mm long

Small pigmented spot of white or yellow, similar to yellow Sigatoka stage 1

Stage 2 Light green streak several millimetres long

Brown streak, visible on underside of leaf, later visible on leaf upper surface as yellow streak; colour changes progressively to brown, then black on upper leaf surface

Stage 3 An elongated rusty brown spot with an poorly defined border

Enlarged stage 2, streaks become longer

Stage 4 A mature spot with a dark brown sunken centre; often surrounded by a yellow halo, conidiophores and conidia are produced at this stage

Appears on leaf underside as brown spot, as a black spot on upper leaf surface

Stage 5 Spot has developed a grey, dried out centre and a peripheral black ring which is evident even after the leaf has dried out

Elliptical spot is totally black on the underside of the leaf, surrounded by a yellow halo

Stage 6 Centre of spot dries out, turns grey and is surrounded by a well-defined margin and a bright yellow halo

Table 1: Summary of the different lesion stages associated with yellow and black

Sigatoka leaf spot diseases of banana.

17

Other Leaf spots

A third leaf spot disease, Eumusae leaf spot (Figure 7), has recently been described. This

disease is caused by the pathogen, Mycosphaerella eumusae, anamorph Pseudocercospora

eumusae which is very closely related to M. fijiensis and M.musicola (Carlier et al. 2000c;

Crous and Mourichon 2002). Distribution of this pathogen is still uncertain however originally

it was found serendipitously in Asia in West Malaysia, Thailand, Vietnam, Southern India and

Sri Lanka during a survey initiated by INIBAP to determine the distribution of M. fijiensis and

M. musicola within South and South-east Asia. Samples collected as Sigatoka leaf spots were

found to be associated with this new pathogen (Carlier et al. 2000b; Carlier et al. 2000c;

Crous and Mourichon 2002). Little is known about M. eumusae however, one isolate was

found infecting a banana known to be resistant to M. fijiensis. Morphologically it is similar to

M. musicola.

Several other leaf spot diseases may produce lesions with a similar appearance to those of

M. fijiensis and M. musicola however these other pathogens can be easily distinguished using

light microscopy as they are morphologically quite different.

Figure 7: Banana leaves with lesions associated with Eumusae leaf spot (ELS) caused by

the fungal pathogen Mycosphaerella eumusae. (Images reproduced with permission, INIBAP

& CABI, UK)

18

The Pathogens

The Causal Agents

Black Sigatoka is caused by the heterothallic ascomycetous fungi Mycosphaerella fijiensis

Morelet (anamorph Paracercospora fijiensis). Yellow Sigatoka is caused by another,

Mycosphaerella musicola Leach ex Mulder (anamorph Pseudocercospora musae). Jones

(2000) has a comprehensive chapter describing fungal leaf diseases of banana plants.

Taxonomy of M.fijiensis and M. musicola

Morphology

Although M. fijiensis and M. musicola are extremely closely related, and some stages of the

disease appear similar, the morphology of the conidia and conidiophores can be routinely

used to differentiate the two pathogens. Conidia produced by M. fijiensis are pale to medium

olive green with paler tips, 1-10 septate, obclavate to cylindro-obclavate and straight or

curved. Conidia produced by M. musicola however are a paler shade of olive green, 0-6

septate, cylindrical to obclavate-cylindrical, and also either straight or curved. The conidia of

M. fijiensis are also discernable by the thickened basal hilum at the base.

Conidiophores of Paracercospora fijiensis can be either straight or bent, are pale to medium

brown, 0-5 septate, often geniculate and are generally unbranched. A diagnostic

characteristic are the distinctive scars present on the tip of the conidiophores. Conidiophores

of P. musae differ in that they are straight, hyaline, mostly without septa, geniculation or

branching scars are not present.

Another difference between the two pathogens is the location of the conidiophores. When P.

fijiensis is the infecting pathogen they are mainly found on the abaxial surface of the leaf

whereas conidiophores of P. musae are abundant on both surfaces. Conidiophores are also

present much earlier in the lesions associated with black Sigatoka, as early as stage 2

lesions, whereas they are generally not present until the disease has progressed to stage 4

lesions for yellow Sigatoka. Images of these structures are presented in Figures 8 and 9. The

structures of Mycosphaerella eumusae are also presented in Figure 10 for comparison. The

morphology of the anamorphs of M. fijiensis and M. musicola is summarised in Table 2.

19

Figure 8 (a) Fruiting bodies of Paracercospora fijiensis found in lesions associated with black Sigatoka. Note the small number of conidia produced by these in comparison with M. musicola and M. eumusae.

Figure 8(b) Conidia produced by the fruiting bodies of Paracercospora fijiensis Note the basal thickening which is not found in Pseudocercospora musae or Pseudocercospora eumusae.

(Images courtesy of CIRAD & INIBAP)

(X 10) CIRAD (X 40) CIRAD

Figure 9 (a): Fruiting bodies of Pseudocercospora musae found in lesions associated with yellow Sigatoka disease.

Figure 9 (b): Conidia of Pseudocercospora musae. No basal thickening is present. Up to 50 conidia may be associated with a single sporodochia.

(X

CIRAD (X

CIRAD

(Images courtesy of CIRAD & INIBAP)

20

Paracercospora fijiensis

Pseudocercospora musae

Conidiophores • first appear at stage 2 or initial streak stage

• can be either straight or bent, are pale to medium brown, 0-5 septate, often geniculate, generally unbranched with distinctive, slightly thickened spore scars that are diagnostic for this pathogen

• mainly found on the abaxial surface of the leaf

• emerge singly or in small groups

• first appear at stage 4 or first spot stage

• are straight, hyaline, mostly without septa, geniculation or branching and they do not have any spore scaring

• abundant on both surfaces

Conidia • pale to medium olive green with paler tips, 1-10 septate, obclavate to cylindro-obclavate and straight or curved

• thickened basal hilum

• a paler shade of olive green, 0-6 septate, cylindrical to obclavate-cylindrical, and also either straight or curved

• no basal thickening present

Table 2: Comparison of the morphology of Paracercospora fijiensis and Pseudocercospora

musae.

Figure 10 (a): Fruiting bodies of Pseudocercospora eumusae found in lesions associated with Eumusae leaf spot. Conidiophores are found mainly on the abaxial leaf surface.

Figure 10 (b): Conidia of Pseudocercospora eumusae. Conidia are shorter (21.2-41.6 x 2.5 µm) than those of P. musae (10-109 x 2-6 µm).

(Images courtesy of CIRAD & INIBAP)

(X

(X

CIRAD CIRAD

21

Hosts

Currently the only known hosts of M. fijiensis and M. musicola are Musa spp. These species

and subspecies all vary in their levels of resistance to M. fijiensis and M. musicola. There is

one report in the literature of M. musicola having been isolated from leaf spots on a Heliconia

species in Venezuela (Madiz et al. 1991).

Relative distributions of M. fijiensis and M. musicola

M. fijiensis is found throughout the world’s tropical banana growing regions from the Tropic of

Cancer to the Tropic of Capricorn with the exception of Australia. M. musicola also causes

serious yield losses in regions not affected by black Sigatoka. As this pathogen can proliferate

at lower temperatures and lower relative humidity, M. musicola is more widespread than M.

fijiensis. Yellow Sigatoka is often the dominant disease at higher altitudes (>1200 m) although

it appears that M. fijiensis is becoming more adapted to higher altitudes and is gradually

replacing M. musicola in these regions (Carlier et al. 2000a). Figure 1 shows the worldwide

distribution of both of these pathogens.

Life Cycle

Most infections of M. fijiensis and M. musicola begin with spores being deposited on the

susceptible cigar leaf of the banana plant. Spores will germinate within 2-3 hours of being

deposited on the leaf surface if there is a water film present or if the humidity is very high. The

optimal temperature for germination of M. fijiensis spores is 27ºC. For M. musicola the optimal

temperature for germination of conidia is between 25-29ºC and for ascospores it is between

25-26ºC. The germ tube then grows epiphytically for several days (2-3 days for M. fijiensis

and 4-6 days for M. musicola) before penetrating the leaf via stomata in a hydrotropic

response through the formation of appressoria or stomatopodia over the stomata (Meredith

1970; Stover 1980).

Once inside the leaf, the infection hypha forms a large substomatal vesicle. Fine hyphae then

grow through the mesophyll layers into an air chamber and then into the palisade tissue.

From here the hyphae grow out into other air chambers eventually emerging through stomata

in the streak that has developed. Again, epiphytic growth occurs before the re-entry of the

hypha into the leaf through another stomate.

Conidia are observable from stage 2 of black Sigatoka whereas they are generally only visible

from stage 4 of yellow Sigatoka. Perithecia form during stages 5 and 6 of black Sigatoka and

during stage 5 of yellow Sigatoka. Overall the disease cycle is much faster for M. fijiensis than

for M. musicola due to shorter time required to complete the life cycle. Generally, it has been

observed, the optimal conditions for M. fijiensis are those where there is, on average, higher

temperatures and higher relative humidity. See Table 2 for the disease development and

associated structures found during the disease cycle for each of these pathogens.

22

Comprehensive cytological studies of the interactions between M. fijiensis and three banana

genotypes have been undertaken (Beveraggi et al. 1995) (Sallé et al. 1989). From these

studies it was found that there is a relatively long period of biotrophy before any incompatible

reactions are observed in susceptible cultivars. The pathogen colonises the leaf tissue,

growing intercellularly without the production of haustoria, for almost a month. During this

period, little evidence of the presence of the pathogen can be seen externally. Cytological

changes are visible in the parenchyma cells after about 28 days although the cells still appear

healthy. There is contact between the hyphae and the cells but no localised reaction.

Externally, stage 2 or the initial streak stage symptoms are visible.

After 41 days, stage 5 or second spot stage symptoms are visible externally. In the tissue

sections taken from the susceptible cultivar ‘Grande Naine’ at this time during the studies,

three distinctive zones were seen. Zone I which corresponded to the cells within the necrotic

spot contained plasmolysed cells. Zone II corresponded to the yellow halo and this region

contained cells with large intracellular globules. At the boundary of Zones II & III an

intercellular substance, later identified as polyphenol, was noted. This substance formed

intercellular bridges and host cells in contact with it showed degeneration of the cell wall.

Beyond this boundary the remaining host cells in Zone III appeared to be healthy. Hyphae

were observed throughout the intercellular spaces in all of the zones (Sallé et al. 1989).

Importantly, haustoria were never observed during the invasion of any host by M. fijiensis.

The progression of the disease was similar in the partially resistant cultivar, ‘Fougamou’,

except that the growth rate of hyphae in the susceptible cultivar was much higher than in the

partially resistant cultivar (Beveraggi et al. 1995; Sallé et al. 1989). In the highly resistant

cultivar, ‘Yangambi Km5’, a compatible reaction was not observed. There was no biotrophic

period; rather fungal growth was blocked at the site of penetration. Stomatal guard cells

became necrotic and there was a deposition of polyphenolic substances around the outside of

the cell walls of the host and the pathogen. This is consistent with a hypersensitive response

(Beveraggi et al. 1995; Sallé et al. 1989).

23

Disease Development and Epidemiology

Disease Cycle

The disease cycle for both M. fijiensis and M. musicola is similar with only minor differences

as outlined previously. As M. fijiensis produces considerably less conidia and for a shorter

period of time than M. musicola, ascospores are the main dispersal agent for this pathogen

(Stover 1980). Both conidia and ascospores are important for dispersal of M. musicola

(Stover 1971) however for both pathogens ascospores are involved in the movement of the

pathogen over longer distances rather than conidia. A distinctive line spotting pattern of

infection is produced when the source of inoculum is conidia dislodged by rain splashes.

These run down the inside of the cigar leaf cylinder contacting the lower point of the cylinder

resulting in a line of infection. The deposition of ascospores by wind currents is generally on

the terminal end of these leaves resulting in a distinctive leaf tip infection (Meredith 1970;

Stover 1972).

The disease cycle is much faster for black Sigatoka than it is for yellow Sigatoka, as seen by

the earlier appearance of spots. Inoculation studies conducted in Honduras demonstrated that

spotting associated with M. fijiensis infections appeared 8-10 days faster than that associated

with M. musicola infections. Ascospore maturation time is also shorter at 2 weeks for M.

fijiensis compared with 4 weeks for M. musicola (Stover 1980). A diagrammatic

representation of the disease cycle for M. musicola is presented in Figure 11.

Survival of the Inoculum

Production of perithecia and the subsequent discharge of ascospores continues for several

months. Even in severely necrotic tissue, ascospore ejection can continue for more than two

months, this is the case also where the leaf has been removed and placed on the ground

(Carlier et al. 2000a). Ascospore release remains high for three weeks after removal of the

leaf from the plant and then decreased rapidly over the next six weeks until the tenth week

when the leaves themselves had disintegrated (Gauhl 1994). The survival of ascospores is

directly related to the time it takes for the disintegration of the diseased leaf material (Stover

1980). Ascospores ejected are no longer viable after 6 hours of exposure to UV radiation

(Parnell et al. 1998).

24

Figure 11: Life cycle of Mycosphaerella musicola, the fungal pathogen causing yellow

Sigatoka (Reproduced with permission, Department of Primary Industries & Fisheries,

Queensland).

25

Spread of the Pathogen

Both M. musicola and M. fijiensis are dispersed within banana blocks by rain splash of

conidia. Movement between blocks is possible through the aerial spread of ascospores

ejected from the perithecia. Due to the larger amount of conidia produced by M. musicola

than by M. fijiensis, conidia are considered the main means of spread for M. musicola while

ascospores are the main method of dispersal of M. fijiensis (Stover and Dickson 1976).

Long distance spread may also be via the wind dispersal of ascospores. The short time that

ejected ascospores can survive UV irradiation suggests that the distance viable ascospores

are dispersed by this method will also be affected by the amount of cloud cover and the

distance travelled through the night (Parnell et al. 1998). Recent population studies of both M.

fijiensis (Rivas et al. 2004) and M. musicola (Hayden et al. 2005) however, suggest limited

long distance dispersal—less than 50 m—of these pathogens based on the genetic structure

of the populations. In many cases long distance movement, especially intercontinental

movement, of the pathogen is thought to be more likely due to the direct transportation of

germplasm from an infected area to a new region (Rivas et al. 2004).

26

Disease Control

Control of black and yellow Sigatoka can be carried out in a number of ways including

removal of infected leaf area, chemical control or the use of more resistant varieties.

Cultural Control

To reduce inoculum levels in plantations it is extremely important to remove any leaves with

lesions from the plant. Lesions associated with M. fijiensis infections contain perithecia that

continue to produce and eject ascospores for several months. This time can be decreased

significantly if infected leaves are removed from the plant and placed on the ground enabling

them to degenerate faster.

Another factor that can be manipulated, to some degree, is that of relative humidity. The use

of an efficient drainage system within plantations can assist with reducing the relative

humidity by removing excess groundwater and rainwater as quickly as possible. Where

irrigation of plantations is required, the use of drippers or under plant systems prevents

humidity in the canopy from rising to levels favourable for germination of ascospores. For this

reason, the planting density can also affect the spread of disease.

Chemical Control

In regions where M. fijiensis is endemic, chemical control of this pathogen also effectively

controls M. musicola. Unfortunately, the converse is not true.

The fungicides used in the control of black and yellow Sigatoka fall into three categories:

(i) protectant fungicides,

(ii) systemic fungicides, and

(iii) oil.

Protectant fungicides do not penetrate the leaf surface and are broad-spectrum fungicides.

The fungicidal action occurs on the leaf surface and so is used at early stages of infection or

as a preventative. It is the result of a reaction of the fungicide with essential enzymes

containing thiol groups which produces a non-selective toxicity. The protectant fungicides

used to control yellow Sigatoka in Australia are dithiocarbamates and in particular are

formulations of mancozeb a compound made of zinc and magnesium salts and ethylene

bisdithiocarbamate. In Australia these fungicides are generally applied with the addition of oil.

Systemic fungicides do penetrate the leaf surface and so they are used after infections have

taken place—up to stage 3 lesions. Systemic fungicides used in Australia are from the triazole

group. These compounds inhibit a cytochrome P-450 mono-oxygenase enzyme. This

enzyme catalyses the C-14 demethylation reaction which is part of the ergosterol biosynthesis

27

pathway. This group of fungicides are generally referred to as demethylation inhibitors (DMI).

The fungicides Bumper® 250 EC, and Tilt® 250 EC (both propiconazoles); Folicur® 430 EC

(a tebuconazole); Opus® 75 (epoxiconazole) and Score® (difenoconazole) are registered for

use on bananas in Australia.

The third group, oils, are also widely used fungicides and are generally applied with both

protectant and systemic fungicides. It is still unclear how petroleum oils work as fungicides. In

vitro experiments on M. musicola showed that the oil had no effect on the growth of the

fungus. It is thought that the oil may act by stimulating the plants own defence responses.

Care has to be taken though when using oil in spraying programs as it can build up on the

leaf surface resulting in reduced gaseous exchange and photosynthesis leading to a potential

decrease in yield.

In some regions of the world a disease forecasting system is used to assist with managing the

effective use of fungicides. The system is based on the monitoring of plantation disease levels

together with rainfall, temperature and relative humidity. The rationale for the use of this

system is that it enables plantation managers to time fungicide applications by predicting the

optimal time for spraying in an effort to reduce the amount of chemicals required to control the

disease. This is important in regions where the crop is grown as a staple as it reduces the

cost of production. However it has also been adopted in some banana growing regions in an

effort to prevent fungicide resistance developing in local populations of M. fijiensis. This

method has been used successfully in French Antilles for the management of Sigatoka

disease and in Cameroon for black Sigatoka. It has not been as successful though in Central

America possibly due to the more favourable climatic conditions which enable M.fijiensis

populations to proliferate at a much faster rate and thus increasing the number of sexual

cycles attained over a given period of time. This leads to an increase in the amount of

recombination in the population providing a higher potential for resistance to develop.

28

Microscopic Diagnosis of Disease

It is difficult for the less experienced plant pathologist to confidently identify black or yellow

Sigatoka based on leaf spot symptoms alone. In fact there are several diseases that can, at

different stages and under certain conditions, appear to be identical. The development and

appearance of symptoms can differ for each of the Sigatoka diseases as a consequence of

various biotic and abiotic factors such as the prevailing weather conditions, nutritional state of

the plant and inoculum levels present. They will also vary due to the different levels of

resistance among different cultivars of Musa spp. These differences are used to classify

banana cultivars into resistance groupings.

A preliminary diagnosis can sometimes be made based on the leaf spot symptoms. When

used in conjunction with light microscopy a definitive diagnosis can generally be made.

Microscopy is therefore an indispensable tool in the diagnosis of these pathogens. Although

morphologically these two pathogens are very similar, there are some small but significant

differences between them. Generally, these differences can be observed on microscope

slides prepared directly from the diseased leaf tissue.

Leaf tissue with suspected early stage Sigatoka leaf spot lesions should be incubated

overnight at 100% relative humidity at around 25ºC. Generally the samples will already be

contained inside a sealed plastic bag from collection which achieves this high humidity

without additional incubation. The high humidity will ensure a profusion of conidia and

conidiophores for identification. As noted previously, conidia are present much earlier in M.

fijiensis infections and can be observed as early as stage 2 lesions whereas conidia can only

be seen from stage 4 lesions in M. musicola infections.

The Pathogen

Images of the identifying structures (conidiophores and sporodochia) are presented in Figures

8 and 9. Note the scaring and basal thickening in the conidiophores of M. fjiensis. Images of

the closely related M. eumusae are presented as well for comparison (Figure 10).

29

Molecular Diagnosis of Disease

Preliminary diagnosis and sampling

Sections of banana leaves showing disease are inspected for symptoms and a preliminary

diagnosis made where possible based on lesion appearance. When conidia are present,

morphological identifications are made. In the absence of conidia, ascospores may be used to

produce conidia in culture. If a positive diagnosis cannot be made using symptomology and

conidial morphology, molecular diagnosis using gel-based PCR, is carried out as below.

DNA extraction

DNA is extracted directly from leaf tissue using a modified method of Stewart, C. N. and Via,

L. E. (1993) “A rapid CTAB DNA isolation technique useful for RAPD fingerprinting and other

PCR applications”. BioTechniques 14(5): 748-750

Consumables and equipment

Item Ordering Information

Pipettes: P20, P200, P1000 Pipetman P20, P100, P200

John Morris Scientific

www.johnmorris.com.au

Sterile 1.5mL microfuge tubes Quantum 1.5mL Microtubes (500)

Quantum Scientific P/L

www.quantum-scientific.com.au

Catalogue No. QSP505

Sterile plastic micropestles

Kontes 1.5mL Pellet Pestles (100)

Quantum Scientific P/L

www.quantum-scientific.com.au

Catalogue No. 749521-1500

Aerosol Resistant (plugged) tips Axygen Maximum Recovery, racked and pre-sterilised

Quantum Scientific P/L

www.quantum-scientific.com.au

TF-20-L-R-S (suits P20)

TF-200-L-R-S (suits P200)

TF-1000-L-R-S (suits P1000)

Microcentrifuge (24-well)

30

Cork Borer (5mm, ethanol sterilisable)

Gas flame

Heating waterbath (set to 70ºC)

Small liquid nitrogen dewar/flask

Bench top shaking platform or similar

Reagents

Liquid nitrogen

CTAB Extraction Buffer (2% w/v N-cetyl-NNN-trimethyl ammonium bromide, 1.42M NaCl, 20mM EDTA, 100mM Tris-HCl (pH8.0), 2% polyvinylpyrrolidone (PVP-40), 5mM ascorbic acid, 4mM diethyldithiocarbamic acid (DIECA)

See appendix for extraction buffer preparation details

β-mercaptoethanol

Chloroform-isoamyl alcohol (24:1)

Isopropanol (100%)

Sterile dH2O

Sterile, acid-washed sand

Notes

• DNA extraction should be carried out in an area which is physically separated

from areas used for PCR preparation and PCR analysis, using equipment

dedicated to extraction only

• Pre-warm extraction buffer at 70ºC

• Pipetting for steps 4-7 should be carried out in a fume cupboard

31

Procedure

1. Using a 5mm cork borer, excise 8-15 discs (approximately 50mg) from fungal leaf

spot lesions on banana leaves

2. Place the excised leaf discs into a sterile microfuge tube. Samples may be stored at

4ºC or –20ºC until ready to extract

3. Dip microfuge tube in liquid nitrogen and then homogenise using a micropestle

(Alternative method available, see note below ♦). A small amount of sterile, acid-

washed sand may be used to aid grinding. Complete homogenisation is not

necessary

4. Add 600µL of pre-warmed N-cetyl-NNN-trimethyl ammonium bromide (CTAB)

extraction buffer (70ºC) and 3µL β-mercaptoethanol to the microfuge tube and

continue homogenisation to emulsify

5. Add 500µL chloroform-isoamyl alcohol (24:1) and shake homogenate at room

temperature for 5 min on a shaking platform set to 500rpm

6. Centrifuge at 1000g for 5 min at room temperature

7. Transfer the aqueous phase to a fresh microfuge tube and add 0.7 X volume of 100%

isopropanol (approximately 350µL)

8. Mix by inversion and incubate at room temperature for 5 min

9. Centrifuge at 14000g in a benchtop microfuge for 20 min at room temperature

10. Draw off the supernatant using a pipette tip and discard. Air dry the pellet for

approximately 15-20 min, taking care not to over dry. When no traces of isopropanol

can be detected, resuspend in 100µL sterile water

♦ Alternative homogenisation method

1. If available, a Fastprep FP120 machine (Bio101) or similar apparatus, can be used to

homogenise the sample. This is extremely beneficial if large numbers of samples are

being extracted. For this method the leaf discs are placed in a 2mL screw top tube

with O-ring together with approximately 250mg of 1.5–2.5 mm glass beads

2. Add 600µL of pre-warmed CTAB extraction buffer (70ºC) and 3µL β-mercaptoethanol

to the tube

3. Process at 4 m/sec (speed 4) for 45 seconds, using the Fastprep FP120 machine

(Bio101)

4. Continue as above from step 5

32

PCR Amplification

Background: The Sigatoka PCR diagnostic assay design

The Sigatoka PCR assay is designed to amplify specific sections of the ribosomal DNA of M.

fijiensis and M. musicola. Using this region allows good species differentiation as well as good

sensitivity as ribosomal DNA is present in high copy number in the pathogen genome.

Specificity of the PCR assays have been achieved using sequence polymorphisms in the

internal transcribed spacer (ITS) regions; the black Sigatoka diagnostic primer (MFfor) is

designed to the ITS1 region, while the yellow Sigatoka diagnostic primer (MMfor) is designed

to the ITS2 region (Figure 12). Using different regions of the ITS for detection of yellow and

black Sigatoka also introduces a size differential between the PCR products. This allows

quicker identification of the result and serves as an assay control in the laboratory.

The reverse primers for both the yellow and black Sigatoka assays are located in the 26S

ribosomal gene region. For the yellow Sigatoka assay, the forward primer (MMfor) is paired

with the universal reverse primer R635 (Liu et al., 1991) to amplify a PCR product of size

approximately 650 bp. In the black Sigatoka assay, the forward primer (MFfor) is paired with a

modified version of the universal reverse primer R635 to amplify a PCR product of size

approximately 1000bp. The modified reverse primer (R635-mod) was produced by shortening

R635 by two bases at the 3’end. This allows more efficient amplification of black Sigatoka

when used in a PCR with primer MFfor.

18S (partial) 5.8S 26S (partial) ITS2 ITS1

MMfor R635

MFfor R635mod

Yellow Sigatoka ∼650bp

Black Sigatoka ∼1000bp

Figure 12: Primer map showing the location of Sigatoka diagnostic

primers in the ITS regions and the expected sizes of the PCR products.

33

The Banana Internal Control Assay

To avoid potential false negative results, an internal control PCR assay has been developed

to the banana DNA in the extract. A primer pair (MWPL1-110 and MWPL1-197) has been

designed to amplify a 180 base pair fragment of the putative banana pectate lyase encoding

gene (MWPL1) isolated from Musa acuminata cv Williams. This is a single copy gene which is

differentially expressed in ripening fruit. Our research has demonstrated that this band can be

amplified in all tissue types from a wide range of cultivars within the genotypes AA, AB, AAB,

ABB, AAA, AAAA and BB.

The internal control reactions should be set up in parallel with the diagnostic assays. For each

sample to be tested, an internal control assay should be included.

PCR Primer Sequences

Target Primer Name (direction) Sequence (5’→3’)

M. fijiensis MFFor (forward) CGGAGGCCGTCTAAACACT

M. fijiensis R635-mod (reverse) GGTCCGTGTTTCAAGAC

M. musicola MMFor (forward) CCGCGGCCGTTAAATCTTCAAA

M. musicola R635 (Liu et al., 1991) GGTCCGTGTTTCAAGACGG

Banana Internal Control

MWPL1-110 (forward) GTCCGCGACCCTGAATTAGTAGT

Banana Internal Control

MWPL1-197 (reverse) CGGTGCCGCATGACAAG

Consumables and equipment

Item Ordering Information

Pipettes: P2, P20, P200, P1000 Pipetman P2, P20, P100, P200

John Morris Scientific

www.johnmorris.com.au

Aerosol Resistant (plugged) tips Axygen Maximum Recovery, racked and pre-sterilised

Quantum Scientific P/L

www.quantum-scientific.com.au

TF-300-L-R-S (suits P2)

34

TF-20-L-R-S (suits P20)

TF-200-L-R-S (suits P200)

TF-1000-L-R-S (suits P1000)

Sterile 1.5mL microfuge tubes Quantum 1.5mL Microtubes (500)

Quantum Scientific P/L

www.quantum-scientific.com.au

Catalogue No. QSP505

PCR Strip tubes with attached lids PCR 8-strip tubes (120 strips)

www.eppendorf.com.au

Catalogue No. 0030 124.359

PCR rack

Microcentrifuge

Capsulefuge (suit 8-strip PCR tubes)

96-well, 0.5mL plate format PCR Thermal Cycler. The Sigatoka assay was optimised on a MJ Research PTC-100 but most brands should be suitable

MJ Research PTC-100

Geneworks

www.geneworks.com.au

Call for specs and quote

Reagents

Item Ordering Information

Taq DNA polymerase, enzyme buffer and MgCl2

AmpliTaq Gold DNA Polymerase with Buffer II and MgCl2 (250 U)

Applied Biosystems

www.appliedbiosystems.com.au

Catalogue No. N8080241

dNTPs (set of dATP, dCTP, dGTP, dTTP) dNTP Set (40µmol or 100mM each)

Promega

www.promega.com.au

Catalogue No. U1240

Sterile water Millipore® or injectable grade

PCR primers 40nmol scale, HPLC-purified grade

www.geneworks.com.au

35

Preparation and storage of PCR stocks

Reagent Details

Sterile water • Obtain injectable water

• Store in sterile vials at room temp

10X Buffer II • Supplied with enzyme

• Aliquot on first thaw and be sure to mix well before using

• Store –20ºC

MgCl2 • Supplied with enzyme

• Aliquot on first thaw and mix well before using

• Store –20ºC

dNTP mix • Purchased as individual stocks of dATP, dCTP, dGTP and dTTP at 100mM

• Take 10µL of each into 460µL sterile water to give a final working solution of 2mM each dNTP

• Store aliquotted at –20ºC and avoid multiple freeze/thaws where possible

Primer stocks • Resuspend lyophilised pellet to 100µM

• To prepare a 20µM working solution, dilute 1:5 in sterile water and store aliquotted at –20ºC

• Do not dilute all stock as primers are more stable at higher concentrations

AmpliTaq Gold DNA Polymerase (250U) • Supplied at 5 U/µL, use 0.2µL (1U) per reaction

• Store at –20ºC in a cyclic defrost freezer

36

Notes

• PCR set-up should be carried out in a designated, “PCR-clean” area, using

dedicated equipment. A PCR-clean laboratory coat should be worn. No

movement of equipment or reagents should occur between set-up and

processing of PCR products, excepting prepared reactions which may travel one-

way to the template addition laboratory. Backwards movement of racks between

the template addition area to the PCR preparation area must be avoided.

• Internal control PCRs must be set up in parallel with diagnostic samples for

quality control.

• It is recommended to only set-up one PCR experiment per day. PCR set-up

should never directly follow handling of PCR products.

• Reagents, except Taq DNA polymerase, should be thoroughly thawed, mixed and

pulse-centrifuged to collect contents at the bottom of the tube.

• Preparation of mastermixes is recommended when multiple samples are to be

analysed; this permits standardisation of reagents across the tubes and

minimises pipetting errors. When preparing mastermixes, include two extra tubes

for positive and negative PCR controls. Also, allow extra tubes (usually 10% of

the number being tested, ie. 20 samples + 2 extra) to account for losses due to

pipetting errors caused by tip retention during aliquotting.

37

PCR set-up Procedure

1. In a sterile microfuge tube, prepare mastermixes for each of the black and yellow

Sigatoka assays by adding the reagents in the order they appear in the table below.

Reagent amounts are for a single reaction of final volume 25µL, allowing for addition

of 1µL DNA template or 1µL sterile water as a negative PCR control. At the same

time as you are setting up the diagnostic assays, ensure that a separate

internal control assay is set up for each sample being screened

Sigatoka Diagnostic PCR Set-up

Reagent Final Concentration

M. musicola

(Yellow Sigatoka)

M. fijiensis

(Black Sigatoka)

Sterile water 15.55µL 15.55µL

10X PCR Buffer II 1X 2.5µL 2.5µL

MgCl2 (25mM) 3mM 3µL 3µL

dNTPs (2mM) 100µM 1.25µL 1.25µL

Primer MMfor (20µM) 0.6µM 0.75µL -

Primer R635 (20µM) 0.6µM 0.75µL -

Primer MFFor (20µM) 0.6µM - 0.75µL

Primer R635-mod (20uM) 0.6µM - 0.75µL

TaqGold DNA Polymerase

(5U/µL)

1U 0.2µL 0.2µL

TOTAL 24µL 24µL

38

Banana Internal Control PCR Set-up

Reagent Final Concentration Banana Internal Control

Sterile water 15µL

10X PCR Buffer II 1X 2.5µL

MgCl2 (25mM) 3mM 3µL

dNTPs (2mM) 200µM 2.5µL

Primer MWPL1-110 (20µM) 0.3µM 0.4µL

Primer MWPL1-197 (20µM) 0.3µM 0.4µL

TaqGold DNA Polymerase

(5U/µL)

1U 0.2µL

TOTAL 24µL

2. Aliquot 24µL to PCR 8-strip tubes. Add 1µL of sterile water to the negative control

tube. To ensure a reliable control against contamination during mastermix

preparation, the negative control tube must remain closed from this point until post-

PCR analysis.

3. Transfer the tubes to the template addition section. Where possible, racks should not

be removed from the PCR clean section. If this cannot be avoided, the tubes should

be transferred to another rack before template addition and the “template-free” rack

returned to the PCR clean laboratory immediately.

4. Using filter tips, add 1µL template DNA (from a 1:100 dilution of extract) to individual

PCR tubes. The use of plugged tips at template addition ensures the source of the

DNA being tested and prevents cross-contamination from pipette barrels. Open only

one PCR tube at a time and close the lid immediately following template addition. Add

1µL of positive control DNA to the last tube.

Important: take care to prevent cross-contamination between template tubes and

PCR tubes. Opening template tubes with the left-hand and opening PCR tubes with

the right hand is good practice in preventing cross-contamination of samples.

5. Pulse-spin the PCR strip-tubes using a capsule microcentrifuge to collect the DNA

template at the bottom of the tube with the PCR reagents.

39

6. Proceed to PCR thermal cycling or store reactions at 4ºC until ready. Following

storage at 4ºC, condensation will form on the lid of the PCR tubes and another pulse

spin will be necessary.

PCR thermal cycling Procedure

1. Programming should be carried out in a 96-well plate thermal cycler with a hot-lid

attachment. If a hot-lid cycler is not available, add 20µL of sterile paraffin oil to each

reaction (in the PCR clean room, before proceeding to template addition) to prevent

evaporation of reagents during cycling.

2. Thermal cycling:

Yellow Sigatoka Diagnostic PCR

Step Temperature Time (minutes:seconds)

1 94°C 10:00

2 94°C 0:20

3 65°C 0:30 72ºC 0:30

4 Go to step 2, 39 more times

5 72°C 3:00

6 4°C 5:00 7 End

Black Sigatoka Diagnostic PCR

Step Temperature Time (minutes:seconds)

1 94°C 10:00

2 94°C 0:20 3 64°C 0:30

72ºC 1:00

4 Go to step 2, 39 more times

5 72°C 3:00

6 4°C 5:00 7 End

Banana Internal Control PCR

Step Temperature Time (minutes:seconds)

1 94°C 10:00

2 94°C 0:20 3 60°C 0:30

72ºC 0:30 4 Go to step 2, 39 more times

5 72°C 2:00 6 4°C 5:00 7 End

3. Reactions may be stored at 4ºC until ready to be analysed by gel electrophoresis

40

PCR analysis using gel electrophoresis

Consumables and equipment

Item Ordering Information

Pipette: P20 Pipetman 20

John Morris Scientific

www.johnmorris.com.au

Pipette tips Gel loading tip

Quantum Scientific P/L

www.quantum-scientific.com.au

Catalogue No. QSP-010 (1000, bagged, unsterilised)

Catalogue No. QSP-010-R204 (1020, racked, unsterilised)

Nunc Microwell Minitrays HLA Plate 60-well

Medos

www.medos.com.au

Catalogue No. NUN4-52256

Capsulefuge (suit 8-strip PCR tubes)

Gel-electrophoresis set-up (eg. BioRad Sub-Cell GT)

20 well combs (up to 4 combs depending on throughput required)

Reagents

Item Ordering Information

Agarose Agarose I (Biotechnology Grade; DNase, RNase, Protease Free) 500 g

Astral Scientific P/L

www.astralscientific.com.au

Catalogue No. AM0710

DNA marker and 6X Gel loading buffer GenerulerTM

100bp Ladder Plus (0.05mg) supplied with 1mL 6X Loading Dye Solution

MBI Fermentas

www.fermentas.com

41

Catalogue No. SM0321

Tris-Borate EDTA Running Buffer (10X) TBE Buffer 10X Liquid (4L)

Astral Scientific P/L

www.astralscientific.com.au

Catalogue No. AM0658

Ethidium bromide Ethidium Bromide (10mg/mL)

Astral Scientific P/L

www.astralscientific.com.au

Catalogue No. AME406

Notes

• A set of pipettes must be dedicated only to gel analysis. Amplified (PCR) product

poses the highest risk of contamination of any template

• Gel-electrophoresis and preparation of PCR products for analysis must be kept

separate at all times from areas used for DNA extraction and PCR set-up

• Visualisation of PCR products using ethidium bromide (EtBr) may be carried out

by post-staining or by running EtBr in the gel. Protocols for both options are

presented here

• CAUTION: Ethidium Bromide is a powerful mutagen, and possible carcinogen

and teratogen. Refer to MSDS data sheets and safety information on the correct

handling of EtBr before proceeding

Gel electrophoresis Procedure

1. Prepare a 1.5% agarose gel in 0.5X TBE. A gel with 20-wells is sufficient to run 16

samples, positive and negative PCR reactions and two molecular weight markers. If

required, EtBr can be included in the gel; add 5 µL of a 10mg/mL solution to 100mL

(final concentration of 0.5µg/mL).

2. While the gel is setting, prepare the PCR products for analysis. To 5µL of PCR

product add 1µL of 6X gel loading buffer. Prepare enough molecular weight marker

for two wells by adding 2µL (500ng) of GenerulerTM

100 bp Ladder Plus, 8µL sterile

distilled water and 2µL 6X gel loading buffer.

3. Place the set gel into the buffer tank and cover with 0.5X TBE running buffer before

removing the gel comb.

42

4. Load the samples (6µL) onto the gel in the following order: DNA marker, negative

PCR control, test samples, positive PCR control, DNA marker.

5. Run the gel at 6V/cm until the bromophenol blue dye is three quarters along the

length of the gel.

6. If EtBr has not been run in the gel, post-stain in water containing EtBr at (0.5µg/mL)

for 20 min. If necessary, destain in water for 10-15 min.

Results Interpretation

a. Sigatoka Diagnostic PCR

A sample is positive for yellow Sigatoka if a PCR product of approximately 650bp is visible.

Size can be estimated by comparison to bands of similar size in the DNA molecular marker

lane. To control against cross-contamination and false positive results, the negative PCR

control should not have amplified (no band present). As a control for the efficiency of the

yellow Sigatoka PCR, a band of approximately 650 bp should be present in the positive

control lane.

A sample is positive for black Sigatoka if a PCR product of approximately 1000bp is visible.

Size can be estimated by comparison to bands of similar size in the DNA molecular marker

lane. To control against cross-contamination and false positive results, the negative PCR

control should not have amplified (no band present). As a control for the efficiency of the

black Sigatoka PCR, a band of 1000bp should be present in the positive control lane.

b. Banana Internal Control PCR

The results of the Sigatoka assays can be accepted as correct if a 180bp band is visualised

for each sample tested. If no band is present from the internal control PCR reactions then

refer to the trouble shooting guide and reprocess the sample. Figure 13 illustrates typical

amplification results for the yellow and black Sigatoka PCR assays, and the banana internal

control. Extraction buffer controls are useful when a new batch of buffer has been prepared to

demonstrate the batch as template-free.

43

Figure 13. Typical amplification products for the yellow and black Sigatoka diagnostic PCR assays, including banana internal controls.

Lane 1: 500 ng GeneRulerTM

100 bp Ladder Plus; Lanes 2-5: Yellow Sigatoka diagnostic assay (–‘ve PCR control; extraction buffer control; banana with severe mixed yellow & black Sigatoka infection; banana with early black Sigatoka infection); Lanes 6-9: Black Sigatoka diagnostic assay (-‘ve PCR control; extraction buffer control; banana with severe mixed yellow and black Sigatoka infection, banana with early black Sigatoka infection); Lanes 10-13: Banana internal control assay (-‘ve PCR control; extraction buffer control; banana with severe mixed yellow and black Sigatoka infection, banana with early black Sigatoka infection); Lane 14: 500ng MassRuler

TM

DNA Ladder.

1 2 3 4 5 6 7 8 9 10 11 12 13 14

M M YS BS BIC

1000bp

650bp

180bp

44

Troubleshooting

Troubleshooting Guide 1 - DNA Extraction

Problem Possible Causes Suggestions

No DNA pellet at extraction end • Not enough sample tissue

• Sample has not been macerated enough

• Extraction buffer has not been made up correctly

• Pellet is lost after decanting off liquids after centrifugation steps

• Failure to add isopropanol

• Use 50mg plant material

• Add a small amount of sterile sand to facilitate homogenisation

• Check buffer preparation and/or remake

• Use a pipette to remove supernatant

Gelatinous-like material present in the DNA pellet

• Excess polysaccharide in the sample • A 1:100 dilution of the resuspended sample should dilute out possible PCR inhibitors

Coloured DNA pellet • Tannins present in sample

• Commonly found when extracting from necrotic lesions (usually of no consequence)

• A 1:100 dilution usually amplifies well in PCR despite the extract colour

Difficulty resuspending DNA pellet • Accumulation of salts, polysaccharides and other insoluble contaminants in the plant tissue

• Overdrying of pellet

• Avoid using a desiccator; 15-30 min drying on the bench top is often sufficient

• Complete resuspension is not always necessary for diagnostic screening

• Incubating the sample at 55ºC for 60 min may improve solubility

45

Troubleshooting Guide 2 - Gel Electrophoresis

Problem

Possible Causes

Suggestions

Sample escapes from bottom of the wells • Gel comb height set too low on adjustable comb holders

• Bottom of the well pierced with a tip during loading

• Gel not set when comb removed

• Check comb height is 2-3mm above tray before pouring gel

• Do not place tip low into well when loading

• Wait until gel is set before removing comb (15-20 min)

Samples have run backwards • Electrodes or gel tank lid has been fitted backwards (possible on older gel rigs)

• DNA samples are –‘ve charged and so must always run from the black (-‘ve) cathode to the red (+’ve) anode

Samples have not run out of well • Power pack failure

• Incorrect fitting of electrodes or tank lid

• Always check for voltage by looking for bubbles rising from cathode

• Check current (should be 40-50 mA at 100V)

• Ensure correct dilution of TBE is used in the agarose gel and tank

Gel bands wavy, fuzzy or absent • Incorrect concentration of TBE buffer in gel or tank

• Water used instead of TBE (common error)

• Air bubble in agarose gel

• Incomplete dissolving of agarose before pouring gel

• Ensure correct dilution of TBE is used in the agarose gel and tank

• Take care to remove air bubbles before gel begins to set

• Ensure all agarose is dissolved before cooling and pouring gel

Sample flows up and out of well • Insufficient glycerol or sucrose in gel loading buffer (GLB)

• Check concentration of sucrose/glycerol in loading buffer or use commercially prepared

46

• Too little GLB added to sample

• Air bubble in gel loading tip

• Sample loaded too fast

• Sample well too shallow for volume added

loading buffer

• Add GLB: sample in 1:6 ratio

• Check pipetting technique

• Check height that gel comb is set at

No bands visible on agarose gel when viewed under UV light (including molecular weight markers)

• Incorrect concentration of EtBr added to gel

• Post-staining EtBr solution old

• Check concentration of EtBr added to gel

• Post-stain in newly prepared EtBr solution

Uneven EtBr staining of gel (seen as patchiness or regions of intense fluorescence)

• EtBr added to agarose was not mixed properly

• Post-staining with multiple gels in the tank does not allow good contact with the solution

• Swirl EtBr through cooled agarose (60ºC) before pouring gel

• Do not overload post-stain tank with many gels

• Destain with water and restain with fresh EtBr

47

Troubleshooting Guide 3 – PCR Diagnostic Results

Problem

Possible Causes

Suggestions

Failed positive control reaction

• Degraded DNA template

• Inhibitors in DNA template

• Too high or too low DNA template concentration

• PCR Primers degraded

• dNTPs too old

• PCR primer or dNTP preparation errors

• Taq DNA polymerase inactive

• Enzyme buffer or MgCl2 not completely mixed

• PCR thermal cycler error or power outage

• Repeat PCR with new DNA template (preferably extracted from single-spored culture to avoid PCR inhibition)

• Use 1-10ng DNA as control

• Repeat PCR with new aliquots of primers, dNTPs, buffers, MgCl2 making sure to mix components thoroughly before addition

Failed negative control reaction • Contamination of one or more PCR reagents • Do not spend time trying to determine the exact source of the contamination

• PCR reagents should be aliquotted such that when PCR contamination occurs, the aliquot in use at the time can be discarded

• Repeat experiment with new aliquots of reagents

Unexpected black Sigatoka positive result:

• Symptoms not expected for black Sigatoka

• Unexpected incursion of the disease

• First record of black Sigatoka in a region

• Cross-contamination of DNA templates

• The black Sigatoka PCR diagnostic assay is both highly specific and sensitive: the result is most likely real

• Ensure DNA +’ve control is after test samples

• Check extraction buffer and negative PCR controls

• Repeat DNA extraction of leaf sample and repeat PCR

• To further confirm the result, the diagnostic PCR product may be cloned and sequenced

48

or the ITS regions of the pathogen may be PCR-cloned and sequenced using universal ITS primers (White et al., 1990)

Unexpected yellow Sigatoka positive result:

• Symptoms not expected for yellow Sigatoka

• Yellow Sigatoka not expected in region eg. some parts of south-east Asia and Oceania

• Cross-contamination of DNA templates

• The yellow Sigatoka PCR diagnostic assay is both highly specific and sensitive: the result is most likely real

• In Australia, yellow Sigatoka is endemic and is expected to amplify from DNA extracted from most leaf spot lesions. In addition, black Sigatoka and yellow Sigatoka are often found together during a black Sigatoka incursion

• Ensure DNA +’ve control is after test samples

• Check extraction buffer and negative PCR controls

• Repeat DNA extraction of leaf sample and repeat PCR

• To further confirm the result, the PCR product may be cloned and sequenced or the ITS regions may be PCR-cloned and sequenced using universal ITS primers (White et al. 1990)

49

Limitations of the Technology

Due to the nature of PCR-based protocols, specific issues arise because of the high level of

sensitivity and amplification of millions of copies of the target sequence. A few molecules of

PCR-generated fragments can contaminate samples of subsequent PCR runs and result in

false positives. On the other hand, a low copy number of initial target DNA sequences makes

the first amplification cycles critical e.g. PCR inhibition can result in false negatives.

False positives can result from cross-amplification of non-target DNA, exogenous DNA from

cells/cultures or aerosols, or from contaminating DNA originating from carry-over of previous

experiments. A negative control (that contains no template DNA) should be included in all

PCR diagnostic tests to identify false positive results. Aerosol-resistant, or filter-plugged tips

ensure DNA template added to the reaction tube, is not contaminated by templates present in

the barrel of the pipettor.

False negatives can arise for many reasons, including the presence of compounds derived

from extracted substrates that inhibit Taq polymerase, degradation of the DNA target

sequence, or reagent problems. Including a positive control for DNA (a known positive DNA

sample) and the presence of an amplified internal standard for each sample can protect

against false negatives.

PCR reaction inhibitors

Plant-derived compounds that inhibit the PCR reaction have been well documented e.g.

phenolics in banana tissue and chemical sprays on leaf surfaces. This problem is usually

easily solved by the further dilution of samples to 1:1000 in water.

50

Sources of Reference Material

Fungal cultures and DNA

Please contact the Queensland Department of Primary Industries & Fisheries Plant Pathology Herbarium (BRIP) for isolates of M. musicola and M. fijiensis to be used as positive controls in these assays. Please note that only cultures of M. musicola, and heat-treated or γ-irradiated plant tissue infected with M. fijiensis and M. musicola, are held by the Plant Pathology Herbarium. Plant Pathology Herbarium, Qld Dept of Primary Industries & Fisheries,

Plant Pathology Building, 80 Meiers Road, Indooroopilly, Qld, 4068 Ph: +61 7 3896 9598 Fax: +61 7 3896 9533 To enquire about availability of M. fijiensis and M. musicola DNA contact: Dr Juliane Henderson Research Fellow (Banana Diagnostics) Tree Pathology Centre University of Queensland

Located at:

Qld Dept of Primary Industries & Fisheries, Plant Pathology Building,

80 Meiers Road, Indooroopilly, Qld, 4068 Ph: +61 7 3896 9348 Fax: +61 7 3896 9533

51

Contacts

Dr Juliane Henderson Research Fellow (Banana Diagnostics) Tree Pathology Centre University of Queensland

Located at:

Qld Dept of Primary Industries & Fisheries, Plant Pathology Building,

80 Meiers Road, Indooroopilly, Qld, 4068 Ph: +61 7 3896 9348 Fax: +61 7 3896 9533 Kathy Grice Experimentalist Horticulture and Forestry Science, Delivery

Located at: Centre for Tropical Agriculture (CTA) Qld Dept of Primary Industries & Fisheries,

28 Peters Street, Mareeba, Qld, 4880 Ph: +61 7 4048 4675 Fax: +61 7 4092 3593

52

Further Reading

Carlier, J., De Waele, D. & Escalant, J. (2003) Global evaluation of Musa germplasm for resistance to Fusarium wilt, Mycosphaerella leaf spot diseases and nematodes. INIBAP Technical Guidelines No. 6

Available online from www.inibap.org D.R. Jones (ed) (2000) Diseases of Banana, Abacá and Enset. CABI Publishing, New York. Henderson, J., Pattemore, J. A., Porchun, S. C., Hayden, H. L., Van Brunschot, S., Grice, K. R. E., Peterson, R. A., Thomas-Hall, S. R. and Aitken, E. A. B. (2006) Black Sigatoka disease: new technologies to strengthen eradication strategies in Australia. Australasian Plant Pathology 35, 181-193.

53

Appendix

Reagents for DNA extraction

CTAB extraction buffer (100 mL)

Stock Component Volume Added Final Concentration

CTAB 2g 2% (w/v)

5M NaCl 28.4mL 1.42M

0.5M EDTA 4mL 20mM

1M Tris-HCl (ph8.0) 10mL 100mM

PVP-40 2g 2% (w/v)

Ascorbic Acid (MW = 176.12) 88mg 5mM

DIECA (MW = 171.3) 68mg 4mM

Dissolve components completely in MilliQ water, warming up to 70ºC if required. Do not heat

above 70ºC, as some components are heat labile. Divide into smaller aliquots and store out of

the light. Discard unused buffer after 6 weeks.

**DO NOT AUTOCLAVE THIS BUFFER – HEAT LABILE**

5M NaCl Stock Solution

• Place 146.1g NaCl in 1 litre beaker and make up to 500mL with MilliQ water

• Stir until dissolved

• Divide into smaller aliquots and autoclave (121°C/15 mins)

0.5M EDTA (pH 8.0)

• Place 143.1g of EDTA in a 1 litre beaker and add 400mL of MilliQ water

• Stir vigorously whilst adjusting the pH of the solution to 8.0 with NaOH (approximately

10g of solid NaOH)**

• Make up to 500mL with MilliQ water

• Divide into smaller aliquots and autoclave (121°C/ 15 mins)

** The disodium salt of EDTA will only go into solution when

the pH has been adjusted to 8.0 with NaOH. **

54

1M Tris-HCl (ph8.0)

• Place 60.55g Tris Base in a 1 litre beaker and add 400mL of MilliQ water

• Stir whilst adjusting the pH of the solution to 8.0 with concentrated HCl (42mL/L final

solution)**

• After solution has returned to room temperature make up to 500mL and make final

pH adjustment

• Divide into smaller aliquots and autoclave (121°C/ 15 mins)

** This solution will become very warm after the addition of the concentrated HCl but

this is normal. **

Chloroform-Isoamyl Alcohol (24:1)

To make up 100mL

• mix 96mL (24 parts) chloroform with 4mL (1 part) isoamyl alcohol.

** This solution must be made up and used inside a fume cabinet. **

Chloroform is toxic and a possible carcinogen.

Reagents for Agarose Gel Electrophoresis

0.5 X Tris-borate (TBE) Running Buffer

If not purchasing the concentrated TBE make a 5 X stock solution as follows:

54g Tris base

27.5g boric acid

20mL 0.5M EDTA (pH 8.0)

• Add the above to 800 mL of distilled water and stir until dissolved

• Make up to a final volume of 1.0L

Store at room temperature and discard if precipitation occurs. To make a working solution of

0.5 X TBE dilute 1:10 with MilliQ water.

55

6 X Gel-Loading Buffer

Four different gel-loading buffers are provided below. Personal preference and availability of

individual components will dictate choice.

1. 0.25% bromophenol blue

0.25% xylene cyanol FF

40.0% (w/v) sucrose

Dissolve above components in MilliQ water and store at 4° C.

2. 0.25% bromophenol blue

0.25% xylene cyanol FF

15% Ficoll 400

Dissolve above components in MilliQ water and store at room temperature.

3. 0.25% bromophenol blue

0.25% xylene cyanol FF

30.0% (w/v) glycerol

Dissolve above components in MilliQ water and store at 4° C.

4. 0.25% bromophenol blue

40.0% (w/v) sucrose

Dissolve above components in MilliQ water and store at 4° C.

56

References

Beveraggi A, Mourichon X, Sallé G (1995) Etude comparée des premières étapes de línfection chez bananaiers sensibles at résistants infectés par Cercospora fijiensis (Mycosphaerella fijiensis), agent responsable de la maladie des raies noires. Canadian Journal of Botany 73, 1328-1337.

Brun J (1958) Etude sur l'action des fongicides huileux dans la luttre contre la

cercoporiose. Note prélinimaire. Fruits D'outre Mer 13, 3-14. Carlier J, Fouré E, Gauhl F, Jones DR, Lepoivre P, Mourichon X, Pasberg-Gauhl

C, Romero RA (2000a) Black Leaf Streak. In 'Diseases of Banana, Abaca and Enset.' (Ed. DR Jones) pp. 37-79. (CABI Publishing: Wallingford)

Carlier J, Mourichon X, Jones DR (2000b) Septoria Leaf Spot. In 'Diseases of

Banana, Abacá and Enset'. (Ed. DR Jones) pp. 93-96. (CABI Publishing: Wallingford, UK)

Carlier J, Zapater M-F, Lapeyre F, Jones DR, Mourichon X (2000c) Septoria leaf

spot of bananas: A newly discovered disease caused by Mycosphaerella eumusae (Anamorph Septoria eumusae). Phytopathology 90, 884-890.

Crous PW, Mourichon X (2002) Mycosphaerella eumusae and its anamorph

Pseudocercospora eumusae spp. nov.: Causal agent of Eumusae leaf spot disease of banana. Sydowia 54, 35-43.

Dabek AJ, Waller JM (1990) Black leaf streak and viral streak: new banana

diseases in East Africa. Tropical Pest Management 36, 157-158. Davis RI, Grice KRE, Jacobson SC, Gunua TG, Rahamma S (2000) Surveillance

for black Sigatoka disease of banana in and near Torres Strait. Australasian Plant Pathology 29, 225.

Fortune MP, Gosine S, Chow SD, A., St Hill A, Gibbs H, Rambaran N (2005)

First Report of black Sigatoka disease (causal agent Mycosphaerella fijiensis) from Trinidad. Plant Pathology 54, 246.

Fouré E (1987) Varietal Reactions of Bananas and Plantains to Black Leaf

Streak disease. In 'Banana and Plantain breeding strategies: Proceedings of an international workshop'. Cairn, Australia. (Ed. GJ Persley) pp. 110-113. (ACIAR)

Frossard P (1980) Apparition d'une novelle et gravemaladie foliaire des

bananaiers et plantainsau Gabon: la maladie des raies noires: Mycosphaerella fijiensis MORELET. Fruits 35, 519-527.

Gauhl F (1994) 'Epidemiology and ecology of Black Sigatoka (Mycosphaerella

fijiensis Morelet) on Plantain and Banana (Musa spp.) in Costa Rica, Central America.' (INIBAP: Montpellier, France)

Gauhl F, Pasberg-Gauhl C, Jones DR (2000) Black leaf streak: Disease cycle

and epidemiology. In 'Diseases of Banana, Abacá and Enset'. (Ed. DR Jones) pp. 56-62. (CABI Publishing: Wallingford, UK)

Hayden HL, Carlier J, Aitken EAB (2003) Population differentiation in the banana

leaf spot pathogen Mycosphaerella musicola, examined at a global scale. Plant Pathology 52, 713-719.

57

Hayden HL, Carlier J, Aitken EAB (2005) The genetic structure of Australian populations of Mycosphaerella musicola suggests restricted gene flow at the continental scale. Phytopathology 95, 489-498.

Jones DR (1984) Failure of the black Sigatoka eradication program in the Torres

Strait Region. Australasian Plant Pathology 13, 57-58. Jones DR (1989) Black Sigatoka-A threat to Australia. In 'Sigatoka leaf spot

diseases of bananas:Proceedings of an international workshop'. Costa Rica. (Eds RA Fullerton,RH Stover). (INIBAP)

Jones DR (2000) Sigatoka. In 'Diseases of Banana, Abacá and Enset'. (Ed. DR

Jones) pp. 79-92. (CABI Publishing: Wallingford) Jones DR (2002) The distribution and importance of the Mycosphaerella leaf

spot diseases of banana. In 'Mycosphaerella leaf spot diseases of bananas: present status and outlook'. San José, Costa Rica. (Eds L Jacome, P Lepoivre, DH Marin, R Ortiz, RA Romero,JV Escalant) pp. 25-41. (INIBAP)

Kung'U JN, Seif AA, Waller JM (1992) Black leaf streak and other foliage

diseases of Bananas in Kenya. Tropical Pest Mangement 38, 359-361. Leach R (1946) Banana leaf spot (Mycosphaerella musicola) on the Gros Michel

variety in Jamaica. Investigations into the aetiology of the disease and the principles of control by spraying. Bulletin, Government Printer, Kingston, Jamaica.

Leach R (1964) A new form of banana leaf spot in Fiji, black leaf streak. World

Crops 16, 60-64. Liu Z, Stewart, E. L. and Szabo, L. J. (1991) Phylogenetic relationships among

Cercospora and allied genera on banana based on rDNA sequence comparisons. Phytopathology 81, 1240.

Madiz RÇ, Smits B. G, Noguera R (1991) Principales hongos patogenos que

afectan alguns especies ornamentales del genero Heliconia. Agronomia Tropical 41, 265-274.

Massee G (1914) Fungi Exotica:XVIII. Bulletin of Miscellaneous Information, Kew

Gardens 4, 159. Meredith DS (1970) 'Banana leaf spot disease(Sigatoka) caused by

Mycosphaerella musicola Leach.' (Commonwealth Mycological Institute, Kew, Surrey, England)

Meredith DS, Lawrence JS (1969) Black leaf streak disease of bananas

(Mycosphaerella fijiensis): Symptoms of disease in Hawaii, and notes on the conidial state of the causal fungus. Transactions of the British Mycological Society 52, 459-476.

Mobambo KN, Gauhl F, Swennen R, Pasberg-Gauhl C (1996) Assessment of the

cropping cycle effects on black leaf streak severity and yield decline of plantain and plantain hybrids. International Journal of Pest Management 42, 1-8.

Mourichon X, Carlier J, Foure E (1997) Sigatoka Leaf Spot Diseases. Musa

Disease Fact Sheet No. 8. Mourichon X, Fullerton RA (1990) Geographical distribution of the two species

Mycosphaerella musicola Leach (Cercospora musae) and M. fijiensis Morelet (C. fijiensis), respectively agents of Sigatoka Disease and Black Leaf Streak disease in bananas and plantains. Fruits 3, 213-218.

58

Parnell M, Burt PJA, Wilson K (1998) The influence of exposure to ultrviolet

radiation in simulated sunlight on ascospores causing Black Sigatoka disease of banana and plantain. International Journal of Biometeorology 42, 22-27.

Peterson RA (2002) 'Black Sigatoka eradication - controlled management

program: Tully banana production area 2001-2002.' Queensland Department of Primary Industries and Fisheries.

Ploetz R, Channer AG, Chizala CT, Banda DLN, Makina PW, Braunworth Jr WS

(1992) A current appraisal of banana and plantain diseases in Malawi. Tropical Pest Management 38, 36-42.

Rivas GG, Zapater M-F, Abadie C, Carlier J (2004) Founder effects and

stochastic dispersal at the continental scale of the fungal pathogen of bananas Mycosphaerella fijiensis. Molecular Ecology 13, 471-482.

Sallé G, Pichard V, Mourichon X (1989) Cytological studies of the interaction

between Mycosphaerella fijiensis Morelet and three cultivars of Musa presenting different levels of resistance. In 'Sigatoka leaf spot diseases of bananas: Proceedings of an international workshop held at San José, Costa Rica, March 28-April 1, 1989'. San José, Costa Rica. (Eds RA Fullerton,RH Stover) pp. 180-190. (INIBAP)

Sebasigari K (1989) Effect of black Sigatoka (Mycosphaerella fijiensis Morelet)

on bananas and plantains in the Imbo Plain in Rwanda and Burundi. In 'Sigatoka leaf spot diseases of bananas: Proceedings of an international workshop'. Costa Rica. (Eds RA Fullerton,RH Stover). (INIBAP)

Shivas R, Kesavan V (1992) Yellow Sigatoka of Bananas. Farm Notes,

Department of Agriculture Western Australia 49. Simmonds NW (1928) Diseases of banana in Queensland. Queensland

Agricultural Journal 30, 438-454. Stover RH (1962) Intercontinental spread of banana leaf spot (Mycosphaerella

musicola). Tropical Agriculture (Trinidad) 29, 327-338. Stover RH (1971) Leaf spot of bananas caused by Mycosphaerella musicola:

Role of conidia in epidemiology. Phytopathology 60, 856-860. Stover RH (1972) 'Banana, Plantain and Abacá Diseases.' (Commonwealth

Mycological Institute (CAB): Kew, England) Stover RH (1978) Distribution and probable origin of Mycosphaerella fijiensis in

Southeast Asia. Tropical Agriculture (Trinidad) 55, 65-68. Stover RH (1980) Sigatoka leaf spot diseases of banana and plantain. Plant

Disease 64, 750-755. Stover RH (1983) The effect of temperature on ascospore germinative tube

growth of Mycosphaerella musicola and Mycosphaerella fijiensis var. difformis. Fruits 38, 625-628.

Stover RH, Dickson JD (1976) Banana leaf spot caused by Mycosphaerella

musicola and M. fijiensis var.deformis: a comparison of the first Central American epidemics. FAO Plant Protection Bulletin 24, 36-42.

Tushemereirwe WK, Waller JM (1993) Black leaf streak (Mycosphaerella

fijiensis) in Uganda. Plant Pathology 42, 471-472.

59

Vidal A (1992) Outbreaks and new records. Cuba. Black Sigatoka. FAO Plant Protection Bulletin 40, 1-2.

White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of

fungal ribosomal RNA genes for phylogenetics. In 'PCR protocols: A guide to Methods and Applications'. (Eds MA Innis, DH Gelfand, JJ Sninsky,TJ White) pp. 315-322. (Academic Press: London)