Proc. Nail. Acad. Sci. USAVol. 76, No. 10, pp. 4793-4797, October 1979Biochemistry

Sequences of vesicular stomatitis virus RNA in the region coding forleader RNA, N protein mRNA, and their junction

(in vitro polyadenylylation/reverse transcription/dideoxynucleotide sequencing)

DAVID J. ROWLANDS*Department of Biology, University of California at San Diego, La Jolla, California 92093

Communicated by E. Peter Geiduschek, June 8, 1979

ABSTRACT The RNAs extracted from purified preparationsof the Indiana and New Jersey serotypes of vesicular stomatitisvirus were polyadenylylated in vitro by using polynucleotidephosphorylase and sequence determination was carried out bythe dideoxynucleotide method using reverse transcriptase anddTSAC primer. On both virus RNAs a short stretch of adenylicacid residues is present between the regions coding for theleader and N protein mRNAs. Other features of the RNA se-quences of the two viruses are compared to each other and topublished data.

Vesicular stomatitis virus (VSV) RNA is a molecule of molecularweight 4 X 106 and has negative polarity. Expression of thegenetic information encoded in the virion RNA proceeds viasequential primary transcription from the 3' end of virion RNAof a short nonpolyadenylylated leader sequence followed bypolyadenylylated mRNAs corresponding to the five virus-specific proteins (N, NS, M, G, and L) induced in cells duringinfection. The gene order on the virion is 3'-N-NS-M-G-L-5'(1, 2). The nucleotide sequences of the leader RNAs of both VSVIndiana and New Jersey serotypes have been determined bythe analysis of partial ribonuclease digestion products after invitro 32p labeling of the 5' end with polynucleotide kinase orof the 3' end with RNA ligase (3, 4). Confirmation that the se-quence of the VSV Indiana leader RNA is complementary tothe 3'-terminal sequence of the virus RNA, at least up to 17bases from the 3' terminus, has been obtained by sequencedetermination of virus RNA labeled at the 3' end with RNAligase (5). The sequence of nucleotides in the ribosome bindingsites of three of the VSV Indiana mRNAs, including N mRNAhas been determined (6). Because the protected sequences ofN and M mRNAs contain the cap, they must include dataavailable spanning the region between the end of the leaderRNA and the start of the first mRNA sequence.

Recently, application of the dideoxynucleotide method ofsequence determination by introducing base-specific stops incDNA (7) has been successfully employed to obtain extensivesequence data of the regions adjacent to the poly(A) tract in twonaturally polyadenylylated virus RNAs, encephalomyocarditisvirus RNA (8) and poliovirus RNA (9), and of globin mRNA(10). This paper reports extended sequence information on the3' end of VSV RNA, including the leader/N mRNA junction,obtained by the dideoxynucleotide method, using as templateRNA that had been polyadenylylated in vitro with polynu-cleotide phosphorylase.

MATERIALS AND METHODSViruses and RNAs. VSV of serotypes Indiana (Mudd-

Summers strain) and New Jersey (Ogden) was grown in babyhamster kidney cells (BHK-21) infected with cloned virus stocksand incubated with Eagle's minimal essential medium sup-plemented with 7% calf serum. The virus was purified as de-scribed by Doyle and Holland (11) and the RNA was extractedas described by Perrault (12) and purified by sedimentationthrough a 5-25% sucrose gradient in 0.2 M NaCl/50 mMTris-HCI/5 mM EDTA/0.1% Sarkosyl at pH 7.4 (NTE/Sar-kosyl) in a Spinco SW 41 rotor at 40,000 rpm for 3 hr at 40C.The RNA was radioactively labeled by adding [3H]uridine tothe culture medium at 10 MCi/ml (1 Ci = 3.7 X 1010 bec-querels).

In Vitro Polyadenylylation of Virus RNA. Virus RNA waspolyadenylylated in vitro with polynucleotide phosphorylaseand ADP with slight modification of the method used by Engeland Davidson (13). Typically 10-30 ,ug of RNA was dissolvedin 10 Ml of water and to this was added 20 Ml of 20 mM Na ci-trate/3.2 mM MgCl2/4 mM ADP/0.1 M Tris-HCI, pH 8.0, and10 Ml of polynucleotide phosphorylase (200 units/ml in water).After incubation at 37"C for 6 min, the reaction was terminatedby dilution with 1 ml of NTE/sodium dodecyl sulfate (0.2 MNaCI/50 mM Tris-HCI/5 mM EDTA/0.1% sodium dodecylsulfate at pH 7.5) and extracted with an equal volume of phe-nol/chloroform/8-hydroxyquinoline (50:50:0.1). The RNA wasthen precipitated with 2 vol of ethanol at -20°C.The extent of polyadenylylation of the RNA was estimated

by binding to oligo(dT)-cellulose. A sample of the RNA wasdissolved in 1 ml of binding buffer (1 M KCI/10mM Tris-HCI,pH 7.5/0.5% Sarkosyl), and the solution was loaded onto a shortcolumn of oligo(dT)-cellulose in a water jacket at 0°C. Thecolumn was then washed successively with seven 1-ml portionsof binding buffer at 20°C. Finally, the bound RNA was elutedwith 1-ml portions of elution buffer (10 mM Tris-HCI, pH7.5/0.5% Sarkosyl) at 37°C. Each fraction was mixed withTriton/toluene scintillation fluid and assayed for radioactivityin a Beckman scintillation counter.Primer Purification. The specific oligodeoxynucleotide

dT8AC, complementary to the first two bases adjacent to theadded poly(A) tail (5), was gel-purified before being used toprime cDNA synthesis. Approximately 10 Mg of the primer waslabeled with 32P by using polynucleotide kinase and ['y-32P]ATP(3000 Ci/mmol) after removal of the 5' phosphate (14, 15). The32P-labeled material was mixed with untreated primer and

Abbreviation: VSV, vesicular stomatitis virus.* On leave from the Animal Virus Research Institute, Pirbright,Woking, Surrey, U.K.

4793

The publication costs of this article were defrayed in part by pagecharge payment. This article must therefore be hereby marked "ad-vertisement" in accordance with 18 U. S. C. §1734 solely to indicatethis fact.

Dow

nloa

ded

by g

uest

on

July

6, 2

021

Proc. Natl. Acad. Sci. USA 76 (1979)

1

m

0

x

Ea

1

5Fraction

10

x

ECL

FIG,. 1. Binding of [3HJVSV Indiana RNA to oligo(dT)-cellulose.The RNA was loaded onto a column of oligo(dT)-cellulose and eluted.(Upper) Control untreated RNA. (Lower) RNA polyadenylylatedwith polynucleotide phosphorylase. The vertical arrows indicate thechange from binding buffer to elution buffer.

electrophoresed on a 20% polyacrylamide gel containing 7 Murea in Tris borate, pH 8.3. The majority of the incorporated32p migrated as a single band; this band was cut out, ground intosmall fragments, and eluted in NTE/sodium dodecyl sulfate.The primer eluate was extracted with phenol/chloroform/

8-hydroxyquinoline and ethanol-precipitated at -20'C withpurified glycogen as carrier. The precipitate was washed withethanol, dried under reduced pressure, dissolved in water at 60,ug of primer per ml, and stored at -70'C.

Sequence Determination. The procedure used for thesynthesis of cDNA in the presence of dideoxynucleoside tri-phosphates was as described by Zimmern and Kaesberg (8). Ina typical experiment 5-10 Mg of polyadenylylated VSV RNAin 10 MA of water was mixed with purified dT8AC to give aprimer-to-template ratio of 1:60 (wt/wt) and dried undervacuum. The dried mixture was dissolved in 48 Ml of water and20 Ml of 4 times concentrated reverse transcriptase buffer (200mM Tris-HCI/210 mM KCI/20 mM MgCl2/40 mM di-thiothreitol at pH 8.0) and 4 Ml (28 units) of reverse transcriptasewas added. The mixture was transferred into a plastic tube inwhich 0.2 nmol (80 MCi) of [a-32P]dATP had been reduced todryness. Eight 9-Ml aliquots of this mixture were dispensed intoplastic tubes containing 1 Ml of an appropriate ddNTP/dNTPmixture and incubated at 380C for 1-2 hr. ddNTP-to-dNTPratios of 1:1 and 1:5 were used. Neither set of mixtures con-tained dATP, this precursor coming entirely from the 32p-labeled material. In 10 times concentrated stock mixtures de-signed to terminate at A residues, ddATP was included at 5 M

Fraction

FIG. 2. Centrifugation of [3H]VSV Indiana RNA through sucrosegradients. The RNA samples dissolved in TNE/Sarkosyl (0.2 MNaCl/50 mM Tris.HCl/5 mM EDTA/0.1% Sarkosyl at p13 7.5) wereloaded onto 5-ml 5-25% sucrose gradients in TNE/Sarkosyl andcentrifuged in a Spinco SW 50 rotor at 49,000 rpm for 105 min at 70C.Fractions of 0.2 ml were collected from the bottoms of the tubes andassayed for radioactivity in Triton/toluene scintillation fluid. (Upper)Control untreated RNA. (Lower) RNA polyadenylylated with poly-nucleotide phosphorylase.

(1:5 mix) or 25 MM (1:1 mix). In mixtures designed to terminateat C, G, or T residues, the relevant ddNTP/dNTP concentra-tions in stock solution were 10 MM and 50 MM (1:5 mix) or 20MM and 20 MM (1:1 mix) and all other dNTPs were 100 MM.Chains that had not been specifically terminated with a di-deoxynucleotide residue were moved into high molecularweight material by adding 1 Ml of a 500 MM solution of theappropriate dNTP to each reaction tube and incubating for anadditional 20 min at 380C. The reactions were stopped by theaddition of 20 Ml of 8 M urea containing 0.05% bromophenolblue and 0.05% xylene cyanol and heating at 1000C for 1 min.Samples were electrophoresed at 700-800 V on 15% polyac-rylamide gels (80 cm X 15 cm X 2 mm) containing 7 M ureaand 30mM Tris borate, pH 8.3. Gels were cut in half, wrappedin plastic film (Saran Wrap), and exposed to x-ray film (KodakX-Omat R) at -70°C by using intensifying screens (DuPontCronex).Enzymes and Chemicals. Calf intestine alkaline phosphatase

was kindly provided by Ian Kennedy, T4 polynucleotide kinasewas supplied by Bert Semler, and avian myeloblastosis virusreverse transcriptase was provided by J. W. Beard (Life Sci-

~~~~h_mF.'~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~.~~~~~~~~~~~~~~~I

4794 Biochemistry: Rowlands

Dow

nloa

ded

by g

uest

on

July

6, 2

021

Proc. Natl. Acad. Sci. USA 76 (1979) 4795

ences, Saint Petersburg, FL). Polynucleotide phosphoryyase(Micrococcus luteus) was from P-L Biochemicals. Oligo-(dT)-cellulose (T3) and the primer dT8AC were from Collab-orative Research (Waltham, MA). [3HjUridine (28 Ci/mmol)was from Schwarz/Mann; ['y-32P]ATP (3000 Ci/mmol) and[a-32P]dATP (400 Ci/mmol) were obtained from Amersham.Unlabeled dATP, dCTP, dGTP, dTTP, and ADP were fromP-L Biochemicals.

RESULTSPolyadenylylation of VSV RNA. The effects of in vitro

polyadenylylation of VSV virion RNA on the binding of theRNA to oligo(dT)-cellulose are shown in Fig. 1. Althoughvariation in the extent of binding after polyadenylylation wasobserved from experiment to experiment, greater than 50%binding was regularly obtained and, on occasion, more than90% was achieved. Only about 1% of untreated RNA bound tothe column. The polyadenylylated RNA was used in subsequentexperiments without separation or after preparative selectionon oligo(dT)-cellulose with similar results.

Integrity of VSV RNA after Polyadenylylation. The in-tegrity of VSV RNA that had been polyadenylylated and se-lected by binding to oligo(dT)-cellulose was assessed by sedi-mentation through a sucrose gradient (Fig. 2). For comparison,untreated RNA was centrifuged through a parallel gradient andit can be seen that >90% of the polyadenylylated RNA sedi-mented to the same position as control untreated RNA.

Sequence Determination of Polyadenylylated VSV RNA.The sequences of polyadenylylated VSV Indiana or New JerseyRNA were determined by using reverse transcriptase andddNTPs, and Fig. 3 shows the results obtained. The base se-quences can be clearly read for over 100 bases with little am-biguity. Some positions in the sequences showed strong bandsin several tracts, as in the VSV New Jersey RNA at positions 33and 107, making interpretation difficult. In most cases thisphenomenon varied among experiments so that ambiguitiesin the sequence could be eliminated by comparing several gels.From the published sequences of the 3' ends of VSV Indiana(3, 5) and New Jersey (4), it can be predicted that the first base

1:1 1:5

A C T A C G~~:430~~~~~~~~4

A30 I

_g_

ao

1:1 1:5

VSV New Jersey1:5 1:1 1:5

A 1 T A C G T

t ''''

Proc. Natl. Acad. Sci. USA 76 (1979)

VSV Indiana

10 20 30 40 50 60 70 80 90 100 110

A 3' UGXXXXUGUUUGUUUGGUAAUAAUAGUAAUUUUCCGAbuCCuCUUUGAAAUUGUCAUUAuuUUUUACAuAAuGUCAGUUCUCUUAGUAACUGUUGUbUCAGUAUUCAMbUUGG

B 5!.ACXXXXACAAACAAACCATTATTATCATTAAAAGGCTCAGGAGAAACTTTAACAGTAATCAAAATGTCTGTTACAGTCAAGAGAATCATTGACAACACAGTCATAAGTTCAACC

fMetSerValThrValLysArgIl el leAspAsnThrVal I leSerSerThr

C 5'ACGMGACAMCAAACCAUUAUUAUCAUUMMGGCUCAGGAGAAA C AACAGUAAUCAAA UGUCUGUUACAGUCAAG---

fietSerVal ThrVaI Lys

VSV New Jersey10 20 30 40 50 60 70 80 90 100 110I I I I I / I I I I I

A 3' UGXXXXUGUUUUUUUGGUAAUAAUGUUAAUAAACCGGAUCUCCCUUGAAAAUUGUCUAUAGUUUUACCGAGGAUGUCAAUUCUCUUAGUAAUUACUGAGGUAUUACCGAUGA---

B 5'ACXXXXACAAAAAACCATTATTACAATTATTTGGCCTAGAGGGAACTTTTAACAGATATCAAATGGCTCCTACAGTTAAGAGAATCATTAATGACTCCATAATGGTACT---fMetAl aProThrVal LysArgIl1elIl1eAsnAspSerIl1eMetAl aThr

C 5' ACGAAGACAAAAAAACCAUUAUUACAAUUAAUUGGCCUAGAGGGAA C

FIG. 4. Sequences at the 3' ends of VSV Indiana and New Jersey virus RNAs as deduced by the dideoxynucleotide sequence determinationmethod. Included for comparison are the published sequences of the VSV Indiana and New Jersey leader RNAs (3, 4) and VSV Indiana N mRNArib~osome binding site (6). Bases that are different in the RNAs from the two serotypes are underlined and asterisks indicate bases that wereregularly ambiguous. Included are the amino acid allocations for the N mRNA codons. Sequences: A, virus RNA deduced from the determinedcDNA sequence; B. cDNA; C, published sequences of VSV Indiana leader and N mRNA ribosome binding site and VSV New Jersey leaderRNA.

to be detected by using dT8AC as a primer and [32P]dATP aslabel should be the fourth from the 3' end. In fact the first basethat could clearly be seen as the start of a readable sequence onthe cDNA gels was the seventh from the 3' end, according topublished sequence data (3-5).The sequences obtained for the first 110 bases of the cDNAs

from both the Indiana and New Jersey serotypes are shown inFig. 4 together with the predicted sequence of the virus RNAs.Included for comparison are published sequences for the leaderRNAs of both viruses (3, 4) and the sequence of the N mRNAprotected from ribonuclease digestion by binding to ribosomes(6). The first part of the sequence of VSV Indiana RNA wasfound with one exception to be compatible with the sequenceof its transcript, the leader RNA as determined by Colonno andBanerjee (3). The difference was that the 3' end of the leaderRNA contains a run of four adenylic acid residues adjacent tothe terminal cytidylic acid, whereas only three were found inthe cDNA.

Again, with the VSV New Jersey RNA the 3'-end sequencewas similar to the published data on the leader RNA of this virus(4), but, again, the 3'-terminal region of the leader RNA con-tains one more adenylic acid than was found in the cDNA. Also,an adenylic acid and uridylic acid difference was seen at po-sition 31, which may be due to strain difference between thevirus used here and that used by Colonno and Banerjee (4).A striking feature of cDNA sequences of both virus RNAs was

the presence of a short stretch of thymidylic acids (three in VSVIndiana and four in VSV New Jersey) at the junction of theleader sequence and start of the N mRNA sequence. The cor-responding uridylic acids are not found in either of the RNAtranscripts.The cDNA sequence of the start of the N mRNA coding re-

gion of VSV Indiana was identical to the sequence of the ribo-some-protected portion of the N mRNA determined by Rose(6) with the exception that four adenylic acids were seen in thecDNA at the region adjacent to the initiation codon (position61-64), whereas only three were found in the mRNA (6). Fouradenylic acids were also seen in the comparable position in thecDNA of VSV New Jersey RNA. Only one difference was seenbetween cDNA sequences of the noncoding regions of the NmRNAs of the two viruses, an adenylic-thymidylic inversionat position 56, 57 on VSV Indiana and position 57, 58 on VSVNew Jersey. Considerable differences were seen in the codingsequences of the N mRNAs of the two viruses.

DISCUSSIONThe in vitro addition of poly(A) tails of the 3' ends of VSV RNAsconverts the RNAs into convenient templates for the in vitrotranscription into cDNA by using reverse transcriptase and anoligo(dT) primer. The use of the specific primer dT8AC hasmade it possible to apply the dideoxynucleotide sequence de-termination technique (7) and has resulted in a clearly readablesequence up to at least 100 bases from the 3' end of the virusRNA. Confidence in the accuracy of the technique is inspiredby the almost complete coincidence between the sequencesobtained here and the published data on the sequences of theleader RNAs of both VSV Indiana and New Jersey (3, 4) andthe 5' end of the N mRNA of VSV Indiana (6).The transcription of VSV RNA into functional mRNAs ap-

pears to start from the initiation site at the 3' end of the moleculeand to proceed through the short leader sequence followed bymRNAs corresponding to the virus proteins N, NS, M, G, andL in that order (1, 2). There is great similarity between theleader sequences of both Indiana and New Jersey serotypes of

4796 Biochemistry: Rowlands

Dow

nloa

ded

by g

uest

on

July

6, 2

021

Proc. Natl. Acad. Sci. USA 76 (1979) 4797

VSV as has been pointed out before (4). From the results pre-sented here, it can be seen that great homology also exists iti the5' portion of the N mRNAs of the two viruses up to the initiationcodon, the only difference being an A-U inversion at positions56, 57 on the Indiana and 57, 58 on the New Jersey virus RNA.Interestingly, with this A-U inversion the structure of thenoncoding region of the VSV New Jersey N mRNA is identicalto that of the VSV Indiana NS mRNA ribosome binding site (6)up to the stretch of As adjacent to the initiation codon. In thecoding sequences of the two N mRNAs many more differencesare seen.

It is not known how the process of VSV transcription sepa-rates the transcript into the individual species of one leader andfive mRNAs, but it has been proposed that a nucleolytic activityis present in the transcribing system that recognizes the se-quence at the junction regions and cleaves the growing RNAchain at these points (3, 16, 17). It is equally possible thattranscription is interrupted at these regions and misses or jumpsthe bases at the junctions. The observation that transcriptionfrequently terminates at the junction regions so that the mRNAsfrom the 5' end of the virus RNA are produced in lower molaramounts than those from the 3' ends (18) is compatible withsuch a model. The results obtained here show that with bothVSV serotypes the leader/N mRNA junction consists of a shortstretch of adenylic acid residues preceded by a guanylic acid,and in both cases this region is flanked by short stretches ofuridylic acids. In neither virus are the uridylic acids comple-mentary to the adenylic acids on the virus RNAs at the leader/NmRNA junction present in transcripts.

It is impossible to choose between an interrupted synthesisor a nucleolytic excision model as the mechanism of transcriptseparation simply on the basis of sequence information. How-ever, it is interesting to note that in the cDNAs of both VSVIndiana and New Jersey RNAs the stretch of adenylic acids inthe leader sequence region adjacent to the leader/N mRNAjunction region is one base shorter, as determined by the cDNAmethod compared with direct sequence determination of theleader transcript. Also, the 3'-terminal C of the leader sequenceis absent from about 60% of the molecules (3, 4). It is temptingto suggest that these discrepancies represent a loss of fidelityof copying by the viral transcriptase at this point, possiblyproceeding to an interruption of copying through the junction

region. Additional sequence determination of the leader RNAsof the actual virus strains used in the present studies shouldclarify this point.

I thank Dr. Bert L. Semler for assistance in the labeling and purifi-cation of the dT8AC primer, Dr. S. I. T. Kennedy for supplying thephosphatase and kinase, and Dr. J. J. Holland for providing laboratoryspace and facilities. I also thank all three of these gentlemen and Dr.J. Perrault for many valuable discussions and suggestions and J. J.Holland for critically reading the manuscript. This work was supportedby National Institutes of Health Grant Al 14627 to J. J. Holland.

1. Abraham, G. & Banerjee, A. K. (1976) Proc. Natl. Acad. Sci. USA73, 1504-1508.

2. Ball, L. A. & White, C. N. (1976) Proc. NatI. Acad. Sci. USA 73,442-446.

3. Colonno, R. J. & Banerjee, A. K. (1978) Cell 15,93-101.4. Colonno, R. J. & Banerjee, A. K. (1978) Nucleic Acids Res. 5,

4165-4176.5. Keene, J. D., Schubert, M., Lazzarini, R. A. & Rosenberg, M.

(1978) Proc. Natl. Acad. Sci. USA 75,3225-3229.6. Rose, J. K. (1977) Proc. Natl. Acad. Sci. USA 74,3672-3676.7. Sanger, F., Nicklen, S. & Coulsen, A. R. (1977) Proc. Natl. Acad.

Sci. USA 74,5463-5467.8. Zimmern, D. & Kaesberg, P. (1978) Proc. Natl. Acad. Sci. USA

75,4257-4261.9. Porter, A. G., Fellner, P., Black, D. N., Rowlands, D. J., Harris,

T. J. R. & Brown, F. (1978) Nature (London) 276,298-301.10. Hamlyn, P. H., Brownlee, G. G., Cheny, C. C., Gait, M. J. &

Milstein, C. (1978) Cell 15, 1067-1075.11. Doyle, M. & Holland, J. J. (1973) Proc. NatI. Acad. Sci. USA 70,

2105-2108.12. Perrault, J. (1976) Virology 70,360-371.13. Engel, J. D. & Davidson, N. (1978) Biochemistry 17, 3883-

3888.14. Maxam, A. M. & Gilbert, N. (1977) Proc. Natl. Acad. Sci. USA

74,560-564.15. Richardson, C. C. (1965) Proc. Natl. Acad. Sci. USA 54, 158-

165.16. Colonno, R. J., Abraham, G. & Banerjee, A. K. (1976) Prog. Nu-

cleic Acid Res. Mol. Biol. 19, 83-87.17. Ball, L. A., White, C. N. & Collins, P. L. (1976) in Animal Viro-

logy, ICN-UCLA Symposium on Molecular and Cellular Biology,eds. Baltimore, D., Haung, A. S. & Fox, C. F. (Academic, NewYork), Vol. 4, pp. 419-438.

18. Villarreal,'L. P., Breindl, M. & Holland, J. J. (1976) Biochemistry15, 1663-1667.

Biochemistry: Rowlands

Dow

nloa

ded

by g

uest

on

July

6, 2

021