section j analysis of cloned dna molecular biology course

Section JAnalysis of cloned DNA

Molecular Biology Course

J1 Characterization of clones

J2 Nucleic acid sequencingJ3 Polymerase chain reaction

J4 Organization of cloned genes

J5 Mutagenesis of cloned genes

J6 Application of cloning

Molecular Biology Course

1.Restriction mapping

2.Sequencing (DNA & RNA)

3.Northern and Southern blotting

4.PCR

Major Techniques used

These Techniques may be used for other purpose as well

Analysis of cloned DNA- overview

J1 Characterization of clonesJ1-1 Characterization

J1-2 Restriction mapping

J2-3 Partial digestion

J2-4 Labeling nucleic acid

J2-5 Southern and Northern blotting

Analysis of cloned DNA

J1-1 CharacterizationDetermining various properties of a recombinant DNA molecule, such as size, restriction map, nucleotide sequence, whether containing a gene (transcribed sequence), the position and polarity of any gene. Preparation of pure DNA is the first

step of any characterization


Size of DNA fragment cloned

Restriction digestion & agarose gel electrophoresis using molecular weight marker

insert 0.8 kb

0.5 kb

1.0 kb

1.6 kb2.0 kb3.0 kb4.0 kb3.5 kb


J1-2 Restriction Mapping

Cleavage pattern of the insert DNA by restriction enzymes. Useful in determining the order of multiple fragments (genes).

1. Combinational enzyme digestion

2. Partial digestion


1. Combinational enzyme digestion

Nonessential regionLong (left)

armshort (right)

arm phage

Sal I: 19 kb, 15 kb, 9 kb

HindIII: 21 kb, 11 kb, 7 kb, 4 kb

SalI + HindIII: 19 kb, 7 kb, 6 kb, 5 kb, 4 kb, 2 kb

S – H – H – S – H – S 19 kb + 2 kb

2 kb + 7 kb + 6 kb + 5 kb + 4 kb 19 kb 9 kb15 kb


Nonessential regionLong (left)

armshort (right)

arm

S S19 kb 9 kb15 kb

21 kbH

4 kb11 kb7 kbH H

Delineate the restriction sites on the DNA


2. Partial digestion10 kb insert

Completedigestion

Partialdigestion

1 kb

2 kb

3 kb

4 kb6 kb7 kb10 kb

X X

EtBr Stained agarose gel:

Can not delineate the EcoRI sites


10 kb insert****End-labeled radioactive DNA

partial digestion

Agarose electrophoresis

autoradiography

3 kb

4 kb6 kb10 kb

3 kb4 kb

6 kb

Delineate the restriction sites by partial digested end-labeled radioactive DNA

E E E

J1-4 Labeling of DNA or RNA probes

End labeling: put the labels at the endsUniform labeling: put the labels internally

radioactive labeling: display and/or magnify the signals by radioactivity

Non-radioactive labeling: display and/or magnify the signals by antigen labeling – antibody binding – enzyme binding - substrate application (signal release


End labeling

Single stranded DNA/RNA

5’-end labeling: dephosphorylation polynucleotide kinase (PNK)

3’-end labeling: terminal transferase


End labelingDouble stranded DNA/RNA

Fill in the recessive 3’-ends by DNA polymerase

Labeled at both ends

---------------------G---------------------CTTAAp5’

For restriction mapping, cut the DNA with another enzyme

5’pAATTC G


Uniformly labeling of DNA/RNANick translation:

DNase I to introduce random nicks DNA polI to remove dNMPs from 3’ to 5’ and add new dNMP including labeled nucleotide at the 3’ ends.

Hexanucleotide primered labeling: Denature DNA add random hexanucl

eotide primers and DNA pol synthesis of new strand incorporating labeled nucleotide .


Strand-specific DNA probes: e.g.M13 DNA as templatethe missing strand can be re-

synthesized by incorporating radioactive nulceotides

Strand-specific RNA probes: labeled by transcription


J1-5 Southern and Northern blotting

DNA on blot RNA on blot

1.Genomic DNA preparation RNA preparation2.Restriction digestion -3.Denature with alkali - 4. Agarose gel electrophoresis 5. DNA blotting/transfer and fixation RNA6. Probe labeling 6. Hybridization (temperature) 7. Signal detection (X-ray film or antibody)


Southern analysis


Steps of Southern blot


bI1 bI2 bI3 bI4 bI5

Northern analysis COB RNAs in S. cerevisiae

mRNA

Pre-mRNAs

Blot type

Target

Probe Applications

Southern DNA DNA or RNA

mapping genomic clones

estimating gene numbers

Northern RNA DNA or RNA

RNA sizes, abundance,and expression

Western Protein Antibodies protein size, abundance


J2 Nucleic acid sequencing

J2-1 DNA sequencingJ2-2 RNA sequencingJ2-3 Sequence databasesJ2-4 Analysis of sequencesJ2-5 Genome sequencing

projects

Analysis and uses of cloned DNA

J2-1 DNA sequencingTwo main methods:Maxam and Gilbert chemical method the end-labeled DNA is subjected to base-s

pecific cleavage reactions prior to gel separation.

Sanger`s enzymic method () the latter uses dideoxynucleotides as chain te

rminators to produce a ladder of molecules generated by polymerase extension of primer.

J2 nucleic acid sequencing

Maxam and Gilbert

Sanger’s enzymic methodJ2 nucleic acid sequencing

G ATCTC G

ATCTC GGCH3

TCTCG A

TCTCG A

DNA labeled at one end with 32P

DNA labeled at one end with 32P

Base modificationBase modification

Release or displace-ment of reacted basesRelease or displace-

ment of reacted bases

Strand scissionStrand scission

Maxam and Gilbert chemical method


32pGpCpTpGpCpTpApGpGpTpGpCpCpGpApGpC

32p32pGpCpTp

32pGpCpTpGpCpTpAp

32pGpCpTpGpCpTpApGp

32pGpCpTpGpCpTpApGpGpTp

32pGpCpTpGpCpTpApGpGpTpGpCpCp

32pGpCpTpGpCpTpApGpGpTpGpCpCpGpAp

32pGpCpTpGpCpTpApGpGpTpGpCpCpGpApGpC

Chain cleavage at guanines

Chain cleavage at guanines

Maxam-Gilbert sequencing.

We methylate guanines with

a mild DMS treatment that methylates on average one

guanine per DNA strand.Then

use piperidine to remove the

methylated base and break the DNA strand at the apurinic

site.


Sanger sequencing This figure shows t

he structure of a dideoxynucleotide (notice the H atom attached to the 3' carbon). Also depicted in this figure are the ingredients for a Sanger reaction. Notice the different lengths of labeled strands produced in this r

eaction.


This figure is a representation of an acrylamide sequencing gel. Notice that the sequence of the strand of DNA complementary to the sequenced strand is 5' to 3' ACGCCCGAGTAGCCCAGATT while the sequence of the sequenced strand, 5' to 3', is AATCTGGGCTACTCGGGCGT.


Automatic sequencer

1. Fluorescence Labeled ddNTP

2. Polymerase catalyzed


RNA sequencingIt is sometimes necessary to sequence R

NA directly, especially to determine the position of modified nucleotides present in, eg, tRNA and rRNA.

This is achieved by base-specific cleavage of 5’-end-labeled RNA using RNases (ribonuclease) that cleave 3’ to a particular nucleotide. Partial digestion is required to generate a ladder of cleavage products which are analyzed by PAGE.


RNase T1: cleaves after GRNase U2: after ARNase Phy M: after A and UBacillus cereus RNase: after U and C


0 2 10 20 50 G

43

64

25

43

95

121/122

157

222

308

P 2

P 2.1

J3/4P4

P5

P 6

111

P3’P7

P8

P 9

T1 cleaved

J2-3 Sequence databases

• Two largest DNA databases of are EMBL in Europe and Genbank in the USA.

• Newly determined DNA,RNA and protein sequence are entered into databases.The collections of all known sequences are available for analysis by computer.


Sequence database J2 nucleic acid sequencing genebank

Sequence database

EMBLEMBL


J2-4 Analysis of sequences

• Using computers and software packages, such as GCG sequence analysis package offered by Univ. of Wisconsin

1. Identify important sequence features such as restriction sites,open reading frames,start and stop codons, as well as potential promoter sites, intron-exon junctions,etc.


100 200 300 400 500 600 700ORF #1

ORF #2

Sequence analysis of a cloned DNA sequence revealed some important features


2. compare new sequence with all other known sequences in the databases, which can determine whether related sequences have been obtained before.


J2-5 Genome sequencing projects

• With the development of automated DNA sequencers and robotic workstations to prepare samples for sequencing,the entire genome sequence of several organisms have been determined.Many phages and virusesSeveral Bacteria (E. coli, 4 x 106)Plant (Arabidopsis 6.4 x 107 , rice)Human 3 x 109


J3 Polymerase chain reaction

J3-1 PCRJ3-2 The PCR cycle J3-3 TemplateJ3-4 PrimersJ3-5 EnzymesJ3-6 PCR optimization


J3-1 PCR

The polymerase chain reaction(PCR) is to used to amplify a sequence of DNA using a pair of primers each complementary to one end of the the DNA target sequence.


J3-2 The PCR cycle

• Denaturation: The target DNA (template) is separated into two stands by heating to 95℃

• Primer annealing: The temperature is reduced to around 55℃ to allow the primers to anneal.

• Polymerization (elongation, extension): The temperature is increased to 72℃ for optimal polymerization step which uses up dNTPs and required Mg++.


Template

Primers

Enzymes

Fig. Steps of PCR


J3-3 Template

•Any source of DNA that provides one or more target molecules can in principle be used as a template for PCR

•Whatever the source of template DNA, PCR can only be applied if some sequence information is known so that primers can be designed.


J3-4 Primers

• PCR primers need to be about 18 to 30 nt long and have similar G+C contents so that they anneal to their complementary sequences at similar temperatures.They are designed to anneal on opposite strands of the target sequence.

• Tm=2(a+t)+4(g+c): determine annealing temperature. If the primer is 18-30 nt, annealing temperature can be Tm5oC


Degenerate primers: an oligo pool derived from protein sequence.E.g. His-Phe-Pro-Phe-Met-Lys can generate a primer 5’-CAY TTY CCN TTY ATG AARY= PyrimidineN= any baseR= purine


J3-5&6 Enzymes and PCR Optimization

• The most common is Taq polymerase.It has no 3’ to 5’ proofreading exonuclease activity. Accuracy is low, not good for cloning.

• We can change the annealing temperature and the Mg++ concentration or carry out nested PCR to optimize PCR.


PCR optimization

I.Reverse transcriptase-PCR

II.Nested PCR


Fig Nested PCRFig Nested PCR

First roundprimers

First roundPCR

Second roundprimers

Second roundPCR

Gene of interest


Reverse transcriptase-PCR

AAA(A)n

5‘-Cap5‘-CapmRNA

(dT)12~18 primer anneal

5‘-Cap5‘-Cap

AAA(A)n

3‘ 5‘

Reverse transcriptase

dNTP

5‘-Cap5‘-Cap

AAA(A)n

5‘

cDNA:mRNA hybridRegular

PCR

Fig RT-PCR


J4 Organiztaion of cloned genesJ4-1 OrganizationJ4-2Mapping cDNA on Genomic DNA (whe

re)J4-3 S1 nuclease mapping (5’ and 3’ en

d)J4-4 Primer extension (5’ end)J4-5 Gel retardation (binding protein)J4-6 DNase I footprinting (protein binding

sites) J4-7 Reporter genes (promoter study)


cDNA clones have defined organization.

A run of A residues defines the clone’s 3’-end.

There will be a stop codon at its upstream. If the clone is complete, there also will be a start condon. These two codon indicates an ORF.

J4-1 OrganiztionJ4 Organization of cloned genes

• The presence and polarity of any gene in a genomic clone is not obvious (5’ and 3’ end)

• It can be determined by mapping and probing experiments

• To determine:• which genomic sequences are present in

the mature mRNA transcript• The absent sequences are usually

introns and sequences upstream of the transcription start site and down stream of the 3’-processing site.

•Start and stop sites for transcription•regulatory sequences.


J4-2 Mapping cDNA on genomic DNA• The genomic clone is digested on a gel and then

subjected to Southern blot using all or part of the cDNA as a probe.

• Using full length cDNA as probe can show which genomic restriction fragments contain sequences also present in the cDNA

• Using a probe from one end of a cDNA can show the polarity of the gene in the genomic clone.

• Some of the restriction sites will be common in both clones but may be different distances apart. These can often help to determine the organization of the genomic clone.


J4-3 S1 nuclease mapping determines the precise 5’- and 3’- ends of RNA

transcripts. Sequence ladder is required to determine the precise position

S1 nuclease is an enzyme which specifically hydrolyses single-stranded RNA or DNA.

RNA 5’DNA 3’ *5’

3’

RNA 5’DNA 3’ 5’

3’

PAGE Analysis

Add S1 nuclease


J4-4 Primer extension• Determine the 5’ ends of RNA molecules using

reverse transcriptase to extend an antisense DNA primer in the 5’ to 3’ direction. Sequence ladder is required to determine the precise position


J4-5 Gel retardation

• Mixing a protein extract with a labeled DNA fragment and running the mixture on a native gel will show the presence of DNA-protein complex as retarded bands on the gel.

Labeled free DNA/RNA

Protein bound with DNA/RNA


DNA bound totwo proteins

DNA-proteincomplex

Bare DNA

Fig Gel retardation A short labeled nucleic acid is mixed with a cell or nuclear extract expected to contain

the binding protein. Then, samples of labeled nucleic acid, with and without

extract, are run on a gel. The DNA-protein complexes are shown by the presence of

slowly migrating bands.


J4-6 Dnase I footprinting

Identify the actual region of sequence with which the protein interacts.

AATAAG5’ *

Sequence ladder is required to determine the precise position


Bind protein

DNase(mild),then removeprotein and denature DNA

Fig DNase footprinting The protein protects

DNA from attack by DNase. We treat the DNA

-protein complex with DNase I under mild conditions, so that an average of only one cut occur per DNA molecule.

Electrophoresis,autoradiograph


0 1 5ProteinConc:

The three lanes represent DNA that was bound to 0,

1, and 5 units of protein.

The lane with no protein shows a regular ladder of fragments. The lane with

one unit shows some protection, and the lane

with 5 units shows complete

protection in the middle. We usually include

sequencing reactions performed on the same

DNA in parallel lanes, which

tells exactly where the protein bound.

TCGGAGCAACGCAAACAAACGTGCTTGG


J4-7 Reporter genes

To study the function of a control element of a gene (promoter and regulatory elements), reporter genes such as b-galactosidase to “report” the promoter action.



J5-1 Deletion mutagenesisJ5-2 Site-directed mutagenesis J5-3 PCR mutagenesis


J5-1 Deletion mutagenesis

In the cDNA clones,it is common to delete progressively from the ends of the coding region to discover with parts of the whole protein have properties.

In genomic clones,when the transcription part has been identified,upstream are removed progressively to discover the minimum length of upstream sequence that has promoter and regulatory function .


Exonuclease III

S1 or mung bean nuclease

Ligation


J5-2 Site-directed mutagenesis

Formerly,single-stranded templates prepared using M13 were used,but now PCR techniques are now preferred.


J5-3 PCR mutagenesis

Deletion or point mutation


SP6 primer

T7 primer

Forward mutagenic primer

Reverse mutagenic primer

First PCR

Remove primersDenature and anneal

PCR mutagenesis

Two separate PCR reactions are

performed, one amplifying the

5’-portion of the insert using SP6 and the reverse primer, and the other amplifying

the 3’-portion of the insert

using the forward and T7 primers.


Extend and dosecond PCR

SP6 primer

T7 primer

PCR mutagenesis

Two separate PCR reactions are

performed, one amplifying the

5’-portion of the insert using SP6 and the reverse primer, and the other amplifying

the 3’-portion of the insert

using the forward and T7 primers.

Subclone


PCR

elongation

PCR

P(deltaP

5abc) construction

E1-P5P5’-E2

exon intron P5abc


J6 Applications of cloning

J6-1 ApplicationsJ6-2 Recombinant proteinJ6-3Genetically modified

organismsJ6-4 DNA fingerprintingJ6-5 Medical diagnosisJ6-5 Gene therapy

Analysis of cloned DNA

J6-1 Applications


DNAfingerprinting

DNAfingerprinting

GeneticallyModified

Organisms

GeneticallyModified

Organisms

Recombinantprotein

Recombinantprotein

Genetherapy

Genetherapy

MedicaldiagnosisMedical

diagnosis

CLONING

J6-2 Recombinant protein

·Prior to the advent of gene cloning, production of protein was to purify them from tissues. Drawbacks: small amounts, viral contamination etc. ·Gene cloning has circumvented the listed problems.


Prokaryotic expression system can be used to produce eukaryotic proteins, but there are some

problems:• Only cDNA clones can be used as they contain no introns

• Insoluble, precipitated

• Lack of eukaryotic post- translational modifications


Fusion protein

These problems can be solved by using the eukaryotic expression systems, such as the yeast, Baculovirus

and humn cell lines.

These problems can be solved by using the eukaryotic expression systems, such as the yeast, Baculovirus

and humn cell lines.


J6-3 Genetically modified organisms

• Genetically modified organisms(GMOs) are created when cloned genes are introduced into germ cells.

• In eukaryotes, if the introduced genes are derived from another organism, the resulting transgenic plants or animals can be propagated by normal breeding.

e.g. A tomato has a gene for a ripening enzyme inactivated



J6-4 DNA fingerprinting

How is DNA fingerprinting done?

I. Performing Southern blotII. Making a radioactive probeIII.Creating a hybridization reactionIV. VNTRs

J6 Applications of cloning A given person's VNTRs come fro

m the genetic information donated by his or her parents; he or she could have VNTRs inherited from his or her mother or father, or a combination, but never a VNTR either of his or her parents do not have. Shown in the left are the VNTR patterns for Mrs. Nguyen [blue], Mr. Nguyen [yellow], and their four children: D1 (the Nguyens' biological daughter), D2 (Mr. Nguyen's step-daughter, child of Mrs. Nguyen and her former husband [red]), S1 (the Nguyens' biological son), and S2 (the Nguyens' adopted son, not biologically related [his parents are light and

dark green]).

The application of DNA fingerprinting:

I. Paternity and maternity

II.Criminal identification and forensics

III.Personal identification


J6-5 Medical diagnosis

A great variety of medical conditions arise from mutation. e.g. muscular dystophy, many cancers. By using sequence information to design PCR primers and probes, many tests have been developed to screen patients for these clinically important mutations.



Classical methods for scanning mutations:Classical methods for scanning mutations:

Complete gene sequencing

Single-strand conformation analysis

Heteroduplex analysis

Chemical cleavage of mismatch and enzymatic cleavage of mismatch

Protein-truncation test

J6-6 Gene therapy Attempts have

been made to treat some genetic disorders by delivering a normal copy of the defective gene to patients. This is known as gene therapy.


Fundamentals of Gene

Therapy

Cell replacement

Retroviralvector


Thanks

section j analysis of cloned dna molecular biology course

Documents

labeling of dna

insert dna

dna polymerase

radioactive dna e e

partial digestion j2

sequencing dna rna

restriction sites

size of dna fragment