shaw et al . selenium and formate...

Shaw et al. Selenium and C. jejuni formate dehydrogenase

1

REVISED MANUSCRIPT JB06586-11-v1 1

2

Selenium-dependent biogenesis of formate dehydrogenase in 3

Campylobacter jejuni is controlled by the fdhTU accessory genes 4

5

Frances L. Shaw, Francis Mulholland, Gwénaëlle Le Gall, Ida Porcelli, Dave J. Hart, 6

Bruce M. Pearson & Arnoud H.M. van Vliet * 7

8

Institute of Food Research, Norwich Research Park, Norwich NR4 7UA, United Kingdom 9

10

* Corresponding author. Mailing address: Institute of Food Research, Norwich Research Park, 11

Colney Lane, Norwich NR4 7UA, United Kingdom. Phone +44-1603-255250, Fax +44-1603-12

507723, E-mail: [email protected] 13

14

Running title: Selenium and C. jejuni formate dehydrogenase 15

16

Keywords: Campylobacter, foodborne pathogen, selenoprotein 17

18

Copyright © 2012, American Society for Microbiology. All Rights Reserved.J. Bacteriol. doi:10.1128/JB.06586-11 JB Accepts, published online ahead of print on 18 May 2012

on May 19, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


2

ABSTRACT 19

The foodborne bacterial pathogen Campylobacter jejuni efficiently utilizes organic acids such 20

as lactate and formate for energy production. Formate is rapidly metabolized via the activity of 21

the multi-subunit formate dehydrogenase (FDH) enzyme, of which the FdhA subunit is predicted 22

to contain a selenocysteine (SeC) amino acid. In this study we have investigated the function of 23

the cj1500 and cj1501 genes of C. jejuni, demonstrate that they are involved in selenium-24

controlled production of FDH, and propose the names fdhT and fdhU, respectively. Insertional 25

inactivation of fdhT or fdhU in C. jejuni resulted in the absence of FdhA and FdhB protein 26

expression, reduced fdhABC RNA levels, absence of FDH enzyme activity, and lack of formate 27

utilization as assessed by 1H NMR. The fdhABC genes are transcribed from a single promoter 28

located two genes upstream of fdhA, and the decrease in fdhABC RNA levels in the fdhU mutant 29

is mediated at the post-transcriptional level. FDH activity and the ability to utilize formate were 30

restored by genetic complementation with fdhU, and by supplementation of growth media with 31

selenium dioxide. Disruption of SeC synthesis by inactivation of the selA and selB genes also 32

resulted in absence of FDH activity, which could not be restored by selenium supplementation. 33

Comparitive genomic analysis suggests a link between the presence of selA and fdhTU orthologs, 34

and the predicted presence of SeC in FdhA. The fdhTU genes encode accessory proteins required 35

for FDH expression and activity in C. jejuni, possibly by contributing to acquisition or utilization 36

of selenium. 37

38


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


3

INTRODUCTION 39

The foodborne bacterial pathogen Campylobacter jejuni is the most prevalent bacterial cause 40

of human gastroenteritis in the developed world (7). The organism colonizes the avian cecum to 41

high densities, and is highly adapted to life in this environmental niche. C. jejuni is a 42

microaerophilic organism which cannot ferment sugars for energy production, but instead relies 43

on organic acids and amino acids (22). One of the preferred substrates for C. jejuni is formate 44

(15), which is produced by anaerobic fermentation by the local microflora in the avian and 45

mammalian intestine (22). Formate is metabolized by the formate dehydrogenase (FDH) enzyme 46

via oxidation (21), with electrons being donated to a second substrate, such as NAD+ (Formate + 47

NAD+ + H+ + 2e- ↔ CO2 + NADH + 2H+ + 2e-) (24). 48

The C. jejuni NCTC 11168 genome sequence (10, 25) contains four genes annotated as FDH 49

subunits (fdhABCD, cj1511c-1508c). FdhA (Cj1511c) is a large 110 kDa protein which is 50

predicted to contain a selenocysteine amino acid (SeC), whereas FdhB (24 kDa) and FdhC (35 51

kDa) are an iron-sulfur protein and a cytochrome B-containing protein, respectively (22). FdhD 52

acts as sulfurtransferase in E. coli, where it is required for FDH activity (37), but its function in 53

C. jejuni is unknown. Upstream of fdhABCD, there are two more genes involved in FDH 54

biosynthesis and activity: cj1514c was shown to be specifically required for the activity of FDH 55

and was designated fdhM (14), whereas cj1513c encodes a TAT-exported protein of unknown 56

function which is translationally coupled to the downstream fdhA gene and is specific to the 57

Epsilonproteobacteria (14). The C. jejuni FDH has been reported to be a tungstoenzyme (31, 35), 58

and the Cj1513c protein has been suggested to be required for formation of a tungsten-pterin 59

cofactor (14). FDH plays an important role in C. jejuni, as the combined absence of FDH and 60

hydrogenase activity significantly reduced the ability of C. jejuni to colonize the chicken cecum 61

(42), whereas the inactivation of either fdhD or the formic acid chemoreceptor gene cj0952c 62

resulted in reduced immunopathology in gnotobiotic mice containing a humanized intestinal 63


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


4

microflora (2). The natural flora of the chicken cecum is dominated by anaerobic fermentative 64

organisms which produce formate and hydrogen, and a mutant unable to oxidize either of these 65

substrates in this ecological niche is most likely disadvantaged. 66

The SeC amino acid, as predicted to be present in C. jejuni FdhA, is the 21st amino acid (5). 67

It has the same structure as cysteine, except that the sulphur atom is replaced by selenium, and 68

has both a lower pKa and a higher redox potential than cysteine. In selenoproteins, the SeC amino 69

acid is coded for by an in-frame UGA codon (which is normally a stop codon) (4, 5, 13). This 70

process is controlled via a specialized element present in the mRNA, called SECIS 71

(SElenoCysteine Insertion Sequence), which is located immediately downstream of the UGA 72

codon, and together with SelB ensures the incorporation of the SeC into the polypeptide chain 73

(11). Synthesis of tRNA-SeC (selC) is mediated by SelA, and selAB orthologs are present in the 74

C. jejuni genome (cj1378-1379) (6, 13, 41). In general, when cells are grown in the absence of 75

selenium, translation of selenoproteins terminates at the SeC UGA codon, resulting in a 76

truncated, non-functional enzyme (1). 77

Although biosynthesis of selenoproteins has been extensively studied, there are still 78

questions relating to which transport systems, and in what form selenium is taken up into 79

bacterial cells, and what factors other than the currently known sel genes are involved in 80

biogenesis of selenoproteins. One class of proteins which have recently been implicated in 81

microbial selenium metabolism are those containing a SirA-like domain (23, 47), which are 82

present in many microbial and archaeal genomes. This family shares an N-terminal domain, 83

modelled by pfam01206, with the sulfurtransferase TusA (also called SirA-like) (19), but 84

experimental validation of a role of SirA-like domain containing proteins in selenium metabolism 85

is lacking to date. In this study we have investigated the function of the C. jejuni cj1501 gene, 86

which encodes a SirA-like protein which we have named FdhU, and report on the role of the 87

cj1500-cj1501 (fdhTU) and selAB genes in selenium-dependent FDH biogenesis in C. jejuni. 88

89


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


5

MATERIALS AND METHODS 90

91

Bacterial strains, media and growth conditions 92

C. jejuni strains NCTC 11168, 81116 (NCTC 11828) and their isogenic mutants (Table 1) 93

were routinely grown in Brucella media at 37°C under microaerobic conditions (85% N2, 5% O2, 94

10% CO2). Escherichia coli TOP10 (Novagen) was grown aerobically in Luria Bertani medium 95

(30) at 37°C. Where appropriate, media were supplemented with ampicillin (final concentration 96

100 µg ml-1), kanamycin (final concentration 20 µg ml-1), or chloramphenicol (final concentration 97

20 µg ml-1). Filter-sterilized selenium dioxide solution in water was used to supplement Brucella 98

media to a final concentration of 5 µM. Filter-sterilized formate solution in water was used to 99

supplement media to a final concentration of 1 mM. 100

101

Genetic manipulation of C. jejuni 102

Inactivation and complementation of C. jejuni genes was done essentially as described 103

previously (36). Specific C. jejuni genes were inactivated by the replacement and insertion of 104

antibiotic resistance cassettes (kanamycin or chloramphenicol). The mutants were confirmed by 105

PCR and sequencing. To complement/supplement the cj1501 gene in C. jejuni strains, the gene 106

was inserted together with a chloramphenicol resistance gene into the pseudogene Cj0046, under 107

control of a native C. jejuni promoter, fdxA (36, 39). This construct was then introduced into the 108

C. jejuni wild-type strain and its isogenic cj1501 mutant by electroporation, followed by selection 109

for chloramphenicol resistance. Correct integration of the constructs into the genomic copy of the 110

cj0046 pseudogene of C. jejuni NCTC 11168 was validated by PCR (36). 111

112

Preparation of C. jejuni genomic DNA and RNA 113

Genomic DNA was isolated from C. jejuni cells grown microaerobically for 24 hours on 114


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


6

Brucella agar, using a DNeasy kit (Qiagen) according to the manufacturer’s instructions. RNA 115

was extracted from C. jejuni cultures grown to an OD600 of approximately 0.4, using protocols 116

described previously (18). Briefly, 0.1 volume of 5% phenol in ethanol was mixed with the broth 117

culture, and RNA was isolated from pelleted cells with Tri Reagent (Sigma) and chloroform. 118

RNA was further purified using an RNeasy kit (Qiagen) and the Turbo DNA-free treatment 119

(Ambion), according to the manufacturer’s instructions. The purity of the RNA was determined 120

using the RNA 6000 Nano Kit (Agilent) according to manufacturer’s instructions. The 121

concentration of the RNA was determined using the Nanodrop Spectrophotometer NS-1000 122

(Thermo Scientific). 123

124

Transcription start site determination by 5' RACE 125

Transcription start sites in the cj1500-1514c region of C. jejuni NCTC 11168 were 126

determined using 5′ RACE, essentially as described previously (9). Briefly, 12 µg of RNA, 127

isolated from a mid-log phase culture of C. jejuni NCTC 11168 using the RNeasy kit (Qiagen, 128

UK), was treated with tobacco acid pyrophosphatase (TAP) and RNA oligonucleotide adaptor 129

(Table 2) was ligated to the 5′ end of the treated RNA (9). TAP cleaves the 5′-triphosphate of 130

primary transcripts to a monophosphate, thus making them available for ligation of the RNA 131

adaptor. This results in an enrichment of 5′-RACE products for primary transcripts in TAP-132

treated RNA, in comparison with an untreated control. First strand cDNA synthesis was 133

performed using random hexamers, followed by PCR amplification with gene-specific primers 134

and a 5′-adaptor-specific DNA primer (Table 2). The resulting PCR products were cloned into the 135

pGEM-Teasy cloning vector (Promega, UK) and the nucleotide sequence of the inserts was 136

determined using standard protocols. 137

138

Transcriptomic Analysis by Whole Genome Microarray 139


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


7

An 8 × 15K microarray slide (Agilent) specific for the genome of C. jejuni NCTC 11168 was 140

used to visualize relative mRNA levels in the wild-type strain when compared to the fdhU 141

mutant, complemented fdhU mutant, and the wild-type strain overexpressing fdhU (Table 1). The 142

Affinity Script kit (GE Healthcare) was used to produce Cy3 or Cy5 labeled cDNA, from the 143

aforementioned RNA samples. These were then hybridized to the microarray slide according to 144

the manufacturer’s instructions (Agilent Hi-RPM Gene Expression Hybridization Kit). DNA 145

microarrays were scanned using an Axon GenePix 4000A microarray laser scanner (Axon 146

Instruments) and the data from detected features initially processed using the GenePix 3.0 147

software. Statistical analysis of the data was performed with Marray as described in (17). The 148

microarray design and data have been deposited in the GEO database with accession number 149

GPL13841 (microarray design) and GSE35016 (data from this study). 150

151

Proteomics 152

C. jejuni cells were harvested from 50 ml Brucella broth by centrifugation (4,000 × g, 10 153

minutes, room temperature). The cell pellets were resuspended in 500 µl Lysis Buffer (50 mM 154

Tris, pH 7.5, 0.3% SDS, 0.2 M DTT, 3.3 mM MgCl2, 16.7 µg RNase ml-1, 1.67 U DNase ml-1) 155

and sonicated (Soniprep 150 MSE, Sanyo) for 10 seconds six times with incubation on ice 156

between sonications, and 20 minutes incubation on ice following sonication. The samples were 157

centrifuged (20,000 × g, 20 minutes, 4°C). The total cell protein was quantified by using 2D 158

Quant Kit (GE HealthCare) according to the manufacturer’s instructions. A total of 100 µg 159

protein was separated by isoelectric focusing on a pH 3-11 NL 24cm IPG strip (GE HealthCare), 160

for 44.7 kVh at 20°C over 8.75 hours using the IPGphor (GE Healthcare) (17). The focused IPG 161

strips were then conditioned and the size separation on the second dimension was done by SDS-162

PAGE as described previously (17). The proteins were fixed, then stained by Sypro-Ruby 163

(Invitrogen) and de-stained according to the manufacturer’s instructions. The gel images were 164


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


8

captured with a Pharos FX+ Molecular Imager with Quantity One imaging software (v4.6.1 165

BioRad). A 532 nm excitation laser was used with a 605 nm band pass emission filter and gels 166

were scanned at 100μm resolution to produce a 16 bit image. The laser strength was adjusted for 167

each image to give the maximum signal without saturation on the strongest spot. Gel images were 168

compared using ProteomWeaver analysis software (v3.0.1, Definiens). 169

170

Protein Identification (MS/MS) 171

Proteins of interest were removed from the gel using ProPick excision robot (Genomic 172

Solutions), and in-gel trypsin digested using a ProGest Protein Digester (Genomic Solutions) 173

essentially as described previously (16). LC-MS/MS analysis was performed using a LTQ-174

Orbitrap mass spectrometer (Thermo Electron) and a nanoflow-HPLC system (nanoACQUITY: 175

Waters). Peptides were trapped on line to a Symmetry C18 Trap (5 µm, 180 µm × 20 mm) which 176

was then switched in-line to a UPLC BEH C18 Column, (1.7 µm, 75 µm × 250 mm) held at 177

45°C. Peptides were eluted by a gradient of 0–80% acetonitrile in 0.1% formic acid over 50 min 178

at a flow rate of 250 nl min−1. The mass spectrometer was operated in positive ion mode with a 179

nano-spray source at a capillary temperature of 200°C. The Orbitrap was run with a resolution of 180

60,000 over the mass range m/z 300–2,000 and an MS target of 106 and 1 sec maximum scan 181

time. The MS/MS was triggered by a minimal signal of 2000 with an Automatic Gain Control 182

target of 30,000 ions and maximum scan time of 150 ms. For MS/MS events selection of 2+ and 183

3+ charge states selection were used. Dynamic exclusion was set to 1 count and 30 sec exclusion 184

time with an exclusion mass window of ±20 ppm. Proteins were identified by searching the 185

Thermo RAW files converted to Mascot generic format by DTA supercharger (reference: 186

http://www.msquant.sourceforge.net) against C. jejuni protein sequences in a monthly updated 187

copy of the SPtrEMBL database, using an in-house version (v2.2) of the MASCOT search tool 188

(reference: http://www.matrixscience.com). 189


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


9

190

Formate Dehydrogenase Activity Assay 191

FDH activity was measured using a benzyl viologen-coupled colorimetric assay (14). 192

Bacterial cells were grown over-night in Brucella broth and the OD600 was measured. Five ml of 193

culture was spun down (10 minutes, 10,000 × g) and washed twice with 1 ml of 25 mM 194

phosphate buffer pH 7.4 (centrifuged for 1 minute, 10,000 × g). The cells remained on ice until 195

the start of the enzyme assay. The cells were resuspended in 1 ml 25 mM phosphate buffer pH 196

7.4 and 200 µl was aliquoted into anaerobic cuvettes, followed by 200 µl 10 mM benzylviologen 197

and 1600 µl 25 mM phosphate buffer pH 7.4. The cuvettes were individually sparged with 198

nitrogen for 8 minutes. The cuvette was then heated to 37°C and a reading was taken at 578 nm. 199

Subsequently the substrate was added, which consisted of 20 µl 1 M sodium formate sparged 200

with nitrogen for approx 20 minutes prior to use. The reaction was monitored at 578 nm at one 201

read per second for approximately 200 sec, or until the reading was above 2.0. FDH activity was 202

calculated by determination of the nmoles of viologen oxidized per minute per mg protein. The 203

protein concentration was determined using the Bradford Assay (Bio-Rad). 204

205

1H NMR 206

NMR was used to identify the presence, absence and concentration of several metabolites in 207

C. jejuni growth medium. The spent growth medium was filter-sterilised (0.2 µm) to remove the 208

cells. Supernatant samples were thawed at room temperature and prepared for 1H NMR 209

spectroscopy by mixing 400 μl of spent medium with 200 μl phosphate buffer (0.2 M Na2HPO4 210

and 0.038 M NaH2PO4, pH 7.4) made up in 100% D2O and containing 0.06% sodium azide, 6 211

mM DFTMP (difluoro (trimethylsilyl) methylphosphonic acid) and 1.5 mM DSS (sodium 2,2-212

dimethyl-2-silapentane-5-sulfonate) as a chemical shift reference. The sample was mixed, and 213

500 μl transferred into a 5 mm NMR tube for spectral acquisition. 1H NMR spectra were 214


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


10

recorded at 600 MHz on a Bruker Avance spectrometer (Bruker BioSpin GmbH, Rheinstetten, 215

Germany) running TOPSPIN 2.0 software and fitted with a cryoprobe and a 60 slot autosampler. 216

Each 1H NMR spectrum was acquired with 128 scans, spectral width 8012.8 Hz, acquisition time 217

2.04 sec and relaxation delay 2.0 sec. The noesypr1d presaturation sequence was used to suppress 218

the residual water signal with low power selective irradiation at the water frequency during the 219

recycle delay and mixing time (tm) 150 ms. Spectra were transformed with 0.3 Hz line 220

broadening, manually phased, baseline corrected and referenced by setting the DSS methyl signal 221

to 0 ppm. Absolute concentrations were obtained using CHENOMXTM software (version 5.1) 222

(43). Several metabolites were quantified from a possible library of 290, with quantification 223

relative to DSS. 224

225

226


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


11

RESULTS 227

228

The cj1500-1501 gene cluster is located in a conserved region of the C. jejuni genome 229

In the C. jejuni NCTC 11168 genome, the cj1501 gene is preceded by the cj1500 gene, which 230

is annotated to encode an inner membrane protein, orthologous to the E. coli YedE protein, and 231

contains 10 transmembrane domains suggesting a transporter function. Both genes are located 232

divergently from the SeC-tRNA (selC, Fig. 1A), in an area of the genome (cj1429c-cj1519) 233

which is highly conserved between the C. jejuni reference strains 81-176, 81116 and RM1221 (8, 234

16, 26). The cj1500 and cj1501 genes are present as two separate but adjacent genes in all 235

sequenced C. jejuni genomes, with the exception of the C. jejuni 81116 genome (26) where these 236

two genes are fused into a single open reading frame (C8J_1404), although the translational 237

signals (ribosome binding site, GTG start codon) for translation of the Cj1501 ortholog are still 238

present (Fig. 1A). 239

The transcription start sites of the predicted cistrons in the cj1500-cj1514c region were 240

determined using 5' RACE. The cj1500 and cj1501 genes are co-transcribed from a σ70 promoter 241

(gnTAnAAT (27)), with the RNA starting at the C residue 46 nt upstream of the TTG start codon 242

of cj1500 (Fig. 1B). Other transcription start sites were detected upstream of the cj1503c (putP), 243

cj1505c, cj1506c (ccaA) (12), cj1508c (fdhD) (34) and cj1514c (fdhM) (14) genes, all with 244

recognisable σ70 -10 promoter sequences (Fig. 1B). No transcription start site could be detected 245

directly upstream of the fdhA gene, suggesting that transcription of the fdhABC genes originates 246

from the promoter upstream of the fdhM gene (Fig. 1A, B). 247

248

Inactivation of cj1500 (fdhT) and cj1501 (fdhU) leads to loss of FDH activity and expression 249

Insertional mutagenesis was used to investigate the function of the cj1500 and cj1501 genes 250

in C. jejuni strain NCTC 11168, and the cj1500-1501 fusion gene C8J_1404 in strain 81116. The 251


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


12

majority of the coding sequences of the cj1500, cj1501 and C8J_1404 genes were replaced by a 252

kanamycin resistance gene, resulting in cj1500 and cj1501 single mutants and a cj1500-1501 253

double mutant in strain NCTC 11168, and a C8J_1404 mutant in strain 81116 (Table 1). We also 254

complemented the different cj1500, cj1501 and C8J_1404 mutations by introducing the cj1501 255

gene in the cj0046 pseudogene, under control of the C. jejuni fdxA promoter (36, 39) (Table 1). 256

Initial characterization of the cj1500, cj1501, and cj1500-1501 mutants of C. jejuni strain NCTC 257

11168, and the C8J_1404 mutant of C. jejuni strain 81116 showed no difference between the 258

wild-type strains and their isogenic mutants in terms of growth in Brucella media, auto-259

agglutination, motility, or resistance to acid-shock (data not shown). 260

Two-dimensional protein gel electrophoresis was used to identify proteins differentially 261

expressed in the cj1501 mutant when compared to the NCTC 11168 wild-type strain, using cells 262

grown to mid-log growth phase in standard Brucella medium. Two proteins of approximately 100 263

kDa and 26 kDa were consistently present in the wild-type strain (Fig. 2A), but absent in the 264

cj1501 mutant. Subsequent identification of the 100 kDa and 26 kDa proteins by mass 265

spectrometry demonstrated these proteins to be the Cj1511c (FdhA) FDH large subunit and 266

Cj1510c (FdhB) putative FDH iron-sulfur subunit, respectively. The absence of the FdhA and 267

FdhB proteins resulted in the loss of FDH activity in the cj1500, cj1501 and C8J_1404 mutants, 268

as measured by a benzylviologen-linked colorimetric assay (Fig. 3A), confirming the coupled 269

function of the cj1500 and cj1501 genes, and that the fused C8J_1404 gene in strain 81116 is 270

functional. Genetic complementation with the cj1501 gene restored FDH activity in a cj1501 271

mutant, but not in the cj1500 or C8J_1404 mutants (Fig. 3A), suggesting that both Cj1500 and 272

Cj1501 are required for FDH biosynthesis and enzyme activity. Hence we have renamed the 273

cj1500 and cj1501 genes to fdhT and fdhU, respectively, and the fusion gene C8J_1404 in strain 274

81116 to fdhTU* and will refer to these genes as such henceforth. 275

The effect of the fdhU mutation on FDH protein expression was reflected at the 276


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


13

transcriptional level, as measured by whole-genome microarray analysis. Transcriptomic 277

comparison of the NCTC 11168 wild-type strain, fdhU mutant, complemented fdhU mutant and 278

the wild-type strain overexpressing fdhU showed the successful complementation and 279

overexpression of fdhU in the respective mutants (Fig. 2B). Subsequent analysis showed that 280

transcription of the fdhA, fdhB and fdhC genes was significantly reduced in the fdhU mutant, but 281

that transcript levels were restored by genetic complementation (Fig. 2B), but that overexpression 282

of fdhU did not result in further increases in fdhABC transcription. Interestingly, transcript levels 283

of the upstream, co-transcribed fdhM (cj1514c) and cj1513c genes were not significantly altered 284

in any of the mutants (Fig. 2B), suggesting that the effect on fdhABC transcription is likely to be 285

post-transcriptional, possibly via RNA instability or degradation. 286

287

Exogenous selenium complements the fdhT, fdhU and fdhTU mutations. 288

We hypothesized that the absence of FDH expression and activity in the fdhU mutant could 289

be due to interference with selenium metabolism, and investigated the effect of supplementation 290

with exogenous selenium on FDH activity in the C. jejuni wild-type and the set of fdhT, fdhU and 291

fdhTU* mutants. We also generated strains with the fdhA (cj1511c), selA (cj1378) and selB 292

(cj1379) genes inactivated, and have tested the effect of selenium supplementation on FDH 293

activity. Inactivation of the selA and selB genes resulted in the absence of detectable FDH activity 294

in the benzylviologen linked assay, confirming the role of SeC in FDH expression and activity 295

(Fig. 3B). As previously described (42), the fdhA mutant lacked any detectable FDH activity, thus 296

confirming the absence of other formate-metabolizing enzymes in C. jejuni NCTC 11168 (Fig. 297

3B). Interestingly, supplementation of growth media with selenium dioxide resulted in partial 298

restoration of FDH activity in the fdhT, fdhU and fdhTU mutants to approximately one third of 299

the activity of the wild-type strain in C. jejuni NCTC 11168, and fully restored FDH activity in 300

the fdhTU* mutant of strain 81116 (Fig. 3B). Selenium supplementation failed to restore FDH 301


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


14

activity in the selA, selB and selAB mutants (Fig. 3B), suggesting that absence of FDH expression 302

and activity in the fdhT and fdhU mutants is due to a defect in selenium metabolism in these 303

strains, which can be complemented by external supplementation of selenium. We hypothesize 304

that a high external concentration of selenium allows the cell to bypass the FdhU function, 305

allowing SeC synthesis and incorporation into the FdhA protein. 306

To investigate whether inactivation of fdhU and/or selenium supplementation of growth 307

media affected transcriptional patterns in the cj1500-cj1514c region, 5' RACE was performed 308

with primers located in fdhM, cj1513c, and both upstream and downstream of the SeC UGA 309

codon of fdhA (Fig. 3C), using RNA isolated from the NCTC 11168 wild-type and fdhU mutant 310

strain, grown with and without selenium dioxide supplementation. Only a single transcription 311

start site was found with primers located in fdhM, cj1513c and upstream of the fdhA SeC UGA 312

codon, whereas no specific amplification product was found with the primer downstream of the 313

fdhA SeC UGA codon (Fig. 3C). This was independent of selenium supplementation or 314

inactivation of the fdhU gene, suggesting that any effect on the fdh transcripts is mediated at the 315

post-transcriptional level. The other transcription start sites in the cj1503c-cj1514c region were 316

not affected by fdhU inactivation or selenium supplementation (only shown for fdhD in Fig. 3C), 317

whereas the fdhT amplification product was more present in the fdhU mutant samples (Fig. 3C). 318

319

Inactivation of fdhU still allows very low levels of formate utilization 320

To further investigate the effect of the fdhU mutation on metabolite usage of C. jejuni, we 321

performed 1H NMR-based metabolite analysis of spent growth media from cultures grown for 0, 322

2, 4, 8 and 24h at 37°C. Figure 4A shows a representative example of such an analysis for the 323

wild-type strain. The formate concentration in unsupplemented Brucella broth was ~0.2 mM, and 324

since an initial experiment demonstrated very rapid removal of formate by the wild-type strain 325

(data not shown), Brucella media were supplemented with formate to 1 mM to avoid the formate 326


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


15

levels falling below the lower detection level too rapidly. As expected, the FDH-negative fdhA 327

mutant was unable to utilize formate, and formate levels remained constant over an 8h growth 328

period (Fig. 4B). In contrast, the wild-type strain metabolized formate very rapidly, with formate 329

levels dropping below detection levels within 2h (Fig. 4B). Formate levels in media obtained 330

from the fdhU mutant decreased between 8h and 24h, suggesting that there may be a very low 331

level of FDH activity in the fdhU mutant, below detection levels of the benzylviologen-linked 332

FDH assay (Figs. 3, 4B). In contrast, genetic complementation with the fdhU gene in the cj0046 333

pseudogene resulted in a formate utilization pattern identical to the wild-type strain. The positive 334

effect of exogenous selenium supplementation of growth media on FDH activity in the fdhU 335

mutant was confirmed using 1H NMR-based metabolite analysis as the formate levels in spent 336

medium were reduced formate levels to below detection level in 24h, whereas selenium 337

supplementation did not result in formate utilization in the fdhA mutant (Fig. 4B). Finally, 1H 338

NMR spectra for lactate, acetate, pyruvate and succinate and other metabolites were analysed to 339

ascertain that there was no significant difference between the wild-type strain and the mutants 340

tested for other metabolites (see Fig. 4B for lactate), thus confirming that the metabolite 341

utilization phenotype of the fdhU mutant is limited to formate (data not shown). 342

343

Presence of FdhT and FdhU orthologs in bacterial genomes coincides with the presence of 344

SelA and SeC-containing FDH enzymes 345

To investigate the potential link between FdhTU orthologs and a SeC-containing FDH, we 346

combined Occurence analysis using the EMBL String database (http://string.embl.de) (33) 347

containing 943 bacterial taxa, 121 eukaryotic taxa and 69 archaeal taxa, with the information on 348

selenium in the trace element database dbTEU 349

(http://gladyshevlab.bwh.harvard.edu/trace_element) (46). FdhTU orthologs were detected in 350

many genera throughout the bacterial kingdom, including the Beta-, Gamma-, and Epsilon-351


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


16

subdivisions of the Proteobacteria, in some members of the Firmicutes and Actinobacteridae, 352

suggesting a joint function of the adjacent genes. When combined with searching for the presence 353

of a SelA and FdhA orthologs, we did find a strong correlation between the predicted presence of 354

adjacent genes encoding FdhTU orthologs and a SeC-containing FdhA in the Gamma and 355

Epsilon-subdivisions of the Proteobacteria (Table 3), whereas the reverse was not found, as SeC-356

containing FdhA were predicted in genomes lacking FdhTU orthologs (for example in Wolinella 357

succinogenes). It should be noted that the analysis only included SeC-containing FdhA, and not 358

other possible selenoproteins. Despite this limitation, the bioinformatic analysis still suggests a 359

link between FdhTU proteins and selenium metabolism in bacteria. 360

361


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


17

DISCUSSION 362

Although C. jejuni is best known as gastrointestinal pathogen of human and animals (20, 45), 363

its natural niche is in the intestinal tract of birds, where it can colonize to high densities in the 364

cecum. Research on metabolic features of C. jejuni has highlighted many adaptations of this 365

bacterium to that cecal niche (22), such as the periplasmic fumarate reductase Mfr which can also 366

use fumarate analogs produced via fermentation by anaerobic bacteria in the cecal microbiota (9), 367

and its versatility in using lactate as a carbon source (36). Another favored substrate for C. jejuni 368

is formate, which is very rapidly used by C. jejuni when present in the growth medium (Fig. 4B), 369

and to which C. jejuni displays chemotactic behaviour (34). The inability to use formate results in 370

lowered colonization in chickens when combined with the absence of hydrogenase activity (42), 371

whereas absence of the formate chemoreceptor or the FDH accessory protein FdhD resulted in 372

lowered immunopathology (but not reduced intestinal colonization) in gnotobiotic mice colonized 373

with a humanized microflora (2). All of these studies highlight the importance of respiration and 374

metabolism for C. jejuni in the intestinal environment. 375

Metabolism of formate in C. jejuni is mediated by the formate dehydrogenase enzyme FDH. 376

The C. jejuni FDH is a tungstoenzyme rather than a molybdoenzyme (31, 35), and is predicted to 377

contain a selenocysteine (SeC) amino acid at position 181 (10), however, the requirement for 378

selenium in FDH activity in C. jejuni was predicted but not demonstrated prior to this study. Here 379

we have shown the need for selenium for FDH activity, and that the Cj1500 (FdhT) and Cj1501 380

(FdhU) proteins are involved in FDH biogenesis, possibly by mediating selenium uptake or 381

downstream processing. In an independent, concurrent study (28), Pryjma and co-workers have 382

shown that in C. jejuni strain 81-176, the fdhTU genes are required for optimal recovery 383

following invasion of epithelial cells, and their data confirm the role of the fdhTU genes in FDH 384

biosynthesis and activity in a third reference strain of C. jejuni. Combined with earlier studies on 385

formate metabolism and intestinal colonization studies and virulence of C. jejuni (2, 34, 42), this 386


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


18

suggests an important contribution of FDH, and also FdhTU and potentially selenium in 387

colonization and virulence properties of C. jejuni. 388

Selenium is an essential trace element for many organisms, and is used in proteins as the 21st 389

amino acid selenocysteine in eukaryotes and prokaryotes (3). Next to FDH, SeC is mostly found 390

in redox-active proteins like peroxiredoxins, glycine reductases, glutaredoxin and proline 391

reductases (46, 47), but these proteins are absent in C. jejuni. Functional genomics approaches 392

have greatly facilitated identification of the encoded selenoproteins, as exemplified by the 393

database for Trace Element Utilization (dbTEU) (46). In dbTEU, 220 species have an annotated 394

FDH, and 120 of the 220 species listed have a SeC-containing FDH enzyme predicted. SeC is 395

coded for by the UGA codon, which is commonly annotated as a stop codon, but in mRNA with a 396

SECIS element, SeC insertion can occur at the UGA codon (11). The SECIS element binds the 397

Sec-specific elongation factor (SelB) which forms a complex with tRNA-SeC (selC), which 398

contains the anticodon for UGA. Synthesis of tRNA-SeC is dependent on the SeC synthase 399

(SelA), which uses selenophosphate as the selenium donor, which is synthesized by the 400

selenophosphate synthase SelD protein. SeC insertion is a unique example of co-translational 401

insertion of a non-standard amino-acid. The dual nature of the UGA codon (a stop codon and a 402

SeC codon) raises an important question of the ability of the cell to distinguish between these two 403

functions. The presence of a SECIS element is a marker for SeC UGA codon, but its sequence or 404

secondary structure is not conserved between bacteria (11, 47), and hence predictions are 405

unreliable. This has led to mis-annotation of genome sequences, as exemplified by the presence 406

of two adjacent fdhA genes rather than a single fdhA gene (e.g. in Helicobacter hepaticus ORFs 407

HH0229 and HH0228 (32)). Next to fdhA, the C. jejuni NCTC 11168 genome sequence contains 408

two other candidates for SeC-containing proteins: a gene encoding a currently unannotated SelW 409

orthologue in the intergenic region between cj0717 and cj0718 (11), and the SelD protein 410

encoded by the cj1504c gene (Fig. 1A). Interestingly, translation of the cj1504c gene is probably 411


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


19

initiated from a rare CTG startcodon, a feature which is not apparent in related Campylobacter 412

species and hence its significance is not known. Also, transcript levels of selD are not 413

significantly affected by the inactivation of the fdhU gene, suggesting that not all selenoproteins 414

are affected by the absence of fdhU (Fig. 2B). 415

Analysis of RNA levels of the fdhABC genes in the fdhU mutant showed that the absence of 416

FDH proteins in the fdhU mutant is linked to reduced RNA levels of the corresponding genes 417

(Fig. 2B). As RNA levels of the fdhM and cj1513c genes were not affected in the fdhU mutant 418

(Fig. 2B, 3C), we hypothesize that the reduced levels of fdhABC RNA is mediated at the post-419

transcriptional level in C. jejuni, possibly due to RNA instability in the absence of fdhABC 420

translation beyond the UGA codon in fdhA when the SeC-tRNA is not available. An alternative 421

explanation could be that this is due to increased transcription in the presence of selenium and 422

binding of the SelB protein to the SECIS element (44), as has been suggested for an SeC-423

containing FDH in Treponema primitia, where sodium selenite-supplementation of growth media 424

did not result in increased transcript level upstream of the SeC UGA codon, but resulted in 425

increased transcript level downstream of the SeC UGA codon (23). 426

In a previous bioinformatic study (47), the SirA-like domain was highlighted as one often 427

found in the vicinity of the selD gene. This gene is present in a highly conserved region of the C. 428

jejuni genome, and contains several genes involved in FDH biogenesis and activity, and selenium 429

metabolism (Fig. 1). The cj1501 and cj1505c genes both contain a SirA-like domain, whereas the 430

cj1507c gene was identified as a ModE-like regulator controlling molybdenum and tungsten 431

uptake (35). Selenocysteine biosynthesis is dependent on the presence of selenium, and selenium 432

storage proteins have not been described to date. This implicates that selenium import will be 433

required for biosynthesis of SeC-containing enzymes, but surprisingly little is known about 434

selenium transport in bacteria (29). In E. coli, selenate (Se(VI)) is transported via the sulfate ABC 435

transporter encoded by the cysAWTP operon (38), but orthologs of this system are absent in C. 436


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


20

jejuni. As FdhT has ten predicted transmembrane regions, it is tempting to speculate that this 437

inner membrane protein may function as a selenium transporter or channel, and this hypothesis is 438

supported by the presence of a pfam04143 (sulphur transport) domain. In addition, FdhT 439

orthologs are also annotated as containing a TIGR04112 (seleno_YedE) domain, which is 440

commonly found in genomes also encoding a selenium trait. The homology of FdhU with the 441

TusA sulfate relay protein (19) points to a possible role in intracellular movement of selenium or 442

conversion of the selenium compound to SeC synthesis apparatus. Such a joint role is supported 443

by the link of fdhTU operons with the presence of SeC-containing FDH enzymes in the Gamma- 444

and Epsilon-subdivisions of the Proteobacteria (Table 3). The role of FdhU is more difficult to 445

predict, but the protein shares significant sequence homology and the N-terminal CPxP motif 446

with the sulfurtransferase TusA which functions in a sulfur-relay system in E. coli (19). 447

Preliminary evidence based on single replicate determination of the selenium content in C. jejuni 448

wild-type and fdhU mutant suggests that the absence of FDH activity in the fdhU mutant is not 449

due to a lack of selenium, as the cellular content of selenium was similar (~2 × 105 Se atoms/cell) 450

between wild-type and fdhU mutant. As it is unknown what selenium compound(s) are used, it is 451

again tempting to speculate that FdhU is involved in interaction or modification with yet 452

unknown selenium compounds, transferring them to the selenocysteine-biosynthesis pathway. 453

Taken together, this study is the first to provide direct evidence for the role of a SirA-like 454

protein (FdhU) in selenium metabolism, via its requirement for FDH biogenesis in C. jejuni. this 455

work also shows that inactivation of the fdhTU genes can be partially complement by exogenous 456

selenium, suggesting the presence of alternative, low-affinity pathways for selenium utilisation or 457

transport in C. jejuni, and links FDH biogenesis and selenium metabolism in this important 458

human bacterial pathogen. 459

460


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


21

ACKNOWLEDGMENTS 461

We thank Julea Butt and Sophie Marritt (University of East Anglia) for assistance with setup 462

of FDH assays, Graham Chilvers (UEA) for selenium measurements, Elena Gomez and Tom 463

Turner (IFR) for technical assistance, and Mark Reuter (IFR), Dave Kelly and Andy Hitchcock 464

(Sheffield) for helpful discussions, suggestions and protocols. 465

This research is supported by the Institute Strategic Programme Grant and a Doctoral Training 466

Grant from the Biotechnology and Biological Research Council (BBSRC) to the Institute of Food 467

Research. 468

469


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


22

REFERENCES 470

471

1. Arner, E. S. 2002. Recombinant expression of mammalian selenocysteine-containing 472

thioredoxin reductase and other selenoproteins in Escherichia coli. Meth Enzymol 347:226-473

235. 474

2. Bereswill, S., A. Fischer, R. Plickert, L. M. Haag, B. Otto, A. A. Kuhl, J. I. Dasti, A. E. 475

Zautner, M. Munoz, C. Loddenkemper, U. Gross, U. B. Gobel, and M. M. Heimesaat. 476

2011. Novel murine infection models provide deep insights into the "menage a trois" of 477

Campylobacter jejuni, microbiota and host innate immunity. PLoS One 6:e20953. 478

3. Bock, A. 2001. Selenium metabolism in bacteria p. 7-22. In Hatfield and D. L (ed.), 479

Selenium. Kluwer Academic Publishers, Hingham, MA, USA. 480

4. Bock, A., K. Forchhammer, J. Heider, and C. Baron. 1991. Selenoprotein synthesis: an 481

expansion of the genetic code. Trends Biochem Sci 16:463-467. 482

5. Bock, A., K. Forchhammer, J. Heider, W. Leinfelder, G. Sawers, B. Veprek, and F. 483

Zinoni. 1991. Selenocysteine: the 21st amino acid. Mol Microbiol 5:515-520. 484

6. Driscoll, D. M., and P. R. Copeland. 2003. Mechanism and regulation of selenoprotein 485

synthesis. Ann Rev Nutr 23:17-40. 486

7. EFSA. 2010. Scientific Opinion on Quantification of the risk posed by broiler meat to 487

human campylobacteriosis in the EU. EFSA Journal 8. 488

8. Fouts, D. E., E. F. Mongodin, R. E. Mandrell, W. G. Miller, D. A. Rasko, J. Ravel, L. 489

M. Brinkac, R. T. DeBoy, C. T. Parker, S. C. Daugherty, R. J. Dodson, A. S. Durkin, 490

R. Madupu, S. A. Sullivan, J. U. Shetty, M. A. Ayodeji, A. Shvartsbeyn, M. C. Schatz, 491

J. H. Badger, C. M. Fraser, and K. E. Nelson. 2005. Major structural differences and 492

novel potential virulence mechanisms from the genomes of multiple Campylobacter 493

species. PLoS Biol 3:e15. 494


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


23

9. Guccione, E., A. Hitchcock, S. J. Hall, F. Mulholland, N. Shearer, A. H. M. van Vliet, 495

and D. J. Kelly. 2010. Reduction of fumarate, mesaconate and crotonate by Mfr, a novel 496

oxygen-regulated periplasmic reductase in Campylobacter jejuni. Environ Microbiol 497

12:576-591. 498

10. Gundogdu, O., S. D. Bentley, M. T. Holden, J. Parkhill, N. Dorrell, and B. W. Wren. 499

2007. Re-annotation and re-analysis of the Campylobacter jejuni NCTC11168 genome 500

sequence. BMC Genomics 8:162. 501

11. Gursinsky, T., D. Grobe, A. Schierhorn, J. Jager, J. R. Andreesen, and B. Sohling. 502

2008. Factors and selenocysteine insertion sequence requirements for the synthesis of 503

selenoproteins from a gram-positive anaerobe in Escherichia coli. Appl Environ Microbiol 504

74:1385-1393. 505

12. Hartley-Tassell, L. E., L. K. Shewell, C. J. Day, J. C. Wilson, R. Sandhu, J. M. Ketley, 506

and V. Korolik. 2010. Identification and characterization of the aspartate chemosensory 507

receptor of Campylobacter jejuni. Mol Microbiol 75:710-730. 508

13. Hatfield, D. L., and V. N. Gladyshev. 2002. How selenium has altered our understanding 509

of the genetic code. Mol Cell Biol 22:3565-3576. 510

14. Hitchcock, A., S. J. Hall, J. D. Myers, F. Mulholland, M. A. Jones, and D. J. Kelly. 511

2010. Roles of the twin-arginine translocase and associated chaperones in the biogenesis of 512

the electron transport chains of the human pathogen Campylobacter jejuni. Microbiology 513

156:2994-3010. 514

15. Hoffman, P. S., and T. G. Goodman. 1982. Respiratory physiology and energy 515

conservation efficiency of Campylobacter jejuni. J Bacteriol 150:319-326. 516

16. Hofreuter, D., J. Tsai, R. O. Watson, V. Novik, B. Altman, M. Benitez, C. Clark, C. 517

Perbost, T. Jarvie, L. Du, and J. E. Galan. 2006. Unique features of a highly pathogenic 518

Campylobacter jejuni strain. Infect Immun 74:4694-4707. 519


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


24

17. Holmes, K., F. Mulholland, B. M. Pearson, C. Pin, J. McNicholl-Kennedy, J. M. 520

Ketley, and J. M. Wells. 2005. Campylobacter jejuni gene expression in response to iron 521

limitation and the role of Fur. Microbiology 151:243-257. 522

18. Holmes, K., T. J. Tavender, K. Winzer, J. M. Wells, and K. R. Hardie. 2009. AI-2 does 523

not function as a quorum sensing molecule in Campylobacter jejuni during exponential 524

growth in vitro. BMC Microbiol 9:214. 525

19. Ikeuchi, Y., N. Shigi, J. Kato, A. Nishimura, and T. Suzuki. 2006. Mechanistic insights 526

into sulfur relay by multiple sulfur mediators involved in thiouridine biosynthesis at tRNA 527

wobble positions. Mol Cell 21:97-108. 528

20. Janssen, R., K. A. Krogfelt, S. A. Cawthraw, W. van Pelt, J. A. Wagenaar, and R. J. 529

Owen. 2008. Host-pathogen interactions in Campylobacter infections: the host perspective. 530

Clin Microbiol Rev 21:505-518. 531

21. Jormakka, M., B. Byrne, and S. Iwata. 2003. Formate dehydrogenase--a versatile 532

enzyme in changing environments. Curr Opin Struct Biol 13:418-423. 533

22. Kelly, D. J. 2008. Complexity and Versatility in the Physiology and Metabolism of 534

Campylobacter jejuni, p. 41-61. In I. Nachamkin, C. Szymanski, and M. J. Blaser (ed.), 535

Campylobacter 3ed. ASM Press, Washington DC. 536

23. Matson, E. G., X. Zhang, and J. R. Leadbetter. 2010. Selenium controls transcription of 537

paralogous formate dehydrogenase genes in the termite gut acetogen, Treponema primitia. 538

Environ Microbiol 12:2245-2258. 539

24. Mota, C. S., M. G. Rivas, C. D. Brondino, I. Moura, J. J. Moura, P. J. Gonzalez, and 540

N. M. Cerqueira. 2011. The mechanism of formate oxidation by metal-dependent formate 541

dehydrogenases. J Biol Inorg Chem 16:1255-1268. 542

25. Parkhill, J., B. W. Wren, K. Mungall, J. M. Ketley, C. Churcher, D. Basham, T. 543

Chillingworth, R. M. Davies, T. Feltwell, S. Holroyd, K. Jagels, A. V. Karlyshev, S. 544


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


25

Moule, M. J. Pallen, C. W. Penn, M. A. Quail, M. A. Rajandream, K. M. Rutherford, 545

A. H. M. van Vliet, S. Whitehead, and B. G. Barrell. 2000. The genome sequence of the 546

food-borne pathogen Campylobacter jejuni reveals hypervariable sequences. Nature 547

403:665-668. 548

26. Pearson, B. M., D. J. Gaskin, R. P. Segers, J. M. Wells, P. J. Nuijten, and A. H. M. van 549

Vliet. 2007. The complete genome sequence of Campylobacter jejuni strain 81116 550

(NCTC11828). J Bacteriol 189:8402-8403. 551

27. Petersen, L., T. S. Larsen, D. W. Ussery, S. L. On, and A. Krogh. 2003. RpoD 552

promoters in Campylobacter jejuni exhibit a strong periodic signal instead of a -35 box. J 553

Mol Biol 326:1361-1372. 554

28. Pryjma, M., D. Apel, S. Huynh, C. T. Parker, and E. C. Gaynor. 2011. Recovery of 555

Campylobacter jejuni following host cell infection requires FdhTU-modulated formate 556

dehydrogenase expression and electron donor availability. J Bacteriol: submitted for 557

publication (JB06665-11). 558

29. Rosen, B. P., and Z. Liu. 2009. Transport pathways for arsenic and selenium: a 559

minireview. Environ Int 35:512-515. 560

30. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory 561

Manual 2nd Edition, vol. Cold Spring Harbor Laboratory Press. 562

31. Smart, J. P., M. J. Cliff, and D. J. Kelly. 2009. A role for tungsten in the biology of 563

Campylobacter jejuni: tungstate stimulates formate dehydrogenase activity and is 564

transported via an ultra-high affinity ABC system distinct from the molybdate transporter. 565

Mol Microbiol 74:742-757. 566

32. Suerbaum, S., C. Josenhans, T. Sterzenbach, B. Drescher, P. Brandt, M. Bell, M. 567

Droge, B. Fartmann, H. P. Fischer, Z. Ge, A. Horster, R. Holland, K. Klein, J. Konig, 568

L. Macko, G. L. Mendz, G. Nyakatura, D. B. Schauer, Z. Shen, J. Weber, M. Frosch, 569


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


26

and J. G. Fox. 2003. The complete genome sequence of the carcinogenic bacterium 570

Helicobacter hepaticus. Proc Natl Acad Sci USA 100:7901-7906. 571

33. Szklarczyk, D., A. Franceschini, M. Kuhn, M. Simonovic, A. Roth, P. Minguez, T. 572

Doerks, M. Stark, J. Muller, P. Bork, L. J. Jensen, and C. von Mering. 2011. The 573

STRING database in 2011: functional interaction networks of proteins, globally integrated 574

and scored. Nucleic Acids Res 39:D561-568. 575

34. Tareen, A. M., J. I. Dasti, A. E. Zautner, U. Gross, and R. Lugert. 2010. Campylobacter 576

jejuni proteins Cj0952c and Cj0951c affect chemotactic behaviour towards formic acid and 577

are important for invasion of host cells. Microbiology 156:3123-3135. 578

35. Taveirne, M. E., M. L. Sikes, and J. W. Olson. 2009. Molybdenum and tungsten in 579

Campylobacter jejuni: their physiological role and identification of separate transporters 580

regulated by a single ModE-like protein. Mol Microbiol 74:758-771. 581

36. Thomas, M. T., M. Shepherd, R. K. Poole, A. H. M. van Vliet, D. J. Kelly, and B. M. 582

Pearson. 2011. Two respiratory enzyme systems in Campylobacter jejuni NCTC 11168 583

contribute to growth on L-lactate. Environ Microbiol 13:48-61. 584

37. Thome, R., A. Gust, R. Toci, R. Mendel, F. Bittner, A. Magalon, and A. Walburger. 585

2012. A sulfurtransferase is essential for activity of formate dehydrogenases in Escherichia 586

coli. J Biol Chem 287:4671-4678. 587

38. Turner, R. J., J. H. Weiner, and D. E. Taylor. 1998. Selenium metabolism in 588

Escherichia coli. Biometals 11:223-227. 589

39. van Vliet, A. H. M., M. A. Baillon, C. W. Penn, and J. M. Ketley. 2001. The iron-590

induced ferredoxin FdxA of Campylobacter jejuni is involved in aerotolerance. FEMS 591

Microbiol Lett 196:189-193. 592

40. van Vliet, A. H. M., K. G. Wooldridge, and J. M. Ketley. 1998. Iron-responsive gene 593

regulation in a Campylobacter jejuni fur mutant. J Bacteriol 180:5291-5298. 594


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


27

41. Walczak, R., N. Hubert, P. Carbon, and A. Krol. 1997. Solution structure of SECIS, the 595

mRNA element required for eukaryotic selenocysteine insertion--interaction studies with 596

the SECIS-binding protein SBP. Biomed Environ Sci 10:177-181. 597

42. Weerakoon, D. R., N. J. Borden, C. M. Goodson, J. Grimes, and J. W. Olson. 2009. 598

The role of respiratory donor enzymes in Campylobacter jejuni host colonization and 599

physiology. Microb Pathogen 47:8-15. 600

43. Weljie, A. M., J. Newton, P. Mercier, E. Carlson, and C. M. Slupsky. 2006. Targeted 601

profiling: quantitative analysis of 1H NMR metabolomics data. Anal Chem 78:4430-4442. 602

44. Yoshizawa, S., L. Rasubala, T. Ose, D. Kohda, D. Fourmy, and K. Maenaka. 2005. 603

Structural basis for mRNA recognition by elongation factor SelB. Nat Struct Mol Biol 604

12:198-203. 605

45. Young, K. T., L. M. Davis, and V. J. Dirita. 2007. Campylobacter jejuni: molecular 606

biology and pathogenesis. Nat Rev Microbiol 5:665-679. 607

46. Zhang, Y., and V. N. Gladyshev. 2010. dbTEU: a protein database of trace element 608

utilization. Bioinformatics 26:700-702. 609

47. Zhang, Y., A. A. Turanov, D. L. Hatfield, and V. N. Gladyshev. 2008. In silico 610

identification of genes involved in selenium metabolism: evidence for a third selenium 611

utilization trait. BMC Genomics 9:251. 612

613

614


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


28

LEGENDS TO FIGURES 615

616

Figure 1 617

Schematic representation of the region of the C. jejuni genome containing the fdhTU 618

accessory genes and fdhABC structural genes of C. jejuni strain NCTC 11168 and 81116, and the 619

promoters and transcription start sites driving transcription of the genes in this genomic region. 620

(A) The region is shown from the selC gene (cjp26, SeC-tRNA) to the cj1514c gene (fdhM). In 621

the 81116 genome this is the region from C8J_t0031 to C8J_1417 (26), in strain 81-176 the 622

region from CJJ81176_1753 (upstream of CJJ81176_1490) to CJJ81176_1506 (16). Grey arrows 623

represent FDH subunit or accessory proteins, white arrows genes predicted to be involved in 624

selenium metabolism, black arrows genes not known to be involved in either FDH expression or 625

selenium metabolism. Arrows show the presence of promoters in C. jejuni NCTC 11168, the box 626

shows the point mutation in strain 81116 leading to the fdhTU* fusion gene. (B) Transcription 627

start sites and annotated promoters and 5' untranslated regions in the C. jejuni NCTC 11168 628

cj1500-cj1514c genomic region. The nucleotide position of the transcription start site on the 629

NCTC 11168 genome is given on the left, whereas the sequence of the promoter and 5' UTR is 630

shown with specific sections shown in capital letters, underlined from left to right: -10 promoter 631

sequence, transcription start site (in bold), ribosome binding site and translational start codon. 632

<Nxx> represents a stretch of xx nucleotides not shown. 633

634

Figure 2 635

Inactivation of the fdhU gene results in reduced expression of the FdhA and FdhB formate 636

dehydrogenase subunit proteins in C. jejuni NCTC 11168, and is accompanied by reduced 637

transcription of the fdhABC genes. (A) The wild-type strain and its isogenic fdhU mutant were 638

grown to mid-log phase in Brucella medium, and total protein was separated by two-dimensional 639


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


29

protein gel electrophoresis. Two proteins were detected which showed differential expression 640

between the wild-type strain and the fdhU mutant, and were identified as the FdhA (~100 kDa) 641

and FdhB (~26 kDa) proteins. A 2D gel is shown, with the regions containing the FdhA and 642

FdhB proteins magnified, allowing comparison of protein expression. A representative example 643

is shown of the three biological repeats examined. (B) Effect of inactivation, complementation 644

and overexpression of fdhU on RNA levels in C. jejuni NCTC 11168, as determined by 645

microarray analysis. Black bars represent the fdhU mutant (11168 ΔfdhU), white bars represent 646

the complemented strain (11168 ΔfdhU::fdhUC), grey bars represent the strain overexpressing 647

fdhU (11168 wild-type::fdhUC) (Table 1). RNA levels are expressed as the fold change of RNA 648

levels in the mutant strain when compared to the wild-type (ratio mutant/wild-type) ± standard 649

deviation. All values are the average from RNA samples isolated from three biological replicates, 650

except for the fdhU overexpression strain, which is based on analysis two independent RNA 651

samples. An asterisk indicates RNA levels significantly altered in either the fdhU mutant, 652

complemented fdhU mutant, or fdhU overexpression strain when compared to the wild-type strain 653

(P < 0.01). 654

655

Figure 3 656

Selenium and genetic complementation restore formate dehydrogenase enzyme activity in C. 657

jejuni, but do not affect transcription initiation of fdhABC and other genes in the cj1500-cj1514c 658

genomic region. (A) Effect of inactivation of the fdhT and fdhU genes in C. jejuni NCTC 11168, 659

and the fusion gene fdhTU* in C. jejuni 81116, and the effect of complementation with the NCTC 660

11168 fdhU gene under control of the fdxA promoter, on FDH activity. (B) Inactivation of the 661

SeC-biosynthesis pathway genes selA and selB results in absence of FDH activity. Medium 662

supplementation with selenium dioxide to a final concentration of 5 μM partially (NCTC 11168) 663

or fully (81116) restores FDH enzyme activity in fdhT, fdhU and fdhTU* mutants, but cannot 664


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


30

restore FDH activity in selA and selB mutants. An fdhA mutant was included as control. Black 665

bars show FDH activity in unsupplemented Brucella broth, white bars show the effect of medium 666

supplementation with 5 μM selenium dioxide. Error bars represent the standard deviation from 667

two (for FDH-negative samples) to five biological replicates. Asterisks indicate samples where 668

activity was below detection level, ND = not determined, WT = wild-type strain. (C) Comparitive 669

5' RACE determination of fdhA, cj1513c, fdhM, fdhT and fdhD transcription start sites, using the 670

NCTC 11168 wild-type strain and fdhU mutant, grown in Brucella broth with and without 5 μM 671

selenium dioxide supplementation. Asterisks highlight TAP-specific amplification products 672

representing transcription start sites shown in Figure 1B, other bands are non-specific 673

amplification products. 674

675

Figure 4 676

Inactivation of fdhU disrupts formate metabolism in C. jejuni, as determined by 1H NMR 677

analysis of spent growth medium. (A) Representative example of the 1H NMR traces of spent 678

medium, obtained from the wild-type strain, with time points of 0, 2, 4, 8 and 24h. Peaks for 679

which the metabolite has been identified are indicated: asn, asparagine; asp, aspartate; glu, 680

glutamate; lac, lactate; suc, succinate; pyr, pyruvate; pyglu, pyroglutamate. (B) Comparison of 681

formate concentrations in spent medium (supplemented with formate to 1 mM prior to incubation 682

with cells) for wild-type C. jejuni NCTC 11168, the fdhU mutant and the genetically 683

complemented strain, and the fdhU mutant in selenium-supplemented medium. Formate levels go 684

down very rapidly in the wild-type strain, but go down partially in the mutant only after 24h, 685

showing the presence of very low levels of FDH activity in the fdhU mutant. The (partial) 686

restoration of FDH activity in the fdhU mutant by genetic complementation results in very similar 687

formate disappearance when compared to the wild-type strain, whereas selenium supplementation 688

results in reduction of formate levels, but more slowly than in the wild-type strain. A medium 689


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


31

control is included, and an fdhA mutant with and without selenium supplementation, and none of 690

these show removal of formate. The levels of lactate are shown for comparison, and are 691

independent of selenium supplementation or genetic inactivation and complementation. Bars 692

show the average of data obtained from three biological replicates, error bars denote standard 693

deviation. Asterisks indicate samples where formate levels were below detection level, ND = not 694

determined. WT = wild-type strain. 695


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

Table 1. C. jejuni strains used in this investigation

C. jejuni strain Details / Reference a

NCTC 11168 Wild-type strain (25)

81116 Wild-type strain (NCTC 11828) (26)

11168 ΔfdhT cj1500::kanR

11168 ΔfdhU cj1501::kanR

11168 ΔfdhTU cj1500-1501::kanR

11168 ΔfdhT::fdhUC (b) cj1500::kanR complemented with cj0046::(PfdxA-cj1501 catR)

11168 ΔfdhU::fdhUC (b) cj1501::kanR complemented with cj0046::(PfdxA-cj1501 catR)

11168 ΔfdhTU::fdhUC (b) cj1500-1501::kanR complemented with cj0046::(PfdxA-cj1501 catR)

11168 wild-type::fdhUC (b) NCTC 11168 with cj0046::(PfdxA-cj1501 catR), overexpressing fdhU

11168 ΔselA cj1378::kanR

11168 ΔselB cj1379::kanR

11168 ΔselAB cj1378-1379::kanR

11168 ΔfdhA cj1511c::kanR

81116 ΔfdhTU* C8J_1404::kanR

81116 ΔfdhTU*::fdhUC (b) C8J_1404::kanR complemented with cj0046::(PfdxA-cj1501 catR)

a. kanR is the kanamycin resistance cassette (40), catR is the chloramphenicol resistance

cassette (40).

b. Complementation and overexpression of fdhU was performed using the cj0046 pseudogene

(36), with the gene expressed from the fdxA promoter (PfdxA) (39).


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

Table 2. Oligonucleotide primers used for 5' RACE.

Primer name Primer sequence (5' → 3')

RNA adaptor AUAUGCGCGAAUUCCUGUAGAACGAACACUAGAAGAAA

Adaptor-specific primer GCGCGAATTCCTGTAGA

Cj1500R (fdhT) AACCTATAAACATACCTATG

Cj1503cR (putA) TTGGCTTCTATTTGTCCTTG

Cj1505cR (cj1505c) ATTCACCCTCACCCACTTTG

Cj1506cR (ccaA) GGTTGATCTAAACATTTCTG

Cj1508cR (fdhD) ATCGATATTGGCAGTATGTG

Cj1511cR-SeC (fdhA*) a TTTGAAGTTCCTACAGTATG

Cj1511cR (fdhA) b CCACCTGAACTCACAGGATG

Cj1513cR (cj1513c) TCCCAATTAGCACTTCTTTG

Cj1514cR (fdhM) AAGAAAAAGTCGTTGGAATG

a. primer located downstream (3') of the SeC UGA codon in the fdhA gene.

b. primer located upstream (5') of the SeC UGA codon in the fdhA gene.


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

Table 3. Distribution of FdhTU orthologs, SelA and selenoproteins in completed Proteobacterial

genomes a

Genus (species) fdhTU operon b SelA c Selenoproteins d

Epsilonproteobacteria

Campylobacter (6) yes (4/6 species) All SelA+ FDH

Arcobacter (1) yes SelA+ FDH

Helicobacter (3) yes (1/3 species) All SelA+ FDH in 1 species

Sulfurimonas (1) yes SelA+ FDH

other Epsilonproteobacteria (2) e no SelA+ FDH

Gammaproteobacteria

Escherichia (2) yes (all) All SelA+ FDH

Salmonella (1) yes SelA+ FDH

Yersinia (3) yes (all) All SelA+ FDH

Serratia (1) yes SelA+ FDH

other Enterobacteriaceae (10) f yes SelA+ FDH

other Enterobacteriaceae (15) g no 4/15 SelA+ (h) FDH in 4 species h

Pseudomonas (9) yes (2/9 species) 4/9 SelA+ (h) FDH in 4 species h

Shewanella (14) yes (5/14 species) 5/14 SelA+ (h) FDH in 5 species h

Actinobacillus (2) yes (1/2 species) 2/2 SelA+ (h) FDH in 2 species h

Betaproteobacteria

Nitrosomonas (2) yes (all) Negative none

a. Analysis based on Version 9.0 of the String Database (http://string.embl.de, last accessed

27/04/2012) (33). The dataset consists of 943 bacterial taxa, 121 eukaryotic taxa and 69

archeaeal taxa, and only includes completed genome sequences. The modules used were

Neighborhood (for analysis of the presence of a fdhTU operon) and Occurence (with Cj1500

(FdhT), Cj1501 (FdhU), Cj1378 (SelA) and Cj1511c (FdhA)).


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

b. As FdhU is homologous to TusA (19), only species with adjacent fdhT and fdhU orthologs

were included in the analysis.

c. Based on presence of orthologous open reading frame and annotation, using String (33).

d. Based on the database on Trace Element Utilization (dbTEU) (46) and annotation of gene

sequences. Some species have more than a single FDH enzyme.

e. Other Epsilonproteobacteria: Wolinella (1), Nautilia (1).

f. Other FdhTU-positive Enterobacteriaceae: Shigella (4), Klebsiella (1), Cronobacter (2),

Citrobacter (1), Proteus (1), Enterobacter (1).

g. Other FdhTU-negative Enterobacteriaceae: Buchnera (1), Dickeya (2), Blochmania (2),

Hamiltonella (1), Pectobacterium (3), Edwardsiella (2), Photorabdus (2), Erwinia (2),

Sodalis (1), Wigglesworthia (1).

h. For all categories, the SelA+-species are the same ones as the species with SeC-containing

FDH enzyme(s).


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

fdhTj1500

putPj1502

fdhUj1501

putAj1503

fdhAj1511

selDj1504

fdhBj1510

1505c fdhCj1509

ccaAj1506

fdhDj1508

modEj1507

fdhMj1514

1513cselCtRNA

SeC

ASeC

fdhUQ L K G * V K

11168 caacttaAAGGATAAacaGTGaaa||||||||||||| ||||||||||

81116 caacttaAAGGAtcaacaGTGaaaQ L K G S T V K

fdhTU*C8J_1404

cj1500 cj1502ccj1501 cj1503c cj1511ccj1504c cj1510ccj1509ccj1506c cj1508ccj1507c cj1514ctRNA

81116 not involved in FDH biogenesis/activity

FDH subunit / accessory protein

putative selenium metabolism gene

putative SeC-codon containing geneSeC

promoter

Bcj1500 (pos 1,432,561): atttaagcTATAATctcactCttttttag<N20>atttttAGGAtctttctTTG

cj1503c (pos 1,439,066): ttatttataTATTATttattAaaatttattttatcttAGGAGatacgaaATG

cj1505c (pos 1,440,795): ataaaataaTATTATttttcAaagctaatatcAAGGAaaaataATG

cj1506c (pos 1,443,012): aaatatgtTAAAATtagaatCtaaatttttattttAGGAGttataagATG

cj1508c (pos 1,444,629): tttttgaTATAATattatttAaagatatttaAAGGAtaaggtATG

cj1514c (pos 1,450,118): aaatagtatTAAGATaaatcGatttaaaa<N82>aatgcatGGGAGctttaATG

Shaw et al (JB06586-11.R1), Fig. 1


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

FdhA

wild-type ΔfdhUA

(KD

a)

~100113 pI

Mol

ecul

ar w

eigh

t (

10~10

FdhB

wild-type ΔfdhUBB

10

100

(mut

ant/w

ild-ty

pe) *

0.01

0.1

1

fold

cha

nge

RN

A le

vel

** * *

fdhUfdhT selD fdhC fdhB fdhA fdhM1513c



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

A FDH activity(nmoles viologen oxidised min-1 mg protein-1)

0 500 1000 1500

*

11168 WT

ΔfdhT

ΔfdhU

**

*

ΔfdhTU

ΔfdhT::fdhUC

ΔfdhU::fdhUC

ΔfdhTU::fdhUC

00 50 100 150 200

ΔfdhTU*

81116 WT

B

ΔfdhTU*::fdhUC

*

ND

ND

0 500 1000 1500

FDH activity(nmoles viologen oxidised min-1 mg protein-1)

11168 WT

ΔfdhA

ΔfdhT

**

*

ΔfdhT

ΔfdhU

ΔfdhTU

ΔselA

ΔselB

ΔselAB

**

**

**

00 50 100 150 200

ΔfdhTU*

81116 WTND

C +Se-Se

wild-type ΔfdhU ΔfdhUwild-type

+ - + - + - + -MTAP

*fdhA

fdhA*

*1513c

*fdhM

fdhA

*fdhD

*fdhT

fdhAfdhM cj1513c

SeC


fdhA fdhA*1513cfdhM


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

A formate

asn, asp

pyglupyglu,

gluglu

lac

t=0h

suc acetatepyr

t=2h

t=4h

t=8h

B

1.51.61.71.81.92.02.12.22.32.42.52.62.72.82.9 ppm8.48.68.8 ppm

t=24h

0.8

0.9

1.0

M

0.1

0.2

0.3

0.4

0.5

0.6

0.7

[form

ate]

in m

M

* * * * * * * ** * ND ND0

0 2 4 8 24 0 2 4 8 24 0 2 4 8 24 0 2 4 8 24 0 2 4 8 24 0 2 4 8 24 0 2 4 8 24

medium 11168 WT ΔfdhU ΔfdhU + Se ΔfdhU::fdhUC ΔfdhA ΔfdhA + Se

* * * * * * * ** *

1 5

2.0

2.5

3.0

te] i

n m

M

0

0.5

1.0

1.5

[lact

at

0 2 4 8 24 0 2 4 8 24 0 2 4 8 24 0 2 4 8 24 0 2 4 8 24 0 2 4 8 24 0 2 4 8 24

medium 11168 WT ΔfdhU ΔfdhU + Se ΔfdhU::fdhUC ΔfdhA ΔfdhA + Se

ND ND

Strain (complementation/supplementation) and time-point (h)



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

shaw et al . selenium and formate...

Documents