shaw et al . selenium and formate...
TRANSCRIPT
Shaw et al. Selenium and C. jejuni formate dehydrogenase
1
REVISED MANUSCRIPT JB06586-11-v1 1
2
Selenium-dependent biogenesis of formate dehydrogenase in 3
Campylobacter jejuni is controlled by the fdhTU accessory genes 4
5
Frances L. Shaw, Francis Mulholland, Gwénaëlle Le Gall, Ida Porcelli, Dave J. Hart, 6
Bruce M. Pearson & Arnoud H.M. van Vliet * 7
8
Institute of Food Research, Norwich Research Park, Norwich NR4 7UA, United Kingdom 9
10
* Corresponding author. Mailing address: Institute of Food Research, Norwich Research Park, 11
Colney Lane, Norwich NR4 7UA, United Kingdom. Phone +44-1603-255250, Fax +44-1603-12
507723, E-mail: [email protected] 13
14
Running title: Selenium and C. jejuni formate dehydrogenase 15
16
Keywords: Campylobacter, foodborne pathogen, selenoprotein 17
18
Copyright © 2012, American Society for Microbiology. All Rights Reserved.J. Bacteriol. doi:10.1128/JB.06586-11 JB Accepts, published online ahead of print on 18 May 2012
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Shaw et al. Selenium and C. jejuni formate dehydrogenase
2
ABSTRACT 19
The foodborne bacterial pathogen Campylobacter jejuni efficiently utilizes organic acids such 20
as lactate and formate for energy production. Formate is rapidly metabolized via the activity of 21
the multi-subunit formate dehydrogenase (FDH) enzyme, of which the FdhA subunit is predicted 22
to contain a selenocysteine (SeC) amino acid. In this study we have investigated the function of 23
the cj1500 and cj1501 genes of C. jejuni, demonstrate that they are involved in selenium-24
controlled production of FDH, and propose the names fdhT and fdhU, respectively. Insertional 25
inactivation of fdhT or fdhU in C. jejuni resulted in the absence of FdhA and FdhB protein 26
expression, reduced fdhABC RNA levels, absence of FDH enzyme activity, and lack of formate 27
utilization as assessed by 1H NMR. The fdhABC genes are transcribed from a single promoter 28
located two genes upstream of fdhA, and the decrease in fdhABC RNA levels in the fdhU mutant 29
is mediated at the post-transcriptional level. FDH activity and the ability to utilize formate were 30
restored by genetic complementation with fdhU, and by supplementation of growth media with 31
selenium dioxide. Disruption of SeC synthesis by inactivation of the selA and selB genes also 32
resulted in absence of FDH activity, which could not be restored by selenium supplementation. 33
Comparitive genomic analysis suggests a link between the presence of selA and fdhTU orthologs, 34
and the predicted presence of SeC in FdhA. The fdhTU genes encode accessory proteins required 35
for FDH expression and activity in C. jejuni, possibly by contributing to acquisition or utilization 36
of selenium. 37
38
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Shaw et al. Selenium and C. jejuni formate dehydrogenase
3
INTRODUCTION 39
The foodborne bacterial pathogen Campylobacter jejuni is the most prevalent bacterial cause 40
of human gastroenteritis in the developed world (7). The organism colonizes the avian cecum to 41
high densities, and is highly adapted to life in this environmental niche. C. jejuni is a 42
microaerophilic organism which cannot ferment sugars for energy production, but instead relies 43
on organic acids and amino acids (22). One of the preferred substrates for C. jejuni is formate 44
(15), which is produced by anaerobic fermentation by the local microflora in the avian and 45
mammalian intestine (22). Formate is metabolized by the formate dehydrogenase (FDH) enzyme 46
via oxidation (21), with electrons being donated to a second substrate, such as NAD+ (Formate + 47
NAD+ + H+ + 2e- ↔ CO2 + NADH + 2H+ + 2e-) (24). 48
The C. jejuni NCTC 11168 genome sequence (10, 25) contains four genes annotated as FDH 49
subunits (fdhABCD, cj1511c-1508c). FdhA (Cj1511c) is a large 110 kDa protein which is 50
predicted to contain a selenocysteine amino acid (SeC), whereas FdhB (24 kDa) and FdhC (35 51
kDa) are an iron-sulfur protein and a cytochrome B-containing protein, respectively (22). FdhD 52
acts as sulfurtransferase in E. coli, where it is required for FDH activity (37), but its function in 53
C. jejuni is unknown. Upstream of fdhABCD, there are two more genes involved in FDH 54
biosynthesis and activity: cj1514c was shown to be specifically required for the activity of FDH 55
and was designated fdhM (14), whereas cj1513c encodes a TAT-exported protein of unknown 56
function which is translationally coupled to the downstream fdhA gene and is specific to the 57
Epsilonproteobacteria (14). The C. jejuni FDH has been reported to be a tungstoenzyme (31, 35), 58
and the Cj1513c protein has been suggested to be required for formation of a tungsten-pterin 59
cofactor (14). FDH plays an important role in C. jejuni, as the combined absence of FDH and 60
hydrogenase activity significantly reduced the ability of C. jejuni to colonize the chicken cecum 61
(42), whereas the inactivation of either fdhD or the formic acid chemoreceptor gene cj0952c 62
resulted in reduced immunopathology in gnotobiotic mice containing a humanized intestinal 63
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Shaw et al. Selenium and C. jejuni formate dehydrogenase
4
microflora (2). The natural flora of the chicken cecum is dominated by anaerobic fermentative 64
organisms which produce formate and hydrogen, and a mutant unable to oxidize either of these 65
substrates in this ecological niche is most likely disadvantaged. 66
The SeC amino acid, as predicted to be present in C. jejuni FdhA, is the 21st amino acid (5). 67
It has the same structure as cysteine, except that the sulphur atom is replaced by selenium, and 68
has both a lower pKa and a higher redox potential than cysteine. In selenoproteins, the SeC amino 69
acid is coded for by an in-frame UGA codon (which is normally a stop codon) (4, 5, 13). This 70
process is controlled via a specialized element present in the mRNA, called SECIS 71
(SElenoCysteine Insertion Sequence), which is located immediately downstream of the UGA 72
codon, and together with SelB ensures the incorporation of the SeC into the polypeptide chain 73
(11). Synthesis of tRNA-SeC (selC) is mediated by SelA, and selAB orthologs are present in the 74
C. jejuni genome (cj1378-1379) (6, 13, 41). In general, when cells are grown in the absence of 75
selenium, translation of selenoproteins terminates at the SeC UGA codon, resulting in a 76
truncated, non-functional enzyme (1). 77
Although biosynthesis of selenoproteins has been extensively studied, there are still 78
questions relating to which transport systems, and in what form selenium is taken up into 79
bacterial cells, and what factors other than the currently known sel genes are involved in 80
biogenesis of selenoproteins. One class of proteins which have recently been implicated in 81
microbial selenium metabolism are those containing a SirA-like domain (23, 47), which are 82
present in many microbial and archaeal genomes. This family shares an N-terminal domain, 83
modelled by pfam01206, with the sulfurtransferase TusA (also called SirA-like) (19), but 84
experimental validation of a role of SirA-like domain containing proteins in selenium metabolism 85
is lacking to date. In this study we have investigated the function of the C. jejuni cj1501 gene, 86
which encodes a SirA-like protein which we have named FdhU, and report on the role of the 87
cj1500-cj1501 (fdhTU) and selAB genes in selenium-dependent FDH biogenesis in C. jejuni. 88
89
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Shaw et al. Selenium and C. jejuni formate dehydrogenase
5
MATERIALS AND METHODS 90
91
Bacterial strains, media and growth conditions 92
C. jejuni strains NCTC 11168, 81116 (NCTC 11828) and their isogenic mutants (Table 1) 93
were routinely grown in Brucella media at 37°C under microaerobic conditions (85% N2, 5% O2, 94
10% CO2). Escherichia coli TOP10 (Novagen) was grown aerobically in Luria Bertani medium 95
(30) at 37°C. Where appropriate, media were supplemented with ampicillin (final concentration 96
100 µg ml-1), kanamycin (final concentration 20 µg ml-1), or chloramphenicol (final concentration 97
20 µg ml-1). Filter-sterilized selenium dioxide solution in water was used to supplement Brucella 98
media to a final concentration of 5 µM. Filter-sterilized formate solution in water was used to 99
supplement media to a final concentration of 1 mM. 100
101
Genetic manipulation of C. jejuni 102
Inactivation and complementation of C. jejuni genes was done essentially as described 103
previously (36). Specific C. jejuni genes were inactivated by the replacement and insertion of 104
antibiotic resistance cassettes (kanamycin or chloramphenicol). The mutants were confirmed by 105
PCR and sequencing. To complement/supplement the cj1501 gene in C. jejuni strains, the gene 106
was inserted together with a chloramphenicol resistance gene into the pseudogene Cj0046, under 107
control of a native C. jejuni promoter, fdxA (36, 39). This construct was then introduced into the 108
C. jejuni wild-type strain and its isogenic cj1501 mutant by electroporation, followed by selection 109
for chloramphenicol resistance. Correct integration of the constructs into the genomic copy of the 110
cj0046 pseudogene of C. jejuni NCTC 11168 was validated by PCR (36). 111
112
Preparation of C. jejuni genomic DNA and RNA 113
Genomic DNA was isolated from C. jejuni cells grown microaerobically for 24 hours on 114
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Shaw et al. Selenium and C. jejuni formate dehydrogenase
6
Brucella agar, using a DNeasy kit (Qiagen) according to the manufacturer’s instructions. RNA 115
was extracted from C. jejuni cultures grown to an OD600 of approximately 0.4, using protocols 116
described previously (18). Briefly, 0.1 volume of 5% phenol in ethanol was mixed with the broth 117
culture, and RNA was isolated from pelleted cells with Tri Reagent (Sigma) and chloroform. 118
RNA was further purified using an RNeasy kit (Qiagen) and the Turbo DNA-free treatment 119
(Ambion), according to the manufacturer’s instructions. The purity of the RNA was determined 120
using the RNA 6000 Nano Kit (Agilent) according to manufacturer’s instructions. The 121
concentration of the RNA was determined using the Nanodrop Spectrophotometer NS-1000 122
(Thermo Scientific). 123
124
Transcription start site determination by 5' RACE 125
Transcription start sites in the cj1500-1514c region of C. jejuni NCTC 11168 were 126
determined using 5′ RACE, essentially as described previously (9). Briefly, 12 µg of RNA, 127
isolated from a mid-log phase culture of C. jejuni NCTC 11168 using the RNeasy kit (Qiagen, 128
UK), was treated with tobacco acid pyrophosphatase (TAP) and RNA oligonucleotide adaptor 129
(Table 2) was ligated to the 5′ end of the treated RNA (9). TAP cleaves the 5′-triphosphate of 130
primary transcripts to a monophosphate, thus making them available for ligation of the RNA 131
adaptor. This results in an enrichment of 5′-RACE products for primary transcripts in TAP-132
treated RNA, in comparison with an untreated control. First strand cDNA synthesis was 133
performed using random hexamers, followed by PCR amplification with gene-specific primers 134
and a 5′-adaptor-specific DNA primer (Table 2). The resulting PCR products were cloned into the 135
pGEM-Teasy cloning vector (Promega, UK) and the nucleotide sequence of the inserts was 136
determined using standard protocols. 137
138
Transcriptomic Analysis by Whole Genome Microarray 139
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Shaw et al. Selenium and C. jejuni formate dehydrogenase
7
An 8 × 15K microarray slide (Agilent) specific for the genome of C. jejuni NCTC 11168 was 140
used to visualize relative mRNA levels in the wild-type strain when compared to the fdhU 141
mutant, complemented fdhU mutant, and the wild-type strain overexpressing fdhU (Table 1). The 142
Affinity Script kit (GE Healthcare) was used to produce Cy3 or Cy5 labeled cDNA, from the 143
aforementioned RNA samples. These were then hybridized to the microarray slide according to 144
the manufacturer’s instructions (Agilent Hi-RPM Gene Expression Hybridization Kit). DNA 145
microarrays were scanned using an Axon GenePix 4000A microarray laser scanner (Axon 146
Instruments) and the data from detected features initially processed using the GenePix 3.0 147
software. Statistical analysis of the data was performed with Marray as described in (17). The 148
microarray design and data have been deposited in the GEO database with accession number 149
GPL13841 (microarray design) and GSE35016 (data from this study). 150
151
Proteomics 152
C. jejuni cells were harvested from 50 ml Brucella broth by centrifugation (4,000 × g, 10 153
minutes, room temperature). The cell pellets were resuspended in 500 µl Lysis Buffer (50 mM 154
Tris, pH 7.5, 0.3% SDS, 0.2 M DTT, 3.3 mM MgCl2, 16.7 µg RNase ml-1, 1.67 U DNase ml-1) 155
and sonicated (Soniprep 150 MSE, Sanyo) for 10 seconds six times with incubation on ice 156
between sonications, and 20 minutes incubation on ice following sonication. The samples were 157
centrifuged (20,000 × g, 20 minutes, 4°C). The total cell protein was quantified by using 2D 158
Quant Kit (GE HealthCare) according to the manufacturer’s instructions. A total of 100 µg 159
protein was separated by isoelectric focusing on a pH 3-11 NL 24cm IPG strip (GE HealthCare), 160
for 44.7 kVh at 20°C over 8.75 hours using the IPGphor (GE Healthcare) (17). The focused IPG 161
strips were then conditioned and the size separation on the second dimension was done by SDS-162
PAGE as described previously (17). The proteins were fixed, then stained by Sypro-Ruby 163
(Invitrogen) and de-stained according to the manufacturer’s instructions. The gel images were 164
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Shaw et al. Selenium and C. jejuni formate dehydrogenase
8
captured with a Pharos FX+ Molecular Imager with Quantity One imaging software (v4.6.1 165
BioRad). A 532 nm excitation laser was used with a 605 nm band pass emission filter and gels 166
were scanned at 100μm resolution to produce a 16 bit image. The laser strength was adjusted for 167
each image to give the maximum signal without saturation on the strongest spot. Gel images were 168
compared using ProteomWeaver analysis software (v3.0.1, Definiens). 169
170
Protein Identification (MS/MS) 171
Proteins of interest were removed from the gel using ProPick excision robot (Genomic 172
Solutions), and in-gel trypsin digested using a ProGest Protein Digester (Genomic Solutions) 173
essentially as described previously (16). LC-MS/MS analysis was performed using a LTQ-174
Orbitrap mass spectrometer (Thermo Electron) and a nanoflow-HPLC system (nanoACQUITY: 175
Waters). Peptides were trapped on line to a Symmetry C18 Trap (5 µm, 180 µm × 20 mm) which 176
was then switched in-line to a UPLC BEH C18 Column, (1.7 µm, 75 µm × 250 mm) held at 177
45°C. Peptides were eluted by a gradient of 0–80% acetonitrile in 0.1% formic acid over 50 min 178
at a flow rate of 250 nl min−1. The mass spectrometer was operated in positive ion mode with a 179
nano-spray source at a capillary temperature of 200°C. The Orbitrap was run with a resolution of 180
60,000 over the mass range m/z 300–2,000 and an MS target of 106 and 1 sec maximum scan 181
time. The MS/MS was triggered by a minimal signal of 2000 with an Automatic Gain Control 182
target of 30,000 ions and maximum scan time of 150 ms. For MS/MS events selection of 2+ and 183
3+ charge states selection were used. Dynamic exclusion was set to 1 count and 30 sec exclusion 184
time with an exclusion mass window of ±20 ppm. Proteins were identified by searching the 185
Thermo RAW files converted to Mascot generic format by DTA supercharger (reference: 186
http://www.msquant.sourceforge.net) against C. jejuni protein sequences in a monthly updated 187
copy of the SPtrEMBL database, using an in-house version (v2.2) of the MASCOT search tool 188
(reference: http://www.matrixscience.com). 189
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Shaw et al. Selenium and C. jejuni formate dehydrogenase
9
190
Formate Dehydrogenase Activity Assay 191
FDH activity was measured using a benzyl viologen-coupled colorimetric assay (14). 192
Bacterial cells were grown over-night in Brucella broth and the OD600 was measured. Five ml of 193
culture was spun down (10 minutes, 10,000 × g) and washed twice with 1 ml of 25 mM 194
phosphate buffer pH 7.4 (centrifuged for 1 minute, 10,000 × g). The cells remained on ice until 195
the start of the enzyme assay. The cells were resuspended in 1 ml 25 mM phosphate buffer pH 196
7.4 and 200 µl was aliquoted into anaerobic cuvettes, followed by 200 µl 10 mM benzylviologen 197
and 1600 µl 25 mM phosphate buffer pH 7.4. The cuvettes were individually sparged with 198
nitrogen for 8 minutes. The cuvette was then heated to 37°C and a reading was taken at 578 nm. 199
Subsequently the substrate was added, which consisted of 20 µl 1 M sodium formate sparged 200
with nitrogen for approx 20 minutes prior to use. The reaction was monitored at 578 nm at one 201
read per second for approximately 200 sec, or until the reading was above 2.0. FDH activity was 202
calculated by determination of the nmoles of viologen oxidized per minute per mg protein. The 203
protein concentration was determined using the Bradford Assay (Bio-Rad). 204
205
1H NMR 206
NMR was used to identify the presence, absence and concentration of several metabolites in 207
C. jejuni growth medium. The spent growth medium was filter-sterilised (0.2 µm) to remove the 208
cells. Supernatant samples were thawed at room temperature and prepared for 1H NMR 209
spectroscopy by mixing 400 μl of spent medium with 200 μl phosphate buffer (0.2 M Na2HPO4 210
and 0.038 M NaH2PO4, pH 7.4) made up in 100% D2O and containing 0.06% sodium azide, 6 211
mM DFTMP (difluoro (trimethylsilyl) methylphosphonic acid) and 1.5 mM DSS (sodium 2,2-212
dimethyl-2-silapentane-5-sulfonate) as a chemical shift reference. The sample was mixed, and 213
500 μl transferred into a 5 mm NMR tube for spectral acquisition. 1H NMR spectra were 214
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Shaw et al. Selenium and C. jejuni formate dehydrogenase
10
recorded at 600 MHz on a Bruker Avance spectrometer (Bruker BioSpin GmbH, Rheinstetten, 215
Germany) running TOPSPIN 2.0 software and fitted with a cryoprobe and a 60 slot autosampler. 216
Each 1H NMR spectrum was acquired with 128 scans, spectral width 8012.8 Hz, acquisition time 217
2.04 sec and relaxation delay 2.0 sec. The noesypr1d presaturation sequence was used to suppress 218
the residual water signal with low power selective irradiation at the water frequency during the 219
recycle delay and mixing time (tm) 150 ms. Spectra were transformed with 0.3 Hz line 220
broadening, manually phased, baseline corrected and referenced by setting the DSS methyl signal 221
to 0 ppm. Absolute concentrations were obtained using CHENOMXTM software (version 5.1) 222
(43). Several metabolites were quantified from a possible library of 290, with quantification 223
relative to DSS. 224
225
226
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Shaw et al. Selenium and C. jejuni formate dehydrogenase
11
RESULTS 227
228
The cj1500-1501 gene cluster is located in a conserved region of the C. jejuni genome 229
In the C. jejuni NCTC 11168 genome, the cj1501 gene is preceded by the cj1500 gene, which 230
is annotated to encode an inner membrane protein, orthologous to the E. coli YedE protein, and 231
contains 10 transmembrane domains suggesting a transporter function. Both genes are located 232
divergently from the SeC-tRNA (selC, Fig. 1A), in an area of the genome (cj1429c-cj1519) 233
which is highly conserved between the C. jejuni reference strains 81-176, 81116 and RM1221 (8, 234
16, 26). The cj1500 and cj1501 genes are present as two separate but adjacent genes in all 235
sequenced C. jejuni genomes, with the exception of the C. jejuni 81116 genome (26) where these 236
two genes are fused into a single open reading frame (C8J_1404), although the translational 237
signals (ribosome binding site, GTG start codon) for translation of the Cj1501 ortholog are still 238
present (Fig. 1A). 239
The transcription start sites of the predicted cistrons in the cj1500-cj1514c region were 240
determined using 5' RACE. The cj1500 and cj1501 genes are co-transcribed from a σ70 promoter 241
(gnTAnAAT (27)), with the RNA starting at the C residue 46 nt upstream of the TTG start codon 242
of cj1500 (Fig. 1B). Other transcription start sites were detected upstream of the cj1503c (putP), 243
cj1505c, cj1506c (ccaA) (12), cj1508c (fdhD) (34) and cj1514c (fdhM) (14) genes, all with 244
recognisable σ70 -10 promoter sequences (Fig. 1B). No transcription start site could be detected 245
directly upstream of the fdhA gene, suggesting that transcription of the fdhABC genes originates 246
from the promoter upstream of the fdhM gene (Fig. 1A, B). 247
248
Inactivation of cj1500 (fdhT) and cj1501 (fdhU) leads to loss of FDH activity and expression 249
Insertional mutagenesis was used to investigate the function of the cj1500 and cj1501 genes 250
in C. jejuni strain NCTC 11168, and the cj1500-1501 fusion gene C8J_1404 in strain 81116. The 251
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Shaw et al. Selenium and C. jejuni formate dehydrogenase
12
majority of the coding sequences of the cj1500, cj1501 and C8J_1404 genes were replaced by a 252
kanamycin resistance gene, resulting in cj1500 and cj1501 single mutants and a cj1500-1501 253
double mutant in strain NCTC 11168, and a C8J_1404 mutant in strain 81116 (Table 1). We also 254
complemented the different cj1500, cj1501 and C8J_1404 mutations by introducing the cj1501 255
gene in the cj0046 pseudogene, under control of the C. jejuni fdxA promoter (36, 39) (Table 1). 256
Initial characterization of the cj1500, cj1501, and cj1500-1501 mutants of C. jejuni strain NCTC 257
11168, and the C8J_1404 mutant of C. jejuni strain 81116 showed no difference between the 258
wild-type strains and their isogenic mutants in terms of growth in Brucella media, auto-259
agglutination, motility, or resistance to acid-shock (data not shown). 260
Two-dimensional protein gel electrophoresis was used to identify proteins differentially 261
expressed in the cj1501 mutant when compared to the NCTC 11168 wild-type strain, using cells 262
grown to mid-log growth phase in standard Brucella medium. Two proteins of approximately 100 263
kDa and 26 kDa were consistently present in the wild-type strain (Fig. 2A), but absent in the 264
cj1501 mutant. Subsequent identification of the 100 kDa and 26 kDa proteins by mass 265
spectrometry demonstrated these proteins to be the Cj1511c (FdhA) FDH large subunit and 266
Cj1510c (FdhB) putative FDH iron-sulfur subunit, respectively. The absence of the FdhA and 267
FdhB proteins resulted in the loss of FDH activity in the cj1500, cj1501 and C8J_1404 mutants, 268
as measured by a benzylviologen-linked colorimetric assay (Fig. 3A), confirming the coupled 269
function of the cj1500 and cj1501 genes, and that the fused C8J_1404 gene in strain 81116 is 270
functional. Genetic complementation with the cj1501 gene restored FDH activity in a cj1501 271
mutant, but not in the cj1500 or C8J_1404 mutants (Fig. 3A), suggesting that both Cj1500 and 272
Cj1501 are required for FDH biosynthesis and enzyme activity. Hence we have renamed the 273
cj1500 and cj1501 genes to fdhT and fdhU, respectively, and the fusion gene C8J_1404 in strain 274
81116 to fdhTU* and will refer to these genes as such henceforth. 275
The effect of the fdhU mutation on FDH protein expression was reflected at the 276
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Shaw et al. Selenium and C. jejuni formate dehydrogenase
13
transcriptional level, as measured by whole-genome microarray analysis. Transcriptomic 277
comparison of the NCTC 11168 wild-type strain, fdhU mutant, complemented fdhU mutant and 278
the wild-type strain overexpressing fdhU showed the successful complementation and 279
overexpression of fdhU in the respective mutants (Fig. 2B). Subsequent analysis showed that 280
transcription of the fdhA, fdhB and fdhC genes was significantly reduced in the fdhU mutant, but 281
that transcript levels were restored by genetic complementation (Fig. 2B), but that overexpression 282
of fdhU did not result in further increases in fdhABC transcription. Interestingly, transcript levels 283
of the upstream, co-transcribed fdhM (cj1514c) and cj1513c genes were not significantly altered 284
in any of the mutants (Fig. 2B), suggesting that the effect on fdhABC transcription is likely to be 285
post-transcriptional, possibly via RNA instability or degradation. 286
287
Exogenous selenium complements the fdhT, fdhU and fdhTU mutations. 288
We hypothesized that the absence of FDH expression and activity in the fdhU mutant could 289
be due to interference with selenium metabolism, and investigated the effect of supplementation 290
with exogenous selenium on FDH activity in the C. jejuni wild-type and the set of fdhT, fdhU and 291
fdhTU* mutants. We also generated strains with the fdhA (cj1511c), selA (cj1378) and selB 292
(cj1379) genes inactivated, and have tested the effect of selenium supplementation on FDH 293
activity. Inactivation of the selA and selB genes resulted in the absence of detectable FDH activity 294
in the benzylviologen linked assay, confirming the role of SeC in FDH expression and activity 295
(Fig. 3B). As previously described (42), the fdhA mutant lacked any detectable FDH activity, thus 296
confirming the absence of other formate-metabolizing enzymes in C. jejuni NCTC 11168 (Fig. 297
3B). Interestingly, supplementation of growth media with selenium dioxide resulted in partial 298
restoration of FDH activity in the fdhT, fdhU and fdhTU mutants to approximately one third of 299
the activity of the wild-type strain in C. jejuni NCTC 11168, and fully restored FDH activity in 300
the fdhTU* mutant of strain 81116 (Fig. 3B). Selenium supplementation failed to restore FDH 301
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Shaw et al. Selenium and C. jejuni formate dehydrogenase
14
activity in the selA, selB and selAB mutants (Fig. 3B), suggesting that absence of FDH expression 302
and activity in the fdhT and fdhU mutants is due to a defect in selenium metabolism in these 303
strains, which can be complemented by external supplementation of selenium. We hypothesize 304
that a high external concentration of selenium allows the cell to bypass the FdhU function, 305
allowing SeC synthesis and incorporation into the FdhA protein. 306
To investigate whether inactivation of fdhU and/or selenium supplementation of growth 307
media affected transcriptional patterns in the cj1500-cj1514c region, 5' RACE was performed 308
with primers located in fdhM, cj1513c, and both upstream and downstream of the SeC UGA 309
codon of fdhA (Fig. 3C), using RNA isolated from the NCTC 11168 wild-type and fdhU mutant 310
strain, grown with and without selenium dioxide supplementation. Only a single transcription 311
start site was found with primers located in fdhM, cj1513c and upstream of the fdhA SeC UGA 312
codon, whereas no specific amplification product was found with the primer downstream of the 313
fdhA SeC UGA codon (Fig. 3C). This was independent of selenium supplementation or 314
inactivation of the fdhU gene, suggesting that any effect on the fdh transcripts is mediated at the 315
post-transcriptional level. The other transcription start sites in the cj1503c-cj1514c region were 316
not affected by fdhU inactivation or selenium supplementation (only shown for fdhD in Fig. 3C), 317
whereas the fdhT amplification product was more present in the fdhU mutant samples (Fig. 3C). 318
319
Inactivation of fdhU still allows very low levels of formate utilization 320
To further investigate the effect of the fdhU mutation on metabolite usage of C. jejuni, we 321
performed 1H NMR-based metabolite analysis of spent growth media from cultures grown for 0, 322
2, 4, 8 and 24h at 37°C. Figure 4A shows a representative example of such an analysis for the 323
wild-type strain. The formate concentration in unsupplemented Brucella broth was ~0.2 mM, and 324
since an initial experiment demonstrated very rapid removal of formate by the wild-type strain 325
(data not shown), Brucella media were supplemented with formate to 1 mM to avoid the formate 326
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Shaw et al. Selenium and C. jejuni formate dehydrogenase
15
levels falling below the lower detection level too rapidly. As expected, the FDH-negative fdhA 327
mutant was unable to utilize formate, and formate levels remained constant over an 8h growth 328
period (Fig. 4B). In contrast, the wild-type strain metabolized formate very rapidly, with formate 329
levels dropping below detection levels within 2h (Fig. 4B). Formate levels in media obtained 330
from the fdhU mutant decreased between 8h and 24h, suggesting that there may be a very low 331
level of FDH activity in the fdhU mutant, below detection levels of the benzylviologen-linked 332
FDH assay (Figs. 3, 4B). In contrast, genetic complementation with the fdhU gene in the cj0046 333
pseudogene resulted in a formate utilization pattern identical to the wild-type strain. The positive 334
effect of exogenous selenium supplementation of growth media on FDH activity in the fdhU 335
mutant was confirmed using 1H NMR-based metabolite analysis as the formate levels in spent 336
medium were reduced formate levels to below detection level in 24h, whereas selenium 337
supplementation did not result in formate utilization in the fdhA mutant (Fig. 4B). Finally, 1H 338
NMR spectra for lactate, acetate, pyruvate and succinate and other metabolites were analysed to 339
ascertain that there was no significant difference between the wild-type strain and the mutants 340
tested for other metabolites (see Fig. 4B for lactate), thus confirming that the metabolite 341
utilization phenotype of the fdhU mutant is limited to formate (data not shown). 342
343
Presence of FdhT and FdhU orthologs in bacterial genomes coincides with the presence of 344
SelA and SeC-containing FDH enzymes 345
To investigate the potential link between FdhTU orthologs and a SeC-containing FDH, we 346
combined Occurence analysis using the EMBL String database (http://string.embl.de) (33) 347
containing 943 bacterial taxa, 121 eukaryotic taxa and 69 archaeal taxa, with the information on 348
selenium in the trace element database dbTEU 349
(http://gladyshevlab.bwh.harvard.edu/trace_element) (46). FdhTU orthologs were detected in 350
many genera throughout the bacterial kingdom, including the Beta-, Gamma-, and Epsilon-351
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Shaw et al. Selenium and C. jejuni formate dehydrogenase
16
subdivisions of the Proteobacteria, in some members of the Firmicutes and Actinobacteridae, 352
suggesting a joint function of the adjacent genes. When combined with searching for the presence 353
of a SelA and FdhA orthologs, we did find a strong correlation between the predicted presence of 354
adjacent genes encoding FdhTU orthologs and a SeC-containing FdhA in the Gamma and 355
Epsilon-subdivisions of the Proteobacteria (Table 3), whereas the reverse was not found, as SeC-356
containing FdhA were predicted in genomes lacking FdhTU orthologs (for example in Wolinella 357
succinogenes). It should be noted that the analysis only included SeC-containing FdhA, and not 358
other possible selenoproteins. Despite this limitation, the bioinformatic analysis still suggests a 359
link between FdhTU proteins and selenium metabolism in bacteria. 360
361
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Shaw et al. Selenium and C. jejuni formate dehydrogenase
17
DISCUSSION 362
Although C. jejuni is best known as gastrointestinal pathogen of human and animals (20, 45), 363
its natural niche is in the intestinal tract of birds, where it can colonize to high densities in the 364
cecum. Research on metabolic features of C. jejuni has highlighted many adaptations of this 365
bacterium to that cecal niche (22), such as the periplasmic fumarate reductase Mfr which can also 366
use fumarate analogs produced via fermentation by anaerobic bacteria in the cecal microbiota (9), 367
and its versatility in using lactate as a carbon source (36). Another favored substrate for C. jejuni 368
is formate, which is very rapidly used by C. jejuni when present in the growth medium (Fig. 4B), 369
and to which C. jejuni displays chemotactic behaviour (34). The inability to use formate results in 370
lowered colonization in chickens when combined with the absence of hydrogenase activity (42), 371
whereas absence of the formate chemoreceptor or the FDH accessory protein FdhD resulted in 372
lowered immunopathology (but not reduced intestinal colonization) in gnotobiotic mice colonized 373
with a humanized microflora (2). All of these studies highlight the importance of respiration and 374
metabolism for C. jejuni in the intestinal environment. 375
Metabolism of formate in C. jejuni is mediated by the formate dehydrogenase enzyme FDH. 376
The C. jejuni FDH is a tungstoenzyme rather than a molybdoenzyme (31, 35), and is predicted to 377
contain a selenocysteine (SeC) amino acid at position 181 (10), however, the requirement for 378
selenium in FDH activity in C. jejuni was predicted but not demonstrated prior to this study. Here 379
we have shown the need for selenium for FDH activity, and that the Cj1500 (FdhT) and Cj1501 380
(FdhU) proteins are involved in FDH biogenesis, possibly by mediating selenium uptake or 381
downstream processing. In an independent, concurrent study (28), Pryjma and co-workers have 382
shown that in C. jejuni strain 81-176, the fdhTU genes are required for optimal recovery 383
following invasion of epithelial cells, and their data confirm the role of the fdhTU genes in FDH 384
biosynthesis and activity in a third reference strain of C. jejuni. Combined with earlier studies on 385
formate metabolism and intestinal colonization studies and virulence of C. jejuni (2, 34, 42), this 386
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Shaw et al. Selenium and C. jejuni formate dehydrogenase
18
suggests an important contribution of FDH, and also FdhTU and potentially selenium in 387
colonization and virulence properties of C. jejuni. 388
Selenium is an essential trace element for many organisms, and is used in proteins as the 21st 389
amino acid selenocysteine in eukaryotes and prokaryotes (3). Next to FDH, SeC is mostly found 390
in redox-active proteins like peroxiredoxins, glycine reductases, glutaredoxin and proline 391
reductases (46, 47), but these proteins are absent in C. jejuni. Functional genomics approaches 392
have greatly facilitated identification of the encoded selenoproteins, as exemplified by the 393
database for Trace Element Utilization (dbTEU) (46). In dbTEU, 220 species have an annotated 394
FDH, and 120 of the 220 species listed have a SeC-containing FDH enzyme predicted. SeC is 395
coded for by the UGA codon, which is commonly annotated as a stop codon, but in mRNA with a 396
SECIS element, SeC insertion can occur at the UGA codon (11). The SECIS element binds the 397
Sec-specific elongation factor (SelB) which forms a complex with tRNA-SeC (selC), which 398
contains the anticodon for UGA. Synthesis of tRNA-SeC is dependent on the SeC synthase 399
(SelA), which uses selenophosphate as the selenium donor, which is synthesized by the 400
selenophosphate synthase SelD protein. SeC insertion is a unique example of co-translational 401
insertion of a non-standard amino-acid. The dual nature of the UGA codon (a stop codon and a 402
SeC codon) raises an important question of the ability of the cell to distinguish between these two 403
functions. The presence of a SECIS element is a marker for SeC UGA codon, but its sequence or 404
secondary structure is not conserved between bacteria (11, 47), and hence predictions are 405
unreliable. This has led to mis-annotation of genome sequences, as exemplified by the presence 406
of two adjacent fdhA genes rather than a single fdhA gene (e.g. in Helicobacter hepaticus ORFs 407
HH0229 and HH0228 (32)). Next to fdhA, the C. jejuni NCTC 11168 genome sequence contains 408
two other candidates for SeC-containing proteins: a gene encoding a currently unannotated SelW 409
orthologue in the intergenic region between cj0717 and cj0718 (11), and the SelD protein 410
encoded by the cj1504c gene (Fig. 1A). Interestingly, translation of the cj1504c gene is probably 411
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Shaw et al. Selenium and C. jejuni formate dehydrogenase
19
initiated from a rare CTG startcodon, a feature which is not apparent in related Campylobacter 412
species and hence its significance is not known. Also, transcript levels of selD are not 413
significantly affected by the inactivation of the fdhU gene, suggesting that not all selenoproteins 414
are affected by the absence of fdhU (Fig. 2B). 415
Analysis of RNA levels of the fdhABC genes in the fdhU mutant showed that the absence of 416
FDH proteins in the fdhU mutant is linked to reduced RNA levels of the corresponding genes 417
(Fig. 2B). As RNA levels of the fdhM and cj1513c genes were not affected in the fdhU mutant 418
(Fig. 2B, 3C), we hypothesize that the reduced levels of fdhABC RNA is mediated at the post-419
transcriptional level in C. jejuni, possibly due to RNA instability in the absence of fdhABC 420
translation beyond the UGA codon in fdhA when the SeC-tRNA is not available. An alternative 421
explanation could be that this is due to increased transcription in the presence of selenium and 422
binding of the SelB protein to the SECIS element (44), as has been suggested for an SeC-423
containing FDH in Treponema primitia, where sodium selenite-supplementation of growth media 424
did not result in increased transcript level upstream of the SeC UGA codon, but resulted in 425
increased transcript level downstream of the SeC UGA codon (23). 426
In a previous bioinformatic study (47), the SirA-like domain was highlighted as one often 427
found in the vicinity of the selD gene. This gene is present in a highly conserved region of the C. 428
jejuni genome, and contains several genes involved in FDH biogenesis and activity, and selenium 429
metabolism (Fig. 1). The cj1501 and cj1505c genes both contain a SirA-like domain, whereas the 430
cj1507c gene was identified as a ModE-like regulator controlling molybdenum and tungsten 431
uptake (35). Selenocysteine biosynthesis is dependent on the presence of selenium, and selenium 432
storage proteins have not been described to date. This implicates that selenium import will be 433
required for biosynthesis of SeC-containing enzymes, but surprisingly little is known about 434
selenium transport in bacteria (29). In E. coli, selenate (Se(VI)) is transported via the sulfate ABC 435
transporter encoded by the cysAWTP operon (38), but orthologs of this system are absent in C. 436
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Shaw et al. Selenium and C. jejuni formate dehydrogenase
20
jejuni. As FdhT has ten predicted transmembrane regions, it is tempting to speculate that this 437
inner membrane protein may function as a selenium transporter or channel, and this hypothesis is 438
supported by the presence of a pfam04143 (sulphur transport) domain. In addition, FdhT 439
orthologs are also annotated as containing a TIGR04112 (seleno_YedE) domain, which is 440
commonly found in genomes also encoding a selenium trait. The homology of FdhU with the 441
TusA sulfate relay protein (19) points to a possible role in intracellular movement of selenium or 442
conversion of the selenium compound to SeC synthesis apparatus. Such a joint role is supported 443
by the link of fdhTU operons with the presence of SeC-containing FDH enzymes in the Gamma- 444
and Epsilon-subdivisions of the Proteobacteria (Table 3). The role of FdhU is more difficult to 445
predict, but the protein shares significant sequence homology and the N-terminal CPxP motif 446
with the sulfurtransferase TusA which functions in a sulfur-relay system in E. coli (19). 447
Preliminary evidence based on single replicate determination of the selenium content in C. jejuni 448
wild-type and fdhU mutant suggests that the absence of FDH activity in the fdhU mutant is not 449
due to a lack of selenium, as the cellular content of selenium was similar (~2 × 105 Se atoms/cell) 450
between wild-type and fdhU mutant. As it is unknown what selenium compound(s) are used, it is 451
again tempting to speculate that FdhU is involved in interaction or modification with yet 452
unknown selenium compounds, transferring them to the selenocysteine-biosynthesis pathway. 453
Taken together, this study is the first to provide direct evidence for the role of a SirA-like 454
protein (FdhU) in selenium metabolism, via its requirement for FDH biogenesis in C. jejuni. this 455
work also shows that inactivation of the fdhTU genes can be partially complement by exogenous 456
selenium, suggesting the presence of alternative, low-affinity pathways for selenium utilisation or 457
transport in C. jejuni, and links FDH biogenesis and selenium metabolism in this important 458
human bacterial pathogen. 459
460
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Shaw et al. Selenium and C. jejuni formate dehydrogenase
21
ACKNOWLEDGMENTS 461
We thank Julea Butt and Sophie Marritt (University of East Anglia) for assistance with setup 462
of FDH assays, Graham Chilvers (UEA) for selenium measurements, Elena Gomez and Tom 463
Turner (IFR) for technical assistance, and Mark Reuter (IFR), Dave Kelly and Andy Hitchcock 464
(Sheffield) for helpful discussions, suggestions and protocols. 465
This research is supported by the Institute Strategic Programme Grant and a Doctoral Training 466
Grant from the Biotechnology and Biological Research Council (BBSRC) to the Institute of Food 467
Research. 468
469
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Shaw et al. Selenium and C. jejuni formate dehydrogenase
22
REFERENCES 470
471
1. Arner, E. S. 2002. Recombinant expression of mammalian selenocysteine-containing 472
thioredoxin reductase and other selenoproteins in Escherichia coli. Meth Enzymol 347:226-473
235. 474
2. Bereswill, S., A. Fischer, R. Plickert, L. M. Haag, B. Otto, A. A. Kuhl, J. I. Dasti, A. E. 475
Zautner, M. Munoz, C. Loddenkemper, U. Gross, U. B. Gobel, and M. M. Heimesaat. 476
2011. Novel murine infection models provide deep insights into the "menage a trois" of 477
Campylobacter jejuni, microbiota and host innate immunity. PLoS One 6:e20953. 478
3. Bock, A. 2001. Selenium metabolism in bacteria p. 7-22. In Hatfield and D. L (ed.), 479
Selenium. Kluwer Academic Publishers, Hingham, MA, USA. 480
4. Bock, A., K. Forchhammer, J. Heider, and C. Baron. 1991. Selenoprotein synthesis: an 481
expansion of the genetic code. Trends Biochem Sci 16:463-467. 482
5. Bock, A., K. Forchhammer, J. Heider, W. Leinfelder, G. Sawers, B. Veprek, and F. 483
Zinoni. 1991. Selenocysteine: the 21st amino acid. Mol Microbiol 5:515-520. 484
6. Driscoll, D. M., and P. R. Copeland. 2003. Mechanism and regulation of selenoprotein 485
synthesis. Ann Rev Nutr 23:17-40. 486
7. EFSA. 2010. Scientific Opinion on Quantification of the risk posed by broiler meat to 487
human campylobacteriosis in the EU. EFSA Journal 8. 488
8. Fouts, D. E., E. F. Mongodin, R. E. Mandrell, W. G. Miller, D. A. Rasko, J. Ravel, L. 489
M. Brinkac, R. T. DeBoy, C. T. Parker, S. C. Daugherty, R. J. Dodson, A. S. Durkin, 490
R. Madupu, S. A. Sullivan, J. U. Shetty, M. A. Ayodeji, A. Shvartsbeyn, M. C. Schatz, 491
J. H. Badger, C. M. Fraser, and K. E. Nelson. 2005. Major structural differences and 492
novel potential virulence mechanisms from the genomes of multiple Campylobacter 493
species. PLoS Biol 3:e15. 494
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Shaw et al. Selenium and C. jejuni formate dehydrogenase
23
9. Guccione, E., A. Hitchcock, S. J. Hall, F. Mulholland, N. Shearer, A. H. M. van Vliet, 495
and D. J. Kelly. 2010. Reduction of fumarate, mesaconate and crotonate by Mfr, a novel 496
oxygen-regulated periplasmic reductase in Campylobacter jejuni. Environ Microbiol 497
12:576-591. 498
10. Gundogdu, O., S. D. Bentley, M. T. Holden, J. Parkhill, N. Dorrell, and B. W. Wren. 499
2007. Re-annotation and re-analysis of the Campylobacter jejuni NCTC11168 genome 500
sequence. BMC Genomics 8:162. 501
11. Gursinsky, T., D. Grobe, A. Schierhorn, J. Jager, J. R. Andreesen, and B. Sohling. 502
2008. Factors and selenocysteine insertion sequence requirements for the synthesis of 503
selenoproteins from a gram-positive anaerobe in Escherichia coli. Appl Environ Microbiol 504
74:1385-1393. 505
12. Hartley-Tassell, L. E., L. K. Shewell, C. J. Day, J. C. Wilson, R. Sandhu, J. M. Ketley, 506
and V. Korolik. 2010. Identification and characterization of the aspartate chemosensory 507
receptor of Campylobacter jejuni. Mol Microbiol 75:710-730. 508
13. Hatfield, D. L., and V. N. Gladyshev. 2002. How selenium has altered our understanding 509
of the genetic code. Mol Cell Biol 22:3565-3576. 510
14. Hitchcock, A., S. J. Hall, J. D. Myers, F. Mulholland, M. A. Jones, and D. J. Kelly. 511
2010. Roles of the twin-arginine translocase and associated chaperones in the biogenesis of 512
the electron transport chains of the human pathogen Campylobacter jejuni. Microbiology 513
156:2994-3010. 514
15. Hoffman, P. S., and T. G. Goodman. 1982. Respiratory physiology and energy 515
conservation efficiency of Campylobacter jejuni. J Bacteriol 150:319-326. 516
16. Hofreuter, D., J. Tsai, R. O. Watson, V. Novik, B. Altman, M. Benitez, C. Clark, C. 517
Perbost, T. Jarvie, L. Du, and J. E. Galan. 2006. Unique features of a highly pathogenic 518
Campylobacter jejuni strain. Infect Immun 74:4694-4707. 519
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Shaw et al. Selenium and C. jejuni formate dehydrogenase
24
17. Holmes, K., F. Mulholland, B. M. Pearson, C. Pin, J. McNicholl-Kennedy, J. M. 520
Ketley, and J. M. Wells. 2005. Campylobacter jejuni gene expression in response to iron 521
limitation and the role of Fur. Microbiology 151:243-257. 522
18. Holmes, K., T. J. Tavender, K. Winzer, J. M. Wells, and K. R. Hardie. 2009. AI-2 does 523
not function as a quorum sensing molecule in Campylobacter jejuni during exponential 524
growth in vitro. BMC Microbiol 9:214. 525
19. Ikeuchi, Y., N. Shigi, J. Kato, A. Nishimura, and T. Suzuki. 2006. Mechanistic insights 526
into sulfur relay by multiple sulfur mediators involved in thiouridine biosynthesis at tRNA 527
wobble positions. Mol Cell 21:97-108. 528
20. Janssen, R., K. A. Krogfelt, S. A. Cawthraw, W. van Pelt, J. A. Wagenaar, and R. J. 529
Owen. 2008. Host-pathogen interactions in Campylobacter infections: the host perspective. 530
Clin Microbiol Rev 21:505-518. 531
21. Jormakka, M., B. Byrne, and S. Iwata. 2003. Formate dehydrogenase--a versatile 532
enzyme in changing environments. Curr Opin Struct Biol 13:418-423. 533
22. Kelly, D. J. 2008. Complexity and Versatility in the Physiology and Metabolism of 534
Campylobacter jejuni, p. 41-61. In I. Nachamkin, C. Szymanski, and M. J. Blaser (ed.), 535
Campylobacter 3ed. ASM Press, Washington DC. 536
23. Matson, E. G., X. Zhang, and J. R. Leadbetter. 2010. Selenium controls transcription of 537
paralogous formate dehydrogenase genes in the termite gut acetogen, Treponema primitia. 538
Environ Microbiol 12:2245-2258. 539
24. Mota, C. S., M. G. Rivas, C. D. Brondino, I. Moura, J. J. Moura, P. J. Gonzalez, and 540
N. M. Cerqueira. 2011. The mechanism of formate oxidation by metal-dependent formate 541
dehydrogenases. J Biol Inorg Chem 16:1255-1268. 542
25. Parkhill, J., B. W. Wren, K. Mungall, J. M. Ketley, C. Churcher, D. Basham, T. 543
Chillingworth, R. M. Davies, T. Feltwell, S. Holroyd, K. Jagels, A. V. Karlyshev, S. 544
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Shaw et al. Selenium and C. jejuni formate dehydrogenase
25
Moule, M. J. Pallen, C. W. Penn, M. A. Quail, M. A. Rajandream, K. M. Rutherford, 545
A. H. M. van Vliet, S. Whitehead, and B. G. Barrell. 2000. The genome sequence of the 546
food-borne pathogen Campylobacter jejuni reveals hypervariable sequences. Nature 547
403:665-668. 548
26. Pearson, B. M., D. J. Gaskin, R. P. Segers, J. M. Wells, P. J. Nuijten, and A. H. M. van 549
Vliet. 2007. The complete genome sequence of Campylobacter jejuni strain 81116 550
(NCTC11828). J Bacteriol 189:8402-8403. 551
27. Petersen, L., T. S. Larsen, D. W. Ussery, S. L. On, and A. Krogh. 2003. RpoD 552
promoters in Campylobacter jejuni exhibit a strong periodic signal instead of a -35 box. J 553
Mol Biol 326:1361-1372. 554
28. Pryjma, M., D. Apel, S. Huynh, C. T. Parker, and E. C. Gaynor. 2011. Recovery of 555
Campylobacter jejuni following host cell infection requires FdhTU-modulated formate 556
dehydrogenase expression and electron donor availability. J Bacteriol: submitted for 557
publication (JB06665-11). 558
29. Rosen, B. P., and Z. Liu. 2009. Transport pathways for arsenic and selenium: a 559
minireview. Environ Int 35:512-515. 560
30. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory 561
Manual 2nd Edition, vol. Cold Spring Harbor Laboratory Press. 562
31. Smart, J. P., M. J. Cliff, and D. J. Kelly. 2009. A role for tungsten in the biology of 563
Campylobacter jejuni: tungstate stimulates formate dehydrogenase activity and is 564
transported via an ultra-high affinity ABC system distinct from the molybdate transporter. 565
Mol Microbiol 74:742-757. 566
32. Suerbaum, S., C. Josenhans, T. Sterzenbach, B. Drescher, P. Brandt, M. Bell, M. 567
Droge, B. Fartmann, H. P. Fischer, Z. Ge, A. Horster, R. Holland, K. Klein, J. Konig, 568
L. Macko, G. L. Mendz, G. Nyakatura, D. B. Schauer, Z. Shen, J. Weber, M. Frosch, 569
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Shaw et al. Selenium and C. jejuni formate dehydrogenase
26
and J. G. Fox. 2003. The complete genome sequence of the carcinogenic bacterium 570
Helicobacter hepaticus. Proc Natl Acad Sci USA 100:7901-7906. 571
33. Szklarczyk, D., A. Franceschini, M. Kuhn, M. Simonovic, A. Roth, P. Minguez, T. 572
Doerks, M. Stark, J. Muller, P. Bork, L. J. Jensen, and C. von Mering. 2011. The 573
STRING database in 2011: functional interaction networks of proteins, globally integrated 574
and scored. Nucleic Acids Res 39:D561-568. 575
34. Tareen, A. M., J. I. Dasti, A. E. Zautner, U. Gross, and R. Lugert. 2010. Campylobacter 576
jejuni proteins Cj0952c and Cj0951c affect chemotactic behaviour towards formic acid and 577
are important for invasion of host cells. Microbiology 156:3123-3135. 578
35. Taveirne, M. E., M. L. Sikes, and J. W. Olson. 2009. Molybdenum and tungsten in 579
Campylobacter jejuni: their physiological role and identification of separate transporters 580
regulated by a single ModE-like protein. Mol Microbiol 74:758-771. 581
36. Thomas, M. T., M. Shepherd, R. K. Poole, A. H. M. van Vliet, D. J. Kelly, and B. M. 582
Pearson. 2011. Two respiratory enzyme systems in Campylobacter jejuni NCTC 11168 583
contribute to growth on L-lactate. Environ Microbiol 13:48-61. 584
37. Thome, R., A. Gust, R. Toci, R. Mendel, F. Bittner, A. Magalon, and A. Walburger. 585
2012. A sulfurtransferase is essential for activity of formate dehydrogenases in Escherichia 586
coli. J Biol Chem 287:4671-4678. 587
38. Turner, R. J., J. H. Weiner, and D. E. Taylor. 1998. Selenium metabolism in 588
Escherichia coli. Biometals 11:223-227. 589
39. van Vliet, A. H. M., M. A. Baillon, C. W. Penn, and J. M. Ketley. 2001. The iron-590
induced ferredoxin FdxA of Campylobacter jejuni is involved in aerotolerance. FEMS 591
Microbiol Lett 196:189-193. 592
40. van Vliet, A. H. M., K. G. Wooldridge, and J. M. Ketley. 1998. Iron-responsive gene 593
regulation in a Campylobacter jejuni fur mutant. J Bacteriol 180:5291-5298. 594
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Shaw et al. Selenium and C. jejuni formate dehydrogenase
27
41. Walczak, R., N. Hubert, P. Carbon, and A. Krol. 1997. Solution structure of SECIS, the 595
mRNA element required for eukaryotic selenocysteine insertion--interaction studies with 596
the SECIS-binding protein SBP. Biomed Environ Sci 10:177-181. 597
42. Weerakoon, D. R., N. J. Borden, C. M. Goodson, J. Grimes, and J. W. Olson. 2009. 598
The role of respiratory donor enzymes in Campylobacter jejuni host colonization and 599
physiology. Microb Pathogen 47:8-15. 600
43. Weljie, A. M., J. Newton, P. Mercier, E. Carlson, and C. M. Slupsky. 2006. Targeted 601
profiling: quantitative analysis of 1H NMR metabolomics data. Anal Chem 78:4430-4442. 602
44. Yoshizawa, S., L. Rasubala, T. Ose, D. Kohda, D. Fourmy, and K. Maenaka. 2005. 603
Structural basis for mRNA recognition by elongation factor SelB. Nat Struct Mol Biol 604
12:198-203. 605
45. Young, K. T., L. M. Davis, and V. J. Dirita. 2007. Campylobacter jejuni: molecular 606
biology and pathogenesis. Nat Rev Microbiol 5:665-679. 607
46. Zhang, Y., and V. N. Gladyshev. 2010. dbTEU: a protein database of trace element 608
utilization. Bioinformatics 26:700-702. 609
47. Zhang, Y., A. A. Turanov, D. L. Hatfield, and V. N. Gladyshev. 2008. In silico 610
identification of genes involved in selenium metabolism: evidence for a third selenium 611
utilization trait. BMC Genomics 9:251. 612
613
614
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Shaw et al. Selenium and C. jejuni formate dehydrogenase
28
LEGENDS TO FIGURES 615
616
Figure 1 617
Schematic representation of the region of the C. jejuni genome containing the fdhTU 618
accessory genes and fdhABC structural genes of C. jejuni strain NCTC 11168 and 81116, and the 619
promoters and transcription start sites driving transcription of the genes in this genomic region. 620
(A) The region is shown from the selC gene (cjp26, SeC-tRNA) to the cj1514c gene (fdhM). In 621
the 81116 genome this is the region from C8J_t0031 to C8J_1417 (26), in strain 81-176 the 622
region from CJJ81176_1753 (upstream of CJJ81176_1490) to CJJ81176_1506 (16). Grey arrows 623
represent FDH subunit or accessory proteins, white arrows genes predicted to be involved in 624
selenium metabolism, black arrows genes not known to be involved in either FDH expression or 625
selenium metabolism. Arrows show the presence of promoters in C. jejuni NCTC 11168, the box 626
shows the point mutation in strain 81116 leading to the fdhTU* fusion gene. (B) Transcription 627
start sites and annotated promoters and 5' untranslated regions in the C. jejuni NCTC 11168 628
cj1500-cj1514c genomic region. The nucleotide position of the transcription start site on the 629
NCTC 11168 genome is given on the left, whereas the sequence of the promoter and 5' UTR is 630
shown with specific sections shown in capital letters, underlined from left to right: -10 promoter 631
sequence, transcription start site (in bold), ribosome binding site and translational start codon. 632
<Nxx> represents a stretch of xx nucleotides not shown. 633
634
Figure 2 635
Inactivation of the fdhU gene results in reduced expression of the FdhA and FdhB formate 636
dehydrogenase subunit proteins in C. jejuni NCTC 11168, and is accompanied by reduced 637
transcription of the fdhABC genes. (A) The wild-type strain and its isogenic fdhU mutant were 638
grown to mid-log phase in Brucella medium, and total protein was separated by two-dimensional 639
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Shaw et al. Selenium and C. jejuni formate dehydrogenase
29
protein gel electrophoresis. Two proteins were detected which showed differential expression 640
between the wild-type strain and the fdhU mutant, and were identified as the FdhA (~100 kDa) 641
and FdhB (~26 kDa) proteins. A 2D gel is shown, with the regions containing the FdhA and 642
FdhB proteins magnified, allowing comparison of protein expression. A representative example 643
is shown of the three biological repeats examined. (B) Effect of inactivation, complementation 644
and overexpression of fdhU on RNA levels in C. jejuni NCTC 11168, as determined by 645
microarray analysis. Black bars represent the fdhU mutant (11168 ΔfdhU), white bars represent 646
the complemented strain (11168 ΔfdhU::fdhUC), grey bars represent the strain overexpressing 647
fdhU (11168 wild-type::fdhUC) (Table 1). RNA levels are expressed as the fold change of RNA 648
levels in the mutant strain when compared to the wild-type (ratio mutant/wild-type) ± standard 649
deviation. All values are the average from RNA samples isolated from three biological replicates, 650
except for the fdhU overexpression strain, which is based on analysis two independent RNA 651
samples. An asterisk indicates RNA levels significantly altered in either the fdhU mutant, 652
complemented fdhU mutant, or fdhU overexpression strain when compared to the wild-type strain 653
(P < 0.01). 654
655
Figure 3 656
Selenium and genetic complementation restore formate dehydrogenase enzyme activity in C. 657
jejuni, but do not affect transcription initiation of fdhABC and other genes in the cj1500-cj1514c 658
genomic region. (A) Effect of inactivation of the fdhT and fdhU genes in C. jejuni NCTC 11168, 659
and the fusion gene fdhTU* in C. jejuni 81116, and the effect of complementation with the NCTC 660
11168 fdhU gene under control of the fdxA promoter, on FDH activity. (B) Inactivation of the 661
SeC-biosynthesis pathway genes selA and selB results in absence of FDH activity. Medium 662
supplementation with selenium dioxide to a final concentration of 5 μM partially (NCTC 11168) 663
or fully (81116) restores FDH enzyme activity in fdhT, fdhU and fdhTU* mutants, but cannot 664
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Shaw et al. Selenium and C. jejuni formate dehydrogenase
30
restore FDH activity in selA and selB mutants. An fdhA mutant was included as control. Black 665
bars show FDH activity in unsupplemented Brucella broth, white bars show the effect of medium 666
supplementation with 5 μM selenium dioxide. Error bars represent the standard deviation from 667
two (for FDH-negative samples) to five biological replicates. Asterisks indicate samples where 668
activity was below detection level, ND = not determined, WT = wild-type strain. (C) Comparitive 669
5' RACE determination of fdhA, cj1513c, fdhM, fdhT and fdhD transcription start sites, using the 670
NCTC 11168 wild-type strain and fdhU mutant, grown in Brucella broth with and without 5 μM 671
selenium dioxide supplementation. Asterisks highlight TAP-specific amplification products 672
representing transcription start sites shown in Figure 1B, other bands are non-specific 673
amplification products. 674
675
Figure 4 676
Inactivation of fdhU disrupts formate metabolism in C. jejuni, as determined by 1H NMR 677
analysis of spent growth medium. (A) Representative example of the 1H NMR traces of spent 678
medium, obtained from the wild-type strain, with time points of 0, 2, 4, 8 and 24h. Peaks for 679
which the metabolite has been identified are indicated: asn, asparagine; asp, aspartate; glu, 680
glutamate; lac, lactate; suc, succinate; pyr, pyruvate; pyglu, pyroglutamate. (B) Comparison of 681
formate concentrations in spent medium (supplemented with formate to 1 mM prior to incubation 682
with cells) for wild-type C. jejuni NCTC 11168, the fdhU mutant and the genetically 683
complemented strain, and the fdhU mutant in selenium-supplemented medium. Formate levels go 684
down very rapidly in the wild-type strain, but go down partially in the mutant only after 24h, 685
showing the presence of very low levels of FDH activity in the fdhU mutant. The (partial) 686
restoration of FDH activity in the fdhU mutant by genetic complementation results in very similar 687
formate disappearance when compared to the wild-type strain, whereas selenium supplementation 688
results in reduction of formate levels, but more slowly than in the wild-type strain. A medium 689
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Shaw et al. Selenium and C. jejuni formate dehydrogenase
31
control is included, and an fdhA mutant with and without selenium supplementation, and none of 690
these show removal of formate. The levels of lactate are shown for comparison, and are 691
independent of selenium supplementation or genetic inactivation and complementation. Bars 692
show the average of data obtained from three biological replicates, error bars denote standard 693
deviation. Asterisks indicate samples where formate levels were below detection level, ND = not 694
determined. WT = wild-type strain. 695
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Table 1. C. jejuni strains used in this investigation
C. jejuni strain Details / Reference a
NCTC 11168 Wild-type strain (25)
81116 Wild-type strain (NCTC 11828) (26)
11168 ΔfdhT cj1500::kanR
11168 ΔfdhU cj1501::kanR
11168 ΔfdhTU cj1500-1501::kanR
11168 ΔfdhT::fdhUC (b) cj1500::kanR complemented with cj0046::(PfdxA-cj1501 catR)
11168 ΔfdhU::fdhUC (b) cj1501::kanR complemented with cj0046::(PfdxA-cj1501 catR)
11168 ΔfdhTU::fdhUC (b) cj1500-1501::kanR complemented with cj0046::(PfdxA-cj1501 catR)
11168 wild-type::fdhUC (b) NCTC 11168 with cj0046::(PfdxA-cj1501 catR), overexpressing fdhU
11168 ΔselA cj1378::kanR
11168 ΔselB cj1379::kanR
11168 ΔselAB cj1378-1379::kanR
11168 ΔfdhA cj1511c::kanR
81116 ΔfdhTU* C8J_1404::kanR
81116 ΔfdhTU*::fdhUC (b) C8J_1404::kanR complemented with cj0046::(PfdxA-cj1501 catR)
a. kanR is the kanamycin resistance cassette (40), catR is the chloramphenicol resistance
cassette (40).
b. Complementation and overexpression of fdhU was performed using the cj0046 pseudogene
(36), with the gene expressed from the fdxA promoter (PfdxA) (39).
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Table 2. Oligonucleotide primers used for 5' RACE.
Primer name Primer sequence (5' → 3')
RNA adaptor AUAUGCGCGAAUUCCUGUAGAACGAACACUAGAAGAAA
Adaptor-specific primer GCGCGAATTCCTGTAGA
Cj1500R (fdhT) AACCTATAAACATACCTATG
Cj1503cR (putA) TTGGCTTCTATTTGTCCTTG
Cj1505cR (cj1505c) ATTCACCCTCACCCACTTTG
Cj1506cR (ccaA) GGTTGATCTAAACATTTCTG
Cj1508cR (fdhD) ATCGATATTGGCAGTATGTG
Cj1511cR-SeC (fdhA*) a TTTGAAGTTCCTACAGTATG
Cj1511cR (fdhA) b CCACCTGAACTCACAGGATG
Cj1513cR (cj1513c) TCCCAATTAGCACTTCTTTG
Cj1514cR (fdhM) AAGAAAAAGTCGTTGGAATG
a. primer located downstream (3') of the SeC UGA codon in the fdhA gene.
b. primer located upstream (5') of the SeC UGA codon in the fdhA gene.
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
Table 3. Distribution of FdhTU orthologs, SelA and selenoproteins in completed Proteobacterial
genomes a
Genus (species) fdhTU operon b SelA c Selenoproteins d
Epsilonproteobacteria
Campylobacter (6) yes (4/6 species) All SelA+ FDH
Arcobacter (1) yes SelA+ FDH
Helicobacter (3) yes (1/3 species) All SelA+ FDH in 1 species
Sulfurimonas (1) yes SelA+ FDH
other Epsilonproteobacteria (2) e no SelA+ FDH
Gammaproteobacteria
Escherichia (2) yes (all) All SelA+ FDH
Salmonella (1) yes SelA+ FDH
Yersinia (3) yes (all) All SelA+ FDH
Serratia (1) yes SelA+ FDH
other Enterobacteriaceae (10) f yes SelA+ FDH
other Enterobacteriaceae (15) g no 4/15 SelA+ (h) FDH in 4 species h
Pseudomonas (9) yes (2/9 species) 4/9 SelA+ (h) FDH in 4 species h
Shewanella (14) yes (5/14 species) 5/14 SelA+ (h) FDH in 5 species h
Actinobacillus (2) yes (1/2 species) 2/2 SelA+ (h) FDH in 2 species h
Betaproteobacteria
Nitrosomonas (2) yes (all) Negative none
a. Analysis based on Version 9.0 of the String Database (http://string.embl.de, last accessed
27/04/2012) (33). The dataset consists of 943 bacterial taxa, 121 eukaryotic taxa and 69
archeaeal taxa, and only includes completed genome sequences. The modules used were
Neighborhood (for analysis of the presence of a fdhTU operon) and Occurence (with Cj1500
(FdhT), Cj1501 (FdhU), Cj1378 (SelA) and Cj1511c (FdhA)).
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
b. As FdhU is homologous to TusA (19), only species with adjacent fdhT and fdhU orthologs
were included in the analysis.
c. Based on presence of orthologous open reading frame and annotation, using String (33).
d. Based on the database on Trace Element Utilization (dbTEU) (46) and annotation of gene
sequences. Some species have more than a single FDH enzyme.
e. Other Epsilonproteobacteria: Wolinella (1), Nautilia (1).
f. Other FdhTU-positive Enterobacteriaceae: Shigella (4), Klebsiella (1), Cronobacter (2),
Citrobacter (1), Proteus (1), Enterobacter (1).
g. Other FdhTU-negative Enterobacteriaceae: Buchnera (1), Dickeya (2), Blochmania (2),
Hamiltonella (1), Pectobacterium (3), Edwardsiella (2), Photorabdus (2), Erwinia (2),
Sodalis (1), Wigglesworthia (1).
h. For all categories, the SelA+-species are the same ones as the species with SeC-containing
FDH enzyme(s).
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
fdhTj1500
putPj1502
fdhUj1501
putAj1503
fdhAj1511
selDj1504
fdhBj1510
1505c fdhCj1509
ccaAj1506
fdhDj1508
modEj1507
fdhMj1514
1513cselCtRNA
SeC
ASeC
fdhUQ L K G * V K
11168 caacttaAAGGATAAacaGTGaaa||||||||||||| ||||||||||
81116 caacttaAAGGAtcaacaGTGaaaQ L K G S T V K
fdhTU*C8J_1404
cj1500 cj1502ccj1501 cj1503c cj1511ccj1504c cj1510ccj1509ccj1506c cj1508ccj1507c cj1514ctRNA
81116 not involved in FDH biogenesis/activity
FDH subunit / accessory protein
putative selenium metabolism gene
putative SeC-codon containing geneSeC
promoter
Bcj1500 (pos 1,432,561): atttaagcTATAATctcactCttttttag<N20>atttttAGGAtctttctTTG
cj1503c (pos 1,439,066): ttatttataTATTATttattAaaatttattttatcttAGGAGatacgaaATG
cj1505c (pos 1,440,795): ataaaataaTATTATttttcAaagctaatatcAAGGAaaaataATG
cj1506c (pos 1,443,012): aaatatgtTAAAATtagaatCtaaatttttattttAGGAGttataagATG
cj1508c (pos 1,444,629): tttttgaTATAATattatttAaagatatttaAAGGAtaaggtATG
cj1514c (pos 1,450,118): aaatagtatTAAGATaaatcGatttaaaa<N82>aatgcatGGGAGctttaATG
Shaw et al (JB06586-11.R1), Fig. 1
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
FdhA
wild-type ΔfdhUA
(KD
a)
~100113 pI
Mol
ecul
ar w
eigh
t (
10~10
FdhB
wild-type ΔfdhUBB
10
100
(mut
ant/w
ild-ty
pe) *
0.01
0.1
1
fold
cha
nge
RN
A le
vel
** * *
fdhUfdhT selD fdhC fdhB fdhA fdhM1513c
Shaw et al (JB06586-11.R1), Fig. 2
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
A FDH activity(nmoles viologen oxidised min-1 mg protein-1)
0 500 1000 1500
*
11168 WT
ΔfdhT
ΔfdhU
**
*
ΔfdhTU
ΔfdhT::fdhUC
ΔfdhU::fdhUC
ΔfdhTU::fdhUC
00 50 100 150 200
ΔfdhTU*
81116 WT
B
ΔfdhTU*::fdhUC
*
ND
ND
0 500 1000 1500
FDH activity(nmoles viologen oxidised min-1 mg protein-1)
11168 WT
ΔfdhA
ΔfdhT
**
*
ΔfdhT
ΔfdhU
ΔfdhTU
ΔselA
ΔselB
ΔselAB
**
**
**
00 50 100 150 200
ΔfdhTU*
81116 WTND
C +Se-Se
wild-type ΔfdhU ΔfdhUwild-type
+ - + - + - + -MTAP
*fdhA
fdhA*
*1513c
*fdhM
fdhA
*fdhD
*fdhT
fdhAfdhM cj1513c
SeC
Shaw et al (JB06586-11.R1), Fig. 3
fdhA fdhA*1513cfdhM
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
A formate
asn, asp
pyglupyglu,
gluglu
lac
t=0h
suc acetatepyr
t=2h
t=4h
t=8h
B
1.51.61.71.81.92.02.12.22.32.42.52.62.72.82.9 ppm8.48.68.8 ppm
t=24h
0.8
0.9
1.0
M
0.1
0.2
0.3
0.4
0.5
0.6
0.7
[form
ate]
in m
M
* * * * * * * ** * ND ND0
0 2 4 8 24 0 2 4 8 24 0 2 4 8 24 0 2 4 8 24 0 2 4 8 24 0 2 4 8 24 0 2 4 8 24
medium 11168 WT ΔfdhU ΔfdhU + Se ΔfdhU::fdhUC ΔfdhA ΔfdhA + Se
* * * * * * * ** *
1 5
2.0
2.5
3.0
te] i
n m
M
0
0.5
1.0
1.5
[lact
at
0 2 4 8 24 0 2 4 8 24 0 2 4 8 24 0 2 4 8 24 0 2 4 8 24 0 2 4 8 24 0 2 4 8 24
medium 11168 WT ΔfdhU ΔfdhU + Se ΔfdhU::fdhUC ΔfdhA ΔfdhA + Se
ND ND
Strain (complementation/supplementation) and time-point (h)
Shaw et al (JB06586-11.R1), Fig. 4
on May 19, 2018 by guest
http://jb.asm.org/
Dow
nloaded from