Upload File

scrip ttttt

1
Past Script Tease Events: Union Hall June 2009-November 2010 Works by: Joshua Gelb, Holly Hepp-Galvan, Theresa Giacopasi, C.S. Hanson, Jeannine Jones, Daniel John Kelley, Courtney Brooke Lauria, Crystal Skillman, Erin Murtaugh Strouse, David L. Williams, and Ethan Youngerman Curated and Directed by Barrie Gelles Featuring members: Brandon Jones, Jesse Manocherian, Mimian Morales, Alyson Leigh Rosenfeld, Jason Siegel, Kristin Warheit-Bresler, Brett Warwick October, 2010 Under the Bed by Theresa Giacopasi Stalk Me, Baby by C.S. Hanson Wearing the Pants by Daniel John Kelley Ten Year Twilight by Crystal Skillman Regulations by David L. Williams Yoga Time! by Ethan Youngerman Featuring: Samantha Cooper, Joey Davis, Clayton Reed Ellis, Holly Hepp-Galvan, Brandon Jones, Mimian Morales, Erika Smith, Shayla Spradley, Kristin Warheit, Brett Warwick December, 2009 Dec. 26 by Mark Saunders Feeding the Reindeer by Trevor Suthers A Super Shiny Precious Thing by Joshua Conkel. Featuring: Andrea Dionne, Ellen Haynes, Kate Juliano, Mimian Morales, Alyson Leigh Rosenfeld, Andy Stokhan, Kristin Wahrheit, Brett Warwick, and Benjamin Weaver November, 2009 For Our Mothers & Fathers by Crystal Skillman Strike for $200 by Courtney Brooke Lauria Criminal Behavior by Jeannine Jones The Disappearing Woman by Holly Hepp-Galvan Dadʼs Visit by Erin Murtaugh Strouse. Featuring: Andrea Dionne, Ellen Haynes, Kate Juliano, Nancy Kelly, Jesse Manocherian, Mimian Morales, Alyson Leigh Rosenfeld, Kristin Warheit, and Brett Warwick October, 2009 Be My Ghoul by Marc Saunders Horror Play by Jeanine Jones The Corpse Servant or Fun With Dead Bodies by Holly Hepp-Galvan Very Very Vader by Bruce Shearer Featuring: Stuart Bridgett, Joey Davis, Ellen Hayes, Kate Juliano, Jesse Manocherian, Mimian Morales, Kristin Warheit, Benjamin Weaver July, 2009 Wealth of the Universe by Daniel John Kelley Water Music by Joshua Gelb Upcoming Script Tease Events: scriptteaserevealsitself Where: 61 Local When: March 11th, 7pm Boldly Go by Matt Barbot Wildfire by Libby Emmons Tigers in America by Theresa Giacopasi Government Cheese by Amina Henry All in Her Head by Holly Hepp-Galvan The Ninth Life of Suzanne McKinley Teeth by Max Reuben Featuring: Stuart Bridgett, Samantha Cooper, Holly Hepp-Galvan, Brandon Jones, Jesse Manocherian, Mimian Morales, Max Reuben, Kristin Warheit, Brett Warwick Scriptteasepremiers scriptteasegetsspooky sciptteaseexploresfamilyangst

Upload: shoegal321

Post on 30-Sep-2015

12 views

Category:

Documents


0 download

Report

DESCRIPTION

script brass

TRANSCRIPT

  • Past Script Tease Events:

    Script TeaseUnion HallJune 2009-November 2010Works by: Joshua Gelb, Holly Hepp-Galvan, Theresa Giacopasi, C.S. Hanson, Jeannine Jones, Daniel John Kelley, Courtney Brooke Lauria, Crystal Skillman, Erin Murtaugh Strouse, David L. Williams, and Ethan YoungermanCurated and Directed by Barrie GellesFeaturing members: Brandon Jones, Jesse Manocherian, Mimian Morales, Alyson Leigh Rosenfeld, Jason Siegel, Kristin Warheit-Bresler, Brett Warwick

    script tease returnsOctober, 2010Under the Bed by Theresa GiacopasiStalk Me, Baby by C.S. HansonWearing the Pants by Daniel John KelleyTen Year Twilight by Crystal SkillmanRegulations by David L. Williams Yoga Time! by Ethan YoungermanFeaturing: Samantha Cooper, Joey Davis, Clayton Reed Ellis, Holly Hepp-Galvan, Brandon Jones, Mimian Morales, Erika Smith, Shayla Spradley, Kristin Warheit, Brett Warwick

    script tease gets festiveDecember, 2009Dec. 26 by Mark SaundersFeeding the Reindeer by Trevor SuthersA Super Shiny Precious Thing by Joshua Conkel.Featuring: Andrea Dionne, Ellen Haynes, Kate Juliano, Mimian Morales, Alyson Leigh Rosenfeld, Andy Stokhan, Kristin Wahrheit, Brett Warwick, and Benjamin Weaver

    scipt tease explores family angstNovember, 2009For Our Mothers & Fathers by Crystal SkillmanStrike for $200 by Courtney Brooke LauriaCriminal Behavior by Jeannine JonesThe Disappearing Woman by Holly Hepp-Galvan Dads Visit by Erin Murtaugh Strouse.Featuring: Andrea Dionne, Ellen Haynes, Kate Juliano, Nancy Kelly, Jesse Manocherian, Mimian Morales, Alyson Leigh Rosenfeld, Kristin Warheit, and Brett Warwick

    script tease gets spookyOctober, 2009Be My Ghoul by Marc SaundersHorror Play by Jeanine JonesThe Corpse Servant or Fun With Dead Bodies by Holly Hepp-GalvanVery Very Vader by Bruce ShearerFeaturing: Stuart Bridgett, Joey Davis, Ellen Hayes, Kate Juliano, Jesse Manocherian, Mimian Morales, Kristin Warheit, Benjamin Weaver

    Script tease premiersJuly, 2009Wealth of the Universe by Daniel John KelleyWater Music by Joshua Gelb

    Past Script Tease Events:

    Script TeaseUnion HallJune 2009-November 2010Works by: Joshua Gelb, Holly Hepp-Galvan, Theresa Giacopasi, C.S. Hanson, Jeannine Jones, Daniel John Kelley, Courtney Brooke Lauria, Crystal Skillman, Erin Murtaugh Strouse, David L. Williams, and Ethan YoungermanCurated and Directed by Barrie GellesFeaturing members: Brandon Jones, Jesse Manocherian, Mimian Morales, Alyson Leigh Rosenfeld, Jason Siegel, Kristin Warheit-Bresler, Brett Warwick

    script tease returnsOctober, 2010Under the Bed by Theresa GiacopasiStalk Me, Baby by C.S. HansonWearing the Pants by Daniel John KelleyTen Year Twilight by Crystal SkillmanRegulations by David L. Williams Yoga Time! by Ethan YoungermanFeaturing: Samantha Cooper, Joey Davis, Clayton Reed Ellis, Holly Hepp-Galvan, Brandon Jones, Mimian Morales, Erika Smith, Shayla Spradley, Kristin Warheit, Brett Warwick

    script tease gets festiveDecember, 2009Dec. 26 by Mark SaundersFeeding the Reindeer by Trevor SuthersA Super Shiny Precious Thing by Joshua Conkel.Featuring: Andrea Dionne, Ellen Haynes, Kate Juliano, Mimian Morales, Alyson Leigh Rosenfeld, Andy Stokhan, Kristin Wahrheit, Brett Warwick, and Benjamin Weaver

    scipt tease explores family angstNovember, 2009For Our Mothers & Fathers by Crystal SkillmanStrike for $200 by Courtney Brooke LauriaCriminal Behavior by Jeannine JonesThe Disappearing Woman by Holly Hepp-Galvan Dads Visit by Erin Murtaugh Strouse.Featuring: Andrea Dionne, Ellen Haynes, Kate Juliano, Nancy Kelly, Jesse Manocherian, Mimian Morales, Alyson Leigh Rosenfeld, Kristin Warheit, and Brett Warwick

    script tease gets spookyOctober, 2009Be My Ghoul by Marc SaundersHorror Play by Jeanine JonesThe Corpse Servant or Fun With Dead Bodies by Holly Hepp-GalvanVery Very Vader by Bruce ShearerFeaturing: Stuart Bridgett, Joey Davis, Ellen Hayes, Kate Juliano, Jesse Manocherian, Mimian Morales, Kristin Warheit, Benjamin Weaver

    Script tease premiersJuly, 2009Wealth of the Universe by Daniel John KelleyWater Music by Joshua Gelb

    Past Script Tease Events:

    Script TeaseUnion HallJune 2009-November 2010Works by: Joshua Gelb, Holly Hepp-Galvan, Theresa Giacopasi, C.S. Hanson, Jeannine Jones, Daniel John Kelley, Courtney Brooke Lauria, Crystal Skillman, Erin Murtaugh Strouse, David L. Williams, and Ethan YoungermanCurated and Directed by Barrie GellesFeaturing members: Brandon Jones, Jesse Manocherian, Mimian Morales, Alyson Leigh Rosenfeld, Jason Siegel, Kristin Warheit-Bresler, Brett Warwick

    script tease returnsOctober, 2010Under the Bed by Theresa GiacopasiStalk Me, Baby by C.S. HansonWearing the Pants by Daniel John KelleyTen Year Twilight by Crystal SkillmanRegulations by David L. Williams Yoga Time! by Ethan YoungermanFeaturing: Samantha Cooper, Joey Davis, Clayton Reed Ellis, Holly Hepp-Galvan, Brandon Jones, Mimian Morales, Erika Smith, Shayla Spradley, Kristin Warheit, Brett Warwick

    script tease gets festiveDecember, 2009Dec. 26 by Mark SaundersFeeding the Reindeer by Trevor SuthersA Super Shiny Precious Thing by Joshua Conkel.Featuring: Andrea Dionne, Ellen Haynes, Kate Juliano, Mimian Morales, Alyson Leigh Rosenfeld, Andy Stokhan, Kristin Wahrheit, Brett Warwick, and Benjamin Weaver

    scipt tease explores family angstNovember, 2009For Our Mothers & Fathers by Crystal SkillmanStrike for $200 by Courtney Brooke LauriaCriminal Behavior by Jeannine JonesThe Disappearing Woman by Holly Hepp-Galvan Dads Visit by Erin Murtaugh Strouse.Featuring: Andrea Dionne, Ellen Haynes, Kate Juliano, Nancy Kelly, Jesse Manocherian, Mimian Morales, Alyson Leigh Rosenfeld, Kristin Warheit, and Brett Warwick

    script tease gets spookyOctober, 2009Be My Ghoul by Marc SaundersHorror Play by Jeanine JonesThe Corpse Servant or Fun With Dead Bodies by Holly Hepp-GalvanVery Very Vader by Bruce ShearerFeaturing: Stuart Bridgett, Joey Davis, Ellen Hayes, Kate Juliano, Jesse Manocherian, Mimian Morales, Kristin Warheit, Benjamin Weaver

    Script tease premiersJuly, 2009Wealth of the Universe by Daniel John KelleyWater Music by Joshua Gelb

    Past Script Tease Events:

    Union HallJune 2009-November 2010Works by: Joshua Gelb, Holly Hepp-Galvan, Theresa Giacopasi, C.S. Hanson, Jeannine Jones, Daniel John Kelley, Courtney Brooke Lauria, Crystal Skillman, Erin Murtaugh Strouse, David L. Williams, and Ethan YoungermanCurated and Directed by Barrie GellesFeaturing members: Brandon Jones, Jesse Manocherian, Mimian Morales, Alyson Leigh Rosenfeld, Jason Siegel, Kristin Warheit-Bresler, Brett Warwick

    October, 2010Under the Bed by Theresa GiacopasiStalk Me, Baby by C.S. HansonWearing the Pants by Daniel John KelleyTen Year Twilight by Crystal SkillmanRegulations by David L. Williams Yoga Time! by Ethan YoungermanFeaturing: Samantha Cooper, Joey Davis, Clayton Reed Ellis, Holly Hepp-Galvan, Brandon Jones, Mimian Morales, Erika Smith, Shayla Spradley, Kristin Warheit, Brett Warwick

    December, 2009Dec. 26 by Mark SaundersFeeding the Reindeer by Trevor SuthersA Super Shiny Precious Thing by Joshua Conkel.Featuring: Andrea Dionne, Ellen Haynes, Kate Juliano, Mimian Morales, Alyson Leigh Rosenfeld, Andy Stokhan, Kristin Wahrheit, Brett Warwick, and Benjamin Weaver

    November, 2009For Our Mothers & Fathers by Crystal SkillmanStrike for $200 by Courtney Brooke LauriaCriminal Behavior by Jeannine JonesThe Disappearing Woman by Holly Hepp-Galvan Dads Visit by Erin Murtaugh Strouse.Featuring: Andrea Dionne, Ellen Haynes, Kate Juliano, Nancy Kelly, Jesse Manocherian, Mimian Morales, Alyson Leigh Rosenfeld, Kristin Warheit, and Brett Warwick

    October, 2009Be My Ghoul by Marc SaundersHorror Play by Jeanine JonesThe Corpse Servant or Fun With Dead Bodies by Holly Hepp-GalvanVery Very Vader by Bruce ShearerFeaturing: Stuart Bridgett, Joey Davis, Ellen Hayes, Kate Juliano, Jesse Manocherian, Mimian Morales, Kristin Warheit, Benjamin Weaver

    July, 2009Wealth of the Universe by Daniel John KelleyWater Music by Joshua Gelb

    Upcoming Script Tease Events:

    script tease reveals itselfWhere: 61 LocalWhen: March 11th, 7pm

    Boldly Go by Matt BarbotWildfire by Libby EmmonsTigers in America by Theresa GiacopasiGovernment Cheese by Amina HenryAll in Her Head by Holly Hepp-GalvanThe Ninth Life of Suzanne McKinleyTeeth by Max Reuben

    Featuring: Stuart Bridgett, Samantha Cooper, Holly Hepp-Galvan, Brandon Jones, Jesse Manocherian, Mimian Morales, Max Reuben, Kristin Warheit, Brett Warwick

    Past Script Tease Events:

    Script TeaseUnion HallJune 2009-November 2010Works by: Joshua Gelb, Holly Hepp-Galvan, Theresa Giacopasi, C.S. Hanson, Jeannine Jones, Daniel John Kelley, Courtney Brooke Lauria, Crystal Skillman, Erin Murtaugh Strouse, David L. Williams, and Ethan YoungermanCurated and Directed by Barrie GellesFeaturing members: Brandon Jones, Jesse Manocherian, Mimian Morales, Alyson Leigh Rosenfeld, Jason Siegel, Kristin Warheit-Bresler, Brett Warwick

    script tease returnsOctober, 2010Under the Bed by Theresa GiacopasiStalk Me, Baby by C.S. HansonWearing the Pants by Daniel John KelleyTen Year Twilight by Crystal SkillmanRegulations by David L. Williams Yoga Time! by Ethan YoungermanFeaturing: Samantha Cooper, Joey Davis, Clayton Reed Ellis, Holly Hepp-Galvan, Brandon Jones, Mimian Morales, Erika Smith, Shayla Spradley, Kristin Warheit, Brett Warwick

    script tease gets festiveDecember, 2009Dec. 26 by Mark SaundersFeeding the Reindeer by Trevor SuthersA Super Shiny Precious Thing by Joshua Conkel.Featuring: Andrea Dionne, Ellen Haynes, Kate Juliano, Mimian Morales, Alyson Leigh Rosenfeld, Andy Stokhan, Kristin Wahrheit, Brett Warwick, and Benjamin Weaver

    scipt tease explores family angstNovember, 2009For Our Mothers & Fathers by Crystal SkillmanStrike for $200 by Courtney Brooke LauriaCriminal Behavior by Jeannine JonesThe Disappearing Woman by Holly Hepp-Galvan Dads Visit by Erin Murtaugh Strouse.Featuring: Andrea Dionne, Ellen Haynes, Kate Juliano, Nancy Kelly, Jesse Manocherian, Mimian Morales, Alyson Leigh Rosenfeld, Kristin Warheit, and Brett Warwick

    script tease gets spookyOctober, 2009Be My Ghoul by Marc SaundersHorror Play by Jeanine JonesThe Corpse Servant or Fun With Dead Bodies by Holly Hepp-GalvanVery Very Vader by Bruce ShearerFeaturing: Stuart Bridgett, Joey Davis, Ellen Hayes, Kate Juliano, Jesse Manocherian, Mimian Morales, Kristin Warheit, Benjamin Weaver

    Script tease premiersJuly, 2009Wealth of the Universe by Daniel John KelleyWater Music by Joshua Gelb

    Past Script Tease Events:

    Script TeaseUnion HallJune 2009-November 2010Works by: Joshua Gelb, Holly Hepp-Galvan, Theresa Giacopasi, C.S. Hanson, Jeannine Jones, Daniel John Kelley, Courtney Brooke Lauria, Crystal Skillman, Erin Murtaugh Strouse, David L. Williams, and Ethan YoungermanCurated and Directed by Barrie GellesFeaturing members: Brandon Jones, Jesse Manocherian, Mimian Morales, Alyson Leigh Rosenfeld, Jason Siegel, Kristin Warheit-Bresler, Brett Warwick

    script tease returnsOctober, 2010Under the Bed by Theresa GiacopasiStalk Me, Baby by C.S. HansonWearing the Pants by Daniel John KelleyTen Year Twilight by Crystal SkillmanRegulations by David L. Williams Yoga Time! by Ethan YoungermanFeaturing: Samantha Cooper, Joey Davis, Clayton Reed Ellis, Holly Hepp-Galvan, Brandon Jones, Mimian Morales, Erika Smith, Shayla Spradley, Kristin Warheit, Brett Warwick

    script tease gets festiveDecember, 2009Dec. 26 by Mark SaundersFeeding the Reindeer by Trevor SuthersA Super Shiny Precious Thing by Joshua Conkel.Featuring: Andrea Dionne, Ellen Haynes, Kate Juliano, Mimian Morales, Alyson Leigh Rosenfeld, Andy Stokhan, Kristin Wahrheit, Brett Warwick, and Benjamin Weaver

    scipt tease explores family angstNovember, 2009For Our Mothers & Fathers by Crystal SkillmanStrike for $200 by Courtney Brooke LauriaCriminal Behavior by Jeannine JonesThe Disappearing Woman by Holly Hepp-Galvan Dads Visit by Erin Murtaugh Strouse.Featuring: Andrea Dionne, Ellen Haynes, Kate Juliano, Nancy Kelly, Jesse Manocherian, Mimian Morales, Alyson Leigh Rosenfeld, Kristin Warheit, and Brett Warwick

    script tease gets spookyOctober, 2009Be My Ghoul by Marc SaundersHorror Play by Jeanine JonesThe Corpse Servant or Fun With Dead Bodies by Holly Hepp-GalvanVery Very Vader by Bruce ShearerFeaturing: Stuart Bridgett, Joey Davis, Ellen Hayes, Kate Juliano, Jesse Manocherian, Mimian Morales, Kristin Warheit, Benjamin Weaver

    Script tease premiersJuly, 2009Wealth of the Universe by Daniel John KelleyWater Music by Joshua Gelb

    Past Script Tease Events:

    Script TeaseUnion HallJune 2009-November 2010Works by: Joshua Gelb, Holly Hepp-Galvan, Theresa Giacopasi, C.S. Hanson, Jeannine Jones, Daniel John Kelley, Courtney Brooke Lauria, Crystal Skillman, Erin Murtaugh Strouse, David L. Williams, and Ethan YoungermanCurated and Directed by Barrie GellesFeaturing members: Brandon Jones, Jesse Manocherian, Mimian Morales, Alyson Leigh Rosenfeld, Jason Siegel, Kristin Warheit-Bresler, Brett Warwick

    script tease returnsOctober, 2010Under the Bed by Theresa GiacopasiStalk Me, Baby by C.S. HansonWearing the Pants by Daniel John KelleyTen Year Twilight by Crystal SkillmanRegulations by David L. Williams Yoga Time! by Ethan YoungermanFeaturing: Samantha Cooper, Joey Davis, Clayton Reed Ellis, Holly Hepp-Galvan, Brandon Jones, Mimian Morales, Erika Smith, Shayla Spradley, Kristin Warheit, Brett Warwick

    script tease gets festiveDecember, 2009Dec. 26 by Mark SaundersFeeding the Reindeer by Trevor SuthersA Super Shiny Precious Thing by Joshua Conkel.Featuring: Andrea Dionne, Ellen Haynes, Kate Juliano, Mimian Morales, Alyson Leigh Rosenfeld, Andy Stokhan, Kristin Wahrheit, Brett Warwick, and Benjamin Weaver

    scipt tease explores family angstNovember, 2009For Our Mothers & Fathers by Crystal SkillmanStrike for $200 by Courtney Brooke LauriaCriminal Behavior by Jeannine JonesThe Disappearing Woman by Holly Hepp-Galvan Dads Visit by Erin Murtaugh Strouse.Featuring: Andrea Dionne, Ellen Haynes, Kate Juliano, Nancy Kelly, Jesse Manocherian, Mimian Morales, Alyson Leigh Rosenfeld, Kristin Warheit, and Brett Warwick

    script tease gets spookyOctober, 2009Be My Ghoul by Marc SaundersHorror Play by Jeanine JonesThe Corpse Servant or Fun With Dead Bodies by Holly Hepp-GalvanVery Very Vader by Bruce ShearerFeaturing: Stuart Bridgett, Joey Davis, Ellen Hayes, Kate Juliano, Jesse Manocherian, Mimian Morales, Kristin Warheit, Benjamin Weaver

    Script tease premiersJuly, 2009Wealth of the Universe by Daniel John KelleyWater Music by Joshua Gelb


Scrip View

Abort Ttttt

ttttt iiiliiiiiiiiilil ooc · ttttt iiiliiiiiiiiilil ooc . ttttt ooc . Created Date: 5/19/2020 1:16:00 PM

LET’S TTTTT SOON TALK - stokstok.com/public/stok Tenant Representation SOQ_2017.pdf · TTTTT. SOON. stoco ellostoco 45 9. stok Net Zero Energy office. 945 Front Street San Francsco

ttttt - VIVA · 2016-02-19 · alore CO, g,pz . Title: ttttt Author: MobileRem Created Date: 7/14/2015 5:03:25 PM

Re: Scrip Code 542602; Scrip Code 959990, 958770, 959074

u Ttttt Ttttt Re Eeeeee

November 18, 2020 To, To, Scrip Code: 505509 Scrip Code

Double strand cDNA AAAAA TTTTT RT AAAAA TTTTT RT AAAAA TTTTT Oligo dT primer is bound to mRNA Reverse transcriptase (RT) copies first cDNA strand Reverse

Scrip Code: 533259 Scrip Code: SASTASUNDR

ttttt t tt ttttttttt. - UoM IR

Supporting*Information*for* … · 2015-08-21 · 4.5* TTTTT AG GATC TACGTGATAAGTTTGACACGGAATCCTCGT GATC TTTTT 4.6* TTTTT AC CTAG AAAGTCCAGCAXTCACAACGGGCYTAGACC GATC TTTTT SupportingTable,1.,*Putative*aptamer*sequences*identified*by*AM*Biotechnologies*XMAptamer*

Scrip Code: ACC Scrip Code: 500410

Scrip BJEP

Brochure CMA CGM LOG ttttt

Company Scrip Code: 533033 Company Scrip Code: ISGEC EQ

9 ouTOF10 ttttt WOMEN ttttt · ttttt ttttt ~ 5.4 MILLION ~~tb~A~[t~ ARE EXPOSED TO MEDICATIONS EACH YEAR Women and healthcare providers DON'T HAVE ENOUGH INFORMATION to make INFORMED

Management Tt Ttttt

Scrip Program

NSE Scrip Code - PRECAM BSE Scrip Code - 539636

Movimiento de Ttttt

ttttt - ProSites, Inc.c2-preview.prosites.com/113897/wy/docs/Patient Forms... · 2016-07-01 · ttttt A 2012 lVisconsirt Denral Association (800) 24J-4675 PATIENT NUMBER Age- Date

Of) 4io , ~ttttt

Analyzing Scrip Systems Files/kris scrip systems_77315561-6c03-49e3...Scrip systems provide a non-monetary trade economy for exchange of resources. We model a scrip system as a stochastic

p Ptt Ttttt Ttttt

Explanatory Material - Reforms to the Scrip for Scrip Roll

NSE Scrip Symbol Scrip Name SERIES

Ingles tecnico ttttt

Gymstars Scrip Program. Substitute Money Scrip means

Scrip Systems

Scrip Fundrasing

Scrip Code: 519602 Scrip Code: KELLTONTEC

SCRIP Ebony

Ppp Ppppt t Ttt Ttttt

Holy Spirit Scrip Program Shop With Scrip.com. Scrip credits are entered weekly into your scrip account. Bookkeeper requests money in family scrip accounts