Upload File

sequence (1)

prev
next
out of 1
Download Sequence (1)

Upload: pupi-ggz

Post on 12-Mar-2016

212 views

Category:

Documents


0 download

Report

DESCRIPTION

,m,m

TRANSCRIPT

  • >lcl|JF444305.1_cds_AEA75562.1_1 [gene=COI] [protein=cytochrome oxidase subunit 1] [partial=5',3'] [protein_id=AEA75562.1] [location=657]ACCCTTTACCTTTTATTTGGTGCATGGGCAGGAATGGTGGGCACCGCCCTTAGCCTATTAATCCGCGCTGAGCTAGGTCAGCCTGGCGCCCTACTAGGAGATGATCAGATTTATAACGTCATCGTAACCGCCCACGCATTTGTAATAATCTTCTTTATGGTGATACCAATTATGATCGGGGGGTTTGGGAACTGACTAGTGCCCCTAATAATTGGTGCGCCTGATATGGCATTTCCACGGATGAATAACATGAGCTTTTGACTTCTACCTCCCTCCTTCCTTCTACTTCTGGCCTCTTCTATGGTTGAAGCGGGTGCAGGGACAGGATGGACCGTGTATCCTCCTCTGGCAGGAAATCTAGCACATGCAGGGGCATCAGTAGATTTGACAATTTTTTCTCTACACTTAGCGGGTGTTTCATCCATCCTGGGAGCCATTAACTTCATTACTACCATCATTAATATGAAACCCCCTGCCATATCGCAATACCAGACCCCCTTATTCGTATGATCTGTCCTAATCACAGCCGTACTTCTACTTCTATCTCTACCAGTCTTAGCAGCCGGCATTACCATACTACTTACAGACCGAAATCTTAATACCACCTTTTTTGACCCGGCCGGAGGAGGAGATCCTGTCCTATACCAACACCTGTTC


BOOK1 SBS 1 Scope Sequence

Narrative learning sequence English Early Stage 1€¦  · Web view2021. 7. 1. · Narrative learning sequence. English – Early Stage 1. Resource considerations. This lesson sequence

Sequence powerpoint 1

Character learning sequence English ES1 · Web viewEnglish Early Stage 1 learning sequence – focus on character Learning sequence description

An Introduction to Phylogenetics > Sequence 1 GAGGTAGTAATTAGATCCGAAA… > Sequence 2 GAGGTAGTAATTAGATCTGAAA… > Sequence 3 GAGGTAGTAATTAGATCTGTCA… Anton E

Tittle sequence order 1

Gee.pdf sequence=1 - UNEMI

1 RECURRENCE 1. Sequence 2. Recursively defined sequence 3. Finding an explicit formula for recurrence relation

DNAMAN Sequence Analysis Software Sequence Search and ... · Dotplot Analysis 1. Name of Sequence 1 2. Name of Sequence 2 3. Annotations of Sequence 1 4. Annotations of Sequence 2

Self-sustained sequence replication (3SR): an isothermal ...repository.cshl.edu › 25251 › 1 › Self-sustained-sequence-replication-(… · Self-sustained Sequence Replication

Narrative learning sequence English Early Stage 1 · Web viewNarrative learning sequence English – Early Stage 1 Resource considerations This lesson sequence allows for continuity

Sequence 1 full

Slide 1 cover slide - Broward County, Florida€¦ · Slide 18 –sequence 1 alternate. Slide 19 –sequence 2a. Slide 20 –sequence 2b. Slide 21 –sequence 3. Slide 22 –sequence

Sequence Chapter 1

Sequence 1

Title Sequence Evaluation question 1

Sequence Stratigraphy: Methodology and …quaternary.stratigraphy.org/stratigraphicguide/sequence...Part one – Concepts Introduction 1. Definition of sequence stratigraphy Sequence

Narrative learning sequence Englisg Early Stage 1€¦  · Web view2020-04-09 · Narrative learning sequence. English – Early Stage 1. Resource considerations. This lesson sequence

Scope & Sequence - Kids - Year 1

Opening Sequence Analysis Question 1

Sequence Alignment Techniques. In this presentation…… Part 1 – Searching for Sequence Similarity Part 2 – Multiple Sequence Alignment

1 Multiple sequence alignment Lesson 3. 2 1. What is a multiple sequence alignment?

Sequence analysis course Lecture 8 Sequence databank searching 1

Title sequence 1 final

Opening sequence draft 1

04. Sequence and Series-1

UNIT 1 SEQUENCE AND SERIES Sequence and Seriesignou.ac.in/upload/UNIT 1 SEQUENCE FINAL-BSC-012-BL2.pdf5 UNIT 1 SEQUENCE AND SERIES Sequence and Series Structure 1.0 Introduction 1.1

Mathematics Stage 1 learning sequence b€¦ · Web viewMathematics Stage 1 learning sequence b Learning sequence description This sequence of lessons provides opportunities to deepen

Chapter 4. Sequence Comparison - SJTUcgm.sjtu.edu.cn/.../omics/week-3-sequence_comparison.pdf · 2019. 3. 12. · Sequence Comparison 1. Contents 1. Sequence comparison 2. Sequence

Storyboard title sequence (1)

1 Use Case and Sequence Diagram Tutorialpeople.auc.ca/xu/Cosc4506/Use_Case_Sequence_Diagram_Tutorial.pdf · Use Case and Sequence Diagram Tutorial 1 Use Case and Sequence Diagram

Scope and Sequence - Essential Skills and Sequence... · Scope and Sequence - Complete Math K-1 1 Essential Skills Software 1.800.753.3727 Scope and Sequence Complete Math K-1 Marks

First Sequence Draft - #NSA (1)

LEVEL 1 SCOPE & SEQUENCE

Rudiment Sequence 1