shred is a regulatory cascade that reprograms ubr1 ... · dale muzzey, georg h.h. borner, sebastian...
TRANSCRIPT
![Page 1: SHRED Is a Regulatory Cascade that Reprograms Ubr1 ... · Dale Muzzey, Georg H.H. Borner, Sebastian Schuck Correspondence s.schuck@zmbh.uni-heidelberg.de In Brief Szoradi et al. uncover](https://reader030.vdocuments.us/reader030/viewer/2022041217/5e06b3823924f726c567acbd/html5/thumbnails/1.jpg)
Article
SHRED Is a Regulatory Ca
scade that ReprogramsUbr1 Substrate Specificity for Enhanced ProteinQuality Control during StressGraphical Abstract
non-stress conditionsSHRED inactive
stress conditionsSHRED active
Ubr1Ubr1
Roq1∆21
N-end rulesubstrate
Roq1uncleaved
Roq1∆21binding
degradation
misfoldedprotein
UbUb
cleavage
Ynm3
degradation
Highlights
d Stress induces the synthesis of Roq1, which undergoes
cleavage by the protease Ynm3
d Cleaved Roq1 modulates substrate specificity of the N-end
rule ubiquitin ligase Ubr1
d Roq1-bound Ubr1 promotes selective proteasomal
degradation of misfolded proteins
d This pathway, termed SHRED, adapts protein quality control
to changing cellular needs
Szoradi et al., 2018, Molecular Cell 70, 1–13June 21, 2018 ª 2018 Elsevier Inc.https://doi.org/10.1016/j.molcel.2018.04.027
Authors
Tamas Szoradi, Katharina Schaeff,
Enrique M. Garcia-Rivera, ...,
Dale Muzzey, Georg H.H. Borner,
Sebastian Schuck
In Brief
Szoradi et al. uncover SHRED, a stress
response pathway that hinges on the
previously uncharacterized regulatory
protein Roq1. Proteolytically cleaved
Roq1 binds to the N-end rule ubiquitin
ligase Ubr1 as a pseudosubstrate and
directs Ubr1 toward misfolded proteins,
thereby promoting the degradation of
aberrant proteins.
![Page 2: SHRED Is a Regulatory Cascade that Reprograms Ubr1 ... · Dale Muzzey, Georg H.H. Borner, Sebastian Schuck Correspondence s.schuck@zmbh.uni-heidelberg.de In Brief Szoradi et al. uncover](https://reader030.vdocuments.us/reader030/viewer/2022041217/5e06b3823924f726c567acbd/html5/thumbnails/2.jpg)
Please cite this article in press as: Szoradi et al., SHRED Is a Regulatory Cascade that Reprograms Ubr1 Substrate Specificity for Enhanced ProteinQuality Control during Stress, Molecular Cell (2018), https://doi.org/10.1016/j.molcel.2018.04.027
Molecular Cell
Article
SHRED Is a Regulatory Cascade that ReprogramsUbr1 Substrate Specificity for EnhancedProtein Quality Control during StressTamas Szoradi,1 Katharina Schaeff,1 Enrique M. Garcia-Rivera,2,5 Daniel N. Itzhak,3 Rolf M. Schmidt,1 Peter W. Bircham,1
Kevin Leiss,1 Juan Diaz-Miyar,1 Vivian K. Chen,2,6 Dale Muzzey,4,7 Georg H.H. Borner,3 and Sebastian Schuck1,8,*1Center for Molecular Biology of Heidelberg University (ZMBH), DKFZ-ZMBH Alliance and CellNetworks Cluster of Excellence,
69120 Heidelberg, Germany2Department of Biochemistry and Biophysics, University of California, San Francisco, San Francisco, CA 94143, USA3Department of Proteomics and Signal Transduction, Max Planck Institute of Biochemistry, 82152 Martinsried, Germany4Department of Cellular and Molecular Pharmacology, University of California, San Francisco, San Francisco, CA 94158, USA5Present address: nference, Inc., Cambridge, MA 02141, USA6Present address: Department of Biology, Stanford University, Stanford, CA 94305, USA7Present address: Counsyl, Inc., South San Francisco, CA 94080, USA8Lead Contact
*Correspondence: [email protected]://doi.org/10.1016/j.molcel.2018.04.027
SUMMARY
When faced with proteotoxic stress, cells mountadaptive responses to eliminate aberrant proteins.Adaptive responses increase the expression of pro-tein folding and degradation factors to enhance thecellular quality control machinery. However, it is un-clear whether and how this augmented machineryacquires new activities during stress. Here, we un-cover a regulatory cascade in budding yeast thatconsists of the hydrophilin protein Roq1/Yjl144w,the HtrA-type protease Ynm3/Nma111, and the ubi-quitin ligase Ubr1. Various stresses stimulate ROQ1transcription. The Roq1 protein is cleaved by Ynm3.Cleaved Roq1 interacts with Ubr1, transforming itssubstrate specificity. Altered substrate recognitionby Ubr1 accelerates proteasomal degradation ofmisfolded as well as native proteins at the endo-plasmic reticulum membrane and in the cytosol. Weterm this pathway stress-induced homeostaticallyregulated protein degradation (SHRED) and proposethat it promotes physiological adaptation by repro-gramming a key component of the quality controlmachinery.
INTRODUCTION
Cells are frequently challenged by changing physiological condi-
tions. An important consequence of such stress is impaired pro-
tein folding. The resulting accumulation of misfolded proteins
poses a serious threat to cell function and is associated
with various disorders, including major age-related neurodegen-
erative diseases (Balchin et al., 2016; Labbadia and Mori-
moto, 2015).
The cellular quality control machinery recognizes misfolded
proteins, typically on the basis of surface-exposed hydrophobic
residues, and refolds, sequesters, or degrades them (Buch-
berger et al., 2010). Molecular chaperones are essential for pro-
tein folding, refolding, and sequestration (Balchin et al., 2016).
Ubiquitin ligases are central players in protein degradation
and attach ubiquitin to misfolded proteins as a mark for
destruction. Different subcellular compartments are equipped
with distinct sets of ubiquitin ligases. In yeast, for instance,
the membrane of the endoplasmic reticulum (ER) contains
Hrd1 and Doa10, which function in ER-associated protein
degradation (ERAD; Ruggiano et al., 2014). The nucleus con-
tains several quality control ubiquitin ligases, including San1
(Gardner et al., 2005), and the cytosol contains Ubr1, Ubr2,
Hul5, and Rsp5 (Eisele and Wolf, 2008; Fang et al., 2011,
2014; Heck et al., 2010; Nillegoda et al., 2010). However, there
is functional overlap between certain ubiquitin ligases. For
example, Doa10 also contributes to nuclear and cytosolic qual-
ity control, San1 helps to eliminate misfolded cytosolic pro-
teins, and Ubr1 participates in ERAD (Heck et al., 2010; Prasad
et al., 2010; Ravid et al., 2006; Stolz et al., 2013; Swanson
et al., 2001).
Stress-induced protein misfolding elicits adaptive cellular
responses that promote folding and degradation of aberrant
proteins. Accumulation of misfolded proteins in the ER lumen
triggers the unfolded protein response (UPR). The UPR induces
numerous genes whose products enhance ER protein folding
and ERAD (Travers et al., 2000; Walter and Ron, 2011). Mis-
folded proteins in the cytosol activate the heat shock response
(HSR), which increases chaperone levels and stimulates cyto-
solic protein degradation (Labbadia and Morimoto, 2015;
Verghese et al., 2012). ER membrane proteins with misfolded
cytosolic domains induce transcriptional programs that are
distinct from the classical UPR and HSR, suggesting that this
Molecular Cell 70, 1–13, June 21, 2018 ª 2018 Elsevier Inc. 1
![Page 3: SHRED Is a Regulatory Cascade that Reprograms Ubr1 ... · Dale Muzzey, Georg H.H. Borner, Sebastian Schuck Correspondence s.schuck@zmbh.uni-heidelberg.de In Brief Szoradi et al. uncover](https://reader030.vdocuments.us/reader030/viewer/2022041217/5e06b3823924f726c567acbd/html5/thumbnails/3.jpg)
A
GFPN Pho8*
Rtn1Pho8*-GFP
N CPY* GFP
Rtn1CPY*-GFP
N GFP
ER lumen
cytosolRtn1-GFP
repo
rter l
evel
s (%
)
C
Rtn1-GFPRtn1Pho8*-GFP
5tunicamycin treatment (h)
0 1 2 3 40
20
40
60
80
100
E
Rtn1-GFP
Rtn1Pho8*-GFPRtn1Pho8*-GFP + Tm
Rtn1-GFP + Tm
repo
rter r
emai
ning
(%)
0 1 2 3 4 5time after promoter shut-off (h)
0
20
40
60
80
100
120
GFP
Pgk1
DRtn1-GFP Rtn1Pho8*-GFP
Tm (h) 0 1 2 3 4 5
Hmg2-GFP
Rtn1CPY*-GFPRtn1Pho8*-GFP
Rtn1-GFP
0
20
40
60
80
100
repo
rter r
emai
ning
(%)
0 1 2 3 4cycloheximide treatment (h)
B
F
0 1 2 3 4 5
repo
rter r
emai
ning
(%)
0 1 2 3 4 5time after promoter shut-off (h)
0
20
40
60
80
100
120
Rtn1Pho8*-GFP + TmRtn1Pho8*-GFP + Tm + MG132
Figure 1. Stress Induces Proteasomal
Degradation of ER Proteins with Misfolded
Cytosolic Domains
(A) Schematic of reporter proteins.
(B) Flow cytometry of total cellular GFP fluores-
cence after cycloheximide treatment. Error bars
represent mean ± SEM; n = 5.
(C) Flow cytometry of cellular reporter levels after
tunicamycin (Tm) treatment. Error bars represent
mean ± SEM; n = 4.
(D)WesternblotofGFPandPgk1after Tm treatment.
(E) Flow cytometry of total cellular GFP fluores-
cence after promoter shutoff in cells expressing
Rtn1-GFP or Rtn1Pho8*-GFP from the GAL pro-
moter. Error bars represent mean ± SEM; n = 4.
(F) As in (E) with cells expressing GAL promoter-
driven Rtn1Pho8*-GFP and treated with Tm or with
Tm + MG132. Error bars represent mean ± SEM;
n = 4.
See also Figures S1–S3.
Please cite this article in press as: Szoradi et al., SHRED Is a Regulatory Cascade that Reprograms Ubr1 Substrate Specificity for Enhanced ProteinQuality Control during Stress, Molecular Cell (2018), https://doi.org/10.1016/j.molcel.2018.04.027
class of quality control substrates is sensed and handled in
unique ways (Buck et al., 2015). Finally, a variety of unfavorable
conditions activate the environmental stress response (ESR),
which expands chaperone capacity and globally downregu-
lates protein synthesis (Gasch et al., 2000). The UPR, HSR,
and ESR remodel the quality control machinery by adjusting
the abundance of its constituent parts. However, quality control
factors such as chaperones and ubiquitin ligases are also
regulated post-translationally (Cloutier and Coulombe, 2013;
Zheng and Shabek, 2017). Adaptive responses may, therefore,
not only expand the quality control machinery but also alter
how certain parts of this machinery function.
Here, we investigate protein quality control at the interface
of the ER and the cytosol in budding yeast, Saccharomyces
cerevisiae. We uncover stress-induced homeostatically regu-
lated protein degradation (SHRED), a stress-inducible pathway
for the degradation of misfolded ER membrane and cytosolic
proteins. We show that SHRED involves reprogramming of
the ubiquitin ligase Ubr1 by a proteolytically processed
regulator.
2 Molecular Cell 70, 1–13, June 21, 2018
RESULTS
Stress Induces Degradation of ERProteins with Misfolded CytosolicDomainsTo analyze protein quality control at the ER
membrane,wegenerated the reporter pro-
teins Rtn1-GFP, Rtn1CPY*-GFP, and
Rtn1Pho8*-GFP (Figure 1A). We used the
reticulon protein Rtn1 as a scaffold,
because it is anchored in the ER mem-
brane by hydrophobic hairpin structures
(Voeltz et al., 2006) and is, therefore, un-
coupled from quality control mechanisms
monitoring the ER lumen. To introduce
misfolded domains, we fused folding-
defective CPY* (Stolz and Wolf, 2012) or
Pho8* (FigureS1) to the cytosolicC terminusofRtn1. The resulting
reporter proteins were membrane associated and localized to the
peripheral ER (Figure S2). To assay their turnover, we performed
cycloheximide chase experiments with the Rtn1-based reporters
and the well-studied ERAD substrate Hmg2-GFP (Hampton et al.,
1996). Hmg2-GFP was degraded rapidly, whereas Rtn1-GFP
showed no turnover. Rtn1CPY*-GFP was degraded, albeit less
quickly than Hmg2-GFP. In contrast, Rtn1Pho8*-GFP was as
long lived as Rtn1-GFP (Figures 1B and S3A).
The misfolded yet stable Rtn1Pho8*-GFP provided an ideal
model substrate to investigate whether stress affects the degra-
dation of misfolded ER membrane proteins. We first examined
constitutively expressed Rtn1-GFP and Rtn1Pho8*-GFP in cells
treated with tunicamycin, which causes protein misfolding by
preventing N-linked glycosylation. Rtn1-GFP levels decreased
slightly, whereas Rtn1Pho8*-GFP levels dropped to less than
20% (Figures 1C and 1D). Rtn1CPY*-GFP levels showed a
similar decline (Figure S3B). To determine whether this behavior
reflected enhanced degradation, we followed pre-existing re-
porter molecules in promoter shut-off experiments. Rtn1-GFP
![Page 4: SHRED Is a Regulatory Cascade that Reprograms Ubr1 ... · Dale Muzzey, Georg H.H. Borner, Sebastian Schuck Correspondence s.schuck@zmbh.uni-heidelberg.de In Brief Szoradi et al. uncover](https://reader030.vdocuments.us/reader030/viewer/2022041217/5e06b3823924f726c567acbd/html5/thumbnails/4.jpg)
WT∆ubr1∆ynm3∆roq1
Tm (h)
WT
∆ubr1
∆ynm3
∆roq1
A
0 1 2 3 4 5
Rtn1Pho8*-GFP
0 1 2 3 4 5tunicamycin treatment (h)
0
20
40
60
80
100
repo
rter l
evel
s (%
)
B Rtn1Pho8*-GFP
C
FE
D
repo
rter r
emai
ning
(%)
WT∆ubr1∆ynm3∆roq1
tunicamycin treatment (h)
0
20
40
60
80
100
Rtn1Pho8*-GFP, promoter shut-off
0 1 2 3 4 5
WT∆ubr1
∆ubr2∆rad6
∆san1∆ubr1 ∆san1
tunicamycin treatment (h)
0
20
40
60
80
100
repo
rter l
evel
s (%
)
Rtn1Pho8*-GFP
0 1 2 3 4 5
repo
rter r
emai
ning
(%)
WTcdc48-3
Rtn1Pho8*-GFP, promoter shut-off
tunicamycin treatment (h)0 1 2 3 4 5
0
20
40
60
80
100
120
0
20
40
60
80
∆ubr1 ∆ynm3WT ∆roq1 ∆ubr1∆ynm3
∆ubr1∆roq1
∆ynm3∆roq1
Rtn1Pho8*-GFP, promoter shut-off100
repo
rter r
emai
ning
(%)
120
Figure 2. Stress-Induced Proteasomal
Degradation of Rtn1Pho8*-GFP Requires
Ubr1, Ynm3, Roq1, Rad6, and Cdc48
(A) Western blot of GFP after tunicamycin (Tm)
treatment. Equal amounts of total protein were
analyzed for each time point. WT, wild-type.
(B) Flow cytometry of cellular Rtn1Pho8*-GFP
levels after Tm treatment. Error bars represent
mean ± SEM; n = 5.
(C) Flow cytometry of total cellular GFP fluores-
cence after promoter shut-off and Tm treatment
in cells expressing Rtn1Pho8*-GFP from the GAL
promoter. Error bars represent mean ± SEM; n = 5.
(D) As in (B). Error bars represent mean ± SEM;
n = 3.
(E) As in (C). Error bars represent mean ± SEM;
n = 3.
(F) As in (C), except that percent of reporter re-
maining after 5-hr Tm treatment is depicted. Error
bars represent mean ± SEM; n = 4.
See also Figures S3 and S4.
Please cite this article in press as: Szoradi et al., SHRED Is a Regulatory Cascade that Reprograms Ubr1 Substrate Specificity for Enhanced ProteinQuality Control during Stress, Molecular Cell (2018), https://doi.org/10.1016/j.molcel.2018.04.027
and Rtn1Pho8*-GFP were placed under the control of the regu-
latable GAL promoter, expression was induced with galactose
and then repressed with glucose, and reporter levels were moni-
tored in the absence or presence of tunicamycin. Reporter mole-
cules produced during galactose induction were associated
with the ER membrane (Figures S3C and S3D). Without tunica-
mycin, Rtn1-GFP and Rtn1Pho8*-GFP levels remained essen-
tially unchanged, consistent with their slow turnover at steady
state. With tunicamycin, Rtn1-GFP levels remained constant,
but Rtn1Pho8*-GFP levels decreased substantially, showing
that the reporter was degraded (Figure 1E). Tunicamycin-
induced degradation of Rtn1Pho8*-GFPwas blocked by the pro-
teasome inhibitor MG132 (Figure 1F). Hence, ER stress induces
selective proteasomal degradation of ER membrane proteins
with misfolded cytosolic domains.
Stress-InducedMisfoldedProteinDegradationRequiresUbr1, Ynm3, and Roq1To uncover the machinery for stress-induced degradation of
Rtn1Pho8*-GFP, we conducted a genetic screen. Cells express-
ing the reporter were mutagenized and
screened by fluorescence microscopy
and flow cytometry for mutants that
had normal steady-state levels of
Rtn1Pho8*-GFP but failed to degrade it
during stress. Complementation analysis
and whole-genome sequencing revealed
defects in five genes: PRE2, UMP1,
UBR1, YNM3/NMA111, and YJL144W.
The first two encode a proteasome sub-
unit and a proteasome maturation factor,
respectively, consistent with proteasomal
degradation of Rtn1Pho8*-GFP. The
identification of UBR1 is in line with the
roles of this ubiquitin ligase in protein
quality control. YNM3 encodes the only
yeast protease of the HtrA family
(Clausen et al., 2011). YJL144W is a poorly characterized gene
encoding a hydrophilin protein (Dang and Hincha, 2011). We
name this gene ROQ1, for regulator of quality control.
Deletion of UBR1, YNM3, or ROQ1 did not alter steady-state
levels of Rtn1Pho8*-GFP. However, the tunicamycin-induced
decline of Rtn1Pho8*-GFP levels was slowed (Figures 2A
and 2B). The same was true when DTT was used as an alterna-
tive ER stressor (Figure S4A). Promoter shut-off experiments
showed that the deletions inhibited degradation of pre-existing
Rtn1Pho8*-GFP (Figure 2C). Since reporter molecules synthe-
sized prior to promoter shut-off were associated with the ER
(Figures S3C and S3D), Ubr1, Ynm3, and Roq1 must act on
ER-localized Rtn1Pho8*-GFP.
To complement the screen, we examined known quality control
components for roles in the degradation of Rtn1Pho8*-GFP. Ubr2
was dispensable, as were Hrd1 and Doa10 (Figures 2D and S4B).
San1 deletion caused a minor inhibition but had no effect in the
absence of Ubr1. The ubiquitin-conjugating enzyme Rad6, which
interactswithUbr1 (Dohmenetal., 1991),was required (Figure2D).
The essential AAA ATPase Cdc48, which extracts proteins from
Molecular Cell 70, 1–13, June 21, 2018 3
![Page 5: SHRED Is a Regulatory Cascade that Reprograms Ubr1 ... · Dale Muzzey, Georg H.H. Borner, Sebastian Schuck Correspondence s.schuck@zmbh.uni-heidelberg.de In Brief Szoradi et al. uncover](https://reader030.vdocuments.us/reader030/viewer/2022041217/5e06b3823924f726c567acbd/html5/thumbnails/5.jpg)
PKA-as Rtn1Pho8*-GFP, promoter shut-off B
0 1 2 3 4 51NM-PP1 treatment (h)
0
20
40
60
80
100
repo
rter r
emai
ning
(%)
WT∆ubr1∆ynm3∆roq1
0
20
30
70
80
90
10
60
C
RO
Q1
mR
NA
leve
ls
wild-type
0 1 3tunicamycintreatment (h)
1NM-PP1treatment (h)
PKA-as
estradioltreatment (h)
GEMGAL-ROQ1
0 1 3 0 1 3
A
D
analog-sensitive proteinkinase A (PKA-as)
Msn2/4
stress-responsive genes
ATP analog(1NM-PP1)
inactive GEMtranscription factor
estradiol
GAL-ROQ1 gene
active GEMtranscription factor
GEM GAL-ROQ1 Rtn1Pho8*-GFPE
0
20
40
60
80
100
0 2 4 6estradiol treatment (h)
repo
rter l
evel
s (%
)
1 3 5
WT∆ubr1∆ynm3
F GEM GAL-ROQ1
estradiol treatment (h)0 2 4 6
0
20
40
60
80
100
repo
rter l
evel
s (%
)
Gal4DBD
M2TAD
Gal4DBD
M2TAD
Rtn1-GFPRtn1Pho8*-GFP
ATP
Hsf1
120
Figure 3. Regulation of SHRED by the Envi-
ronmental Stress Response and Roq1
(A) Schematic illustrating activation of the ESRwith
the ATP analog 1NM-PP1.
(B) Flow cytometry of total cellular GFP fluores-
cence after promoter shut-off and 1NM-PP1
treatment. Error bars represent mean ± SEM; n = 4.
(C) ROQ1 mRNA levels after tunicamycin, 1NM-
PP1, or estradiol treatment. Error bars represent
mean ± SEM; n = 3.
(D) Schematic illustrating induction of GAL pro-
moter-driven ROQ1 transcription by activation of
the GEM transcription factor with estradiol. GEM
contains the Gal4 DNA-binding domain (Gal4
DBD), an estrogen-binding domain, and the Msn2
transactivation domain (M2 TAD).
(E) Flow cytometry of cellular Rtn1Pho8*-GFP
levels after estradiol treatment. Error bars repre-
sent mean ± SEM; n = 3.
(F) Flow cytometry of cellular Rtn1-GFP and
Rtn1Pho8*-GFP levels after estradiol treatment.
Error bars represent mean ± SEM; n = 4.
See also Figure S4.
Please cite this article in press as: Szoradi et al., SHRED Is a Regulatory Cascade that Reprograms Ubr1 Substrate Specificity for Enhanced ProteinQuality Control during Stress, Molecular Cell (2018), https://doi.org/10.1016/j.molcel.2018.04.027
the ER (Ruggiano et al., 2014), was tested with the temperature-
sensitive cdc48-3 allele. Promoter shut-off experiments at 30�C,a semi-permissive temperature at which cdc48-3 cells still grow,
showed that degradation of Rtn1Pho8*-GFP involves Cdc48
(Figure 2E).
Finally, we asked whether Ubr1, Ynm3, and Roq1 act in parallel
or in a single pathway. Individual and pairwise gene deletions in-
hibited degradation of Rtn1Pho8*-GFP to similar extents, indi-
cating a single pathway (Figure 2F). Thus, Ubr1, Ynm3, and Roq1
are part of a linear pathway responsible for stress-induced degra-
dation of Rtn1Pho8*-GFP. We refer to this pathway as SHRED.
Regulation of SHRED by the Environmental StressResponse and Roq1Next, we investigated how stress regulates SHRED. Degradation
of Rtn1Pho8*-GFP upon tunicamycin treatment did not require
4 Molecular Cell 70, 1–13, June 21, 2018
Ire1 or Hac1, ruling out the UPR as the
relevant signaling pathway (Figure S4C).
Prolonged ER stress affects protein ki-
nase A (PKA) signaling, which controls
the ESR (Gasch et al., 2000; Pincus
et al., 2014). Therefore, we testedwhether
PKA can regulate degradation of
Rtn1Pho8*-GFP. PKA normally represses
the transcription factors Msn2/4 and
Hsf1. Stress inactivates PKA, allowing
Msn2/4 and Hsf1 to induce stress-
responsive genes (Verghese et al.,
2012). To manipulate PKA, we used cells
in which the three PKA isoforms
Tpk1/2/3 had been modified so that they
can be specifically inhibited with the bulky
non-hydrolyzable ATP analog 1NM-PP1
(Figure 3A; Hao and O’Shea, 2011). PKA
inhibition on its own was sufficient to
trigger degradation of Rtn1Pho8*-GFP, which required Ubr1,
Ynm3, and Roq1 (Figure 3B). Thus, SHRED can be induced by
activation of the ESR. Accordingly, degradation of Rtn1Pho8*-
GFP by SHRED was also induced by growth to post-diauxic
phase, a natural starvation condition that activates the ESR
(Figure S4D).
How does the ESR stimulate SHRED? The mRNA levels of
UBR1 and YNM3 do not rise during ER stress (Travers et al.,
2000). The same was true for their protein levels (data not
shown). In contrast, many stresses induce ROQ1 transcription
(Gasch et al., 2000; Travers et al., 2000). Indeed, tunicamycin
increased ROQ1 mRNA levels 10-fold within 3 hr as measured
by real-time qPCR (Figure 3C). Activation of the ESR by inhibition
of PKA caused even stronger induction. Therefore, we asked
whether ROQ1 transcription was a molecular switch for acti-
vating SHRED. If so, enforced ROQ1 expression should trigger
![Page 6: SHRED Is a Regulatory Cascade that Reprograms Ubr1 ... · Dale Muzzey, Georg H.H. Borner, Sebastian Schuck Correspondence s.schuck@zmbh.uni-heidelberg.de In Brief Szoradi et al. uncover](https://reader030.vdocuments.us/reader030/viewer/2022041217/5e06b3823924f726c567acbd/html5/thumbnails/6.jpg)
Roq1
Ub-Roq
1
∆ynm3 ∆roq1 Rtn1Pho8*-GFP
10R
21R
11T
12H
13K
14K
15S
16N
17S
18S
22S
19I
20L
23Q
24R
25D
Ub-Roq1∆X
7T
8I
9Y
0
20
40
60
80
repo
rter l
evel
s (%
)
E
D
HA
WT∆18 ∆19 ∆20 ∆21 ∆22 ∆23WT WT WT WT WT
Roq1-HA(74)
15 kDa
0
20
40
60
80
repo
rter l
evel
s (%
)
F ∆ynm3 ∆roq1Rtn1Pho8*-GFP
Ub-Roq
1R22
AR22
LR22
K
Ub-Roq1∆21
*
0
20
40
60
80
repo
rter l
evel
s (%
)
G∆roq1 Rtn1Pho8*-GFP
L21P
L21V
R22A
R22L
Roq1
R22K
15 kDa
Ub-Roq
1∆21
no R
oq1
WT R
oq1
H
HA
WT L21P
Roq1-HA(74)
L21V
55 kDaPgk1
10 kDa
A Rtn1Pho8*-GFP
repo
rter l
evel
s (%
)
0 1 2 3 4 5tunicamycin treatment (h)
0
20
40
60
80
100
∆ynm3∆ynm3 + pYNM3∆ynm3 + pYNM3(S236A)
WT ∆ynm3
Roq1-HA
55 kDa
B
Pgk1
15 kDa
10 kDa
HA
MG132
C
WT ∆ynm3
Pgk1
HA
Roq1-HA(74)
15 kDa
10 kDa
55 kDa
- +- +
Figure 4. Ynm3 Cleaves Roq1 to Activate It
(A) Flow cytometry of cellular Rtn1Pho8*-GFP
levels after tunicamycin (Tm) treatment. Error bars
represent mean ± SEM; n = 3.
(B) Western blot of HA and Pgk1 from cells ex-
pressing Roq1-HA. MG132 treatment for 4 hr
where indicated. The double arrow indicates
Ynm3-dependent Roq1 cleavage fragments.
(C) As in (B), from cells expressing Roq1-HA(74).
(D) Western blot of HA fromDroq1 cells expressing
Ub-Roq1-HA(74) orDynm3Droq1 cells expressing
Ub-Roq1DX-HA(74) variants. The double arrow
indicates native Roq1 cleavage fragments.
(E) Flow cytometry of cellular Rtn1Pho8*-GFP
levels after Tm treatment for 5 hr. Letters below the
graph indicate the identity of the N-terminal resi-
dues. The orange box marks the variants
also shown in (D). Error bars represent mean ±
SEM; n = 3.
(F) Flow cytometry of cellular Rtn1Pho8*-GFP
levels in cells expressing Ub-Roq1D21 variants
after Tm treatment for 5 hr. Error bars represent
mean ± SEM; n = 3.
(G) As in (F), in cells expressing full-length Roq1
variants.
(H) Western blot of HA and Pgk1. The double arrow
denotes the native Roq1 cleavage fragments, and
the asterisk denotes an alternative cleavage
product.
See also Figure S5.
Please cite this article in press as: Szoradi et al., SHRED Is a Regulatory Cascade that Reprograms Ubr1 Substrate Specificity for Enhanced ProteinQuality Control during Stress, Molecular Cell (2018), https://doi.org/10.1016/j.molcel.2018.04.027
misfolded protein degradation. To test this notion, we placed
ROQ1 under the control of the GAL promoter in cells harboring
the artificial transcription factor GEM. This enables activation
of the GAL promoter with the heterologous steroid b-estradiol
(Figure 3D; Pincus et al., 2014). As expected, estradiol strongly
induced ROQ1 transcription (Figure 3C). Strikingly, ROQ1
induction in otherwise untreated cells caused degradation of
Rtn1Pho8*-GFP, which was completely dependent on Ubr1
and Ynm3 (Figure 3E). Enforced ROQ1 transcription did not
affect cell growth, arguing against the possibility that it triggered
protein degradation indirectly by causing stress (Figure S4E).
Furthermore, Rtn1-GFP was unaffected, showing that Roq1-
induced protein degradation was selective (Figure 3F). These
results show that induction of ROQ1 tran-
scription is a critical step in SHRED.
Ynm3 Cleaves Roq1 to Activate ItWe next focused on Ynm3. Catalytically
inactive Ynm3(S236A) (Padmanabhan
et al., 2009) did not support stress-
induced degradation of Rtn1Pho8*-GFP,
despite normal expression levels (Figures
4A and S5A). Hence, Ynm3 protease ac-
tivity is required for reporter degradation.
Functional Ynm3-GFP localizes to the nu-
cleus (Padmanabhan et al., 2009) (Figures
S5B and S5C) and does not undergo
nucleocytoplasmic shuttling, even during
stress (Belanger et al., 2009). This
localization was incongruent with Ynm3 directly cleaving
Rtn1Pho8*-GFP, which mainly localizes to the peripheral ER.
Instead, the localization of Ynm3 raised the possibility that its
relevant substrate has access to the nucleus.
Roq1 consists of only 104 amino acids, likely allowing it to
freely enter the nucleus. Therefore, we tested whether Roq1
was a substrate of Ynm3. We generated C-terminally tagged
Roq1-hemagglutinin (HA), which restored Rtn1Pho8*-GFP
degradation in Droq1 cells when expressed from the endoge-
nous ROQ1 promoter (Figure S5D). Detection of Roq1-HA by
western blotting required expression from the strong GPD pro-
moter, in line with the very low abundance of the Roq1 protein
(Ghaemmaghami et al., 2003). In wild-type cells, Roq1-HA
Molecular Cell 70, 1–13, June 21, 2018 5
![Page 7: SHRED Is a Regulatory Cascade that Reprograms Ubr1 ... · Dale Muzzey, Georg H.H. Borner, Sebastian Schuck Correspondence s.schuck@zmbh.uni-heidelberg.de In Brief Szoradi et al. uncover](https://reader030.vdocuments.us/reader030/viewer/2022041217/5e06b3823924f726c567acbd/html5/thumbnails/7.jpg)
∆ubr1∆ubr1 + pUBR1
∆ubr1 + pUBR1(G173R)∆ubr1 + pUBR1(D318N)
repo
rter l
evel
s (%
)
B
0 1 2 3 4 5tunicamycin treatment (h)
0
20
40
60
80
100
Rtn1Pho8*-GFPARecognition of type-1and type-2 N-terminalresidues by Ubr1
type-1site
type-2site
additionalsite(s)
LFWYI
R-DR-E
RKH
DE
NQ
D
fold
cha
nge
mC
herr
y/sf
GFP
(log
2)
-2
-1.5
-1
-0.5
0
1.5
1
1.5
2
GEM GAL-ROQ1 Ubiquitin-X-mCherry-sfGFP
stabilized by Roq1overexpression
destabilized by Roq1overexpression
K GR H N D Q E T M CA S V FP W L I Y
E
time (min)
Pgk1
full-length
cleaved
0 5 13 20
cycloheximide
Roq1-HA(74)
C
Roq1∆21-HA(74)
Roq1∆21(R22A)-HA(74)
FLAG-ubr1(G173R)
FLAG-Ubr1
Westernanti-FLAG
Westernanti-HA
lysate (6% of IP input) IP anti-HA
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
Ubr1
Roq1∆21
Figure 5. Cleaved Roq1 Regulates Ubr1 through the Ubr1 Type-1 Site and Is Rapidly Degraded
(A) Schematic illustrating recognition of N-end rule substrates by Ubr1.
(B) Flow cytometry of cellular Rtn1Pho8*-GFP levels after tunicamycin treatment. Error bars represent mean ± SEM; n = 3.
(C) Western blot of FLAG and HA from total cell lysates and anti-HA immunoprecipitates from Dubr1 Droq1 cells expressing FLAG-Ubr1 and Roq1D21-HA(74)
variants where indicated. IP, immunoprecipitation.
(D) Flow cytometry of mCherry/sfGFP fluorescence in untreated and estradiol-treated cells expressing a ubiquitin-X-mCherry-sfGFP N-end rule substrate and
Roq1 under the estradiol-inducible promoter system. Plotted on a log2 scale is the fold change of mCherry/sfGFP fluorescence upon estradiol treatment for 6 hr.
(legend continued on next page)
6 Molecular Cell 70, 1–13, June 21, 2018
Please cite this article in press as: Szoradi et al., SHRED Is a Regulatory Cascade that Reprograms Ubr1 Substrate Specificity for Enhanced ProteinQuality Control during Stress, Molecular Cell (2018), https://doi.org/10.1016/j.molcel.2018.04.027
![Page 8: SHRED Is a Regulatory Cascade that Reprograms Ubr1 ... · Dale Muzzey, Georg H.H. Borner, Sebastian Schuck Correspondence s.schuck@zmbh.uni-heidelberg.de In Brief Szoradi et al. uncover](https://reader030.vdocuments.us/reader030/viewer/2022041217/5e06b3823924f726c567acbd/html5/thumbnails/8.jpg)
Please cite this article in press as: Szoradi et al., SHRED Is a Regulatory Cascade that Reprograms Ubr1 Substrate Specificity for Enhanced ProteinQuality Control during Stress, Molecular Cell (2018), https://doi.org/10.1016/j.molcel.2018.04.027
showed an apparent molecular weight of 15 kDa (Figure 4B) and
was occasionally detected as a double band (data not shown).
Proteasome inhibition raised the levels of full-length Roq1-HA
and revealed additional bands, including a second double
band at 13 kDa that was absent in Dynm3 cells. The simplest
interpretation of this finding is that Ynm3 cleaves Roq1. The
fact that Roq1-HA fragments lacking approximately 2 kDa could
be detected with an antibody against the C-terminal HA tag indi-
cates cleavage near the N terminus. Cleavage of Roq1-HA
appeared to be inefficient, possibly because the HA tag compro-
mised substrate recognition by Ynm3. Therefore, we inserted an
HA tag after residue 74. The resulting internally tagged Roq1,
called Roq1-HA(74), was functional (Figure S5D). Western blot-
ting showed two double bands at 15 and 13 kDa, even without
proteasome inhibition. The bands at 13 kDa were abolished in
Dynm3 cells (Figure 4C). Thus, Ynm3 likely also directly cleaves
Roq1-HA(74). The reason for the appearance of full-length and
cleaved Roq1 as double bands remains to be established.
To determine the size of cleaved Roq1, we used Roq1 trunca-
tions as molecular rulers. We generated N-terminal ubiquitin fu-
sions of Roq1-HA(74) lacking the first 18 to 23 residues, called
Ub-Roq1D18-HA(74) to Ub-Roq1D23-HA(74). The ubiquitin moi-
ety is removed after translation, yielding truncated Roq1 (Bach-
mair et al., 1986). The small sizes of these variants allowed their
separation by tricine-SDS-PAGE. All truncations appeared as
double bands, similar to cleaved Roq1 (Figure 4D). Cleaved
Roq1 derived from full-length Roq1-HA(74) had the same
apparent molecular weight as artificially created Roq1D21-
HA(74), suggesting Roq1D21 as the most likely native cleavage
fragment. We hypothesized that Ynm3 cleaves Roq1 to activate
it and that the active form is N-terminally truncated Roq1. If so,
expression of a Roq1 cleavagemimic should obviate the require-
ment for Ynm3. Indeed, Roq1D21 fully restored degradation of
Rtn1Pho8*-GFP in Dynm3 Droq1 cells. In contrast, Roq1D20
and Roq1D22, the next best candidate cleavage fragments
based on electrophoretic mobility, could not bypass Ynm3 (Fig-
ure 4E, orange box). These results identify Roq1D21 as the
native, physiologically active cleavage fragment and show that
the sole essential function of Ynm3 in SHRED is to cleave
Roq1 after leucine-21.
Intriguingly, Roq1D23 also bypassed Ynm3, even though its
electrophoretic mobility indicated that it was smaller than the
native Roq1 cleavage fragment (Figure 4D and orange box in Fig-
ure 4E). Therefore, we tested additional truncations, ranging
from Roq1D7 to D25. Revealingly, all Roq1 variants with an
N-terminal arginine, lysine, aspartate, asparagine, or glutamine
bypassed Ynm3 (Figure 4E). Proteins starting with aspartate,
asparagine, or glutamine can gain an N-terminal arginine residue
by de-amidation and arginylation (Varshavsky, 2011). These ob-
servations suggest that cleaved Roq1 needs a positively
charged N-terminal residue to be active. To test this notion, we
mutated the N-terminal arginine-22 in Roq1D21 to alanine,
leucine, or lysine. R22A and R22L were inactive, whereas
Letters below the graph indicate the identity of the N-terminal residues. Increa
destabilization of N-end rule substrates by Roq1 overexpression, respectively. D
(E) Western blot of HA and Pgk1.
See also Figure S6.
R22K behaved like wild-type Roq1D21 (Figure 4F). Introducing
these mutations into full-length Roq1 gave the same results,
confirming that a positively charged residue at position 22 was
required (Figure 4G). To probe the relationship between Roq1
activity and cleavage, we mutated leucine-21 in full-length
Roq1. Mutation to proline inactivated Roq1, but mutation to
the structurally similar valine yielded active Roq1 (Figure 4G).
The impact of these mutations on Roq1 functionality correlated
with their effects on cleavage: the L21P mutation strongly dimin-
ished generation of Roq1D21, whereas the functionally neutral
L21V mutation permitted cleavage after residue 21 (Figure 4H).
Hence, activation of Roq1 requires a proteolytic processing
step that exposes a positively charged N-terminal residue.
Cleaved Roq1 Regulates Ubr1 and Is Rapidly DegradedArginine and lysine are destabilizing N-terminal residues and are
recognized by Ubr1 as part of the N-end rule (Varshavsky, 2011).
Two substrate-binding sites for N-terminal residues have been
delineated in Ubr1: the type-1 site for positively charged residues
and the type-2 site for bulky hydrophobic residues. In addition,
Ubr1 contains at least one additional binding site for substrates
with internal degradation determinants (Figure 5A). The type-2
site can be mutated independently of the type-1 site, whereas
disruption of the type-1 site tends to affect also the type-2 site
(Kitamura and Fujiwara, 2013; Tasaki et al., 2009; Xia et al.,
2008). In our system, Ubr1(D318N) was a specific type-2 site
mutant and Ubr1(G173R) was a type-1 site mutant that retained
partial activity toward type-2 N-end rule substrates (Figure S6A).
Using these mutants, we tested which sites were required for
stress-induced misfolded protein degradation. Ubr1(D318N)
restored degradation of Rtn1Pho8*-GFP inDubr1 cells, whereas
Ubr1(G173R) was completely inactive (Figure 5B). Hence,
degradation of Rtn1Pho8*-GFP specifically requires the Ubr1
type-1 site.
The Ubr1 type-1 site is unlikely to directly recognize
Rtn1Pho8*-GFP. First, Rtn1 starts with methionine-serine. Sec-
ond, the divergent behaviors of Rtn1-GFP and Rtn1Pho8*-GFP
indicate that the relevant degradation determinant resides in
the internal Pho8* domain. However, besides recognizing
N-end rule substrates, the type-1 site can mediate allosteric
regulation. Specifically, occupancy of the type-1 and type-2
sites by dipeptides relieves autoinhibition of a third, unmapped
substrate-binding site (Du et al., 2002). Therefore, we hypothe-
sized that the positively charged N terminus of cleaved Roq1
interacts with and regulates Ubr1 through the type-1 site to pro-
mote recognition of misfolded proteins.
To test this model, we performed co-immunoprecipitation ex-
periments with Roq1D21 and Ubr1. Roq1D21-HA(74) interacted
with FLAG-Ubr1 (Figure 5C). Importantly, this interaction was not
detected with Roq1D21(R22A) or Ubr1(G173R). These findings
indicate that cleaved Roq1 binds to the Ubr1 type-1 site through
its N-terminal arginine. Our model furthermore implies that
cleaved Roq1 interferes with the recognition of type-1 N-end
sed and decreased mCherry/sfGFP fluorescence indicates stabilization and
ata are the mean of three experiments.
Molecular Cell 70, 1–13, June 21, 2018 7
![Page 9: SHRED Is a Regulatory Cascade that Reprograms Ubr1 ... · Dale Muzzey, Georg H.H. Borner, Sebastian Schuck Correspondence s.schuck@zmbh.uni-heidelberg.de In Brief Szoradi et al. uncover](https://reader030.vdocuments.us/reader030/viewer/2022041217/5e06b3823924f726c567acbd/html5/thumbnails/9.jpg)
0 1 2 3 4tunicamycin treatment (h)
5
C
repo
rter l
evel
s (%
)
0
20
40
60
80
100
B
Tm (h)
CFTR-HA
Pgk1
Tm (h)
CFTR-HA
Pgk1
100 68 ± 1 56 ± 5 100 65 ± 3 54 ± 6
0 3 5 0 3 5
∆hrd1 ∆doa10 ∆ynm3 ∆hrd1 ∆doa10 ∆roq1
100 55 ± 2 30 ± 2 100 70 ± 1 69 ± 5
0 3 5 0 3 5
∆hrd1 ∆doa10 ∆hrd1 ∆doa10 ∆ubr1
A
WT∆u
br1∆y
nm3
∆roq
1W
T∆u
br1∆y
nm3
∆roq
1W
T∆u
br1∆y
nm3
∆roq
10
20
40
60
80
repo
rter l
evel
s (%
)
Rtn1Pho8*-GFP Rtn1CPY*-GFP Yop1Pho8*-GFP
Dre
porte
r lev
els
(%)
0
20
40
60
80
100
Luciferase(DM)-mCherry
0 1 2 3 4 5tunicamycin treatment (h)
WT∆ubr1∆ynm3∆roq1
Luciferase(DM)-mCherryLuciferase-mCherry
Figure 6. SHRED Mediates Degradation of
Misfolded ER Membrane and Cytosolic
Proteins
(A) Flow cytometry of cellular GFP levels after
tunicamycin (Tm) treatment for 5 hr. Error bars
represent mean ± SEM; n = 3.
(B) Western blot of HA and Pgk1 after Tm treat-
ment. Values are mean ± SEM; n = 3 and for each
strain indicate HA signal relative to Pgk1 signal
normalized to t = 0.
(C) Flow cytometry of cellular Luciferase-mCherry
and Luciferase(DM)-mCherry levels after Tm
treatment. Error bars represent mean ± SEM; n = 7.
(D) Flow cytometry of cellular Luciferase(DM)-
mCherry levels after Tm treatment. Error bars
represent mean ± SEM; n = 3.
See also Figure S7.
Please cite this article in press as: Szoradi et al., SHRED Is a Regulatory Cascade that Reprograms Ubr1 Substrate Specificity for Enhanced ProteinQuality Control during Stress, Molecular Cell (2018), https://doi.org/10.1016/j.molcel.2018.04.027
rule substrates. To test this prediction, we used ubiquitin-fused
X-mCherry-sfGFP constructs as N-end rule substrates, with X
representing one of the 20 proteinogenic amino acids.
mCherry-sfGFP consists of slow-maturing mCherry and fast-
maturing superfolder GFP (sfGFP). Because of these different
maturation times, the mCherry/sfGFP fluorescence ratio in-
creases with protein age and provides a readout for the stability
of X-mCherry-sfGFP variants (Khmelinskii et al., 2012). Expres-
sion of Roq1 stabilized variants starting with a type-1 residue
(R, K, H, N, D, and Q), showing that Roq1 interfered with their
degradation (Figure 5D). In contrast, variants starting with a
type-2 residue (W, F, L, I, and Y) were destabilized, showing
that Roq1 accelerated their degradation. These effects strictly
depended on Ubr1 and Ynm3 (Figure S6B). Thus, cleaved
Roq1 competes with N-end rule substrates for the Ubr1 type-1
site. Accordingly, Roq1 diminished the interaction between
Ubr1 and the type-1 substrate R-mCherry-sfGFP as judged
by co-immunoprecipitation experiments (Figure S6C). The
enhanced degradation of type-2 substrates by Roq1 agrees
with the previous finding that occupancy of the type-1 site accel-
erates turnover of type-2 substrates (Baker and Varshav-
sky, 1991).
We then sought to determine how Ubr1 is inactivated again.
Full-length and cleaved Roq1-HA(74) showed half-lives of about
5 min in cycloheximide chase experiments (Figure 5E). Protea-
some inhibition stabilized cleaved Roq1 (Figure S6D). Cleaved
Roq1 had about 2-fold higher steady-state levels in the absence
of Ubr1, but its degradation was only slightly delayed, indicating
aminor role for Ubr1 in Roq1 turnover (Figure S6D). These results
show that Roq1 is highly unstable and suggest that its levels
closely follow ROQ1 gene activity. Hence, activation of Ubr1 is
8 Molecular Cell 70, 1–13, June 21, 2018
rapidly terminated once stress induction
of the ROQ1 gene ceases.
SHRED Mediates Degradation ofDiverse Membrane and CytosolicProteinsTo explore the scope of protein degrada-
tion by SHRED, we first examined addi-
tional model substrates. We compared
Rtn1Pho8*-GFP, Rtn1CPY*-GFP, and Yop1Pho8*-GFP. The
latter contained the reticulon-like ER protein Yop1 and was
stable at steady state (Figure S7A). Tunicamycin stimulated
degradation of all three reporters through SHRED (Figure 6A).
Degradation was more strongly inhibited in Dubr1 than in
Dynm3 or Droq1 cells, indicating that Ubr1 has additional
stress-induced degradative roles. Next, we analyzed human
cystic fibrosis transmembrane conductance regulator (CFTR),
a polytopic transmembrane protein that is constitutively
degraded through Hrd1 and Doa10 (Gnann et al., 2004; Zhang
et al., 2001). ER stress upregulates ERAD (Travers et al., 2000),
so that these ubiquitin ligases are likely relevant also for stress-
induced CFTR degradation. Therefore, we assessed the role of
SHRED in the degradation of CFTR in a Dhrd1 Ddoa10 back-
ground. Tunicamycin still accelerated CFTR degradation in this
background, which required Ubr1, Ynm3, and Roq1 (Figure 6B).
To determine whether SHRED also targets cytosolic proteins,
we tested Luciferase-mCherry and Luciferase(DM)-mCherry.
These reporters are based on firefly luciferase, with the latter car-
rying destabilizing mutations (Gupta et al., 2011). Accordingly,
Luciferase(DM)-mCherry was turned over more rapidly at steady
state (Figure S7B). Furthermore, stress selectively promoted the
degradation of Luciferase(DM)-mCherry, which required Ubr1,
Ynm3, and Roq1 (Figures 6C and 6D). Similarly, stress stimu-
lated the SHRED-dependent degradation of stGnd1-mCherry,
a misfolded cytosolic protein derived from yeast Gnd1 (Heck
et al., 2010) (Figures S7C and S7D). Hence, SHRED mediates
stress-induced degradation of a range of misfolded ER mem-
brane and cytosolic proteins.
To search for endogenous SHRED substrates, we acutely
overexpressed Roq1 in wild-type and Dubr1 cells by means of
![Page 10: SHRED Is a Regulatory Cascade that Reprograms Ubr1 ... · Dale Muzzey, Georg H.H. Borner, Sebastian Schuck Correspondence s.schuck@zmbh.uni-heidelberg.de In Brief Szoradi et al. uncover](https://reader030.vdocuments.us/reader030/viewer/2022041217/5e06b3823924f726c567acbd/html5/thumbnails/10.jpg)
ER (Rtn1Pho8*-GFP)ER (Rtn1Pho8*-GFP)cytoplasmERcytoplasmcytoplasm and ERcytoplasmnucleusnucleusnucleusnucleusplasma membraneGolgi complexvacuole membranecytoplasmmitochondriacytoplasmcytoplasmnucleusmitochondria
000
10202000
101020202020202000
2020
GFPPho8Caf20Mmm1Ncs6Srp14Mum2Srb7Srb2Rnt1Rsa3Fcy2Cog7Dap2Hst2Ddl1Aap1Yfr006wEaf5Agc1
FDR (%)
change by Roq1 oe
in WT
change by deletion of
UBR1localization
A Candidate SHRED substrates
reduced by >25% reduced by 10-25% changed by <10%
C
leve
ls re
lativ
e to
WT
1
0.8
0
0.2
0.4
0.6
WT WT +Roq1 oe
∆ubr1 ∆ubr1 + Roq1 oe
PTR2 mRNA
-log 10
p-v
alue
B
CIN8
PTR2
ROQ1
-6 -4 -2 0 2 4 6fold change Δubr1+Roq1 / Δubr1 (log2)
0
1
2
3
4
5
UBR1PTR2
-6 -4 -2 0 2 4 6fold change Δubr1 / WT(log2)
0
1
2
3
4
5
UBR1
PTR2ROQ1
-6 -4 -2 0 2 4 6fold change WT+Roq1 / WT (log2)
0
1
2
3
4
5
E
Roq1ROQ1 gene
stress
cleavageexposingarginine-22
Ynm3
Ub
proteasome
misfoldedprotein
Ubr1 Roq1+
rapidturnover
D
WT
∆ubr1
∆roq1
∆ubr1 ∆roq1
WT
∆ubr1
∆roq1
∆ubr1 ∆roq1
untreated
+ 4%ethanol
(legend on next page)
Molecular Cell 70, 1–13, June 21, 2018 9
Please cite this article in press as: Szoradi et al., SHRED Is a Regulatory Cascade that Reprograms Ubr1 Substrate Specificity for Enhanced ProteinQuality Control during Stress, Molecular Cell (2018), https://doi.org/10.1016/j.molcel.2018.04.027
![Page 11: SHRED Is a Regulatory Cascade that Reprograms Ubr1 ... · Dale Muzzey, Georg H.H. Borner, Sebastian Schuck Correspondence s.schuck@zmbh.uni-heidelberg.de In Brief Szoradi et al. uncover](https://reader030.vdocuments.us/reader030/viewer/2022041217/5e06b3823924f726c567acbd/html5/thumbnails/11.jpg)
Please cite this article in press as: Szoradi et al., SHRED Is a Regulatory Cascade that Reprograms Ubr1 Substrate Specificity for Enhanced ProteinQuality Control during Stress, Molecular Cell (2018), https://doi.org/10.1016/j.molcel.2018.04.027
the estradiol-inducible system and analyzed the resulting prote-
omic changes by quantitative mass spectrometry. Roq1 overex-
pression decreased Rtn1Pho8*-GFP levels by about 35% in
wild-type cells, but not in Dubr1 mutants. We applied a series
of statistical filters with false discovery rates (FDRs) of 0%,
10%, and 20% and identified 5, 8, and 18 additional proteins
whose levels were reduced by >25% upon Roq1 overexpression
in wild-type cells (Figure 7A, third column) but changed by <10%
upon Roq1 overexpression in Dubr1 mutants (data not shown).
Of these candidate substrates, Caf20, Mmm1, Ncs6, and
Srp14 showed a <10% difference between wild-type and
Dubr1 cells in the absence of Roq1 overexpression and thus
closely matched the behavior of Rtn1Pho8*-GFP (Figure 7A,
fourth column). These proteins localize to the cytoplasm and
the ER membrane and are involved in diverse processes,
including translation initiation, ER-mitochondria tethering, tRNA
thiolation, and protein targeting to the ER.
In contrast to Rtn1Pho8*-GFP, at least four candidate sub-
strates (Aap1, Yfr006w, Eaf5, and Agc1) were also clearly
reduced by deletion of UBR1 alone. Hence, these proteins are
downregulated by Ubr1 when SHRED is active but are upregu-
lated by Ubr1 when SHRED is inactive. A complementary ana-
lysis aimed at low-abundance proteins additionally identified
Ptr2 as a protein strikingly exhibiting this behavior, i.e., Ptr2
levels were reduced by Roq1 overexpression in wild-type cells
and by deletion of UBR1, but Roq1 overexpression had no
further effect on Ptr2 levels in Dubr1 cells (Figure 7B). Ptr2 im-
ports peptides at the plasmamembrane. These peptides alloste-
rically activate Ubr1 to degrade Cup9, a transcriptional repressor
acting on the PTR2 gene. Degradation of Cup9, therefore, leads
to increased Ptr2 levels (Turner et al., 2000). The strong decrease
in Ptr2 protein levels upon Roq1 overexpression suggested that
Roq1 interferes with Ubr1-mediated degradation of Cup9, re-
sulting in repression of the PTR2 gene. Cup9 protein levels
were too low to be detectable. However, Roq1 overexpression
strongly reduced PTR2 mRNA levels in wild-type cells and had
no effect on the already diminished levels in Dubr1 cells (Fig-
ure 7C). These data show that Roq1 stimulates Ubr1 to degrade
certain misfolded and native proteins and additionally inhibits
Ubr1-mediated degradation of Cup9. Together with the
opposing effects of Roq1 on type-1 and type-2 N-end rule sub-
strates, these results indicate that Roq1 profoundly changes
Ubr1 substrate specificity.
Finally, to begin to address the physiological role of SHRED,
we analyzed cell growth in the presence of the folding stressor
ethanol. Deletion of UBR1 rendered cells ethanol sensitive (Fig-
ure 7D), as reported previously (Heck et al., 2010). Deletion of
ROQ1 had a milder phenotype but also caused ethanol sensi-
tivity. Deletion of ROQ1 in Dubr1 cells did not exacerbate their
Figure 7. SHRED Targets Endogenous Proteins and Helps Counteract
(A) Candidate endogenous SHRED substrates. oe, overexpression.
(B) Global effects of Roq1 overexpression and UBR1 deletion on protein express
between two strains; the y axis shows the result of a t test for that difference (two-t
(C) PTR2 mRNA levels in WT and Dubr1 cells without and with ROQ1 overexpr
represent mean ± SEM; n = 4.
(D) Growth assay of cells on regular and ethanol-containing plates. Series repres
(E) Model of SHRED.
10 Molecular Cell 70, 1–13, June 21, 2018
growth defect, suggesting that lack of Roq1 is inconsequential
in the absence of Ubr1. These results are consistent with the
model that Roq1 helps to counteract protein folding stress by
regulating Ubr1.
DISCUSSION
We have found that Roq1, Ynm3, and Ubr1 act in a stress-induc-
ible pathway to mediate proteasomal degradation of misfolded
ERmembrane and cytosolic proteins. Roq1 is a conditionally ex-
pressed regulator that is cleaved by the protease Ynm3 and re-
programs the ubiquitin ligase Ubr1 through its newly exposed
N-terminal arginine. When ROQ1 transcription declines upon
stress resolution, rapid pathway inactivation is ensured by the
instability of the Roq1 protein (Figure 7E). We name this pathway
SHRED, for stress-induced homeostatically regulated protein
degradation. By virtue of being a branch of the environmental
stress response, SHRED makes protein degradation responsive
to a broad range of stimuli.
A key step in SHRED is induction of ROQ1 transcription. The
ROQ1 promoter contains a stress response element (consensus
sequence AGGGG) and, thus, a binding site for the stress-
responsive transcription factors Msn2/4 (Verghese et al.,
2012). In addition, it is bound by the heat shock transcription fac-
tor Hsf1 (Yamamoto et al., 2005). Therefore, multiple signaling
mechanisms converge onto this promoter, explaining why it re-
sponds to numerous inputs. Of note, ROQ1 mRNA levels are
also strongly increased by expression of the SHRED substrate
CFTR (Buck et al., 2015) and by an accumulation of untranslo-
cated and, presumably, misfolded secretory proteins in the
cytosol (Mutka and Walter, 2001).
The Roq1 protein is cleaved by the HtrA endopeptidase Ynm3
between leucine-21 and arginine-22. This cleavage site is
consistent with the preference of the bacterial and human
Ynm3 homologs, DegP/Q and HtrA2, for aliphatic residues at
the position preceding the scissile peptide bond (Kolmar et al.,
1996; Vande Walle et al., 2007). Subsequently, cleaved Roq1
regulates Ubr1. It has been shown that dipeptides synergistically
activate Ubr1 through its type-1 and type-2 substrate-binding
sites, promoting degradation of the transcriptional repressor
Cup9 (Du et al., 2002). In contrast, regulation of Ubr1 by Roq1 in-
volves only the type-1 site. This regulation results in slowed
degradation of Ubr1 type-1 substrates, accelerated degradation
of Ubr1 type-2 substrates, inhibition of Cup9 degradation, and
enhanced degradation of misfolded proteins. Thus, Roq1 repro-
grams Ubr1 substrate preference. Exactly how Roq1 achieves
this complex modulation—for instance, through allosteric regu-
lation of Ubr1 or by acting as a substrate adaptor—remains
to be uncovered. However, it is clear that Ubr1 is a versatile
Protein Folding Stress
ion. For each protein, the x axis shows the average fold change of expression
ailed; n = 4). The ‘‘volcano’’ lines indicate thresholds of significance (FDR = 5%).
ession. Data are normalized to WT without ROQ1 overexpression. Error bars
ent 5-fold dilutions from one step to the next.
![Page 12: SHRED Is a Regulatory Cascade that Reprograms Ubr1 ... · Dale Muzzey, Georg H.H. Borner, Sebastian Schuck Correspondence s.schuck@zmbh.uni-heidelberg.de In Brief Szoradi et al. uncover](https://reader030.vdocuments.us/reader030/viewer/2022041217/5e06b3823924f726c567acbd/html5/thumbnails/12.jpg)
Please cite this article in press as: Szoradi et al., SHRED Is a Regulatory Cascade that Reprograms Ubr1 Substrate Specificity for Enhanced ProteinQuality Control during Stress, Molecular Cell (2018), https://doi.org/10.1016/j.molcel.2018.04.027
molecular machine that possesses distinct modes of regulation
for different physiological purposes.
Homeostatic feedback regulation of a pathway requires that
its activity can be dynamically tuned up and down. For SHRED,
this is achieved by stress inducibility of the ROQ1 gene, together
with instability of the Roq1 protein. Rapid protein turnover en-
sures tight coupling of stress levels, ROQ1 transcription, and
Roq1 protein levels. Hence, SHRED activity swiftly returns to
basal levels when misfolded proteins have been eliminated.
This is reminiscent of the UPR and the regulation of proteasome
biogenesis by the transcription factors Hac1 and Rpn4, both of
which are extremely short lived (Kawahara et al., 1997; Xie and
Varshavsky, 2001).
Misfolded proteins can be repaired or degraded. Repair by
refolding is energetically less expensive than degradation
and re-synthesis. Therefore, protein repair is likely preferred
under otherwise favorable conditions (Buchberger et al.,
2010). During stress, increased misfolding may eventually
overwhelm chaperone capacity and imperil cell homeostasis.
Under such conditions, averting dysfunction presumably takes
precedent over energy considerations, and misfolded protein
degradation is favored. Stress may, thus, shift the balance be-
tween repair and degradation toward degradation, resulting in
more aggressive quality control (Shao and Hegde, 2016).
SHRED helps mediate this shift during adaptation to stress.
Hence, SHRED appears to be similar to the induction of
ERAD by the UPR and the augmentation of proteasome
biogenesis by Hsf1 and Rpn4 (Hahn et al., 2006; Travers
et al., 2000). SHRED, however, tunes the quality control ma-
chinery at the post-translational level. Interestingly, SHRED
is also activated by nutrient scarcity, which is unlikely to cause
widespread protein misfolding. SHRED may, therefore, addi-
tionally function in protein degradation for regulatory pur-
poses, in line with the identification of native, folding-compe-
tent proteins as SHRED substrates.
Could SHRED be evolutionarily conserved? Roq1 belongs
to the ubiquitous family of hydrophilin proteins, which have
only limited sequence similarity and are thought to be intrinsi-
cally disordered (Battaglia et al., 2008). Given these features
and the small size of Roq1, it is unsurprising that metazoan
sequence homologs are not obvious. Functional analogs,
however, remain possible. HtrA proteases related to Ynm3
are present from bacteria to mammals and function in protein
quality control, mitochondrial homeostasis, and apoptosis
(Clausen et al., 2011; Desideri and Martins, 2012; Fahrenkrog,
2011; Vande Walle et al., 2008). Additionally, human HtrA2 has
been implicated in ERAD (Huttunen et al., 2007). Ubr1 is also
conserved in mammals, and the type-1 sites of yeast and hu-
man Ubr1 are structurally similar (Choi et al., 2010; Matta-Ca-
macho et al., 2010). Moreover, mouse Ubr1 acts in the N-end
rule pathway but also helps to degrade misfolded proteins
(Sultana et al., 2012). Finally, the regulatory principles of
SHRED may be shared between yeast and mammals. Human
HtrA2 is imported into the mitochondrial intermembrane
space where it is cleaved, possibly by itself (Seong et al.,
2004). Induction of apoptosis triggers HtrA2 release into the
cytosol, where it antagonizes inhibitors of apoptosis (IAPs).
It does so by means of an IAP-binding motif at the extreme
N terminus of cleaved HtrA2. This activity depends on the
new N-terminal residue—an alanine, in this case (Martins,
2002). IAPs are ubiquitin ligases, which, upon interaction
with an IAP-binding motif, ubiquitinate themselves and cause
their own degradation (Buetow and Huang, 2016). Thus, in
analogy to SHRED, cleavage of HtrA2 creates a regulator
that activates ubiquitin ligases with its new N terminus. Over-
all, these intriguing clues remain to be connected, but they
raise the possibility that mechanisms related to SHRED exist
in higher eukaryotes.
Deteriorating quality control during stress and aging is a key
factor for the onset of neurodegenerative diseases. Moreover,
cancer cells suffering from chronic folding stress depend on
heightened quality control for survival (Balchin et al., 2016; Lab-
badia andMorimoto, 2015). Thus, both stimulating and inhibiting
quality control may have therapeutic benefits. A promising strat-
egy to reap these benefits is to pharmacologically target path-
ways that regulate quality control, including the UPR, the HSR,
and possible mammalian counterparts of SHRED.
STAR+METHODS
Detailed methods are provided in the online version of this paper
and include the following:
d KEY RESOURCES TABLE
d CONTACT FOR REAGENT AND RESOURCE SHARING
d EXPERIMENTAL MODEL AND SUBJECT DETAILS
d METHOD DETAILS
B Plasmid construction
B Yeast strain generation
B Growth conditions
B Western blotting
B Pho8 assay
B Light microscopy
B Subcellular fractionation
B Flow cytometry
B Genetic screen
B Growth assays
B Quantitative real-time PCR
B Immunoprecipitation
B Mass spectrometry
d QUANTIFICATION AND STATISTICAL ANALYSIS
d DATA AND SOFTWARE AVAILABILITY
SUPPLEMENTAL INFORMATION
Supplemental Information includes seven figures and two tables and can be
found with this article online at https://doi.org/10.1016/j.molcel.2018.04.027.
ACKNOWLEDGMENTS
We are indebted to Peter Walter for inspiration, generosity, and support. We
thank Charles Boone, Jeff Brodsky, Ulrich Hartl, Erin O’Shea, and David
Pincus for reagents; the Flow Cytometry and FACS facility at the ZMBH and
the Nikon Imaging Center at Heidelberg University for assistance; and Bernd
Bukau, Claudio Joazeiro, Anton Khmelinskii, Michael Knop, Marius Lemberg,
Frauke Melchior, Axel Mogk, Dimitrios Papagiannidis, and Anne-Lore Schlaitz
for advice and comments on the manuscript. This work was funded by grant
EXC 81 from the Deutsche Forschungsgemeinschaft.
Molecular Cell 70, 1–13, June 21, 2018 11
![Page 13: SHRED Is a Regulatory Cascade that Reprograms Ubr1 ... · Dale Muzzey, Georg H.H. Borner, Sebastian Schuck Correspondence s.schuck@zmbh.uni-heidelberg.de In Brief Szoradi et al. uncover](https://reader030.vdocuments.us/reader030/viewer/2022041217/5e06b3823924f726c567acbd/html5/thumbnails/13.jpg)
Please cite this article in press as: Szoradi et al., SHRED Is a Regulatory Cascade that Reprograms Ubr1 Substrate Specificity for Enhanced ProteinQuality Control during Stress, Molecular Cell (2018), https://doi.org/10.1016/j.molcel.2018.04.027
AUTHOR CONTRIBUTIONS
Conceptualization, S.S. and T.S.; Software, D.M.; Formal Analysis, G.H.H.B.;
Investigation, P.W.B., J.D.-M., V.K.C., D.N.I., K.L., E.M.G.-R., K.S., R.M.S.,
S.S., and T.S.; Writing – Original Draft, S.S.; Writing – Review & Editing, S.S.
and T.S.
DECLARATION OF INTERESTS
The authors declare no competing interests.
Received: November 11, 2017
Revised: March 12, 2018
Accepted: April 27, 2018
Published: May 31, 2018
SUPPORTING CITATIONS
The following reference appears in the Supplemental Information: Schuck
et al. (2014).
REFERENCES
Bachmair, A., Finley, D., and Varshavsky, A. (1986). In vivo half-life of a protein
is a function of its amino-terminal residue. Science 234, 179–186.
Baker, R.T., and Varshavsky, A. (1991). Inhibition of the N-end rule pathway in
living cells. Proc. Natl. Acad. Sci. USA 88, 1090–1094.
Balchin, D., Hayer-Hartl, M., and Hartl, F.U. (2016). In vivo aspects of protein
folding and quality control. Science 353, aac4354.
Battaglia, M., Olvera-Carrillo, Y., Garciarrubio, A., Campos, F., and
Covarrubias, A.A. (2008). The enigmatic LEA proteins and other hydrophilins.
Plant Physiol. 148, 6–24.
Belanger, K.D., Walter, D., Henderson, T.A., Yelton, A.L., O’Brien, T.G.,
Belanger, K.G., Geier, S.J., and Fahrenkrog, B. (2009). Nuclear localisation
is crucial for the proapoptotic activity of the HtrA-like serine protease
Nma111p. J. Cell Sci. 122, 3931–3941.
Buchberger, A., Bukau, B., and Sommer, T. (2010). Protein quality control in
the cytosol and the endoplasmic reticulum: brothers in arms. Mol. Cell 40,
238–252.
Buck, T.M., Jordan, R., Lyons-Weiler, J., Adelman, J.L., Needham, P.G.,
Kleyman, T.R., and Brodsky, J.L. (2015). Expression of three topologically
distinct membrane proteins elicits unique stress response pathways in the
yeast Saccharomyces cerevisiae. Physiol. Genomics 47, 198–214.
Buetow, L., and Huang, D.T. (2016). Structural insights into the catalysis and
regulation of E3 ubiquitin ligases. Nat. Rev. Mol. Cell Biol. 17, 626–642.
Choi, W.S., Jeong, B.-C., Joo, Y.J., Lee, M.-R., Kim, J., Eck, M.J., and Song,
H.K. (2010). Structural basis for the recognition of N-end rule substrates by the
UBR box of ubiquitin ligases. Nat. Struct. Mol. Biol. 17, 1175–1181.
Clausen, T., Kaiser, M., Huber, R., and Ehrmann, M. (2011). HTRA proteases:
regulated proteolysis in protein quality control. Nat. Rev. Mol. Cell Biol. 12,
152–162.
Cloutier, P., and Coulombe, B. (2013). Regulation of molecular chaperones
through post-translational modifications: decrypting the chaperone code.
Biochim. Biophys. Acta 1829, 443–454.
Cox, J., Hein, M.Y., Luber, C.A., Paron, I., Nagaraj, N., and Mann, M. (2014).
Accurate proteome-wide label-free quantification by delayed normalization
and maximal peptide ratio extraction, termed MaxLFQ. Mol. Cell.
Proteomics 13, 2513–2526.
Dang, N.X., and Hincha, D.K. (2011). Identification of two hydrophilins that
contribute to the desiccation and freezing tolerance of yeast
(Saccharomyces cerevisiae) cells. Cryobiology 62, 188–193.
Desideri, E., and Martins, L.M. (2012). Mitochondrial stress signalling: HTRA2
and Parkinson’s disease. Int. J. Cell Biol. 2012, 607929.
12 Molecular Cell 70, 1–13, June 21, 2018
Dohmen, R.J., Madura, K., Bartel, B., and Varshavsky, A. (1991). The N-end
rule is mediated by the UBC2(RAD6) ubiquitin-conjugating enzyme. Proc.
Natl. Acad. Sci. USA 88, 7351–7355.
Du, F., Navarro-Garcia, F., Xia, Z., Tasaki, T., and Varshavsky, A. (2002). Pairs
of dipeptides synergistically activate the binding of substrate by ubiquitin
ligase through dissociation of its autoinhibitory domain. Proc. Natl. Acad.
Sci. USA 99, 14110–14115.
Eisele, F., and Wolf, D.H. (2008). Degradation of misfolded protein in the cyto-
plasm is mediated by the ubiquitin ligase Ubr1. FEBS Lett. 582, 4143–4146.
Fahrenkrog, B. (2011). Nma111p, the pro-apoptotic HtrA-like nuclear serine
protease in Saccharomyces cerevisiae: a short survey. Biochem. Soc.
Trans. 39, 1499–1501.
Fang, N.N., Ng, A.H.M., Measday, V., and Mayor, T. (2011). Hul5 HECT ubiq-
uitin ligase plays amajor role in the ubiquitylation and turnover of cytosolicmis-
folded proteins. Nat. Cell Biol. 13, 1344–1352.
Fang, N.N., Chan, G.T., Zhu, M., Comyn, S.A., Persaud, A., Deshaies, R.J.,
Rotin, D., Gsponer, J., and Mayor, T. (2014). Rsp5/Nedd4 is the main ubiquitin
ligase that targets cytosolic misfolded proteins following heat stress. Nat. Cell
Biol. 16, 1227–1237.
Gardner, R.G., Nelson, Z.W., and Gottschling, D.E. (2005). Degradation-medi-
ated protein quality control in the nucleus. Cell 120, 803–815.
Gasch, A.P., Spellman, P.T., Kao, C.M., Carmel-Harel, O., Eisen, M.B., Storz,
G., Botstein, D., and Brown, P.O. (2000). Genomic expression programs in the
response of yeast cells to environmental changes. Mol. Biol. Cell 11,
4241–4257.
Ghaemmaghami, S., Huh, W.-K., Bower, K., Howson, R.W., Belle, A.,
Dephoure, N., O’Shea, E.K., and Weissman, J.S. (2003). Global analysis of
protein expression in yeast. Nature 425, 737–741.
Gnann, A., Riordan, J.R., andWolf, D.H. (2004). Cystic fibrosis transmembrane
conductance regulator degradation depends on the lectins Htm1p/EDEM and
the Cdc48 protein complex in yeast. Mol. Biol. Cell 15, 4125–4135.
Gupta, R., Kasturi, P., Bracher, A., Loew, C., Zheng, M., Villella, A., Garza, D.,
Hartl, F.U., and Raychaudhuri, S. (2011). Firefly luciferase mutants as sensors
of proteome stress. Nat. Methods 8, 879–884.
Hahn, J.-S., Neef, D.W., and Thiele, D.J. (2006). A stress regulatory network for
co-ordinated activation of proteasome expression mediated by yeast heat
shock transcription factor. Mol. Microbiol. 60, 240–251.
Hampton, R.Y., Koning, A., Wright, R., and Rine, J. (1996). In vivo examination
of membrane protein localization and degradation with green fluorescent pro-
tein. Proc. Natl. Acad. Sci. USA 93, 828–833.
Hao, N., and O’Shea, E.K. (2011). Signal-dependent dynamics of transcription
factor translocation controls gene expression. Nat. Struct. Mol. Biol.
19, 31–39.
Heck, J.W., Cheung, S.K., and Hampton, R.Y. (2010). Cytoplasmic protein
quality control degradation mediated by parallel actions of the E3 ubiquitin
ligases Ubr1 and San1. Proc. Natl. Acad. Sci. USA 107, 1106–1111.
Huttunen, H.J., Guenette, S.Y., Peach, C., Greco, C., Xia, W., Kim, D.Y.,
Barren, C., Tanzi, R.E., and Kovacs, D.M. (2007). HtrA2 regulates b-amyloid
precursor protein (APP) metabolism through endoplasmic reticulum-associ-
ated degradation. J. Biol. Chem. 282, 28285–28295.
Itzhak, D.N., Tyanova, S., Cox, J., and Borner, G.H.H. (2016). Global, quantita-
tive and dynamic mapping of protein subcellular localization. eLife 5, 1–36.
Kawahara, T., Yanagi, H., Yura, T., and Mori, K. (1997). Endoplasmic reticulum
stress-induced mRNA splicing permits synthesis of transcription factor
Hac1p/Ern4p that activates the unfolded protein response. Mol. Biol. Cell 8,
1845–1862.
Khmelinskii, A., Keller, P.J., Bartosik, A., Meurer, M., Barry, J.D., Mardin, B.R.,
Kaufmann, A., Trautmann, S., Wachsmuth, M., Pereira, G., et al. (2012).
Tandem fluorescent protein timers for in vivo analysis of protein dynamics.
Nat. Biotechnol. 30, 708–714.
Kitamura, K., and Fujiwara, H. (2013). The type-2 N-end rule peptide recogni-
tion activity of Ubr11 ubiquitin ligase is required for the expression of peptide
transporters. FEBS Lett. 587, 214–219.
![Page 14: SHRED Is a Regulatory Cascade that Reprograms Ubr1 ... · Dale Muzzey, Georg H.H. Borner, Sebastian Schuck Correspondence s.schuck@zmbh.uni-heidelberg.de In Brief Szoradi et al. uncover](https://reader030.vdocuments.us/reader030/viewer/2022041217/5e06b3823924f726c567acbd/html5/thumbnails/14.jpg)
Please cite this article in press as: Szoradi et al., SHRED Is a Regulatory Cascade that Reprograms Ubr1 Substrate Specificity for Enhanced ProteinQuality Control during Stress, Molecular Cell (2018), https://doi.org/10.1016/j.molcel.2018.04.027
Kolmar, H., Waller, P.R.H., and Sauer, R.T. (1996). The DegP and DegQ peri-
plasmic endoproteases of Escherichia coli: specificity for cleavage sites and
substrate conformation. J. Bacteriol. 178, 5925–5929.
Labbadia, J., and Morimoto, R.I. (2015). The biology of proteostasis in aging
and disease. Annu. Rev. Biochem. 84, 435–464.
Langmead, B., Trapnell, C., Pop, M., and Salzberg, S.L. (2009). Ultrafast and
memory-efficient alignment of short DNA sequences to the human genome.
Genome Biol. 10, R25.
Martins, L.M. (2002). The serine protease Omi/HtrA2: a second mammalian
protein with a Reaper-like function. Cell Death Differ. 9, 699–701.
Matta-Camacho, E., Kozlov, G., Li, F.F., and Gehring, K. (2010). Structural
basis of substrate recognition and specificity in the N-end rule pathway. Nat.
Struct. Mol. Biol. 17, 1182–1187.
Mutka, S.C., andWalter, P. (2001). Multifaceted physiological response allows
yeast to adapt to the loss of the signal recognition particle-dependent protein-
targeting pathway. Mol. Biol. Cell 12, 577–588.
Nillegoda, N.B., Theodoraki, M.A., Mandal, A.K., Mayo, K.J., Ren, H.Y.,
Sultana, R., Wu, K., Johnson, J., Cyr, D.M., and Caplan, A.J. (2010). Ubr1
and Ubr2 function in a quality control pathway for degradation of unfolded
cytosolic proteins. Mol. Biol. Cell 21, 2102–2116.
Padmanabhan, N., Fichtner, L., Dickmanns, A., Ficner, R., Schulz, J.B., and
Braus, G.H. (2009). The yeast HtrA orthologue Ynm3 is a protease with chap-
erone activity that aids survival under heat stress. Mol. Biol. Cell 20, 68–77.
Pincus, D., Aranda-Dıaz, A., Zuleta, I.A., Walter, P., and El-Samad, H. (2014).
Delayed Ras/PKA signaling augments the unfolded protein response. Proc.
Natl. Acad. Sci. USA 111, 14800–14805.
Prasad, R., Kawaguchi, S., and Ng, D.T. (2010). A nucleus-based quality con-
trol mechanism for cytosolic proteins. Mol. Biol. Cell 21, 2117–2127.
Ravid, T., Kreft, S.G., and Hochstrasser, M. (2006). Membrane and soluble
substrates of the Doa10 ubiquitin ligase are degraded by distinct pathways.
EMBO J. 25, 533–543.
Ruggiano, A., Foresti, O., and Carvalho, P. (2014). Quality control: ER-associ-
ated degradation: protein quality control and beyond. J. Cell Biol. 204,
869–879.
Schuck, S., Prinz, W.A., Thorn, K.S., Voss, C., and Walter, P. (2009).
Membrane expansion alleviates endoplasmic reticulum stress independently
of the unfolded protein response. J. Cell Biol. 187, 525–536.
Schuck, S., Gallagher, C.M., and Walter, P. (2014). ER-phagy mediates selec-
tive degradation of endoplasmic reticulum independently of the core auto-
phagy machinery. J. Cell Sci. 127, 4078–4088.
Seong, Y.M., Choi, J.Y., Park, H.J., Kim, K.J., Ahn, S.G., Seong, G.H., Kim,
I.K., Kang, S., and Rhim, H. (2004). Autocatalytic processing of HtrA2/Omi is
essential for induction of caspase-dependent cell death through antagonizing
XIAP. J. Biol. Chem. 279, 37588–37596.
Shao, S., and Hegde, R.S. (2016). Target selection during protein quality con-
trol. Trends Biochem. Sci. 41, 124–137.
Sprouffske, K., andWagner, A. (2016). Growthcurver: an R package for obtain-
ing interpretable metrics from microbial growth curves. BMC Bioinformatics
17, 172.
Stolz, A., andWolf, D.H. (2012). Use of CPY and its derivatives to study protein
quality control in various cell compartments. MethodsMol. Biol. 832, 489–504.
Stolz, A., Besser, S., Hottmann, H., andWolf, D.H. (2013). Previously unknown
role for the ubiquitin ligase Ubr1 in endoplasmic reticulum-associated protein
degradation. Proc. Natl. Acad. Sci. USA 110, 15271–15276.
Sultana, R., Theodoraki, M.A., and Caplan, A.J. (2012). UBR1 promotes pro-
tein kinase quality control and sensitizes cells to Hsp90 inhibition. Exp. Cell
Res. 318, 53–60.
Swanson, R., Locher, M., and Hochstrasser, M. (2001). A conserved ubiquitin
ligase of the nuclear envelope/endoplasmic reticulum that functions in both
ER-associated and Matalpha2 repressor degradation. Genes Dev. 15,
2660–2674.
Tasaki, T., Zakrzewska, A., Dudgeon, D.D., Jiang, Y., Lazo, J.S., and Kwon,
Y.T. (2009). The substrate recognition domains of the N-end rule pathway.
J. Biol. Chem. 284, 1884–1895.
Taxis, C., and Knop, M. (2006). System of centromeric, episomal, and integra-
tive vectors based on drug resistance markers for Saccharomyces cerevisiae.
Biotechniques 40, 73–78.
Travers, K.J., Patil, C.K., Wodicka, L., Lockhart, D.J., Weissman, J.S., and
Walter, P. (2000). Functional and genomic analyses reveal an essential coordi-
nation between the unfolded protein response and ER-associated degrada-
tion. Cell 101, 249–258.
Turner, G.C., Du, F., and Varshavsky, A. (2000). Peptides accelerate their up-
take by activating a ubiquitin-dependent proteolytic pathway. Nature 405,
579–583.
Tyanova, S., Temu, T., Sinitcyn, P., Carlson, A., Hein, M.Y., Geiger, T., Mann,
M., and Cox, J. (2016). The Perseus computational platform for comprehen-
sive analysis of (prote)omics data. Nat. Methods 13, 731–740.
Vande Walle, L., Van Damme, P., Lamkanfi, M., Saelens, X., Vandekerckhove,
J., Gevaert, K., and Vandenabeele, P. (2007). Proteome-wide identification of
HtrA2/Omi substrates. J. Proteome Res. 6, 1006–1015.
Vande Walle, L., Lamkanfi, M., and Vandenabeele, P. (2008). The mitochon-
drial serine protease HtrA2/Omi: an overview. Cell Death Differ. 15, 453–460.
Varshavsky, A. (2011). The N-end rule pathway and regulation by proteolysis.
Protein Sci. 20, 1298–1345.
Verghese, J., Abrams, J., Wang, Y., and Morano, K.A. (2012). Biology of the
heat shock response and protein chaperones: budding yeast
(Saccharomyces cerevisiae) as a model system. Microbiol. Mol. Biol. Rev.
76, 115–158.
Voeltz, G.K., Prinz, W.A., Shibata, Y., Rist, J.M., and Rapoport, T.A. (2006).
A class of membrane proteins shaping the tubular endoplasmic reticulum.
Cell 124, 573–586.
Walter, P., and Ron, D. (2011). The unfolded protein response: from stress
pathway to homeostatic regulation. Science 334, 1081–1086.
Xia, Z.,Webster, A., Du, F., Piatkov, K., Ghislain, M., and Varshavsky, A. (2008).
Substrate-binding sites of UBR1, the ubiquitin ligase of the N-end rule
pathway. J. Biol. Chem. 283, 24011–24028.
Xie, Y., and Varshavsky, A. (2001). RPN4 is a ligand, substrate, and transcrip-
tional regulator of the 26S proteasome: a negative feedback circuit. Proc. Natl.
Acad. Sci. USA 98, 3056–3061.
Yamamoto, A., Mizukami, Y., and Sakurai, H. (2005). Identification of a novel
class of target genes and a novel type of binding sequence of heat shock tran-
scription factor in Saccharomyces cerevisiae. J. Biol. Chem. 280,
11911–11919.
Zhang, Y., Nijbroek, G., Sullivan, M.L., McCracken, A.A., Watkins, S.C.,
Michaelis, S., and Brodsky, J.L. (2001). Hsp70 molecular chaperone facilitates
endoplasmic reticulum-associated protein degradation of cystic fibrosis trans-
membrane conductance regulator in yeast. Mol. Biol. Cell 12, 1303–1314.
Zheng, N., and Shabek, N. (2017). Ubiquitin ligases: structure, function, and
regulation. Annu. Rev. Biochem. 86, 129–157.
Molecular Cell 70, 1–13, June 21, 2018 13
![Page 15: SHRED Is a Regulatory Cascade that Reprograms Ubr1 ... · Dale Muzzey, Georg H.H. Borner, Sebastian Schuck Correspondence s.schuck@zmbh.uni-heidelberg.de In Brief Szoradi et al. uncover](https://reader030.vdocuments.us/reader030/viewer/2022041217/5e06b3823924f726c567acbd/html5/thumbnails/15.jpg)
Please cite this article in press as: Szoradi et al., SHRED Is a Regulatory Cascade that Reprograms Ubr1 Substrate Specificity for Enhanced ProteinQuality Control during Stress, Molecular Cell (2018), https://doi.org/10.1016/j.molcel.2018.04.027
STAR+METHODS
KEY RESOURCES TABLE
REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Mouse monoclonal anti-GFP (clones 7.1/13.1) Roche Cat#11814460001; RRID: AB_390913
Mouse monoclonal anti-mCherry (clone 1C51) Abcam Cat#Ab125096; RRID: AB_11133266
Rabbit polycolnal anti-mCherry Biovision Cat#5993; RRID: AB_1975001
Rabbit polyclonal anti-Sec61 Schuck et al., 2009 N/A
Mouse monoclonal anti-Pgk1 (clone 22C5) Abcam Cat#Ab113687; RRID: AB_10861977
Mouse monoclonal anti-Pho8 (clone 1D3A10) Abcam Cat#Ab113688; RRID: AB_10860792
Mouse monoclonal anti-FLAG (clone M2) Sigma-Aldrich Cat#F1804; RRID: AB_262044
Mouse monoclonal anti-FLAG-agarose (clone M2) Sigma-Aldrich Cat#A2220; RRID: AB_262044
Mouse monoclonal anti-HA (clone 6E2) Cell Signaling Cat#2367S; RRID: AB_10691311
Rat monoclonal anti-HA (clone 3F10) Roche Cat#11867423001; RRID: AB_390918
Mouse monoclonal anti-HA-agarose (clone HA-7) Sigma-Aldrich Cat#A2095; RRID: AB_257974
Chemicals, Peptides, and Recombinant Proteins
Beta-estradiol Sigma-Aldrich Cat#E8875; CAS: 50-28-2
MG132 Merck Cat#474790-20MG; CAS: 133407-82-6
1NM-PP1 Merck Cat#529581-1MG; CAS: 221244-14-0
Tunicamycin Merck Cat#654380-50MG; CAS: 11089-65-9
Deposited Data
Mass spectrometry proteomics data This paper https://www.ebi.ac.uk/pride/archive/,
ProteomeXchange: PXD008962
Original data This paper https://doi.org/10.17632/ks6h7p7wbg.1
Experimental Models: Organisms/Strains
See Table S2 N/A N/A
Oligonucleotides
knock-in_URA_fw: atttatggtgaaggataagttttgaccatca
aagaaggttagcttgtctgtaagcggatg
This paper N/A
knock-in_URA_rev: gaagctttttctttccaattttttttttttcgtc
attatacatgttctttcctgcgttatcc
This paper N/A
URA part2 fw: TTGTGAGTTTAGTATACATGC This paper N/A
URA part1 rev: ATTCGGTAATCTCCGAACAG This paper N/A
Recombinant DNA
See Table S1 N/A N/A
Software and Algorithms
Bowtie Langmead et al., 2009 http://bowtie-bio.sourceforge.net/index.shtml
Growthcurver Sprouffske and Wagner, 2016 https://cran.r-project.org/web/packages/
growthcurver/index.html
MaxQuant Cox et al., 2014 http://www.coxdocs.org/doku.php?id=
maxquant:start
Perseus Tyanova et al., 2016 http://www.coxdocs.org/doku.php?id=
perseus:start
CONTACT FOR REAGENT AND RESOURCE SHARING
Further information and requests for resources and reagents should be directed to andwill be fulfilled by the Lead Contact, Sebastian
Schuck ([email protected]).
e1 Molecular Cell 70, 1–13.e1–e5, June 21, 2018
![Page 16: SHRED Is a Regulatory Cascade that Reprograms Ubr1 ... · Dale Muzzey, Georg H.H. Borner, Sebastian Schuck Correspondence s.schuck@zmbh.uni-heidelberg.de In Brief Szoradi et al. uncover](https://reader030.vdocuments.us/reader030/viewer/2022041217/5e06b3823924f726c567acbd/html5/thumbnails/16.jpg)
Please cite this article in press as: Szoradi et al., SHRED Is a Regulatory Cascade that Reprograms Ubr1 Substrate Specificity for Enhanced ProteinQuality Control during Stress, Molecular Cell (2018), https://doi.org/10.1016/j.molcel.2018.04.027
EXPERIMENTAL MODEL AND SUBJECT DETAILS
S. cerevisiae strains were generated in theW303 (leu2-3,112 trp1-1 ura3-1 his3-11,15 can1-100) or BY4741 (his3D1 leu2D0met15D0
ura3D0) background. Strains were cultured at 30�C in SCD (2% glucose, 0.7% yeast nitrogen base, amino acids, lacking uracil or
leucine where appropriate to maintain plasmid selection), SC-raf (2% raffinose, 0.7% yeast nitrogen base, amino acids) or YPD
(1% yeast extract, 2% peptone, 2% glucose) as indicated in ‘‘Method Details’’ below.
METHOD DETAILS
Plasmid constructionPlasmids used in this study are listed in Table S1. Sequence information is available upon request. Pho8* constructs contain residues
61-550 of Pho8 with an F352S mutation and an additional but irrelevant N247D mutation. Rtn1CPY*-GFP contains full-length CPY
with a G255R mutation. Hmg2-GFP contains residues 1-671 of Hmg2. pRS303K-GPD-TagBFP and pRS303H-GPD-TagBFP are
based on pRS303K and pRS303H (Taxis and Knop, 2006) and were provided by Michael Knop (Heidelberg University). Lucif-
erase-mCherry and Luciferase(DM)-mCherry contain wild-type firefly Luciferase or double mutant (DM) luciferase(R188Q,R261Q)
(Gupta et al., 2011). stGnd1-mCherry contains residues 1-150 of Gnd1. To generate pRS316-TCYC1, the CYC1 terminator from
pRS413ADH was inserted into the XhoI/KpnI site of pRS316. To generate pRS316-Pynm3-Ynm3, pRS316-PROQ1-Roq1 and
pRS316-PUBR1-Ubr1, the YNM3, ROQ1 and UBR1 coding sequences including 331, 328 and 582 bp of upstream sequence were
amplified from W303 genomic DNA and inserted into the BamHI/XhoI site of pRS316-TCYC1. Point mutations were introduced ac-
cording to theQuikchange site-directedmutagenesis kit (Stratagene). Insertionswere introduced by linearization of the recipient vec-
tor by restriction digest or inverse PCR, amplification of the insert with primers creating homologous ends to the recipient vector, and
ligation with the NEBuilder HiFi DNA assembly master mix (NEB). Deletions were similarly generated by inverse PCR with primers
removing part of the plasmid sequence and enabling re-ligation of homologous ends.
Yeast strain generationStrains used in this study are listed in Table S2. Unless indicated otherwise, strains were derived from W303 mating type a (strain
SSY122). Chromosomal integrations were introduced with PCR products or the integrative plasmids described above. Gene dele-
tion, tagging or insertion was confirmed by colony PCR. For strains generated with integrative plasmids, clones with a single copy of
the expression cassettes were selected by flow cytometry or western blotting. To generate strains with the F352S mutation in the
endogenous PHO8 gene along with isogenic control strains, the sequence encoding Pho8(136-566) together with the kanamycin
resistance cassette was amplified from pFA6a-Pho8D60(F352S)-kanMX6 or pFA6a-Pho8D60-kanMX6 and integrated into the
PHO8 locus. Except for the F352S mutation, this leaves the PHO8 coding sequence intact. To generate strains SSY2323 and
SSY2324 with chromosomal Roq1D21 variants, Ub-Roq1D21-HA(74) or Ub-Roq1D21(R22A)-HA(74) together with the URA3 gene
were amplified from plasmids pSS764 or pSS927 with primers knock-in_URA_fw/rev and integrated into the ura3 locus of strain
SSY792. To generate strains containing nat::GEM-PGAL1-ROQ1 (SSY1856, 1857 and 1858), the ROQ1 promoter was first replaced
with kan::GEM-PGAL1 using plasmid pFA6a-kanMX6-GEM-PGAL1. The kanamycin resistance cassette was then replaced with the
nat resistance cassette by marker swap. To generate strains containing ura3::PGPD-Ub-X-mCherry-sfGFP-kan, Ub-X-mCherry-
sfGFP together with the kanamycin resistance cassette were amplified from plasmids pAK146-160, pMAM46-48 or pMAM66-67
with primers URA part2 fw/URA part1 and integrated into the ura3 locus. To generate strains SSY2376 containing both Ub-
Roq1D21-HA(74) and Ub-R-mCherry-sfGFP in the ura3 locus, Ub-X-mCherry-sfGFP together with the kanamycin resistance
cassette were amplified from plasmid pMaM66 with primers URA part1 rev/URA part2 fw and integrated into the intact URA3
gene of strain SSY2323.
Growth conditionsFor steady state analyses, cultures were grown to saturation, diluted and grown for at least 9 h so that they reached mid log phase
(OD600 = 0.5 - 1). For cycloheximide chase experiments, cells in mid log phase were treated with 50 mg/ml cycloheximide (Sigma). For
ER stress treatment, cells in mid log phase were diluted to OD600 0.05 and either left untreated or treated with tunicamycin (Merck) or
8 mM DTT (Applichem). The standard tunicamycin concentration was 1 mg/ml, but 2 mg/ml were used in flow cytometry experiments
for maximum effectiveness of the drug. For proteasome inhibition, MG132 (Merck) was used at a final concentration of 80 mM and
strains lacking PDR5where used tomakeMG132 effective. For inhibition of analog-sensitive protein kinase A, 1NM-PP1 (Merck) was
used at 3 mM. For activation of the Gal4-ER-Msn2 transcription factor, b-estradiol (Sigma) was dissolved in ethanol and used at a final
concentration of 400 nM for up to six hours for flow cytometric measurements and for eight hours for mass spectrometric analysis.
For analyses after galactose induction, cultures were grown to early log phase (OD600 = 0.2) in SC-raf medium, galactose was added
to a final concentration of 2% and cells were grown for another 2 - 3 h. For promoter shut-off, galactose-induced cells were diluted
1:10 into SCD. For growth to post-diauxic phase, cultures in mid log phase were diluted to OD600 0.5 and grown for 10 h.
Molecular Cell 70, 1–13.e1–e5, June 21, 2018 e2
![Page 17: SHRED Is a Regulatory Cascade that Reprograms Ubr1 ... · Dale Muzzey, Georg H.H. Borner, Sebastian Schuck Correspondence s.schuck@zmbh.uni-heidelberg.de In Brief Szoradi et al. uncover](https://reader030.vdocuments.us/reader030/viewer/2022041217/5e06b3823924f726c567acbd/html5/thumbnails/17.jpg)
Please cite this article in press as: Szoradi et al., SHRED Is a Regulatory Cascade that Reprograms Ubr1 Substrate Specificity for Enhanced ProteinQuality Control during Stress, Molecular Cell (2018), https://doi.org/10.1016/j.molcel.2018.04.027
Western blottingCells were collected by centrifugation, washed once with water and disrupted by bead beating with a FastPrep 24 (MP Biomedicals)
in 50 mM Tris-HCl pH 7.5 containing 0.5 mMEDTA, 1 mMPMSF and complete protease inhibitors (Roche). Proteins were solubilized
by addition of 1.5% SDS and incubation at 65�C for 5 min. Lysates were cleared at 16,000 g at 4�C for 2 min and protein concen-
trations were determined with the BCA assay kit (Thermo Scientific Pierce). Equal amounts of protein were resolved by SDS-
PAGE and transferred onto nitrocellulose membranes. Membranes were probed with primary and HRP-coupled secondary
antibodies and incubated with homemade ECL. Chemiluminescence was detected with an ImageQuant LAS 4000 imaging system
(GE Healthcare). Images were quantified with ImageJ and processed with Adobe Photoshop. Antibodies were mouse-anti
GFP 7.1/13.1 (Roche), mouse anti-mCherry 1C51 (Abcam) for detection of Luciferase-mCherry, rabbit anti-mCherry (Biovision) for
detection of R-mCherry-sfGFP, rabbit anti-Sec61 (Peter Walter, UCSF), mouse anti-Pgk1 22C5 (Abcam), mouse anti-Pho8
1D3A10 (Abcam), mouse anti-FLAG M2 (Sigma), mouse anti-HA 6E2 (Cell Signaling) for detection of CFTR-HA, and rat anti-HA
3F10 (Roche) for detection of HA-tagged Roq1.
Pho8 assayCells were grown to mid log phase (OD600 = 0.5 - 1) in SCD. Two ODs of cells were collected by centrifugation, washed with water,
resuspended in 200 ml cold lysis buffer (20 mM PIPES pH 6.8, 1% Triton X-100, 50 mM KCl, 100 mM KOAc pH 7.5, 10 mM MgSO4,
10 mM ZnSO4, 1 mM PMSF, complete protease inhibitors), and disrupted as above. For each duplicate reaction, 50 ml lysate were
combined with 200 ml reaction buffer (250 mM Tris pH 8.5, 1% Triton X-100, 10 mM MgSO4, 10 mM ZnSO4) containing 1.25 mM
p-nitrophenyl phosphate (Sigma) as substrate and incubated at 37�C. The reaction was stopped by addition of 250 ml 1 M
glycine/KOH pH 11. Absorption was measured at 405 nm and one unit phosphatase activity was defined as 1 nmol p-nitrophenol
produced per min and mg total protein.
Light microscopyCells were imaged live at room temperature. Images were acquired with a spinning-disk confocal microscope (a Nikon TE2000 in-
verted microscope equipped with a Yokogawa CSU-X1 confocal scanning unit, Hamamatsu C9100-02 EMCCD camera and Nikon
Plan Apo VC 100x/1.4 NA oil objective lens or a Leica DMi8 inverted microscope equipped with a Yokogawa CSU-X1 confocal scan-
ning unit, Hamamatsu C9100-13 EMCCD camera and a Leica HC PL APO 100x/1.4 NA CS2 oil objective lens) and processed with
Adobe Photoshop.
Subcellular fractionationCells were harvested at 1,000 g at room temperature for 5min, washedwith 100mMTris-HCl pH 9.4 with 10mMNaN3 and incubated
at 30�C for 10 min in the same buffer additionally containing 10 mM DTT. Cells were pelleted, resuspended in spheroplast buffer
(50 mM Tris-HCl pH 7.5, 1 M sorbitol, 1 mM PMSF and complete protease inhibitors) and treated with zymolyase T20 (0.2 U/OD
of cells, MP Biomedicals) at 30�C for 10 min. Spheroplasts were collected at 1,000 g at 4�C for 5 min, washed with ice-cold sphe-
roplast buffer and resuspended in lysis buffer (50mMTris-HCl pH 7.5, 1mMEDTA, 200mMsorbitol, 1mMPMSF, complete protease
inhibitors). Lysates were homogenized in a Dounce homogenizer (Kimble Chase, clearance 0.01 – 0.06 mm) and cleared at 500 g at
4�C for 5 min. One half of the supernatant was kept as total lysate T, the other half was centrifuged at 16,000 g at 4�C for 15 min. The
supernatant was collected as soluble fraction S. The pellet, containing total cell membranes, was washed once and resuspended in
lysis buffer as pellet fraction P. Proteins in T, S and P were solubilized by addition of 1.5% SDS and incubation at 65� for 5 min. Equal
fractions were analyzed by western blotting.
Flow cytometryCultures for flow cytometry were grown in 1mLmedium in 96 deep-well plates. At each time point, 100 ml aliquots were removed and
fluorescence and cell number were measured with a BD Biosciences FACS Canto flow cytometer equipped with a high-throughput
sampler. For experiments measuring the degradation of constitutively expressed reporter proteins, regular GFP was used as a tag.
To determine cellular reporter levels, GFP fluorescence was first corrected for autofluorescence by subtracting the fluorescence of
identically treated control cells not expressing GFP. Corrected GFP fluorescence was divided by the fluorescence of constitutively
expressed cytosolic BFP as a measure for cell volume. To determine the effect of stress treatment, at each time point the GFP/BFP
ratios of treated cells were divided by those of corresponding untreated cells. This step accounted for minor changes in reporter
levels that were unrelated to stress treatment but caused by the dilution of the cultures at the beginning of the experiment. The re-
sulting reporter levels were expressed in per cent of those at t = 0. For cycloheximide chase and promoter shut-off experiments, re-
porters tagged with fast-maturing sfGFP instead of slow-maturing regular GFP were used. This ameliorated the problem that new
fluorescence can be generated after reporter synthesis has ceased because of the delayedmaturation of fully synthesized but incom-
pletely folded GFP. Total GFP amounts were determined bymultiplying autofluorescence-correctedmean cellular GFP fluorescence
by cell number. These amounts were expressed as reporter remaining in per cent of the amounts at t = 0.
e3 Molecular Cell 70, 1–13.e1–e5, June 21, 2018
![Page 18: SHRED Is a Regulatory Cascade that Reprograms Ubr1 ... · Dale Muzzey, Georg H.H. Borner, Sebastian Schuck Correspondence s.schuck@zmbh.uni-heidelberg.de In Brief Szoradi et al. uncover](https://reader030.vdocuments.us/reader030/viewer/2022041217/5e06b3823924f726c567acbd/html5/thumbnails/18.jpg)
Please cite this article in press as: Szoradi et al., SHRED Is a Regulatory Cascade that Reprograms Ubr1 Substrate Specificity for Enhanced ProteinQuality Control during Stress, Molecular Cell (2018), https://doi.org/10.1016/j.molcel.2018.04.027
Genetic screenStrain SSY633 was grown in YPDmedium to 108 cells/ml. Cells from 1mL culture were washed twice with H2O, resuspended in 1mL
0.1 M sodium phosphate buffer pH 7.0 and treated with 50 ml ethyl methanesulfonate (EMS, Sigma) at 30�C for 60 min. EMS was
quenched with 0.8mL 5% (w/v) NaS2O3, and cells were washed twice with 5mL 5% (w/v) NaS2O3 and once with H2O. This treatment
resulted in approximately 65% lethality. Mutants were grown on YPD plates and replicated onto thin SCD plates containing 1 mg/ml
tunicamycin. 56,000 colonies were screened by fluorescence microscopy for mutants with high levels of GFP. As a secondary
screen, flow cytometry was used to identify mutants that had normal steady state levels of Rtn1Pho8*-GFP and failed to degrade
it upon tunicamycin treatment. Mating with strain SSY644 showed that all 184 remaining mutants had recessive mutations, and
complementation analysis defined five groups. Representatives from each group were backcrossed three times with SSY633. Six
to ten mutant haploids from the last crossing were mixed and genomic DNA was isolated from the mutants and from strains
SSY633 and SSY644. Sequencing libraries were prepared with the NEBNext DNA sample prep kit (NEB) and single-read sequencing
was done on a HiSeq 2000 sequencer (Illumina). Sequencing reads were aligned to the S. cerevisiae W303 reference genome with
Bowtie (Langmead et al., 2009). Using custom PHP scripts, the frequency of each of the four nucleobases was determined for each
position of the genomes of SSY633, SSY644 and the various mutants. Heterogeneous positions in the mutants indicated irrelevant
mutations segregating randomly between mutant and wild-type haploids during crossing. Homogeneous positions for which the
base in a mutant differed from the bases in SSY633 and SSY644 indicated mutations that segregated with the mutant phenotype.
Growth assaysFor growth assays in liquid culture, strains SSY1488 and 1559 were grown to mid log phase in SCD, diluted to an OD600 of 0.05, and
either treated with 400 nM estradiol or left untreated. Forty-eight well plates were seeded with 500 ml culture and absorbance at
600 nm was measured in five minute intervals using a Tecan Infinite M1000 Pro microplate reader over 20 hours. A shaking routine
consisting of 90 s linear shaking, 30 s rest and 120 s orbital shaking was used to keep cells in suspension in between reads. The area
under the growth curves was used as a measure for cell growth as calculated by the R package Growthcurver (Sprouffske and
Wagner, 2016). For growth assays on solid medium, strains SSY875, 1782, 1729 and 792 were grown to mid-log phase in SCD. Cul-
tures were diluted to an OD600 of 0.2, dilution series with fivefold dilution steps were prepared and spotted onto YPD plates or YPD
plates containing 4% ethanol. Plates were incubated at 30�C for 1.5 and 3 days, respectively.
Quantitative real-time PCRFive ODs of cells were collected by centrifugation, washed once with cold H2O and resuspended in 400 ml TES buffer
(10 mM Tris pH 7.5, 10 mM EDTA, 0.5% (w/v) SDS). Four-hundred ml water-saturated phenol were added, samples were incubated
at 65�C for 60min and phase separation was induced by centrifugation at 16,000 g at 4�C for 5min. The aqueous phasewas collected
and extracted twice with 400 ml water-saturated phenol and once with 400 ml chloroform. RNA was precipitated by addition of 40 ml
3 M NaOAc, pH 5.3, 1 mL ice-cold 100% ethanol and centrifugation at 16,000 g at 4�C for 5 min. Pellets were washed once with 1 mL
ice-cold 70% ethanol and resuspended in 30 ml H2O. Synthesis of cDNA was done with the Protoscript II kit (NEB) using d(T)23VN
primers. PCRs were run on a LightCylcer II 480 (Roche) using the SensiFAST SYBR No-ROX kit (Bioline). TAF10 mRNA served as
internal standard to determine relative ROQ1 mRNA levels. Information on PCR conditions and primer sequences is available
upon request.
ImmunoprecipitationTen ODs of cells in mid log phase were harvested and lysed as above in IP buffer (100 mMNaCl, 10% glycerol, 0.1% NP-40, 0.5 mM
EDTA, 25 mMHEPES pH 7.5) supplemented with complete protease inhibitors and 1mMPMSF. Lysates were cleared at 12,000 g at
4�C for 10 minutes. Six percent of the lysate (about 60 mg total protein) were kept as input. Roq1-HA(74) and FLAG-Ubr1 were immu-
noprecipitated with 30 ml anti-HA-agarose beads (clone HA-7, Sigma) or anti-FLAG-agarose beads (clone M2, Sigma), respectively,
at 4�C for 30 minutes. Beads were washed three times with cold lysis buffer and bound protein was eluted with SDS-PAGE sample
buffer at 95�C for 5 minutes. Samples were analyzed by western blotting as above.
Mass spectrometryStrains SSY1488 (WT), 1559 (WT+Roq1), 2143 (Dubr1) and 1561 (Dubr1+Roq1) were grown tomid log phase in SCD, diluted to anOD
of 0.05 and treated with 400 nM estradiol for 8 h. Three ODs of cells were harvested and lysed as for western blotting except that
PMSF was omitted. Samples were processed and analyzed on a Q Exactive HF Hybrid Quadrupole-Orbitrap mass spectrometer
as described (Itzhak et al., 2016). Full proteomes from each of the four strains were quantified from four independent biological rep-
licates. Raw files were processed with MaxQuant and searched against the yeast protein database (SwissProt) downloaded from
UniProt. Protein expression levels were quantified and normalized based on their intensities using the MaxLFQ algorithm imple-
mented in MaxQuant software (Cox et al., 2014). Protein groups were filtered to remove hits to the reverse decoy database, proteins
exclusively identified through modified peptides, and common contaminants (with the exception of GFP, which was retained in
the list). Furthermore, only proteins with four normalized label-free quantification values (LFQ intensities) in at least one of the
analyzed strains were retained in the set. 3377 protein groups passed these criteria. Rtn1Pho8*-GFP was not separately added to
the database; rather, the GFP was treated as representative of the whole construct. Since endogenous Pho8 is expressed at low
Molecular Cell 70, 1–13.e1–e5, June 21, 2018 e4
![Page 19: SHRED Is a Regulatory Cascade that Reprograms Ubr1 ... · Dale Muzzey, Georg H.H. Borner, Sebastian Schuck Correspondence s.schuck@zmbh.uni-heidelberg.de In Brief Szoradi et al. uncover](https://reader030.vdocuments.us/reader030/viewer/2022041217/5e06b3823924f726c567acbd/html5/thumbnails/19.jpg)
Please cite this article in press as: Szoradi et al., SHRED Is a Regulatory Cascade that Reprograms Ubr1 Substrate Specificity for Enhanced ProteinQuality Control during Stress, Molecular Cell (2018), https://doi.org/10.1016/j.molcel.2018.04.027
levels, the behavior of detected Pho8 also largely reflects that of Rtn1Pho8*-GFP. In contrast, endogenous Rtn1 is highly expressed,
and hence detected Rtn1 does not reflect the behavior of Rtn1Pho8*-GFP. LFQ intensities were compared to gauge protein expres-
sion differences between strains. Two complementary analyses were carried out, one based on a series of filters, and another
applying imputation of missing values and standardized volcano plot analysis (Tyanova et al., 2016).
(1) Filter-based analysis
To identify proteins that show a similar Roq1-dependent downregulation as Rtn1Pho8*-GFP, we custom-designed a sensitive and
false discovery rate (FDR)-controlled filter analysis. LFQ data were log-transformed to obtain approximately normally distributed
data. For each protein, the difference in expression between WT+Roq1 and WT cells was calculated, and averaged over the four
replicates, to obtain the average (paired) fold change in expression. Candidate hits had ratios < 1 on a linear scale. We chose a
cut-off of < 0.75 based on the change observed in the positive controls, GFP and Pho8. Next, we subjected all differences to a
t test (paired, one-tailed). Proteins then had to pass a variable p value filter (see below). Furthermore, for each protein we calculated
the average paired fold change between expression in Dubr1+Roq1 and Dubr1 cells; proteins were required to show very small
changes (between 0.9 and 1.1 fold). Only proteins passing all three filters were considered candidate hits. For FDR control, we
applied the same filters, but swapped the WT/WT+Roq1 strains with the Dubr1/Dubr1+Roq1 strains (mock dataset). With this
data configuration we did not expect to see any real changes, and hence simulated experimental noise. The FDRwas then calculated
as the number of hits identified with themock dataset, divided by the number of hits obtainedwith the analysis dataset. The FDR level
was controlled by changing the p value cut-off of the t test. P values set to 0.0095, 0.02, and 0.05 resulted in estimated FDRs of 0%,
10%, and 20%, respectively. The positive controls GFP and Pho8 passed as hits at the 0%FDR level. Furthermore, we also evaluated
the fold change between WT and Dubr1 cells to identify proteins that are constitutively regulated by Ubr1.
(2) Imputation-assisted analysis
The above test does not cover proteins that are not identified in all strains. Hence, we performed amore inclusive analysis, with lower
statistical power. We imputed missing values from a normal distribution (downshift 1.8 SDs, width 0.3 SDs). Pairwise comparison of
strains was achieved via a t test (non-paired, two-tailed), with permutation-based FDR control (FDR = 5%, S0 = 0.5), implemented in
Perseus software (Tyanova et al., 2016).
QUANTIFICATION AND STATISTICAL ANALYSIS
Statistical details of experiments are listed in the figure legends. The value of n indicates the number of independent experiments.
DATA AND SOFTWARE AVAILABILITY
The accession number for the mass spectrometry proteomics data reported in this paper is ProteomeXchange: PXD008962 via the
PRIDE partner repository. The original data represented in the figures are available from Mendeley Data (https://doi.org/10.17632/
ks6h7p7wbg.1).
e5 Molecular Cell 70, 1–13.e1–e5, June 21, 2018